The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Few clinical factors can help predict spontaneous culture conversion (SCC) in patients with Mycobacterium avium complex-pulmonary disease (MAC-PD). We retrospectively classified 373 MPD patients who had undergone watchful waiting without antibiotics according to the so-called ‘body mass index (BMI), age, cavity, erythrocyte sedimentation rate (ESR), and sex (BACES)’ severity. We evaluated whether lower severity is associated with a higher rate of SCC. Of 373 patients, 153 (41%) achieved SCC without antibiotics during a median follow-up of 48.1 months. There was a trend toward a higher SCC rate in patients with lower BACES severity: 48% (87/183), 37% (58/157), and 24% (8/33) in the mild, moderate, and severe BACES groups, respectively. In addition, a favorable outcome, defined as maintaining SCC or having two consecutive negative sputum cultures until the last follow-up date, was also more common in patients with lower BACES severity with 53% (97/183), 34% (54/157), and 18% (6/33) in the mild, moderate, and severe BACES groups, respectively. In multivariate analysis, moderate (hazard ratio [HR]=0.63; 95% confidence interval [CI] 0.44 – 0.91; p = 0.013) and severe BACES (HR 0.37; 95% CI 0.16 – 0.90; p = 0.028) had a significantly negative impact on favorable outcomes compared to mild BACES. Lower BACES severity may be associated with SCC in MAC-PD patients.

Evaluating soil quality across various altitudinal gradients, both with and without vegetative cover, is crucial for the proper functioning of soil and optimal crop growth, thereby contributing to the sustainability of agroecosystems. Although the altitudinal gradient significantly influences soil quality, the ability to predict this quality, expressed through an index, in soils with and without vegetative cover, is still insufficiently explored. This study aimed to assess soil quality in the Jun Jun micro-watershed, located in the Tungurahua region, Ecuador. To achieve this objective, three categories of altitudinal gradients were selected: less than 2800 meters above sea level (masl), between 2800 and 2900 masl, and greater than 2900 masl. A total of 24 soil samples were collected in the mentioned gradients, considering both areas with and without vegetative cover. The indicators used included chemical and biological parameters such as soil organic carbon (OC), earthworm density (WD), earthworm biomass (WB), organic matter (OM), pH, total nitrogen (TN), and organic carbon (OC). The results revealed that in areas with altitudinal gradients below 2800 masl, soil quality index values were higher compared to other altitudes. In vegetated areas, a decrease in index values was observed as the altitudinal gradient increased, indicating a deterioration in soil quality with altitude. These findings are significant in providing a quantitative assessment of the effects of altitudinal gradient and vegetative cover influence on soil quality.

The purpose of this study is to analyze the causes of cost variation in natural disaster prevention projects (NDPP) in Gyeongsangbuk-do and to develop effective cost and risk management strategies. The study collected data by conducting an online survey of 244 stakeholders. Binary logistic regression was used to analyze the impact of various variables on cost deviation, in-cluding project management risk (PMR), project costing and execution risk (PCER), project exe-cution strategy risk (PESR), construction project risk (CPR), project cost and schedule risk (PCSR), project management challenges (PMC), and construction project subcontractor and safety man-agement (CPSSM). The results showed that PMR (OR=3.744, 95% C.I. [1.657, 8.457]), PCER (OR=5.068, 95% C.I. [2.236, 11.484]), PESR (OR=3.447, 95% C.I. [1. 853, 6.413]), CPR (OR=2.292, 95% C.I. [1.020, 5.151]), PCSR (OR=4.817, 95% C.I. [2.250, 10.317]), PMC (OR=2.954, 95% C.I. [1.452, 6. 013]), and CPSSM (OR=2.419, 95% C.I. [1.297, 4.515]) had statistically significant effects on cost deviation. In particular, PMR, PCER, and PESR were identified as the main causes, and the effects of additional factors such as CPSSM were also important. The developed predictive model plays an important role in helping stakeholders of NDPP to manage risks in advance and take appro-priate preventive measures to ensure the success of the project. This study empirically supports the theoretical hypotheses of previous studies and provides a clear understanding of the causes of cost deviation in NDPP, which provides important insights for strategic decision-making and provides a new perspective on risk management.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

Acoustic emission (AE) is caused by the sudden release of energy by a material as a result of material degradation related to deformation, crack, or fault within a solid. The same situation also occurs in leaks caused by turbulence in the fluid around the leak. In this study, analytical modeling for AE due to leakage through a circular pinhole in a gas storage cylinder was performed. The displacement fields responsible for AE, excited by the concentrated force (CF) associated with the turbulent flow though the pinhole, were derived by solving the Navier-Lamé equation. The CF as an excitation source was formulated in terms of a fluctuating Reynolds stress (FRS) and spatial Green’s function. In particular, a series of experiments were conducted under different operating conditions to explore the characteristics of the AE signals due to leak in a gas cylinder. Finally, the simulation and experimental results were compared to verify the accuracy of the simulation results.

We fabricated the nano-aperture plasmonic platforms for single molecule detection and other various applications such as infrared thermal emission device. The nano-apertures including the nanopores on the pyramid, and the nano-slits on the Au flat membrane were fabricated using a Ga ion focused ion beam drilling technique, followed by high energy electron beam irradiations dependent upon the electron beam current density. The nanopores with a few nanometer size and the nanoslit array with order of ~ 100 nm width were fabricated. Optical characteristics for the various nanoslits were examined dependent upon the slit opening width and sample thickness. The broad emission spectra from the (7x 7) slit array are obtained from spp-mediated emission in the visible and infrared region. A sharp strong infrared emission peak is also obtained due to Au nanoparticle. The fabricated Au platform can be utilized as single molecule sensor and infrared thermal emission device.

The frame construction of an apartment complex that consists of multiple buildings encounters various uncertainties, owing to the complex relationships among units of work. Currently, the period of such a construction is calculated based on the number of floors of the highest building in the complex. This study quantitatively analyzes an apartment frame construction period using a queue model and evaluates the validity of the estimated period. In this regard, a methodology is proposed for analyzing the construction period by applying the concept of a customer and a server. A case study on the duration of an apartment frame construction is conducted with Korea Land and Housing Corporation, which has supplied the largest number of apartments in South Korea. It was found that the stable state of a queue system was observed when the rate of server utilization was applied to the basement and aboveground floors. However, a stable state was not reached on the ground floor. This study includes non-working days in its calculation and quantitatively analyzes uncertainty factors during construction. Therefore, the findings can be practically utilized to quantitatively plan the durations of work units in an apartment frame construction.

Alzheimer’s disease (AD) is a chronic neurodegenerative disease, and typical pathologic findings include abnormally hyperphosphorylated tau aggregation and neurofibrillary tangles. Insulin resistance and hyperglycemia have been assessed as risk factors for AD development. As the maintenance of optimal blood glucose levels is an important indicator of diabetes mellitus (DM) treatment, diet control is essential. AMPK is a crucial sensor of cellular bioenergetics for controlling anabolic and catabolic metabolism. Diet restriction to achieve euglycemia can increase AMPK activity in the liver and heart. Since AMPK is a direct regulator of tau phosphorylation, we hypothesized that strict diet control to achieve euglycemia affects tau protein phosphorylation through increased AMPK activity in the hippocampus of DM rats. To confirm this hypothesis, we generated insulin-deficient DM rats by subtotal pancreatectomy. Animals were categorized into the restriction (R) group, control (C) group and ad libitum (AL) group according to the diet. We found that tau phosphorylation was significantly increased in the R group compared with the C or AL group. AMPK activity in the R group significantly increased compared to that of the C group or AL group, as expected. Furthermore, the R group showed more critical tau pathology in the hippocampus than the other groups. These results suggest that diet control to achieve euglycemia in insulin-deficient DM conditions is harmful because of the increased possibility of AD development through increased tau phosphorylation by AMPK activation in the hippocampus. We propose that not only hyperglycemia but also euglycemia, which is beneficial in DM patients, must be considered a potential risk factor for AD development, especially when euglycemia is achieved by diet control during insulin deficiency.

A nanocomposite rod-shaped structure with single-walled carbon nanotube (SWCNT) embedded in polypyrrole (PPy) doped with nonafluorobutanesulfonic acid (C4F), SWCNT/C4F-PPy, was synthesized using emulsion polymerization. The hybrid ink was then directly coated on a polyimide film interdigitated with the Cu/Ni/Au electrodes via a screen-printing technique to create a flexible film sensor. The sensor film showed a response of 1.72% at 25 °C/atmospheric pressure when acetone gas of 5 ppm was injected, which corresponds to almost 95% compared to the Si wafer-based array interdigitated with the Au electrode. Additionally, C4F was used as a hydrophobic dopant of PPy to improve the stability of humidity and to produce a highly sensitive film-type gas sensor that provides stable detection even in humid conditions.

The aim of the study was to analyze the in ovo injection of chemically and biologically synthesized silver nano-particles (Ag NPs) using Brassica oleracea L. var capitate f. Rubra, (BOL) conjugation with L-Arginine (L-Arg) on the immune, muscle growth, survivability and hatchability of the broiler chickens. L-Arg (100 μg) with 1000 µg (BOL-Ag NPs) and L-Arg (100 μg) with 100 µg (C-Ag NPs) were injected into fertile eggs at 8, 14 and 18 of incubation. Survival and hatched chicks were calculated. Survivability and hatchability were unaffected by the injected dose of L-Arg (100 μg) with 1000 µg (BOL-Ag NPs) and L-Arg (100 μg) with 100 µg (C-Ag NPs) but it significantly improved when the eggs were injected on day 14 of incubation compared with those injected on days 8 or 18. Moreover, the protein expression of muscle development markers such as myogenin and myoD were significantly up-related in 14 d incubation whereas the heat shock proteins (HSPs) such as HSP-60 and HSP-70 were significantly up-regulated in 18 d incubation. In addition, the in ovo injection on 18 d significantly increased the serum glutamate oxaloacetate transaminase (SGOT) and serum glutamate pyruvate transaminase (SGPT) as well the immunoglobulin (IgM) levels were increased in 14-day incubation period in serum at the same concentration. Collectively, these results indicate that injecting L-Arg (100 μg) with 1000 µg of BOL-Ag NPs or L-Arg (100 μg) with 100 µg of C-Ag NPs to eggs at day 14 after incubation could improve their hatchability, survival rate, and muscle growth marker.

The aim of the study was to analyze the in ovo injection of chemically and biologically synthesized silver nano-particles (Ag NPs) using Brassica oleracea L. var capitate f. Rubra, (BOL) conjugation with L-Arginine (L-Arg) on the immune, muscle growth, survivability and hatchability of the broiler chickens. L-Arg (100 μg) conjugated with 1000 µg of Ag NPs synthesized by (BOL)-extract and L-Arg (100 μg) conjugated with 100 µg of Ag NPs chemically synthesized were injected into fertile eggs at 8d, 14d and 18d of incubation. Living embryo and hatched chicks were calculated. Survivability and hatchability were not affected by the injected dose of L-Arg (100 μg) with 1000 µg (BOL-Ag NPs) and L-Arg (100 μg) with 100 µg (C-Ag NPs) but it significantly improved when the eggs were injected on day 14 of incubation compared with those injected on days 8 or 18. Moreover, the protein expression of muscle development markers such as myogenin and myoD were significantly up-related in 14 d of incubation whereas the heat shock proteins (HSPs) such as HSP-60 and HSP-70 were significantly up-regulated in 18 d incubation. In addition, the in ovo injection on 18 d significantly increased the serum glutamate oxaloacetate transaminase (SGOT) and serum glutamate pyruvate transaminase (SGPT) as well the immunoglobulin (IgM) levels were increased in 14d incubation period in serum at the same concentration.

