The vast majority of autonomous driving systems are limited to applications on roads with clear lane markings and are implemented using commercial grade sensing systems coupled with specialized graphic accelerator hardware. This research reviews an alternative approach for autonomously steering vehicles that eliminates the dependency on road markings and specialized hardware. A combination of machine vision, machine learning and artificial intelligence based on popular pre-trained Convolutional Neural Networks (CNN) and Recurrent Neural Networks (RNN) was used to drive a vehicle along roads lacking lane markings (unmarked roads). The team developed and tested this approach on the ACTor (Autonomous Camus TranspORt) vehicle - an autonomous vehicle development and research platform coupled with a low-cost webcam based sensing system and minimal computational resources. The proposed solution was evaluated on real-world roads and varying environmental conditions. It was found that this solution may be used to successfully navigate unmarked roads autonomously with acceptable road following behavior.

Leader-follower autonomy (LFA) systems have so far only focused on vehicles following other vehicles. Though there have been several decades of research into this topic, there has not yet been any work on human-vehicle leader-follower systems. We present a system in which an autonomous vehicle — our ACTor 1 platform — can follow a human leader who controls the vehicle through gestures. We successfully developed a modular pipeline that uses artificial intelligence/deep learning to recognize hand-and-body gestures from a user in view of the vehicle’s camera and translate those gestures into physical action by the vehicle. We demonstrate our work using our ACTor 1 platform, a modified Polaris Gem 2 electric vehicle. This work has numerous applications, such as material transport in industrial contexts.

Due to the inherent risks associated with tunnel construction, including potential collapse, various types of work activities, and challenging visibility and communication conditions, safety management in tunnel projects requires significant investment in terms of cost and time. In this research, we propose and demonstrate a novel smart construction system that utilizes worker location monitoring technology to enhance safety in tunnel construction. The system comprises a wearable beacon integrated into safety helmets, scanners strategically placed at regular intervals inside the tunnel, environmental sensors for monitoring temperature, pressure, and air quality, and mobile devices for collecting and analyzing data on workers and the environment. Through a field demonstration conducted in a Korean tunnel construction site, we validated the effectiveness of the proposed system, which demonstrated real-time monitoring of workers and reliable communication capabilities, leading to improved safety and cost-efficiency in tunnel construction. By implementing the proposed system, we achieved a significant reduction of 37% in monthly construction costs and 77% in annual construction costs compared to conventional methods.

This study focused on the precise detection and concordant analysis of circulating tumor cells (CTCs) to verify the usefulness of CTCs as promising clinical markers. CTCs are traditionally achieved using immune-fluorescence and morphological techniques. By combining two prostate cancer-specific genes (PSA and PSMA) and two epithelial-specific genes (EpCAM and KRT19), the CTC detection efficiency can be enhanced. The detection rates of localized prostate cancer (LPC), locally advanced prostate cancer (LAPC), metastatic hormone-sensitive prostate cancer (mHSPC), and metastatic castration-resistive prostate cancer (mCRPC) were 63.04 % (29/46), 70.59% (34/51), 94.34% (50/53), and 90% (126/140), respectively. Subsequent correlation analysis between the four genes, baseline PSA, and CTC count revealed that only the CTC count correlated with baseline PSA in the localized stages of prostate cancer, whereas all four genes were correlated with baseline PSA and CTC count in the metastatic stages of prostate cancer. The precise detection of CTCs using both numerical and transcriptomic analyses can improve the accuracy of biomarker investigations. This study provides valuable insights into the limitations of serum PSA testing and offers a promising alternative to diagnose and manage prostate cancer via the CTC number and specific genes for prostate cancer.

Objectives: 1) To describe the cardiovascular health of the construction workers in Hong Kong, 2) to examine the demographic differences in cardiovascular health, and 3) to examine the association between modifiable lifestyle behaviors and cardiovascular conditions. Methods: 626 registered construction workers were included in the analysis. Blood chemistry, blood pressure, weight and height were measured. Face-to-face questionnaire interview was conducted. T-tests and One-way ANOVAs were used to compare the cardiovascular health score, cardiovascular outcomes, and lifestyle behaviors by demographic characteristics. Logistic regressions were performed to assess the cardiovascular outcomes by lifestyle behaviors. Results: Two-thirds of the construction workers failed to achieve three out of the seven “ideal” cardiovascular health indicators. The younger, more educated, and female subjects had better cardiovascular health scores than their counterparts. The ideal fish and seafood consumption was associated with 1) ideal weight status and 2) ideal cholesterol level, whereas less soft drink consumption was associated with ideal cholesterol level. Conclusions: The findings highlighted the importance of promoting cardiovascular health in the construction industry. This study provided insights for future interventions, which should include increasing fish and seafood intake, decreasing soft drink consumption, and enhancing the health literacy amongst older, less educated, and male construction workers.