Field cricket (Gryllus bimaculatus) is newly emerged as an edible insect in several countries. Anti-inflammatory effect of glycosaminoglycan derived this cricket was not fully investigated on chronic disease animal model such as diabetic mouse. For potential therapeutic agents, anti-diabetic activities of field cricket glycosaminoglycan (GbG) was evaluated in diabetic mice based on their abilities to reduce glucose, ALT, AST, LDL-cholesterol, and BUN levels, compared with dung beetle (Catharsius molossus) glycosaminoglycan (CaG) as a positive control glycosaminoglycan. Db mice were orally administered for one month according to their groups: Db Hetero (normal), Db Homo (type-2 diabetic), CaG (5 mg/kg), GbG (5 mg/kg), and metformin (10 mg/kg). Blood glucose level was decreased after 1^st week treatment with GbG. It also inhibited LDL-cholesterol and alkaline phosphatase levels. Regarding oxidative damage of diabetic state, levels of hepatocellular biomarkers levels and protein carbonyl content were reduced in db mice treated with GbG. Especially anti-oxidative activities of catalase, superoxide dismutase, and glutathione peroxidase were significantly increased in GbG treated group compared to those in the control. GbG was composed of heparin disaccharides and main N-glycan was identified as Hex₉GlcNAc₂ (m/z 1905.7) of with neutral mono-sugar mainly comprising of hexose, L (+) rhamnose by mass spectroscopy. These results from sero-biochemical, hepatocellular anti-oxidant assay in db mice data suggest cricket (G. bimaculatus) glycosaminoglycan might play a role in its anti-diabetic action.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

The accurate of model attitude angel plays an important role on the aerodynamic test results in the wind tunnel test. The original method applies the spherical coordinate system transformation to obtain attitude angel calculation. The model attitude angel is obtained by coordinate transformation and spherical surface mapping applying the nominal attitude angel (the balance attitude angel in the wind tunnel coordinate system) indicated by the mechanism. First, the coordinate transformation of this method is not only complex but also difficult to establish the transformed relationship between the space coordinate systems especially after many steps of coordinate transformation, moreover it cannot realize the iterative calculation of the interference relationship between attitude angels; Second, during the calculate process to solve the problem the arc is approximately used to replace the straight line, the angel for the tangent value, and the inverse trigonometric function is applied. Therefore, in the calculation of attitude angel, the process is complex and inaccurate, which can be solved approximately when calculating small attack angel. However, with the advancing development of modern aerodynamic unsteady research, the aircraft tends to develop high or super large attack angel and unsteady research field. According to engineering practice and vector theory, the concept of vector angel coordinate system is proposed for the first time, and the vector angel coordinate system of attitude angel is established. With the iterative correction calculation and avoiding the problem of approximate and inverse trigonometric function solution, the model attitude calculation process is carried out in detail, which validates that the calculation accuracy and accuracy of model attitude angels are improved. Based on engineering and theoretical methods, a vector angel coordinate system is established for the first time, which gives the transformation and angel definition relations between different flight attitude coordinate systems, that can accurately calculate the attitude angel of the corresponding coordinate system and determine its direction, especially in the channel coupling calculation, the calculation of the attitude angel between the coordinate systems is only related to the angel, and has nothing to do with the change order s of the coordinate system, which simplifies the calculation process.

Background: Angelica gigas Nakai, Korean dang-gui, has long been widely used in traditional treatment methods. There have been a number of studies of the health effects of A. gigas and related compounds, but studies addressing effects on blood triglycerides (TG) are lacking. To investigate the effects of A. gigas Nakai extract (AGNE) on TG in Korean subjects, we carried out a 12-week, randomized, double-blind, placebo-controlled clinical trial. Methods: Subjects who met the inclusion criterion (130 mg/dL ≤ fasting blood TG ≤ 200 mg/dL) were recruited for this study. One hundred subjects were assigned to the AGNE group (n=50) or the placebo group (n=50), who were given 1g/day of AGNE (as a gigas Nakai extract 200mg/d) in capsules, and the control group for 12 weeks. Outcomes were efficacy TG, lipid profiles, atherogenic index, and safety parameters were assessed initially for a baseline measurement and after 12 weeks. Results: After 12 weeks of supplementation, TG and very low-density lipoprotein cholesterol (VLDL-C) concentration and TG/HDL-C ratio in the AGNE group were significantly reduced compared to the placebo group (p <0.05). No significant changes in any safety parameter were observed. Conclusions: These results suggest that ingestion of AGNE may improve TG and be useful to manage or prevent hypertriglyceridemia.

A short review of the important studies was conducted to evaluate the potential of aerosol transmission of the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). The minimum size of droplets potentially carrying the SARS-CoV-2 was newly estimated and discussed in this review.

Obesity, which is characterized by an excessive accumulation of body fat, is one of the critical factors causing metabolic syndrome. Many studies have been performed to identify appropriate agents to control obesity, but toxicity remains a problem. Herein, we identified that phenylbutyrate (PBA), which has been used to treat urea cycle disorder with very low toxicity for a long time, efficiently inhibited high fat-induced body weight gain in a diet-induced obesity mouse model (DIO model). PBA treatment decreased body fat mass and increased lean composition. Moreover, PBA increased brown adipose tissue (BAT) activity by increasing glucose uptake, thereby improving glucose tolerance and insulin tolerance. Interestingly, PBA could induce the expression of phosphofructokinase (PFKL), a key enzyme in the glycolytic pathway, and knocking down PFKL dramatically repressed the expression level of Ucp1 as well as those of Prdm16, Cidea, Pgc1α, and Pparγ, which are marker genes for BAT activation. These results strongly suggested that PBA could increase energy expenditure by increasing BAT activity via the induction of PFKL. Taken together, PBA could be used as a therapeutic agent for people with obesity to prevent the development of metabolic syndrome.

The objective of this study was to determine the effects of supplementing L-isoleucine (L-Ile) on milk protein synthesis, using an immortalized bovine mammary epithelial (MAC-T) cell line. In this case, the cells were treated with 0, 0.3, 0.6, 0.9, 1.2 and 1.5 mM of supplemental Isoleucine (Ile), and the most efficient time for protein synthesis for each amino acid was determined by measuring the cell, medium and total protein at 0, 24, 48, 72 and 96 h. Confirmatory tests showed that 48h incubation time and 0.6 mM dosage of L-Ile are considered as the optimal time and dosage. The mechanism of milk protein synthesis was elucidated through proteomics analysis to clarify the metabolic pathway. When the L-Ile was supplemented, extracellular protein (medium protein) reached a peak at 48h, whereas in the case of the intracellular cell protein, it was shown to have reached to its peak at 24h in all L-Ile dosage treatments. In total, it is noted that there were 63 upregulated and 52 downregulated proteins. The results of the protein pathway analysis showed that the L-Ile group stimulated insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade, insulin/IGF pathway-protein kinase B signaling cascade, p53 pathway, de novo purine biosynthesis, Wnt signaling pathway, glycolysis, pentose phosphate pathway, and ATP synthesis which are pathways involved and related to protein and energy metabolism. Together, these results demonstrate that L-Ile supplementation was effective in stimulating β-casein synthesis by stimulating genes and pathways which are significantly related to protein and energy metabolism.

Smartphone-based point-of-care testing (POCT) is rapidly emerging as an alternative to traditional screening and laboratory testing, particularly in resource-limited settings. In this proof-of-concept study, we present a smartphone- and cloud-based artificial intelligence quantitative analysis system (SCAISY) for relative quantification of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-specific IgG antibody lateral flow assays that enables rapid and accurate evaluation of test strips. By capturing an image with a smartphone camera, SCAISY quantitatively analyzes antibody levels and provides results to the user. We analyzed changes in antibody levels over time in over 248 individuals, including vaccine type, number of doses, and infection status, with a standard deviation of less than 10%. We also tracked antibody levels in six participants before and after SARS-CoV-2 infection. Finally, we examined the effects of lighting conditions, camera angle, and smartphone type to ensure consistency and reproducibility. This study suggests that SCAISY is a simple and powerful tool for real-time public health surveillance, enabling the acceleration of quantifying SARS-CoV-2-specific antibodies generated by either vaccination or infection and tracking of personal immunity levels.

Natural products are an important source of antibacterial agents. Canthin-6-one alkaloids have displayed potential antibacterial activity based on our previous work. In order to improve the activity, twenty-two new 3-N-benzylated 10-methoxy canthin-6-ones were designed and synthesized through quaternization reaction. The in vitro antibacterial activity against three bacteria was evaluated by double dilution method. Four compounds (6f, 6i, 6p and 6t) displayed 2-fold superiority (minimum inhibitory concentration (MIC) = 3.91 µg/mL) against agricultural pathogenic bacteria R. solanacearum and P. syringae than agrochemical propineb. Moreover, the structure–activity relationships (SARs) were also carefully summarized in order to guide the development of antibacterial canthin-6-one agents.

Although sarcopenia is known to be a risk factor for non-alcoholic fatty liver disease (NAFLD), whether NAFLD is a risk factor for the development of sarcopenia is not clear. We investigated bidirectional relationships between NAFLD and low skeletal muscle mass index (LSMI) using three different datasets. Participants were classified into LSMI and normal groups. LSMI was defined as a body mass index (BMI)-adjusted appendicular skeletal muscle mass &lt;0.789 in men and &lt;0.512 in women or as the sex-specific lowest quintile of BMI-adjusted total skeletal muscle mass. NAFLD was determined according to NAFLD liver fat score or abdominal ultrasonography. The NAFLD groups showed a higher hazard ratios (HRs) with 95% confidence intervals (CIs) for LSMI than the normal groups (HRs=1.213, 95% CIs=1.050–1.402). The LSMI groups also showed a higher HRs with 95% CIs for NAFLD than normal groups (HRs=1.564, 95% CIs=1.378–1.775). Participants with NAFLD had consistently less skeletal muscle mass over 12 years of follow-up. In conclusion, LSMI and NAFLD showed a bidirectional relationship. Maintaining muscle mass should be emphasized in the management of NAFLD.

The economic development and infrastructure of a nation are closely interrelated. In addition, public trust in national infrastructure facilities is closely linked to the preservation of the advantages provided by these facilities to the public. Since the 1970s, Korea has achieved exponential economic growth over a short period of time and the number of infrastructure facilities has increased correspondingly. This compressed economic development has been underpinned by the national infrastructure, whose safety and usability have been excluded from the scope of the development. However, after around 30 years, structural deterioration coupled with general insensitivity to safety in today’s society has considerably reduced public trust in using the infrastructure. Realistically, policies that mainly focus on developing new technologies related to infrastructure construction have led to practical limitations that discourage the development of technologies for maintenance or inspection. Furthermore, current maintenance works face certain limitations caused by various reasons: insufficient budget, increasing number of infrastructure facilities requiring maintenance, shortage of manpower, and rapidly increasing number of aging infrastructure facilities. To overcome these limitations, a new approach is required that is different from general inspection methods under the existing rules and regulations. In this context, this study aimed to explore the efficiency of bridge inspection and maintenance by unmanned aerial vehicles (UAVs) that could observe inaccessible areas, could be conveniently and easily controlled, and could offer high economic benefits. To this end, various tests were performed on elevated bridges, and suitable UAV images were obtained. The obtained UAV images were inspected by using machine vision technology, thereby excluding subjective evaluations by humans. Methods for enhancing the objectivity of the inspection were also discussed. The test results showed that both the efficiency and objectivity of the proposed method were better than those of the existing bridge maintenance and inspection methods.