Organizing pneumonia (OP) can be diagnosed pathologically, and cryptogenic OP (COP) and secondary OP (SOP) have been classified by cause and underlying context. Because it is clinically difficult to differentiate between COP and SOP, this study investigated characteristics that could distinguish between COP and SOP. The medical records of patients who underwent lung biopsy from 2016 to 2018 were retrospectively reviewed. Eighty-five patients had pathologically proven OP, including 16 diagnosed with COP and 69 diagnosed with SOP. The most common cause of SOP was infectious pneumonia, observed in 57 (82.6%) of the 69 patients. Median time from symptom onset to hospital admission is shorter (P=0.006) and fever was more common (P=0.021) in the SOP. Some laboratory results differed significantly between the two groups. Lymphocyte in bronchoalveolar lavage fluid were higher in the COP (P=0.012). Radiologic findings showed that effusion was more common in the SOP (P=0.043). There were no between-group differences in steroid use, 30 day and in-hospital mortality rates, and rates of OP outcomes and recurrences. Infection is the main cause of SOP. Symptom onset is more rapid in patients with SOP. Pleural effusion was more common in the SOP but there were no differences in clinical course.

The spring-in phenomenon of the composite parts can affect the assembly process. This study aims to predict the spring-in phenomenon of carbon fiber reinforced plastic (CFRP) part. Here, we predict the spring-in of the CFRP part using a coupled analysis of the forming and cooling processes during the stamping process. First, a simulation of the entire forming process, such as the transfer of the composite laminate, gravity analysis, and forming was performed to obtain the temperature distribution of the CFRP part. Subsequently, a finite-element (FE) simulation of the cooling process was conducted to predict the spring-in phenomenon of the shaped CFRP part using the temperature data obtained in the forming simulation. Finally, a CFRP part was manufactured and compared with the results of the FE simulation.

Bedbug (Cimex spp.) are a nuisance public-health pest that is on the rise globally, particularly in crowded cities such as Hong Kong. To investigate the health impacts of bedbug infestations among bedbug victims, online surveys were distributed in Hong Kong between June 2019 to July 2020. Data on sociodemographics, self-rated health, average hours of sleep per day, and details of bedbug infestation were collected. Bivariate and multivariable analysis were performed using logistic regression. The survey identified 422 bedbug victims; among them, 223 (52.9%) experienced ≥5 bites in the past month, most bites occurred on the arms (n=202, 47.8%) and legs (n=215, 51%), and the most common reaction to bites were itchiness (n=322, 76.3%), redness, and swelling of the skin (n=246, 58.1%), and difficulties sleeping or restlessness (n=125, 29.6%). Bites usually occurred during sleep (n=230, 54.5%). For impact on daily life in the past month, most bedbug victims reported moderate to severe impact on mental and emotional health (n=223, 52.8%) and sleeping quality (n=239, 56.6%). Lower self-rated health (aOR<1) was independently associated with impact to physical appearance (p=0.008), spending money on medication or doctor consultation (p=0.04), number of bites in the past month (p=0.023), and irregular time of bites (p=0.003). Lower average hours of sleep per day (aOR<1) was independently associated with impact on mental and emotional health (p=0.016). This study brings attention to the neglected issue of bedbug infestation by considering bedbugs as an infectious agent instead of a vector and providing empirical evidence describing its health impacts.

Social isolation magnified by the restriction of movement order during the COVID-19 pandemic may lead to negative psychosocial health impact among community-dwelling older adults. We evaluated the feasibility of virtual research methods and virtual group exercises among individuals aged 60 years and over in Malaysia. Participants were recruited from the Promoting Independence in Seniors with Arthritis (PISA) pilot cohort through social media messages. A four-week course of virtual group exercise was offered. Anxiety and depression were assessed with the Hospital Anxiety and Depression Scale (HADS) during the last attended follow-up of the cohort study (pre-pandemic), pre-intervention, and post-intervention. Exercise adherence was recorded using diary with daily entries and attendance to the virtual group exercise sessions were captured daily. The outcomes of interest were changes of anxiety and depression scores from baseline to pre-intervention (pandemic-related) and post-intervention (virtual exercise related). Forty-three individuals were recruited. A significant increase in anxiety scores from baseline to pre-intervention was observed. Comparisons using repeated-measures analysis of variance between those who attendance ≥14 and <14 group exercise sessions revealed no between-within subjects differences in depression scores. There was a 23% dropout rate in the post intervention survey and 60.5% of diaries were returned. This study demonstrated the feasibility of conducting research entirely virtually among older persons during the peak of global first wave of a pandemic. The pandemic has led to increased anxiety among community-dwelling older adults.

Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

Coral reefs are declining worldwide due to global changes in the marine environment. The increasing frequency of massive bleaching events in the tropics is highlighting the need to better understand the stages of coral physiological responses to extreme conditions. Moreover, like many other coastal regions, coral reef ecosystems are facing additional localized anthropogenic issues such as nutrient loading, increased turbidity, and coastal development. Different strategies have been developed to measure the health status of a damaged reef, ranging from the resolution of individual polyps to an entire coral community, but techniques for measuring coral physiology in situ are not yet widely implemented. For instance, while there are many studies of the coral holobiont response in single or limited-number multiple stressor experiments, they provide only partial insights to metabolic performance under more complex temporally and spatially variable natural conditions. Here, we discuss the current status of coral reefs and their global and local stressors in the context of experimental techniques that measure core processes in coral metabolism (respiration, photosynthesis, and biocalcification) in situ, and their role in indicating the health status of colonies and communities. We highlight the need to improve the capability of in situ studies in order to better understand the resilience and stress response of corals under multiple global and local scale stressors.

Dogs population increased exponentially in the past decade while the birth rate decreased gradually, especially in the developed countries. Due to dogs’ characteristics of loyalty and obedience, most pet owners treated their dogs as their family members or companions, therefore they are willing to select and purchase safe, high quality and nutrition dog food to their dogs. However, there is lack of regulation or standard to reinforce the production or distribution of dog food in Hong Kong. Consequently, this paper will first review the relationship between high dog population and declining birth rate, types of dog food and typical ingredients. Secondly, the potential health implications of various “toxic” food ingredients for dog, hazard analysis of dog food and its testing methods will be investigated. Lastly, this paper will summarize worldwide existing standards and regulations, quality and hygiene management system related to dog food safety to provide insights and suggestions to Hong Kong government about the importance and urgency of implementing regulations and policies to oversee the imported and local manufactured dog food.

In a power plant that uses seawater as a coolant, a debris filter is required to remove foreign substances from the seawater, and differential pressure leads to a decrease in the coolant flow rate, leading to a decrease in power generation efficiency. In this study, analysis was performed under different initial flow velocity conditions of 1.5m/s, 2.0m/s, and 2.5m/s for a debris filter used in a power plant to understand flow characteristics in CTCS. The flow and differential pressure characteristics of a CTCS with an installed debris filter were considered in a comparative analysis of velocity, pressure, and turbulent kinetic energy distribution. The results confirmed that a vortex was generated in the pipe with the debris filter, apparently due to the collision of the flow with the bracket of the debris filter. As the flow rate increased, the range of the vortex increased, causing a loss in flow.

The provision requirement of 10% openings of the total floor area stated in the Uniform Building by Law 1984 Malaysia has been practiced by designers for building plan submission approval. However, the effectiveness of thermal performance in landed residential buildings, despite the imposition by the by-law, has never been empirically measured and proven. Although terraced houses in Malaysia have dominated 40.9% of the total property transaction in 2019, such mass production with typical designs hardly provides its occupants with thermal comfort due to the static outdoor air condition and lack of external windows, where the conventional ventilation technique does not work well, even for houses with an air well system. Consequently, the occupants need to rely on mechanical cooling, which is a high energy-consuming component contributing to outdoor heat dissipation and therefore urban heat island effect. Thus, encouraging more effective natural ventilation to eliminate excessive heat from the indoor environment is critical. Since most of the research focuses on simulation modelling lacking sufficient empirical validation, this paper drawing on field measurement investigates natural ventilation performance in terraced housing with an air well system. More importantly, the key concern as to what extent the current air well system serving as a ventilator is effective to provide better thermal performance in the single storey terraced house is to be addressed. By adopting an existing single storey air welled terrace house, the existing indoor environmental conditions and thermal performance were monitored and measured using scientific equipment, namely HOBO U12 air temperature and air humidity, the HOBO U12 anemometer and the Delta Ohm HD32.3 Wet Bulb Globe Temperature meter for a six-month duration. The findings show that the air temperature of the air well ranged from 27.48°C to 30.92°C, while the mean relative humidity were from 72.67% to 79.25%. The mean air temperature for a test room (single sided ventilation room) ranged from 28.04°C to 30.92°C with a relative humidity of 70.16% to 76%. These empirical findings are of importance, offering novel policy insights and suggestions to potentially revising the existing building code standard and by laws; since the minimum provision of 10% openings has been revealed to be less effective to provide a desired thermal performance and comfort, mandatory compliance with, and the necessity for, the bylaw requirement should be revisited and further studied.