Prevention and management of cytomegalovirus (CMV) reactivation is important to improve outcome of allogeneic hematopoietic cell transplantation (allo-HCT) recipients. The aim of this study was to analyze real-world data for incidence and characteristics of CMV infections until 1-year after allo-HCT under 100-day letermovir prophylaxis. A single-center retrospective study was conducted between November 2020 and October 2021. During the study period, 358 patients underwent allo-HCT, 306 of whom received letermovir prophylaxis. Cumulative incidence of clinically significant CMV infection (CS-CMVi) was 11.4%, 31.7%, and 36.9% at 14-weeks, 24-weeks, and 1-year post-HCT, respectively. In multivariate analysis, risk of CS-CMVi increased with graft-versus-host disease (GVHD) ≥ grade 2 (adjusted odds ratio 3.640 [2.036–6.510]; P &lt; 0.001). One-year non-relapse mortality was significantly higher in letermovir breakthrough CS-CMVi patients than those with subclinical CMV reactivation who continued letermovir (P = 0.002). There were 18 (15.9%) refractory CMV infection in this study population. In summary, letermovir prophylaxis is effective in preventing CS-CMVi until day 100, which increased after cessation of letermovir. GVHD is still a significant risk factor in letermovir prophylaxis era. Further research is needed to establish individualized management strategies especially in patients with significant GVHD or letermovir breakthrough CS-CMVi.

Preproenkephalin (PPE) is a precursor molecule for multiple endogenous opioid peptides Leu-enkephalin (ENK) and Met-ENK, which are involved in a wide variety of modulatory functions in the nervous system. Despite the functional importance of ENK in the brain, the effect of brain-derived factor(s) on PPE expression is unknown. We report the dual effect of neural epidermal growth factor (EGF)-like-like 2 (NELL2) on PPE gene expression. In cultured NIH3T3 cells, transfection of NELL2 expression vectors induced an inhibition of PPE transcription intracellularly, in parallel with downregulation of protein kinase C signaling pathways and extracellular signal-regulated kinase. Interestingly, these phenomena were reversed when synthetic NELL2 was administered extracellularly. The in vivo disruption of NELL2 synthesis resulted in an increase in PPE mRNA level in the rat brain, suggesting that the inhibitory action of intracellular NELL2 predominates the activation effect of extracellular NELL2 on PPE gene expression in the brain. Biochemical and molecular studies with mutant NELL2 structures further demonstrated the critical role of EGF-like repeat domains in NELL2 for regulation of PPE transcription. These are the first results to reveal the spatio-specific role of NELL2 in the homeostatic regulation of PPE gene expression.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

(1)Background:The purpose of the study was conducted to investigate the recovery of heart rate according to the performance level and rest interval conditions during 65%1RM bench press exercise;(2)Methods:The subjects of this study were eight healthy male college studentsin their 20 (years) attending University C. 1RM was measured before theexperiment, and the exercise sequence of six rest intervals (30sec, 1, 2, 3, 4,5min) was randomly selected and cross-distribution experiment. The experimental measurement was conducted a total of six times according to the rest interval condition (six conditions) once every 3 days to minimize the learning effect. The data was verified with repeated measures Two-way ANOVA and Contrast's repeated method was applied for post-comparison;(3)Results: First, the amount of exercise and the number of repetitions statistically substantially dropped (p&lt;.001) as the number of sets rose, and a greater decline was shown when the rest periods got shorter. Second, the heart rate after exercise was increased significantly (p&lt;.01) as the set progressed in the long rest interval conditions (4, 5min), and the heart rate after rest was increased statistically significantly (p&lt;,05) as the set progressed in the short rest interval conditions (30sec, 1min). Third, the heart rate recovery rate (%) was able to perform more repetitions than in the short rest interval condition due to the relatively high physiological recovery of the neuromuscular and circulatory system under the long rest interval condition;(4)Conclusions: Therefore, according to the rest conditionduring the 65%1RM bench press exercise conducted in this study, the restinterval condition of 2~3min may be effective in improving muscular endurance,and the rest interval condition of 4~5min may be effective in improving muscular hypertrophy. As a result of this study, there was a significant difference in exercise performance (repetition) and physiological recovery depending on the rest interval condition according to the set progress during the same intensity resistance exercise. Through this, it is judged that it is possible to adjust the amount of exercise appropriate for the purpose of training by adjusting not only the intensity during resistance exercise but also the rest interval between sets.

We previously found a novel a new sirtuin (SIRT) inhibitor MHY2256 that exerts anticancer activity through p53 acetylation in MCF-7 human breast cancer cells. Here, we investigated the anticancer activity of MHY2256 against hormone-related cancer, which is an endometrial cancer with poor prognosis. We found that MHY2256 markedly reduced cellular proliferation at low concentrations against Ishikawa endometrial cancer cells. The IC50 values of MHY2256 were much lower than that of salermide. Furthermore, MHY2256 significantly reduced the protein expression and activities of SIRT1, 2, and 3 with similar effects as salermide, a well-known SIRT inhibitor. Particularly, MHY2256 markedly inhibited tumor growth in a tumor xenograft mouse model of Ishikawa cancer cells. During the experimental period, there was no significant change in the body weight of mice treated with MHY2256. Detailed analysis of the sensitization mechanisms of Ishikawa cells revealed that late apoptosis was largely increased by MHY2256. Additionally, MHY2256 increased G1 arrest and reduced cell cyclic-related proteins, suggesting that apoptosis by MHY2256 was achieved by cellular arrest. Particularly, p21 was greatly increased by MHY225656, suggesting that cell cycle arrest by p21 is a major factor in MHY2256 sensitization in Ishikawa cells. We also detected a significant increase in acetylated p53, a target protein of SIRT1, in Ishikawa cells after MHY2256 treatment. In a mouse xenograft model, MHY2256 significantly reduced tumor growth and weight without apparent side effects. These results suggest that MHY2256 exerts its anticancer activity through p53 acetylation in endometrial cancer and can be used for targeting hormone-related cancers.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Autoantibodies against specific lung cancer-associated antigens have been suggested for lung cancer diagnosis. This study aimed to evaluate the diagnostic performance of anti-gen-autoantibody immune complex (AIC) against its free antigens for CYFRA21-1, ProGRP, NGAL, and NSE in non-small cell lung cancer (NSCLC). In total, 85 patients with NSCLC and 120 healthy controls (HCs) were examined using a 9G DNA chip method. The ratios of AICs to their antigens and combinations of ratios consisting of two to four markers were calculated. The levels of AICs for CYFRA21-1, ProGRP, NGAL, and NSE were higher than their free antigens in all participants. The levels of each free antigen distinguished patients with NSCLC from HCs. The ratios of AIC to its antigen and seven combinations consisting of two to four ratios were significantly higher in patients with NSCLC than those in HCs. Excellent diagnostic performance was observed for all combination ratios (C4-1), with 85.9% sensitivity and 86.7% specificity at cutoff 3.51. Higher sensitivity was observed in the very early stages (0–I) and adenocarcinoma than in stages II–IV and other pathological types. The combination of all ratios of AICs and their antigens for all four markers is useful in the diagnosis of NSCLC.

In Korea, rice is a major staple grain and is mainly cultivated using various agricultural machinery. Air pollutants emitted from agricultural machinery have their origins mainly from the exhaustion of internal combustion engines. In this study, emission characteristics of five main air pollutants by European Environment Agency's Tier 1 method for rice cultivation was analyzed. Diesel is a main fuel for agricultural machinery and gasoline is generally used only for rice transplanters as a fuel in Korea. Tractors consume 46% of total fuel consumption and 56% of diesel fuel consumption. Gasoline used for rice transplanters accounts for 17% of total fuel consumption each year. Tractors and rice transplanters are emitting 82% of all total pollutants. From 2011 to 2019, the total amount of air pollutant emissions was decrease by 15%. That accounted for the reduction of rice cultivation fields in those periods. Rice transplanting operation was in charge of 42% of total emissions. Then, harrowing, harvesting, tilling, leveling, and pest control operations generated 10%, 10%, 8%, 8% and 7% of total emissions, respectively. The contribution of each air pollutant held 54% of CO, 39% of NOx, 5% of NMVOC, and 2% of TSP from the total emission inventory. The three major regions emitting air pollutants from mechanized agricultural practices were Jeollanam-do, Chungcheongnam-do, and Jeollabuk-do, which consume 55% of total fuel usage in rice farming. The total amount of air pollutant emissions from rice cultivation practices in 2019 was calculated as 8,448 Mg in Korea.

In this study, the effect of heat treatment was investigated to influence the occurrence of fracture during manufacturing process of Alloy B steel with boron contents as high as 130 ppm. As the content of boron increases, it affects the phase transformation temperature and texture. The development of {111}<uvw> components in the γ-fiber is affected depending on the austenite fraction after phase transformation. The Alloy B steel indicated that the increase in the boron content increased the α to γ phase transformation temperature such that sufficient transformation did not occur in the normalizing condition. The cracks occurred at the point of the transition from elastic to plastic deformation in the ND direction during the rolling process, thereby resulting in failure. Therefore, it is necessary to avoid the intermediate heat treatment condition in which γ-fiber does not fully develop, i.e., an imperfect normalization.

Transient receptor potential melastatin-8 (TRPM8) is a cation channel that is activated by cold and “cooling agents” such as menthol and icilin, which induce a cold sensation. Stimulation of TRPM8 activates an intracellular signaling cascade that ultimately leads to a change in the gene expression pattern of the cells. Here, we investigated the TRPM8-induced signaling pathway that links TRPM8 channel activation to gene transcription. Using a pharmacological approach, we show that inhibition of phosphatidylinositol 4-phosphate 5 kinase alpha (PIP5K), an enzyme essential for the biosynthesis of phosphatidylinositol 4,5-bisphosphate, attenuated TRPM8-induced gene transcription. Analyzing the link between TRPM8 and Gq proteins, we show that pharmacological inhibition of the beta gamma subunits impairs TRPM8 signaling. In addition, genetic studies showed that TRPM8 requires an activated Galpha subunit for signaling. In the nucleus, the TRPM8-induced signaling cascade triggers an activation of the transcription factor AP-1, a complex consisting of a dimer of basic region leucine zipper (bZIP) transcription factors. Here, we identified the bZIP protein c-Jun as an essential component of AP-1 within the TRPM8-induced signling cscade. In summary, with PIP5K, Gq subunits and c-Jun we have identified key molecules in the TRPM8-induced signaling from the plasma membrane to the nucleus.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

Using morphological characteristics and SSR markers, we evaluated the morphological and genetic variation of 200 Perilla accessions collected from the five regions of South Korea and other region. In morphological characteristics analysis, particularly, leaf color, stem color, degree of pubescence, leaf size were found to be useful for distinguishing the characteristics of native Perilla accessions cultivated in South Korea. A total of 137 alleles were identified in the 20 simple sequence repeat (SSR) markers, and the number of alleles per locus ranged from 3 to 13, and the average number of alleles per locus was 6.85. The average gene diversity (GD) was 0.649, with a range of 0.290-0.828. From analysis of SSR markers, accessions from the Jeolla-do and Gyeongsang-do regions showed comparatively high genetic diversity values compared with those from other regions in South Korea. In the unweighted pair group method with arithmetic mean (UPGMA) analysis, the 200 Perilla accessions were found to cluster into three major groups and an outgroup with a genetic similarity of 42%, and did not showed a clear geographic structure from the five regions of South Korea. Therefore, it is believed that landrace Perilla seeds are frequently exchanged by farmers through various routes between the five regions of South Korea. The results of this study are expected to provide useful information for conservation of these genetic resources and selection of useful resources for the development of varieties for seeds and leafy vegetables of cultivated var. frutescens of Perilla crop in South Korea.

This study investigates the specific factors affecting the usage intention of distributed ledger technology (DLT), such as availability, diversity and economic value from the perspective of a unified theory of technology acceptance. Users of DLT in public and private sectors were surveyed. Availability and economic value affect performance expectancy, while availability, diversity, and profitability have an influence on effort expectancy. Performance expectancy and transparency have a positive effect on the intention to use DLT which in turn exerts a positive effect on usage behavior. This study provides implications for researchers in that it attempts to investigate the factors affecting the usage intention of DLT based on the extended unified theory of acceptance and encompassing diverse industries that adopt DLT, such as the public, financial, medial, and logistics sectors.

Serum carbohydrate antigen 19-9 (CA19-9) levels can increase in nontuberculous mycobacteria pulmonary disease (NTM-PD) and the levels correlate with disease activity. We compared the clinical characteristics of NTM-PD patients with and without elevated CA19-9 levels and evaluated its association with the antibiotic response in a retrospective study of NTM-PD patients diagnosed between January 1994 and December 2020. We analyzed 1,112 patients who had serum CA19-9 measured: 322 with elevated CA19-9 and 790 with normal CA19-9. The erythrocyte sedimentation rate and C-reactive protein levels were significantly higher in the elevated CA19-9 group (p < 0.001 and p = 0.029, respectively). The 1-year culture conversion rate after antibiotics did not differ between the elevated (n = 206) and normal (n = 377) CA19-9 groups (80% vs. 72%, p = 0.055). Analysis of a subset of 434 patients revealed that current smoking, bronchiectasis, acid-fast bacilli smear positivity, and the M. abscessus strain significantly reduced microbiological cure rates. Serum CA 19-9 levels did not have a significant association with microbiological cure in a multivariate analysis. These findings suggest that the role of serum CA19-9 in predicting antibiotic treatment outcomes is limited, and that elevated CA19-9 does not necessarily indicate a poor outcome.

Metabolic-associated fatty liver disease (MAFLD) and diabetic kidney disease (DKD) share various pathophysiological factors, and epidemiological evidence suggests that these two diseases are associated. Albuminuria and the estimated glomerular filtration rate, which are conventional biomarkers of DKD, are reportedly associated with the risk or severity of MAFLD. Recently, novel DKD biomarkers reflecting renal tubular injury have been introduced to complement conventional DKD markers. In this article, we looked at previous studies that showed an association between MAFLD and DKD and also reviewed the significance of DKD biomarkers as predictive risk factors for MAFLD.

Abstract: Imaging devices of less than 300,000 pixels are mostly used for sewage conduit exploration due to the petty nature of the survey industry in Korea. P articular ly , devices of less than 100,000 pixels are still widely used, and the environment for image processing is very bitter . Since the sewage conduit image s covered in this study ha ve a very low resolution (240 × 320 = 76,800 pixels), it is very difficult to detect cracks. Because most of the resolution of the sewe r conduit images are very low in Korea, this problem of low resolution was selected as the subject of study. Cracks were detected through a total of six steps of improving the crack in Step 2, finding the optimal threshold value in Step 3, and applying an algorithm to detect cracks in Step 5. Cracks were effectively detected by the optimal parameters in Steps 2 and 3 and the user algorithm in Step 5. Desp ite the very low resolution, the cracked image s showed 96.4% accuracy of detection, and the non cracked image s showed 94.5% accuracy . Moreover, the analysis was excellent in quality , also . It is believed that the findings of this study can be effectively u sed for crack detection with low resolution images.

We assessed the growth performance, physiological traits, and gene expressions in steers fed with dietary rumen-protected L-tryptophan (RPT) under cold environment. Eight Korean native steers were assigned to two dietary groups, no RPT (Control) and RPT (0.1% RPT supplementation on a dry matter basis), 6 wks. Maximum and minimum temperatures throughout the experiment were 6.7°C and -7.0°C, respectively. Supplementation of 0.1% RPT to a total mixed ration did not increase body weight but had positive effects of elevating average daily gain (ADG) and reducing the feed conversion ratio (FCR) at day 27 and 48. Metabolic parameter showed higher glucose level (at day 27) in the 0.1% RPT group compared to the control group. Real-time PCR analysis showed no significant differences in the expression of muscle (MYF6, MyoD, and Desmin) metabolism genes between the two groups, whereas the expression of fat (PPARγ, C/EBPα, and FABP4) metabolism genes was lower in the 0.1% RPT group than in the control group. Thus, we demonstrate that long-term (6 wks) dietary supplementation of 0.1% RPT was beneficial owing to enhanced growth performance by increasing ADG and glucose level, decreasing FCR, and maintaining homeostasis in immune responses in beef steers during cold environment.

Capsizing accidents are regarded as marine accidents with a high rate of casualties per accident. Approximately 89% of all such accidents occur in small ships (vessels with gross tonnage less than 10 tons). Stability calculations are critical for assessing the risk of capsizing incidents and evaluating a ship's seaworthiness. Despite the high frequency of capsizing accidents involving small ships, they are generally exempt from adhering to stability regulations, thus remaining systemically exposed to the risk of capsizing. Moreover, the absence of essential design documents complicates direct ship stability calculations. This study utilizes hull form feature data—obtained from the general arrangement of small ships—as input for a deep learning model. The model is structured as a multilayer neural network and aims to infer hydrostatic curves, which is required data for stability calculations.

This study explores the significance of active suspension systems for vehicles with lower chassis compared to conventional ones, aiming at the development of future automobiles. Conventional linear MR (Magneto-Rheological) dampers were found inadequate in ensuring sufficient vibration control because the vehicle's chassis becomes lowered in the unmanned vehicles or purposed based vehicles. As an alternative, a rotary type of MR damper is proposed in this work. The proposed damper is designed based on pre-specified design parameters through mathematical modeling and magnetic field analyses. Subsequently, a prototype of the rotary MR damper identical to the design is fabricated, and effectiveness is shown through experimental investigations. In configuring the experiments, a proportional-integral (PI) controller is employed for current control to reduce the response time of the damper. The results presented in this work provides useful guidelines to develop a new type of MR damper applicable to various types of future vehicles’ suspension systems with low distance from the tire to the body floor.

This study surveyed the variation in Perfluorinated Compounds (PFCs) concentration entering urban wastewater treatment plants and proposed an optimal PFCS treatment method. The PFCS concentration in influent was shown to be affected by the types of industries and operating rate. The concentration of PFCs in the wastewater treatment effluent was slightly lower than that of influent. Thus, PFCs were considered to have barely been removed by the existing biological treatments. The pilot test result showed that about 10% of PFCs were removed by coagulation and precipitation, and the ozone and chlorine test also showed that few PFCs were removed regardless of the amount of injection. The activated carbon adsorption test showed that the removal was significantly increased by the empty bed contact time, with about a 60% removal in five minutes and over a 90% removal in 15 minutes. Therefore it is determined that a more stable and higher PFCs removal would result from the continuous oxidation processes such as ozone and adsorption processes such as activated carbon rather than a single biological treatment.

Poly(acrylic acid) (PAAc) hydrogels possess good bioadhesive properties and allow enhanced penetration of drugs. In addition, it is possible to localize the absorption site of the drug in the hydrogel and increase the drug residence time. As opposed to other cross-linking processes radiation-induced polymer cross-linking can be easily and rapidly carried out without the use of cross-linking agents and other chemical additives. In this study, we fabricated metronidazole (MD) containing PAAc hydrogel (MD/PAAc) with different MD contents (0.1, 0.25, 0.5 wt%) using varying radiation doses (25, 50, 75 kGy) by gamma-irradiation. The physical and thermal properties were determined by gel content analysis, swelling ratio measurements, compressive strength measurements, differential scanning calorimetery, and thermogravimetric analysis. The properties of the hydrogel degraded due to the crystalline nature of MD. The properties of the hydrogel degraded due to the crystalline nature of MD. Cumulative release observed after 50 min in the case of 0.5MD/PAAc and 0.1MD/PAAc was 50% and 10%, respectively. Our findings suggest that MD/PAAc could be a suitable drug delivery carrier for use with radiation-based techniques.

In the context of high-temperature water vapor treatment, Zn-Mg-Al alloy-coated steel sheets exhibit the emergence of a black surface. This study aims to explore the factors and mechanisms contributing to surface blackening by inducing black surfaces on Zn-Mg-Al alloy-coated steel sheets, which were fabricated through molten coating subjected to water vapor treatment at 150 degrees Celsius. The surfaced composition was predominantly identified as ZnO, a zinc oxide film, validated through X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Morphological analysis of the surface and cross-section post-water vapor treatment revealed a disrupted lamellar structure with diffused features, resulting in the formation of an oxide film. Optical properties analysis demonstrated an increased absorbance and a decreased bandgap energy after water vapor treatment, indicative of an augmented blackening effect. Consequently, the high-temperature water vapor treatment led to the formation of oxides on the surface, with the highly reactive Mg and Al extracting oxygen from the predominantly present ZnO surface. This process resulted in the creation of an oxygen-deficient oxide, ultimately causing surface blackening.

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI–TOF MS) is a commonly used technique for analyzing large biomolecules. However, the utilization of organic matrices limits the small-molecule analysis because of the interferences in the low-mass region and reproducibility issues. To overcome these limitations, a surface-assisted laser desorption/ionization (SALDI), which utilizes nanostructured metallic surfaces, has been developed. Herein, a novel approach for SALDI–MS was proposed using nanoengineered gold shell with nanogaps on the silica core (SiO2@Au NGS), which is an emerging material due to its excellent heat-generating capabilities. The gold shell thickness was controlled by adjusting the concentration of gold precursor for the growth of gold nanoparticles. SALDI-MS measurements were performed on a layer formed by drop-casting a mixture of SiO2@Au NGS and analytes. At the optimized process, the gold shell thickness was observed to be 17.2 nm, which showed the highest absorbance. The ion desorption efficiency was confirmed with a survival yield upon fragmentation. Based on the enhanced SALDI capability, SiO2@Au NGS was utilized to detect various small molecules including amino acids, sugars, and flavonoids. The limits of detection, reproducibility, and salt tolerance of SiO2@Au NGS demonstrate its potential as an effective and reliable SALDI material for small-molecule analyses.

In patients with unilateral tinnitus with normal hearing, several studies have compared the ipsilateral and contralateral ears; however, few studies have investigated its relationship with the duration of tinnitus. We compared the auditory brainstem response and otoacoustic emission parameters between ipsilateral and contralateral ears in adults with unilateral tinnitus and normal hearing. This retrospective review included 84 patients with unilateral tinnitus and normal hearing who underwent auditory brainstem response and otoacoustic emission; they were categorized according to the duration of tinnitus. The latencies and amplitudes of waves I, III, and V, and V/I ratio of both ears in auditory brainstem response, and the results of distortion-product otoacoustic emission and transient evoked otoacoustic emission were examined. The auditory brainstem response parameters, distortion-product otoacoustic emission parameters, and transient evoked otoacoustic emission parameters between the ipsilateral and contralateral ears along the duration of tinnitus were analyzed. Moreover, the failure rates of both distortion-product otoacoustic emission and transient evoked otoacoustic emission between the ears along with the duration and the effects of the variables on the amplitude and latency of each wave were examined. Although there was little significant difference between the ipsilateral and contralateral ears, laterality seemed to have an effect on wave I latency in the multiple linear regression analysis. The distortion-product otoacoustic emission failure rate of the ipsilateral ear was higher than that of the contralateral ear in all patients. However, there was no remarkable difference between the ears in the distortion-product otoacoustic emission and transient evoked otoacoustic emission parameters throughout the duration. We found that outer hair cells and the distal portion of the cochlear nerve are possible pathologic lesions in tinnitus with normal hearing and cochlear synaptopathy could be suspected. Further studies, including those on inner hair cells and higher central cortex, are needed.