This study was to identify clinical cancer biomarkers for recurrent gastric cancer survivors using artificial intel-ligence. From a hospital-based cancer registry database in Taiwan, the datasets of the incidence of recurrence and clinical risk features were included in 2476 gastric cancer survivors. We benchmarked Random forest with MLP, C4.5, AdaBoost, and Bagging algorithms on metrics and leveraged synthetic minority oversampling technique (SMOTE) for imbalanced dataset issues, cost-sensitive learning for risk assessment, and SHapley Additive ex-Planations (SHAP) for feature importance analysis in this study. Our proposed Random forest outperformed the other models with an accuracy of 87.9%, a recall rate of 90.5%, an accuracy rate of 86% and F1 of 88.2% on re-current category by a 10-fold cross-validation in a balanced dataset. We identified clinical features of recurrent gastric cancer, which are the top five features, stage, number of regional lymph node involvement, Helicobacter pylori, BMI(body mass index), and gender, which significantly affect the prediction model's output, are worth paying attention to in the following causal effect analysis. Using an artificial intelligence model, the risk factors for recurrent gastric cancer could be identified and cost-effectively ranked according to their feature importance. In addition, they should be crucial clinical features to provide physicians with the knowledge to screen high-risk patients in gastric cancer survivors as well.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

Mutations in the SACS gene are associated with autosomal recessive spastic ataxia of Charlevoix-Saguenay disease (ARSACS) or complex clinical phenotypes of Charcot-Marie-Tooth disease (CMT). This study aimed to identify SACS mutations in a Korean CMT cohort with cerebellar ataxia and spasticity. As a result, eight pathogenic SACS mutations in four families were identified as the underlying causes of these complex phenotypes. The prevalence of CMT families with SACS mutations was determined to be 0.3%. All the patients showed sensory, motor, and gait disturbances with increased deep tendon reflexes. Lower limb magnetic resonance imaging (MRI) was done in four patients, and all had fatty replacements. Of note, they all had similar fatty infiltrations between the proximal and distal lower limb muscles, different from the neuromuscular imaging feature in most CMT patients without SACS mutations who had distal dominant fatty involvement. Therefore, these findings were considered a characteristic feature in CMT patients with SACS mutations. Although further studies with more cases are needed, our results highlight lower extremity MRI findings in CMT patients with SACS mutations and broaden the clinical spectrum. We suggest screening for SACS in recessive CMT patients with complex phenotypes of ataxia and spasticity.

Reactions of Co(OAc)24H2O, N‚N'-bis(3-pyridylmethyl)oxalamide (L) and 4,4’-sulfonyldibenzoic acid (H2SDA) afforded four coordination polymers with the same mixed ligands, {[Co(L)(SDA)(H2O)2]·H2O·CH3OH}n, 1, {[Co(L)0.5(SDA)]·2H2O·0.5L}n, 2, {[Co(L)1.5(SDA)(H2O)]·H2O}n, 3, and {[Co2(L)1.5(SDA)2(H2O)2]·4H2O}n, 4, which have been structurally characterized by using single crystal X-ray crystallography. Complexes 1 – 4 are 2D layers, revealing the topologies of sql, 2,6L1, (4,4)Ia and 6L12, respectively, and demonstrating that the metal to ligand ratio, solvent system and reaction temperature are important in determining the structural diversity. Immersion of these complexes into various solvents show that the structural types govern the chemical stabilities of 1 – 4. Reversible structural transformation can be shown for complexes 1 and 2 upon solvent removal and adsorption, while those of 3 and 4 are irreversible.

The Epithelial-Mesenchymal-Transition (EMT) phenotype, identified as a significant clinical indicator in cancer, manifests as a biological process where cells transition from epithelial to mesenchymal characteristics. Physiologically, EMT plays a crucial role in tissue remodeling, promoting healing, repair, and responding to various tissue damages. This study investigates the impact of BNE-RRC on oral cancer cells (KB) and reveals its significant effects on cancer cell growth, migration, invasion, and EMT. BNE-RRC induces the epithelial-like morphology in KB cells, effectively reversing EMT to Mesenchymal-Epithelial Transition (MET). Extraordinarily, sustained culture of cancer cells with BNE-RRC for 14 days maintains an epithelial status even after treatment withdrawal, suggesting BNE-RRC as a potential therapeutic agent for cancer. These findings highligh the promise of BNE-RRC as a comprehensive therapeutic agent in cancer treatment by inhibiting cancer cell growth, migration, and invasion, while also orchestrating a reversal of the EMT process. The study proposes that BNE-RRC could be effective agent for cancer treatment.