Mutations in the SACS gene are associated with autosomal recessive spastic ataxia of Charlevoix-Saguenay disease (ARSACS) or complex clinical phenotypes of Charcot-Marie-Tooth disease (CMT). This study aimed to identify SACS mutations in a Korean CMT cohort with cerebellar ataxia and spasticity. As a result, eight pathogenic SACS mutations in four families were identified as the underlying causes of these complex phenotypes. The prevalence of CMT families with SACS mutations was determined to be 0.3%. All the patients showed sensory, motor, and gait disturbances with increased deep tendon reflexes. Lower limb magnetic resonance imaging (MRI) was done in four patients, and all had fatty replacements. Of note, they all had similar fatty infiltrations between the proximal and distal lower limb muscles, different from the neuromuscular imaging feature in most CMT patients without SACS mutations who had distal dominant fatty involvement. Therefore, these findings were considered a characteristic feature in CMT patients with SACS mutations. Although further studies with more cases are needed, our results highlight lower extremity MRI findings in CMT patients with SACS mutations and broaden the clinical spectrum. We suggest screening for SACS in recessive CMT patients with complex phenotypes of ataxia and spasticity.

Individual investors often struggle to predict stock prices due to the limitations imposed by the computational capacities of personal laptop Graphics Processing Units (GPUs) when running intensive deep learning models. This study proposes solving these GPU constraints by integrating deep learning models with technical analysis methods. This integration significantly reduces analysis time and equips individual investors with the ability to identify stocks that may yield potential gains or losses in an efficient manner. Thus, a comprehensive buy and sell algorithm, compatible with average laptop GPU performance, is introduced in the study. This algorithm offers a lightweight analysis method that emphasizes factors identified by technical analysis methods, thereby providing a more accessible and efficient approach for individual investors. To evaluate the efficacy of this approach, we analyzed the performance of eight deep learning models: LSTM (4 layers), CNN, BiLSTM (4 layers), CNN Attention, BiGRU CNN BiLSTM Attention, BiLSTM Attention CNN, CNN BiLSTM Attention, and CNN Attention BiLSTM. These models were used to predict stock prices for Samsung Electronics and Celltrion Healthcare. The CNN Attention BiLSTM model displayed superior performance among these models, with the lowest validation mean absolute error value. In addition, an experiment was conducted using WandB Sweep to determine the optimal hyperparameters for four individual hybrid models. These optimal parameters were then implemented in each model to validate their back-testing rate of return. The CNN Attention BiLSTM hybrid model emerged as the highest-performing model, achieving an approximate rate of return of 5 percent. Overall, this study offers valuable insights into the performance of various deep learning and hybrid models in predicting stock prices. These findings can assist individual investors in selecting appropriate models that align with their investment strategies, thereby increasing their likelihood of success in the stock market.

Ongoing climate change causes abnormal climate events worldwide such as increasing temperatures and changing rainfall patterns. With South Korea facing growing damage from the increased frequency of localized heavy rains, the country is not an exception. In particular, its steep slope lands, including mountainous areas, are vulnerable to damage from landslides and debris flows. In addition, localized short-term heavy rains that occur in urban areas with extremely high intensity tend to lead a sharp increase in damage from soil-related disasters and cause huge losses of life and property. Currently, South Korea predicts landslides and debris flows using the standards for forecasting landslides and heavy rains. However, as the forecasting is conducted separately for rainfall intensity and accumulated rainfall, this lacks a technique that reflects both amount and intensity of rainfall in an episode of localized heavy rainfall. This study, therefore, aims to develop such a technique by collecting past cases of debris flow occurrences and rainfall events that accompanied debris flows to calculate the rainfall triggering index (RTI) reflecting accumulated rainfall and rainfall intensity. In addition, the RTI is converted into the critical accumulated rainfall (Rc) to use precipitation information and provide real-time forecasting. The study classifies the standards for flow debris forecasting into three levels: ALERT (10%–50%), WARNING (50%–70%), and EMERGENCY (70% or higher), to provide a nomogram for 6 hr, 12 hr, and 24 hr. As a result of applying this classification into the actual cases of Seoul, Chuncheon, and Cheongju, it is found that about 2–4 hr of response time is secured from the point of the Emergency level to the occurrence of debris flows.

We evaluated hexadecyltrimethylammonium bromide (HTAB) for use in radio frequency (RF) applications in which liquid crystals (LCs) are used in layered structures that have various cell gap conditions. HTAB is a surfactant that can self-align vertically on the surface of indium tin oxide (ITO) substrates, and can induce homeotropic alignment of the LCs. For implementing RF devices with HTAB and LCs, we should consider limitations caused by the design conditions which are different from conventional liquid crystal displays such as cell gap. We quantified the concentration of HTAB ([HTAB]) that is necessary to form and maintain a sufficiently dense vertical alignment of 5CB (4-Cyano-4'-pentylbiphenyl). The required [HTAB] for full-homeotropic alignment was proportional to the cell gap until it was too large to support the transfer of the surface alignment to the LC, due to the weak anchoring nature of HTAB. We also showed the phase-change characteristic of the LC mixture depended on [HTAB] for the design of RF devices driven by light or heat. This work may help to guide the development of new approaches to designing efficient RF devices that use LCs.

Placenta-derived mesenchymal stem cells (PD-MSCs) have been highlighted as therapeutic sources in several degenerative diseases. Recently, microRNAs (miRNAs) were mediated one of the therapeutic mechanisms of PD-MSCs in regenerative medicine. To enhance the therapeutic effects of PD-MSCs, we established functionally enhanced PD-MSCs with phosphatase of regenerating liver-1 overexpression (PRL-1(+)). However, the profile and functions of miRNAs induced by PRL-1(+) PD-MSCs in a rat model with hepatic failure prepared by bile duct ligation (BDL) remained unclear. Hence, the objectives of the present study were to analyze the expression of miRNAs and investigate their therapeutic mechanisms for hepatic regeneration via PRL-1(+) in a rat model with BDL. We selected candidate miRNAs based on microarray analysis. Under hypoxic conditions, compared with invaded naïve PD-MSCs, invaded PRL-1(+) PD-MSCs showed improved integrin-dependent migration ability through RHO family-targeted miRNA expression (e.g., hsa-miR-30a-5p, 340-5p, and 146a-3p). Moreover, rno-miR-30a-5p and 340-5p regulated engraftment into injured rat liver by transplanted PRL-1(+) PD-MSCs through the integrin family. Additionally, an increase in PDGFRA by suppressing rno-miR-27a-3p improved vascular structure in rat liver tissues after PRL-1(+) PD-MSCs transplantation. Furthermore, decreased rno-miR-122-5p was significantly correlated with increased proliferation of hepatocytes in liver tissues by PRL-1(+) PD-MSCs by activating IL-6 signaling pathway through the repression of rno-miR-21-5p. Taken together, these findings improve the understanding of therapeutic mechanisms based on miRNA-mediated stem cell therapy in liver diseases.

This study was conducted to improve the white index (WI) by preparing thermally expandable microspheres (TEMs) for wallpaper. The thermal properties, foam expansion ratio and WI were studied depending on the particle size of colloidal silica in the preparation of TEMs. As a result, the TEMs with small particles of colloidal silica showed the best results for whiteness and yellowing. Additionally, TGA results indicated that it was highly possible that colloidal silica with small particle sizes was physically or chemically attached to the surface of the TEMs that led to an improvement in whiteness at high temperatures.

Surface area and pore size distribution of Eucalyptus samples pretreated by different methods were determined by the Brunauer-Emmett-Teller (BET) technique. Three methods were applied to prepare cellulosic biomass samples for BET measurements: air, freeze, and critical point drying (CPD). Air and freeze drying caused severe collapse of biomass pore structures, but CPD effectively preserved biomass morphology. Surface area of CPD prepared Eucalyptus samples was determined to be 58–161 m2/g, whereas air and freeze dried samples were 0.5–1.3 and 1.0–2.4 m2/g, respectively. Average pore diameter of CPD prepared Eucalyptus samples were 61–70Å. CPD preserved Eucalyptus sample morphology by replacing water with a non-polar solvent, CO2 fluid, which prevented hydrogen bond reformation in the cellulose.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

In this paper, we introduce the partially degenerate Changhee-Genocchi polynomials and numbers and investigated some identities of these polynomials. Furthermore, we investigate some explicit identities and properties of the partially degenerate Changhee-Genocchi arising from the nonlinear dierential equations.

Kim-Kim ([9]) studied some properties of the degenerate gamma and degenerate Laplace transformation and obtained their properties. In this paper, we define modified degenerate gamma and modified degenerate Laplace Transformation and investigate some properties and formulas related to them.

Although the number of unwed mothers have mental health problems and intellectual disability, little research have focused on their mental and cognitive status. Since there has been public stigma of unwed mother in South Korea, they tend to conceal their status and less likely to seek psychiatric and psychological help. In this context, this study aims to assess current status of their mental health and intellectual characteristics. A total 48 unwed mothers from two shelter homes in South Korea were agreed to participate in the study. To compare mental health and intellectual abilities of unwed mothers with the general women population, reference data from national studies was used. Unwed mothers were more likely to have mood disorder, post traumatic stress disorder(PTSD), alcohol and nicotine use disorder, attention-deficit hyperactivity disorder (ADHD) than the general women population. Among 48 participants, 20 (41.7%) were lower than 70 Intelligence Quotient (IQ) and the mean of IQ (78.31) was significantly lower than normalized IQ mean of general women population. In logistic regression analysis, psychiatric disorders were associated intellectual disability. This study confirmed that unwed mothers dwelling in Korean shelter homes have more experience of mental disorders and lower intellectual ability than general women population.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

Synthetic polymer-based gradient foams have considered as promising category of functionally graded materials with unique properties. In this study, the carbon dioxide (CO₂) foaming technology has used for PET-PEN (Polyethylene Terephthalate - Polyethylene Naphthalate) copolymer towards porous functional materials with thermal insulation with reasonable mechanical strength. Through scanning electron microscope based morphological characterization, a potential to fabricate gradient foam structures with micro-pores has identified. It has shown that variation of post-foaming temperature can tune the pore size distribution although the very high post-foaming temperature tends to cause structural instability. Thermal measurement data set the limits of operation, confirmed by simultaneous differential scanning calorimeter and thermo-gravimetric analysis. Mechanical stress and thermal conductivity also has measured to find rationale of thermal insulation with reasonable mechanical strength and to elucidate the actual 3D grid foam of copolymer.

Super duplex stainless steel (SDSS) is used for manufacturing large valves and pipes in offshore plants because of its excellent strength and corrosion resistance. Large valves and pipes are manufactured by forging after casting, and the outside and inside microstructures are different owing to the difference in the cooling rate caused by the thermal conductivity. This microstructural variation causes cracks during solution annealing, which breaks the materials. To study toe corrosion resistance of the SDSS forged material, the microstructure was conducted based on the difference in the cooling rate between the inside and outside of the cast SDSS. To analyze the effects of the secondary phase fraction before solution annealing on the solution and corrosion resistance, the corrosion resistance with and without solution annealing was measured using the potentiodynamic polarization test and critical temperature test after the precipitation of the secondary phase. In the potentiodynamic polarization test, the secondary phase decreased the activation polarization and increased the corrosion rate. The critical pitting temperature exhibited the effect of the secondary phase.