In patients with unilateral tinnitus with normal hearing, several studies have compared the ipsilateral and contralateral ears; however, few studies have investigated its relationship with the duration of tinnitus. We compared the auditory brainstem response and otoacoustic emission parameters between ipsilateral and contralateral ears in adults with unilateral tinnitus and normal hearing. This retrospective review included 84 patients with unilateral tinnitus and normal hearing who underwent auditory brainstem response and otoacoustic emission; they were categorized according to the duration of tinnitus. The latencies and amplitudes of waves I, III, and V, and V/I ratio of both ears in auditory brainstem response, and the results of distortion-product otoacoustic emission and transient evoked otoacoustic emission were examined. The auditory brainstem response parameters, distortion-product otoacoustic emission parameters, and transient evoked otoacoustic emission parameters between the ipsilateral and contralateral ears along the duration of tinnitus were analyzed. Moreover, the failure rates of both distortion-product otoacoustic emission and transient evoked otoacoustic emission between the ears along with the duration and the effects of the variables on the amplitude and latency of each wave were examined. Although there was little significant difference between the ipsilateral and contralateral ears, laterality seemed to have an effect on wave I latency in the multiple linear regression analysis. The distortion-product otoacoustic emission failure rate of the ipsilateral ear was higher than that of the contralateral ear in all patients. However, there was no remarkable difference between the ears in the distortion-product otoacoustic emission and transient evoked otoacoustic emission parameters throughout the duration. We found that outer hair cells and the distal portion of the cochlear nerve are possible pathologic lesions in tinnitus with normal hearing and cochlear synaptopathy could be suspected. Further studies, including those on inner hair cells and higher central cortex, are needed.

Land use and cover change (LUCC) is an important method to investigate the causes of global environment change. We utilized the emergy ecological footprint (EEF) model to construct a land-use change model to be used as a systematic measuring tool for monitoring sustainable development trends. In particular, we estimated the eco-security of the Cing-jing region as a case study so that responsible agencies can use it to maintain a balance between ecological preservation and tourism development. The results indicated the following: First, the ecological environment of the Cing-jing region satisfied the safety standard in 2008–2014; however, the related indices increased considerably. Second, the grey model predicted a decrease in 2015–2024 ecological carrying capacities of Cing-jing and a large increase in capita EFs, resulting in a larger ecological deficit and higher EFI. The eco-security from 2015–2024 was higher compared to 7 years ago and is predicted to reach the Grade 2 intermediate level in 2022; thus the Cing-jing region is gradually becoming ecologically unsustainable. Strengths of our study included the use of EEF theory in a quantitative analysis of slope lands for the effective evaluation of ecological security. Finally, we expanded our research to include ecological security issues.

Antibiotic beads were used to treat surgical infections. In this study, polylactide–polyglycolide (PLGA) was mixed with vancomycin, osteogenic enhancer lithium chloride (LiCl), and hot com-pressing to form PLGA-vancomycin-LiCl delivery beads to treat bone infection. An elution method was employed to characterize the in vitro release characteristics of the vancomycin and the Li over a 42-day period. The released profiles lasted for more than 42 days for vancomycin and 28 days for Li. The concentration of vancomycin in each sample was well above the breakpoint sensitivity. Lithium co-treatment enhanced the bactericidal effect of vancomycin. Released Li and vancomycin increased mRNA or protein expressions of osteogenic markers of mesenchymal stem cells (MSCs). In vivo, the PLGA delivery systems were implanted into the rabbit distal femoral cavities and the cavity fluid content was aspirated and analyzed at each time point. The released Li and vancomycin lasted more than 6 weeks, and vancomycin concentrations were much above the breakpoint sensitivity. Four rabbits in each group were killed at 8 weeks for histologic observation. More mature bone tissue was shown in the Li treatment group. This study provides a PLGA drug delivery system to meet the requirements of patients with bone infections.

: In the realm of data management, data preservation stands as a critical undertaking aimed at preserving and upholding the integrity of data. Regardless of whether it concerns personal or enterprise data, the detrimental effects of malicious alterations implemented by attackers cannot be overlooked. Particularly in conventional industrial control environments, the prevalent practice involves the transmission of data from sensors to databases for storage purposes. However, it is essential to recognize that this process exposes the data to various vulnerabilities. Thus, to ensure the long-term security and reliability of the data, it becomes imperative to implement robust data preservation strategies within these industrial control systems. However, the reliance of these databases on physical hard disks introduces inherent vulnerabilities, including the potential for data loss due to disk damage or targeted malicious attacks. Consequently, it becomes imperative to prioritize the implementation of robust data preservation measures. These measures are crucial in mitigating the risk of disruptions and protecting critical data from compromise. By establishing effective data backup systems, employing advanced security protocols, and implementing proactive monitoring mechanisms, organizations can bolster their data preservation capabilities and safeguard against potential threats to data integrity and availability. As a result, many enterprises opt to store their data with third-party providers to ensure data integrity. However, this approach carries inherent risks. If the third-party service experiences an attack or if the data is tampered with, it becomes challenging to verify the integrity of the data. To address these concerns and ensure data preservation within the context of the Internet of Things (IoT), a growing number of individuals are integrating IoT with Distributed Ledger Technology (DLT). By leveraging DLT, the integrity of data can be ensured, reducing reliance on centralized third-party storage and enhancing security in the IoT ecosystem. In this article, IOTA is the DLT, which employs Directed Acyclic Graph (DAG) to store transaction information. Compared to Ethereum or other blockchain technologies, IOTA offers notable advantages in terms of transaction verification speed, making it highly suitable for real-time IoT environments. However, the conventional transmission path from sensors to IOTA nodes entails a complex route, involving multiple hardware devices before reaching the intended destination. This complexity poses challenges in ensuring data integrity during transmission and introduces vulnerabilities such as man-in-the-middle attacks or SQL injection attacks. To address these issues, we propose a method to streamline the transmission path between sensors and IOTA, specifically tailored for industrial fields with numerous IoT devices. Our approach involves preprocessing the data stored on the server using our method before uploading, ensuring data confidentiality, and leveraging IOTA to guarantee data integrity. To achieve the shortest path between IoT and DLT nodes, it becomes necessary to establish IOTA nodes on lower-level devices, such as Raspberry Pi or IoT controllers. By simplifying the transmission path, we can reduce the potential for tampering and enhance overall data security. Implementing our proposed method enables the assurance of data confidentiality and integrity during both transmission and storage on the server, strengthening the trustworthiness of the IoT, and IOTA integration.

Objectives: To assess clinical implications of increased nuchal translucency (INT) in twin pregnancies based on the chorionicity. Methods: This was a retrospective review of the twin pregnancies who underwent first trimester ultrasound with nuchal translucency (NT) measurement at 11-13 weeks of gestation from January 2006 to December 2014. Data were collected using the OB database and the chart review. Pregnancy outcomes including gestational weeks at the delivery, abnormal fetal karyotypes, fetal structural anomalies, twin specific complications were analyzed. Results: A total of 1,622 twin pregnancies with INT≥95th percentile in one or both fetuses were identified. In all twin pregnancies with INT, abnormal fetal karyotypes were identified in 17 (8.6%) patients (odds ratio=13.28, CI=5.990-29.447, P=0.000) and twin-specific complications were identified in 23 (11.6%) patients (odds ratio=2.398, CI=1.463-3.928, P=0.001) compared to those with normal NT. Among the INT group, when the groups were subdivided into monochorionic (MC) and dichorionic (DC) pregnancies, 14.8% and 29.6% of the MC pregnancies had structural anomalies in one or both fetuses (odds ratio=5.774, 95% CI=1.445-23.071, P=0.01) and twin-specific complications (odds ratio=4.379, 95% CI=1.641-11.684, P=0.03), respectively, compared to DC pregnancies. The prevalence of abnormal fetal karyotypes was not statistically different in patients with INT when compared between MC and DC pregnancies (P=0.329). Conclusions: INT was associated with a higher rate of twin-specific complications and fetal structural anomalies in MC twin pregnancies rather than abnormal fetal karyotype. Therefore, NT measurement in MC twin pregnancies can be a useful tool for prediction of adverse pregnancy outcomes. Appropriate counseling and surveillance based on the chorionicity is imperative in prenatal care of twin pregnancies.

This research aims to understand the Cambodian green economy transition and analyze its strengths, weaknesses, opportunities, and threats (SWOT). The research showed that Cambodia has been significantly transitioning its green economy since 2009 as evidenced by the National Green Growth Roadmap. Cambodia also established the National Council for Green Growth in 2012 and upgraded it to the National Council for Sustainable Development in 2015 in alignment with 2030 Agenda for Sustainable Development of the United Nations. The members of the Council are from all the government’s ministries and relevant inter-ministerial councils/committees, which are significant for policymaking. All governors of the capital and provincial administrations are also its members, which are significant for supporting and implementing the works at the subnational levels. Under the structure of the Council’s Secretariat, Department of Green Economy is playing an important role in promoting green economic development in Cambodia by looking at national policies and strategic plans, undertaking projects, and mobilizing resources. Through coordination between this Department and UNIDO, Cambodia in 2022 became a Member of the United Nations Partnership for Action on Green Economy. The findings showed that Cambodia is transitioning its green economy at the right time, especially the new government’s Pentagonal Strategy strongly supported this green economy transition with a clear and strong political commitment. The national inter-ministerial council for sustainable development is also very significant for cross sectoral policy-making and implementing levels, inclusively for promoting green economic development.