The greatly diversified flowering plants (angiosperms) are the dominating and defining group in the current earth ecosystem. However, from which group by what way the flowers, especially their gynoecia (key characteristics of angiosperms), are derived have been the questions in botany unanswered over centuries. Such an embarrassing situation can be attributed to the lack of plants with partially enclosed ovules, which are supposed to be a post between gymnosperms and angi-osperms. Here we report a fossil plant that has an apparent coniferous vegetative and reproduc-tive morphologies but has a single seed partially wrapped by the subtending bract. Such a mor-phology suggests that the carpels in angiosperms may be equivalent to bracts enclosing their axil-lary seed(s). Such a non-traditional interpretation of the homology of angiosperm carpels is com-patible with various new progresses made in botany and is in line with Tomlinson’s recent hy-pothesis. Together with other fossil evidence reported recently, it appears that gynoecia in angio-sperms are derived in multiple ways.

The contact materials in high-voltage vacuum interrupter require properties such as high conductivity, high density, and high hardness to minimize arc heat damage. In this study, copper–molybdenum-chromium alloys contact materials are examined for a high voltage contact material. Ball milling process was carried out after analyzing the raw materials of copper, chromium, and molybdenum powders. A green compact was produced using a high press with the mixed powder. Afterwards, composite was produced by sintering method according to temperature and infiltration method according to Cu content in green compact. The composite of sintering method showed a density of 8.55 g/cm3 (relative density 93%) a hardness of 217 HV, and an electrical conductivity of 40.7 IACS% at 1200 °C. The composite of 10 wt.% Cu produced by the Cu infiltration method showed a density of 8.7 g/cm3 (relative density 94%), Hardness of 274HV and electrical conductivity of 39 IACS% at 1300 °C. The measurements of physical properties showed the new possibility of using the Cu–Cr–Mo alloy as a contact material for high-voltage vacuum interrupters.

Using a variety of theoretical foundations, this paper examines the association between corporate social responsibility (CSR) and employees’ knowledge-sharing behavior, investigating the sequential mediation role of perceived organizational support and organizational commitment as well as the moderating role of ethical climate. Hypotheses were formulated to address both the sequential mediation effect of perceived organizational support and organizational commitment on the link between CSR and knowledge-sharing and the moderation effect of ethical climate on the relationship between CSR and perceived organizational support. In order to mitigate the problems of potential common method bias, data were gathered from a sample of 204 South Korean employees at three distinct time points. The results of the study offer compelling evidence that CSR activities exert a positive influence on employees’ knowledge-sharing behavior, an effect that is sequentially mediated by both perceived organizational support and organizational commitment. Furthermore, the research uncovers the positive moderating role played by ethical climate in the relationship between CSR and perceived organizational support. By integrating multiple theoretical frameworks, this study not only advances the extant literature but also offers invaluable insights for organizations striving to bolster knowledge-sharing through the strategic implementation of CSR initiatives.

To date, various chimeric lysins have been developed as efficacious antibiotics against multidrug-resistant bacteria, but direct comparisons of their antibacterial activities have been difficult due to the preparation of multiple recombinant chimeric lysins. Previously, we reported an E. coli cell-free expression method to screen better chimeric lysins against Staphylococcus aureus, but we still needed to increase the amounts of expressed proteins enough to be able to detect them non-isotopically for quantity comparisons. In this study, we improved the previous cell-free expression system by adding a previously reported artificial T7 terminator and reversing the different nucleotides between the T7 promoter and start codon to those of the T7 phage. The new method increased the expressed amount of chimeric lysins enough for us to detect them using Western blotting. Therefore, the qualitative comparison of activity between different chimeric lysins has become possible via the adjustment of the amount variables between samples without protein purification. We applied it to select more active chimeric lysins derived from our previously reported chimeric lysin (ALS2). Finally, we compared the antibacterial activities of our selected chimeric lysins with reported chimeric lysins (ClyC and ClyO) and lysostaphin, and determined the rank orders of antibacterial activities on different S. aureus strains in our experimental conditions.

In this paper, the sol−gel method was used to synthesize powders of LaMnO3 (LMO), La0.85Ca0.15MnO3 (LCM), and La0.85Sr0.15MnO3 (LSM). We investigated the impact of substituting Ca and Sr at the A−site on the perovskite crystal structure and electrochemical capabilities of LMO. LCM retained its orthogonal structure in comparison to the parent LMO components, whereas LSM transitioned to a rhombic structure. At 0.5 A/g, the specific capacitance of LCM and LSM electrodes is 185.5 F/g and 248 F/g, respectively.The specific capacitance of LCM was more three times than that of the LMO electrode. Among the three samples (LMO, 22.25 m2 g−1; LSM, 31.56 m2 g−1), the LCM sample exhibited the highest specific surface area of 38.79 m2 g−1. The charge transfer resistances of the LMO, LCM, and LSM are 0.48 Ω, 0.36 Ω, and 0.38 Ω, correspondingly. The LCM electrode exhibits the greatest capacitance performance due to its more refined morphology, increased concentration of oxygen vacancy, and more complete utilization of the perovskite bulk structure. The above results demonstrate that Ca or Sr substitution of A−site compounds has great potential for supercapacitor applications.

This study employs the FLACS code to analyze hydrogen leakage, vapor dispersion, and subsequent explosions. Utilizing pseudo-source models, a liquid pool model, and a hybrid model combining both, we investigate dispersion processes for varying leak mass flow rates (0.225 kg/s and 0.73 kg/s) in a large open space. We also evaluate explosion hazards based on overpressure and impulse effects on humans. The computational results, compared with experimental data, demonstrated reasonable hydrogen vapor cloud concentration predictions, especially aligned with the wind direction. For higher mass flow rate of 0.73 kg/s, the pseudo-source model and hybrid model proved appropriate, while the liquid pool model was more suitable for lower mass flow rate of 0.225 kg/s. Regarding explosion analyses using overpressure-impulse diagram, higher mass flow rates leaded to potentially fatal overpressure and impulse effects on humans. However, lower mass flow rates may cause severe eardrum damage at the maximum overpressure point.

This study aimed to investigate the effects of lupin flake supplementation on the growth, plasma parameters, carcass characteristics, and meat composition of late-fattening Hanwoo steers. The steers (n = 40) were randomly divided into the four groups with 10 steers each: LP0 (Lupin flake 0%), LP3 (lupin flake 3%), LP6 (Lupin flake 6%), and LP9 (lupin flake 9%). The total digestible nutriant intake increased as the concentration of lupin increased (linear and quadratic effects; P &lt; 0.05). The thiobarbituric acid-reactive substance content in the strip loins decreased as lupin flake supplementation levels increased (linear and quadratic effects; P &lt; 0.05), while carnosine levels increased linearly (P &lt; 0.05). As the lupin flake supplementation level increased, anserine and creatinine contents increased linearly and quadratically (P &lt; 0.05). Similarly, adenosine triphosphate (ATP) and adenosine monophosphate (AMP) contents increased with increasing lupin flake supplementation levels in linear and quadratic effects (P &lt; 0.001). Palmitoleic acid content increased significantly with increasing lupin flake supplementation level (linear and quadratic effects; P &lt; 0.05). The content of oleic acid in the strip loin was not significant, but the unsaturated fatty acid (UFA) (P &lt; 0.05) and n-6/n-3 ratio (P &lt; 0.05) increased. The results of this study indicated that although lupin flake supplementation did not markedly affect the growth, carcass characteristics, or meat composition of late-fattening Hanwoo steers, it exerted a positive effect on the flavor, taste profiles (anserine, creatinine, ATP, and AMP), hypotonicity(TBARS), and healthy meat production (UFA and n-6/n-3 ratio) related to beef.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

This study was conducted on elderly over 65 years of age to verify that healing garden activities control stress in the elderly. The experimental group performed garden activities once a week for 12 weeks, 2 hours each, and the control group continued their daily lives. Each group's cumulative stress at the beginning and end, total power (TP), the standard deviation of the normal-to-normal interval (SDNN), and root mean square differences of successive R-R intervals (RMSSD) were measured using a stress index meter, u-bio MACPA. As a result of the analysis, the experimental group had a statistically significant decrease in cumulative stress compared to the control group, and TP significantly increased compared to the control group. SDNN and RMSSD of the experimental group increased, respectively, and the control group decreased, respectively, but it was not statistically significant. The fact that cumulative stress decreased, and stress evaluation indicators increased shows that daily stress can be controlled through healing garden activities. This confirms that the value of the garden can extend to healing.

As broiler farming facilities have become larger and more concentrated in response to external environmental changes, there is a possibility of increased concentrations of fine dust and aerosols inside these facilities due to enclosure. In particular, workers are exposed to high concentrations of organic particulate matter and harmful gases while performing their tasks, and as they age, they become more vulnerable to respiratory diseases. It is essential to directly monitor the concen-trations to which workers are exposed, along with the spatial distribution of aerosols inside broiler house. In this study, we analyzed the regional aerosol concentrations using passive samplers in commercial tunnel-ventilated broiler farms. Simultaneously, we employed active samplers at the height of the workers' breathing zones to monitor real-time aerosol concentrations by particle size along their work routes. Spatial aerosol concentrations generally increased from the inlet to the exhaust in the breathing zone. The average aerosol concentrations were TSP -1,042 µg/m³, PM-10 718 µg/m³, and PM-2.5 137 µg/m³. To analyze the workers' exposure environments, we categorized the tasks in the barn into Static work period (SWP) and Moving work period (MWP) based on video analysis. The results showed that during MWP, fine dust concentrations exceeded the standards by up to 214%. Particularly, during MWP, the concentrations were 1.74 times higher for TSP, 1.40 times higher for PM-10, and 1.22 times higher for PM-2.5 compared to SWP. It was observed that during the movement of workers, physical generation of particles around 10 µm, such as feces, feed, and bedding, occurred due to the movement of chicken, which influenced the aerosol concentration.

Many farms utilize closed-type livestock systems to enhance productivity and facilitate effective environmental management. However, the confined nature of these closed spaces poses an increased risk of exposure to harmful gases and organic dust for both workers and livestock. Additionally, the introduction of outside air through ventilation systems can lead to temperature fluctuations within the breeding environment, resulting in potential productivity issues. This research paper employs computational fluid dynamics (CFD) to develop ventilation operation management plans that address both the working environment and the breeding environment simultaneously. The proposed plans are designed to be easily implemented in practical farm settings. The findings of this study, based on simulation analysis, indicate that while ventilation is effective in reducing harmful gases and improving the working environment, its efficiency decreases after the initial 3 minutes of operation. Furthermore, uncontrolled ventilation can cause sudden temperature changes, which may adversely affect the well-being of the livestock. However, when upgraded ventilation structures are implemented, significant improvements in the working environment (an average of 27.3% improvement) can be achieved while maintaining temperature stability for the livestock. These results highlight the importance of referring to the provided ventilation operation management table before commencing work, as it enables workers to improve the working environment while minimizing the potential impact of ventilation on the breeding environment.