From 2008 to 2024, the Newborn Screening Translational Research Network (NBSTRN), part of the National Institute of Child Health and Human Development (NICHD) Hunter Kelly Newborn Screening Program, served as a robust infrastructure to facilitate groundbreaking research in newborn screening (NBS), rare disease, and genomics. Over fifteen years, NBSTRN developed into a significant international network, supporting innovative research on novel technologies to screen, diagnose, treat, manage, and understand the natural history of more than 280 rare diseases. A key component of these efforts has been the development of resources and expertise for the newborn screening community in ethical, legal, and social issues (ELSI). This paper presents findings from a survey conducted by the NBSTRN team with input from one of theNBSTRN's expert workgroups, the Bioethics and Legal Workgroup. With responses from 88 members of the NBS community including researchers and state NBS programs, the survey found that individuals rely on internal and collegial ELSI resources and highlighted a substantial demand for structured, accessible training and resources. The survey’s insights emphasize the importance of privacy and informed consent in NBS research, and suggested a need for improved collaborative tools and educational programs focused on ELSI for the NBS community. The survey results may inform future efforts in ELSI and NBS research including the development of expanded ELSI tools that leverage digital platforms and consultative services.

In order to reduce the large damage caused by train derailment, protective facilities of various shapes and conditions can be installed on railroad tracks. These protective facilities are referred to as derailment containment provisions (DCPs) and three different types are used worldwide. However, there are no clear standards for DCPs design such as installation location, size, and design load, and performance verification of DCPs installed in the actual railway field is not sufficiently performed. In this paper, the functionality of DCPs is analyzed through the full-scale derailment test. In order to propose a method for estimating the collision load acting on the DCP type I after derailment, the experimental results and simulation results are compared. The function of DCP type I according to the change of the vehicle's center of gravity is identified through comparative analysis of the post derailment behavior.

This study was conducted to improve the white index (WI) by preparing thermally expandable microspheres (TEMs) for wallpaper. The thermal properties, foam expansion ratio and WI were studied depending on the particle size of colloidal silica in the preparation of TEMs. As a result, the TEMs with small particles of colloidal silica showed the best results for whiteness and yellowing. Additionally, TGA results indicated that it was highly possible that colloidal silica with small particle sizes was physically or chemically attached to the surface of the TEMs that led to an improvement in whiteness at high temperatures.

Buildings can generate heats which are mostly generated from the machinery using inside the buildings, and these heats generally released to the atmosphere. Buildings can also block the wind flow by their canopies and trap the heat by using low albedo materials. These causes pointedly contribute to urban heat island and greenhouse effects. Likewise, urban development and building construction in Cambodia are growing rapidly. The construction has been recognized as a key development sector while thousands of buildings are being built and have been operated in the main cities. However, those buildings mostly have not been considered to incorporate sustainability concepts while the major final energy consumers in the country are buildings. The buildings’ energy consumption is also projected to increase more than double until 2040. Hence, sustainable building promotion in Cambodia is necessary, and sustainable building criteria are completely required. This research aims to find out significant sustainable building criteria for Cambodia and focused on planning and design criteria because having proper planning and design is a smart start leading to achieving building sustainability in all stages. This research used the Delphi methods to validate the relevant sustainable building criteria available in the literature and then select the significant ones for Cambodia based on the Delphi consensus. The results showed that ninety-nine consensus planning and design criteria were found to be significant for sustainable buildings in Cambodia.

Tenascin C (TNC) is an element of the extracellular matrix (ECM) of various tissues, including the skin, and is involved in modulating ECM integrity and cell physiology. Although skin aging is apparently associated with changes in the ECM, little is known about the role of TNC in skin aging. Here we found that Tnc mRNA level was significantly reduced in the skin tissues of aged mice compared with young mice, consistent with reduced TNC protein expression in aged human skin. TNC-large (TNC-L; 330-kDa) and -small (TNC-S; 240-kDa) polypeptides were observed in conditional media from primary dermal fibroblasts. Both recombinant TNC polypeptides, corresponding to TNC-L and TNC-S, increased the expression of type I collagen and reduced the expression of matrix metalloproteinase-1 in fibroblasts. Treatment of fibroblasts with a recombinant TNC polypeptide, corresponding to TNC-L, induced phosphorylation of SMAD2 and SMAD3. TNC increased the level of TGF-β1 mRNA and upregulated the expression of type I collagen by activating the TGF-β signaling pathway. In addition, TNC also promoted the expression of type I collagen in fibroblasts embedded in a three-dimensional collagen matrix. Our findings suggest that TNC contributes to the integrity of ECM in young skin and to prevention of skin aging.