Gas flaring is commonly used by industrial plants for processing oil and natural gases in the atmosphere, and hence is an important anthropogenic source for various pollutants including CO₂, CO, and aerosols. This study evaluates the feasibility of using satellite data to characterize gas flaring form space by focusing on the Khanty Mansiysk Autonomous Okrug in Russia, a region that is well known for its dominatingly gas flaring activities. Multiple satellite-based thermal anomaly data products at night are inter-compared and analyzed, including MODIS (Moderate Resolution Imaging Spectroradiometer) Terra level-2 Thermal Anomalies product (MOD14), MODIS Aqua level-2 Thermal Anomalies product (MYD14), VIIRS (Visible Infrared Imaging Radiometer Suite) Active Fires Applications Related Product (VAFP), and VIIRS level-2 data based Nightfire product (VNF). The analysis compares and contrasts the efficacy of these sensor products in detecting small, hot sources like flares on the ground in extremely cold environments such as Russia. We found that the VNF algorithm recently launched by NOAA has the unprecedented accuracy and efficiency in characterizing gas flares in the region owing primarily to the use of Shortwave Infrared (SWIR) bands. Reconciliation of VNF’s differences and similarities with other nighttime fire products is also conducted, indicating that MOD14/MYD14 and VAFP data are only effective in detecting those gas flaring pixels that are among the hottest in the region. Validation of VNF product of gas flaring location with Google Earth images are made. It is shown that that VNF’s estimates of gas flaring area (the area of gas flaming) agree well the counterparts from Google images with a linear correlation of 0.91, highlighting its potential use for routinely monitoring emissions of gas flaring from space.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

Background: Oenothera biennis (evening primrose) produces bioactive substances with a diverse range of pharmacological functions. However, it is currently unknown whether extract prepared from the aerial parts of O. biennis (APOB) can protect the skin against oxidative stress. To investigate the protective effects of APOB against oxidative stress-induced damage in human skin keratinocytes (HaCaT) and elucidate the underlying mechanisms. Methods: We pretreated HaCaT cells with various concentrations of APOB or the antioxidant N-acetyl-L-cysteine before applying H2O2. We then compared the cell viability, intracellular reactive oxygen species (ROS) production, and DNA and mitochondrial damage between pretreated and untreated control cells using a range of assays, flow cytometry, and Western blot analysis and also examined the reducing power and DPPH free radical-scavenging activity of APOB. Results: APOB pretreatment significantly increased cell viability, effectively attenuated H2O2-induced comet tail formation, and inhibited H2O2-induced phosphorylation of the histone γH2AX, as well as the number of apoptotic bodies and Annexin V-positive cells. APOB was found to have a high reducing power and DPPH radical-scavenging activity and also exhibited scavenging activity against intracellular ROS accumulation and restored the loss of mitochondrial membrane potential caused by H2O2. APOB pretreatment almost totally reversed the enhanced cleavage of caspase-3, the degradation of poly (ADP-ribose)-polymerase (PARP), DNA fragmentation that usually occurs in the presence of H2O2 and increased the levels of heme oxygenase-1 (HO-1), a potent antioxidant enzyme that is associated with the induction of nuclear factor-erythroid 2-related factor 2 (Nrf2). Conclusions: APOB can protect HaCaT cells from H2O2-induced DNA damage and cell death by blocking cellular damage related to oxidative stress via a mechanism that affects ROS elimination and by activating the Nrf2/HO-1 signaling pathway.

Amidst the escalating demands for efficient Intelligent Transportation Systems (ITS) management, the significance of accurate Origin-Destination (OD) data prediction has emerged as a paramount concern, given its indispensable role in the ITS domain. This paper introduces a groundbreaking integrated model, creatively fusing the unique strengths of Graph Convolutional Network (GCN), Residual Neural Network (ResNet), and Long Short-Term Memory Network (LSTM) into a single architecture, which we name GraphResLSTM, to exploit road segment average speed data for OD prediction. Compared with conventional road segment traffic volume data, average speed data is more readily available, significantly reducing the data accessibility barrier for OD prediction. We underscore the critical role of selection of key road segments and employs a combination of Entropy Weight Method and Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) to identify 41 representative road segments from the experimental road network. In the experimental phase, we simulate 86400000 seconds of traffic conditions, generating a total of 1440000 data records. Utilizing these simulated data, we design and conduct comparative experiments between models as well as data types. The results demonstrate that both the GraphResLSTM model and road segment average speed data outperform other models and data types notably in OD prediction tasks.

This paper addresses a method to transmit streaming data via rolling shutter camera-based optical camera communications (OCC). Since the amount of data that can be contained within one frame is limited, and the continuity of received data cannot be guaranteed due to OCC environmental variations, we introduce the concept of dividing the streaming data into several fragmented sets that are transmitted sequentially. We propose a superframe to contain sequential packets of fragmented data and corresponding indexes, so that sequential packets for streaming data can be continuously collected. When redundant frame transmission is considered, any packet lost due to OCC environmental conditions can be recovered. Experimental results show that the proposed method can be successfully used to transmit streaming data, with the number of redundant frames required to acquire all data packets based on image resolution. In addition, we describe how to identify missing packets from a network point of view to reduce the number of redundant frames needed to acquire all the data. This paper presents baseline results of communication performance when sending streaming data via a rolling shutter-based OCC.

We evaluated the association of blood pressure with blood levels of cadmium, lead, and cadmium and lead together (cadmium+lead) in a representative sample of adolescents from Korea by use of 2010-2016 data from the Korean National Health and Nutrition Examination Survey (KNHANES). This cross-sectional study enrolled adolescents aged at 10-18 years-old who completed a health examination survey and had blood measurements of lead and cadmium. The association of adjusted mean differences in diastolic and systolic blood pressure with doubling of blood lead and cadmium were estimated by regression of blood pressure against log₂-transformed blood metals and their quartiles after covariate adjustment. Adjusted odds ratios for prehypertension were calculated for log₂-transformed blood levels of lead and cadmium and their quartiles. Our analysis of adolescents in Korea indicated that blood levels of lead and cadmium were not significantly associated with increased blood pressure or risk of pre-hypertension. However, the cadmium+lead level was associated with pre-hypertension. Previous studies showed that blood levels of lead and cadmium were associated with increased blood pressure and risk of hypertension in adult populations. We found no such effect in Korean adolescents, although the cadmium+lead level was associated with prehypertension. These differences may be because adolescents generally have lower levels of these blood metals or because adolescents only rarely have hypertension.

Background: Pathologic complete response (pCR) of breast cancer after neoadjuvant chemotherapy (NAC) is highly related to molecular subtypes. Patients who achieved tumor pCR after NAC have a better prognosis. However, despite of better prognosis, pCR patients have a potential for recurrence. There is little evidence of risk factors of recurrence in patients with pCR. We aim to analyze factors associated with tumor recurrence in patients who achieved pCR. Methods: This study retrospectively reviewed the data of patients diagnosed with breast cancer who achieved pCR after receiving NAC between January 2009 and December 2018 in Samsung Medical Center. pCR was defined as no residual invasive cancer in the breast and axillary nodes even if there is residual ductal carcinoma in situ (ypT0 or ypTis with ypN0). Breast cancers are classified into 4 subtypes based on hormone receptors (HR) and human epithelial growth factor receptor 2 (HER2) status. Patients who had bilateral breast cancer, inflammatory breast cancer, distant metastasis, unknown subtype, and histologically unique case were excluded from the study. Results: In total 483 patients were included in this study except for patients who corresponded to the exclusion criteria. The median follow-up duration was 59.0 months (range, 0.5-153.3 months). Breast cancer recurred in 4.1% of patients (20 of 483). There was a significant difference in clinical T (p = .004) and clinical N (p = .034) stage in the Kaplan-Meier curve for disease-free survival. Molecular subtypes (p = .573), Ki67 (p = 1.000), and breast surgery type (p = .574) were not associated with tumor recurrence in patients who achieved pCR after NAC. In the clinical T stage and clinical N stage, there was a significant difference between recurrence and no-recurrence groups (clinical T stage; p = .045, clinical N stage; p = .002). Univariable Cox regression revealed statistical significance in the clinical T stage (p = .049) and clinical N stage (p = .010), while multivariable Cox regression demonstrated non-significance in the clinical T stage (p = .320) and clinical N stage (p = .073). Conclusion: Results in this study showed that clinical T, clinical N stage, and molecular subtypes were not statistically significant predictors of recurrence in patients who achieved pCR after NAC. It is hypothesized that a multicenter-based study would lead to the identification of factors as predictors of recurrence after achieving pCR.

Background: Existing human cell immortalization methods made the cells obtain oncogenesis phenotype and/or caused the cells gain and/or lose chromosomes. Immortalized normal human T cells lines provide critical in vitro models for basic research and therapeutic products development.Methods: We utilized a CRISPR/Cas9 system to replace a single copy of the exon 2 of the cell cycle inhibitor gene CDKN2A (encoding p16 and p14 proteins) with a single copy of human telomerase reverse transcriptase (hTERT) to immortalize human primary CD8⁺ T cells (hCD8⁺T-TERT). By using Cas9 protein and low donor DNA copies/cell, we successfully immortalized hCD8⁺T cells with a single copy of hTERT transgene, which also avoided uncontrolled insertion of Cas9 gene and guide RNA vector.Results: Human primary CD8+ cells were immortalized and expanded more than 2.6 × 10⁷ times. Characterization of the cells revealed that the immortalized CD8⁺ T-TERT cells retained most of the cell surface markers and normal karyotype. The CD8⁺ T-TERT cells also retained the dependence of IL-2 and CD3/CD28 activator for survival and expansion.Conclusion: we established a stable immortalized CD8⁺ T cell line that had a phenotype consistent with T cells and will be a useful research model.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

. Various elements such as evolutions in IoT services resulting from sensoring by vehicle parts and advances in small communication technology devices have significantly impacted the mass spread of mobility services that are provided to users in need of limited resources. In particular, business models are progressing away from one-off cost towards longer term cost as represented by shared services utilizing kick-boards or bicycles and subscription services for vehicle software. Advances in shared mobility services as described are calling for solutions that can enhance reliability of data aggregate by users leveraging mobility services in the next-generation mobility areas. However, mining process to renew status, ensures continued network communication and block creation demands high performance in public block chain. This thesis proposes random certificate node selection mechanism in block network that creates blocks via node that has tokens issued for block creation and lets only specific nodes selected by encrypting token information acquires token.

Void fillers are required for osseous gaps generated after orthopedic procedures as medial open-wedge high-tibial osteotomy (MOWHTO) to provide sufficient structural support and a rapid osteosynthesis. We developed a novel three-dimensional (3D) printing-based platform technology using the customized 3D scaffolds covered with polycaprolactone (PCL)/β-tri-calcium phosphates (β-TCP)/bone decellularized extracellular matrix (dECM) for use as bone substitute scaffold, which can be effectively exploited to estimate the calculated correction angle with preoperative simulations. PCL/β-TCP/bone dECM scaffolds demonstrated significantly higher cell contain levels in cell seeding efficiency, excellent proliferation capacity, and promotion of early osteogenic differentiation compared with PCL/β-TCP scaffolds. The scaffolds promoted bone mineralization at the early time points of an in vivo study (8 weeks) and exhibited biodegradable properties (38% for 16 weeks). The correction angle measured after osteotomy using 3D printed scaffolds was estimated with high accuracy with low errors (10.3° ± 0.9°), was and was not significantly different even in the presence of lateral cortical hinge fractures. The customized 3D scaffold enriched with PCL/β-TCP/bone dECM yielded excellent cell seeding efficiency, proliferation capacity, early osteogenic differentiation, and bone mineralization outcomes. It is expected to solve the disadvantages related with bone union in MOWHTO, and to replace autografts in the future.

A heat pump with thermal storage system is a system that operates a heat pump during night-time using inexpensive electricity; during this time, the generated thermal energy is stored in a thermal storage tank. The stored thermal energy is used by the heat pump during daytime. Based on a model of a dual latent heat storage tank and a heat pump, this study conducts control simulations using both conventional and advanced methods for heating in a building. Conventional methods include the thermal storage priority method and the heat pump priority method, while advanced approaches include the region control method and the dynamic programming method. The heating load required for an office building is identified using TRNSYS, used for simulations of various control methods. The thermal storage priority method shows a low coefficient of performance (COP), while the heat pump priority method leads to high electricity costs due to the low use of thermal storage. In contrast, electricity costs are lower for the region control method, which operates using the optimal part load ratio of the heat pump, and for dynamic programming, which operates the system by following the minimum cost path. According to simulation results for the winter season, the electricity costs using the dynamic programming method are 17% and 9% lower than those of the heat pump priority and thermal storage priority methods, respectively. The region control method shows results similar to the dynamic programming method with respect to electricity costs. In conclusion, advanced control methods are proven to have advantages over conventional methods in terms of power consumption and electricity costs.

The Korean Pathfinder Lunar Orbiter (KPLO)-MAGnetometer (KMAG) consists of three triaxial fluxgate sensors (MAG1, MAG2, and MAG3) to measure the magnetic field around the Moon. The three sensors are mounted in the order of MAG3, MAG2, and MAG1 inside a 1.2 m long boom away from the satellite body. Before it arrived on the Moon, we compared the magnetic field measurements taken by DSCOVR and KPLO in the solar wind to verify the measurement performance of the KMAG instrument. We found that there were artificial disturbances in the KMAG measurement data, such as step-like and spike-like disturbances, which were produced by the spacecraft body. To remove spacecraft-generated disturbances, we applied a multi-sensor method, employing the gradiometer technique and principal component analysis and using KMAG magnetic field data and confirmed the successful elimination of spacecraft-generated disturbances. This indicates that the multi-sensor method is able to clean the magnetic field data measured onboard the KPLO.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

In this study, the focus is on the drop test simulation of an MR (Magnetorheological) damper-based main landing gear (MRMLG), aiming to explore multi-degree-of-freedom (DOF) dynamic models during aircraft landing. Three different 6-DOF dynamic models are proposed in this work and their drop performances are compared with results achieved one of commercial softwares. The proposed models include a nonlinear aircraft model (NLAM), a linearized approximated aircraft model (LAAM) linearizing from the nonlinear equations of motion in NLAM, and a fully approximated aircraft model (FAAM) which linearizes the MRMLG's strut force model. In order to evaluate drop performance of the aircraft landing gear system with MR dampers, a 7-DOF aircraft model incorporating the nonlinear MRMLG is formulated using RecurDyn. The principal comparative param-eters are the coefficient of determination (R2) for system response of each model with Re-curDyn model and root mean square error (RMSE) which is the ensembles of CG dis-placement data for each model. In addition, the ensemble of time series data is created for diverse drop scenarios, providing valuable insights into the performance of the proposed drop test models of the aircraft landing gear system featuring MR dampers.

Ocean surface waves have been utilized as fundamental information in various fields of oceanic research. In this paper, we suggest a simulation and modelling technique for generating an ocean surface wave using an inverse Fast Fourier Transform (iFFT), and we subsequently verify the wave’s accuracy. The conventional method, linear superposition, requires recursive calculation because of the double summation and the time variable; to circumvent this issue, the new algorithm is presented. The Joint North Sea Wave Project (JONSWAP) spectrum is utilized for the ocean surface wave simulation example, and the parameters are the significant wave height (HS) and the zero-crossing wave period (TZ). A coordinate transform for the wavenumber domain was used to apply the inverse FFT algorithm. To verify the accuracy of the simulation result, the relative error between the input condition and the analysis result was calculated. The result for TZ is below 4% relative error, and the maximum relative error for HS is 7%. To avoid the Nyquist frequency for wave-field analysis and simulation, the minimum grid size was calculated by twice applying the maximum wavenumber.

This study proposes self-calibration of capacitor mismatch errors for high-resolution pipeline analog-to-digital converters (ADCs). The proposed calibration circuit recursively amplifies the capacitor mismatch error by re-utilizing a multiplying digital-to-analog converter in a pipeline stage without increasing the circuit complexity, and the amplified error voltage is converted into digital code by utilizing the remaining pipeline stages. Error correction is performed by subtracting the digital code from the ADC output during normal operation. A prototype of a 12-bit pipeline ADC is fabricated in a 0.18 µm standard CMOS process. The ADC comprises eight 1.5-bit stages, followed by a 4-bit flash ADC as the final stage; the capacitor mismatch errors in the first two pipeline stages are corrected by utilizing the proposed self-calibration technique. At a sampling rate of 30 MS/s, the measured differential and integral nonlinearities improve from +0.82/-0.75 and +1.12/-1.79 to +0.45/-0.41 and +0.47/-0.91 after calibration, respectively. Further, the measured dynamic performances improve significantly with calibration. For an input frequency of 2.09 MHz, the ADC achieves a spurious-free dynamic range (SFDR) and signal-to-noise and distortion ratios (SNDR) of 69.3dB and 63.9dB before calibration, respectively. After calibration, the SFDR and SNDR increase to 84.1dB and 68.9dB, respectively, and the effective number of bits is approximately 11.1bit. The power consumption of the ADC is 35mW under 1.8V supply, and the resulting figure of merit is 514fJ/conversion step.

Software Defined Networking (SDN) is positioning the standard for the management of networks due to its scalability and flexibility to program the network. The SDN provides many advantages but it also involves some specific security problems take down the controller using cyber attack and in result the whole network will shut down which makes it a single point of failure. In this paper, the DDoS attacks in SDN were detected using AI-enabled, machine and deep learning, models with some specific features for data-set under normal and DDoS traffic. In our approach, initial data-set is collected from 84 features on kaggle and then the 20 top most features are selected using permutation importance algorithm. The data-set were learned and tested with AI-enabled 5 models. Our experimental results showed that the use of machine learning based random forest model has achieved the highest accuracy rate of 99.97%, in DDoS attack detection in SDN. Our contributions through this study are, first, we found highest 20 attacks that absolutely contributed to DDoS attacks. Secondly, it can reduce the time and cost of comparing various learning models and performance required for determining a learning model suitable for DDoS detection. Finally, various experimental methods for evaluating the performance of the learning model are presented so that related researchers can utilize them.

A biocatalytic system that could produce bioactive resveratrol poly-glucosides using sucrose as a low-cost source of UDP-glucose donors and amylosucrase DgAS from Deinococcus geothermalis was developed in this study. This system boasts several advantages, including fast and direct conversion of substrates to products, thermostable, and regio-stereospecific, and effectiveness in vitro and in vivo at 40°C. With a success rate of around 97.0% in a short period in vitro and 95.0% in vivo, resveratrol-O-glucosides showed exciting outcomes in cosmetic activities, such as antioxidant, anti-inflammatory, anti-aging, and whitening effects when tested with Raw 264.7, B16, and HS68 cell lines. DgAS is recognized as an important biocatalyst due to its higher thermostability, effectiveness, and specificity among all known amylosucrases (ASases) in the production of poly-glucosides in a chain of polyphenols, like resveratrol, making it an ideal candidate for industrial use to cost-effective production of cosmetic items.

A robust guaranteed cost preview repetitive controller is proposed for a class of polytopic uncertain discrete-time systems. In order to improve the tracking performance, the repetitive controller combined with preview compensator is inserted in the forward channel. By using the L-order forward difference operator, an augmented dynamic system is constructed. Then, the guaranteed cost preview repetitive control problem is transformed into the guaranteed cost control problem for the augmented dynamic system. For given performance index, the sufficient condition of asymptotic stability for the closed-loop system is derived by combining parameter-dependent Lyapunov function method with linear matrix inequality (LMI) techniques. By incorporating the controller obtained into the original system, the guaranteed-cost preview repetitive controller is derived. A numerical example is also included to show the effectiveness of the proposed method.

This study was to investigate and assess salivary biomarkers as a means of diagnosing periodontitis. A total of 121 subjects were included: 28 periodontally healthy subjects, 24 with stage I, 24 with stage II, 23 with stage III, and 22 with stage IV periodontitis. Salivary proteins including active matrix metalloproteinase-8 (MMP-8), pro-MMP-8, total MMP-8, C-reactive protein, secretory immunoglobulin A and planktonic bacteria including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum, Prevotella intermedia, Porphyromonas nigrescens, Parvimonas micra, Campylobacter rectus, Eubacterium nodatum, Eikenella corrodens, Streptococcus mitis, Streptococcus mutans, Staphylococcus aureus, Enterococcus faecalis, and Actinomyces viscosus were measured from salivary samples. The performance of the diagnostic models was assessed by receiver operating characteristics (ROC) and area under the ROC curve (AUC) analysis. The diagnostic models were constructed based on the subjects’ proteins and/or microbial profiles, resulting in two potential diagnosis models, which achieved better diagnostic powers with an AUC value &gt; 0.750 for the diagnosis of stage II, III, and IV periodontitis (Model PC-I; AUC: 0.796, sensitivity: 0.754, specificity: 0.712) and for the diagnosis of stage III and IV periodontitis (Model PC-II; AUC: 0.796, sensitivity: 0.756, specificity: 0.868). This study can contribute to screening for periodontitis based on salivary biomarkers.

With the rapid evolution of SARS-CoV-2, the emergence of new strains is an intriguing question. This paper presents an evolutionary theory to analyze the mutations of the virus and identify the conditions that lead to the generation of new strains. We represent the virus variants using a 4-letter sequence based on amino acid mutations on the spike protein and employ an n-distance algorithm to derive a variant phylogenetic tree. We show that the theoretically-derived tree aligns with experimental data on virus evolution. Additionally, we propose an A-X model, utilizing the set of existing mutation sites (A) and a set of randomly generated sites (X), to calculate the emergence of new strains. Our findings demonstrate that a sufficient number of random iterations can predict the generation of new macro-lineages when the number of sites in X is large enough. These results provide a crucial theoretical basis for understanding the evolution of SARS-CoV-2.

Effective prediction of wastewater treatment is beneficial for precise control of wastewater treatment processes. The nonlinearity of pollutant indicators such as COD and TP makes the model difficult to fit and has low prediction accuracy. The classical deep learning methods have been shown to perform nonlinear modeling. However, there are enormous numerical differences between multi-dimensional data in the prediction problem of wastewater treatment, such as COD above 3000 mg/L and TP around 30 mg/L. It will make current normalization methods challenging to handle effectively, leading to the training failing to converge and the gradient disappears or exploding. This paper proposes a multi-factor prediction model based on deep learning. The model consists of a combined normalization layer and a codec. The combined normalization layer combines the advantages of three normalization calculation methods: z-score, Interval, and Max, which can realize the adaptive processing of multi-factor data, fully retain the characteristics of the data, and finally cooperate with the codec to learn the data characteristics and output the prediction results. Experiments show that the proposed model can overcome data differences and complex nonlinearity in predicting industrial wastewater pollutant indicators and achieve better prediction accuracy than classical models.

Background: The world-wide rate of obesity is increasing continuously, representing a serious medical threat since it is associated with a variety of diseases including type 2 diabetes, cardiovascular disease, and numerous cancers. Sophora japonica is used as a traditional herb for medicinal purposes in eastern Asia. However, the anti-obesity effects of S. japonica fruit have not been explored. Objective: The aim of this study is to investigate the inhibition of adipocyte differentiation and adipogenesis by an ethanol extract of S. japonica fruit (EESF) in 3T3-L1 pre-adipocytes. Methods: MTT assay, Oil Red O staining, and Triglyceride contents were used to investigate lipid accumulation in 3T3-L1 cells to clarify adipocyte differentiation. The expression levels of various molecular signals associated with adipogenesis and lipogenesis were examined by western blot analysis. Results: Our results demonstrate that EESF suppressed the terminal differentiation of 3T3-L1 pre-adipocytes in a dose-dependent manner, as confirmed by a decrease in lipid droplet number and lipid content through Oil Red O staining. EESF significantly reduced the accumulation of cellular triglyceride, which was associated with a significant inhibition of the levels of pro-adipogenic transcription factors, downregulated the expression levels of adipocyte-specific proteins. Furthermore, EESF treatment effectively increased the phosphorylation of AMPK and ACC. Conclusions: These results together indicate that EESF has significant effects on the inhibition of adipogenesis and acts by stimulating the AMPK signaling pathway. Further studies will be needed to identify the active compounds in S. japonica.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.