Background: This study delves into the examination of racial and ethnic disparities in the distribution of the Monkeypox (MPOX) virus vaccine within the United States, offering a critical healthcare perspective on an emerging public health concern. It particularly focuses on the demographic patterns associated with MPOX transmission and the allocation of vaccines. Methods: A comprehensive analysis was conducted, drawing on a wide array of data sources to understand the vaccine distribution and demographic trends in the United States. The study scrutinized three main aspects: MPOX cases by race and ethnicity, vaccine administration across different racial and gender categories, and the potential disparities therein. Results: The findings reveal significant disparities in the distribution of vaccine doses, with males, particularly gay, bisexual, and other Men who have sex with men (MSM), receiving the majority of doses. Moreover, substantial variations in MPOX cases are observed among different racial and ethnic groups, emphasizing the need for culturally sensitive public health strategies. Conclusions: The study underscores the urgent need for targeted public health interventions to address disparities and safeguard the well-being of those at higher risk, particularly MSM. It highlights the importance of equity in vaccine distribution and culturally sensitive approaches, and serves as a foundation for shaping effective public health policies and strategies to mitigate the spread of MPOX. This research advances our understanding of healthcare disparities in the context of an emerging viral infection, providing valuable insights for future public health initiatives.

Red djulis (Chenopodium formosanum) is a native cereal plant in Taiwan; it contains abundant polyphenols, betalian and dietary fiber. The appearance of red djulis is bright red. Therefore, it is also called the “ruby of cereals”. The antioxidative activity of red djulis extract is well-understood. However, the antiaging function still remains unclear. This study examined the potential of red djulis extract for enhancing collagen secretion and preventing cutaneous aging using red djulis extracts. The red djulis extracts are comprised of an abundant active component that can effectively enhance the ability of collagen secretion of dermal fibroblasts, prevent the glycation of collagen and resist the damage of ultraviolet light exposure. After fibroblast treatment with red djulis extracts, TGM1, KRT1, KRT10 and SOD2 genes were up-regulated significantly by 2.3, 4.3, 4.4 and 27.3 times, respectively, compared to those of the control group. Additionally, it can increase COL1A2 gene expression by 43% and decrease MMP9 gene expression 33%. Therefore, it was demonstrated that red djulis extracts affect gene expressions related to the skin barrier, antioxidation and collagen. Moreover, we found positive effects on skin barrier integrity, endogenous antioxidant activity and skin collagen-preservation. The preparation of the red djulis extracts is environmental friendly and can promote the economic value of Chenopodium formosanum; thus, the proposed extract is suitable for applications in the development of food products, especially beverages, skin care and cosmetic products.

Host immunological pathways have been proposed including TH1, TH2, TH3, TH9, TH17, TH22, TH1-like, and THαβ immune reactions. Besides TH2 and TH9 immune responses which are against multicellular parasites, host immunological pathways against viruses, intracellular micro-organisms (bacteria, protozoa, and fungi), and extracellular micro-organisms can use programmed cell death pathways to trigger immune reactions or to execute effective strategies to eliminate these pathogens. These programmed cell deaths include apoptosis, autophagic death, pyroptosis, ferroptosis, necroptosis, and NETosis. Apoptosis is related to host anti-virus eradicable THαβ immunity. Autophagic death is related to host anti-virus tolerable TH3 immunity. Pyroptosis is related to host anti-intracellular micro-organism eradicable TH1 immunity. Ferroptosis is related to host anti-intracellular micro-organism tolerable TH1-like immunity. Necroptosis is related to host anti-extracellular micro-organism eradicable TH22 immunity. NETosis is related to host anti-extracellular micro-organism tolerable TH17 immunity.

This study aimed to elucidate the antibacterial efficacy and unique chemical compositions generated from plasma-activated water (PAW) when utilized a novel vaginal cleansing device. We conducted an analysis of antibacterial activity against probiotics and several chemical compositions including ions under various operational parameters of PAW, including electrical power (12 and 24 V), treatment duration (1, 10, and 20 min), and stay duration (immediate, 30 and 60 min). Our findings revealed that as treatment duration increased, hypochlorous acid (HOCl), Ca2+, and Mg2+ concentrations increased and Cl−concentrations decreased. Higher electrical power and longer treatment duration resulted in increased HOCl levels, which acts to prevent the growth of general microorganisms. Notably, PAW exhibited no antibacterial effects against a type of probiotic, Lactobacillus reuteri that produces lactic acid for vaginal health. This result demonstrated the ability of the vaginal cleaning device to generate ions, primarily HOCl and some cations (Ca2+ and Mg2+), thereby providing vaginal mucosa protecting and cleansing effects with the vaginal environment.

An outbreak of occupational methanol poisoning occurred in small-scale 3rd tier factories of large-scale smartphone manufacturer, in the Republic of Korea, in 2016. To investigate the working environment and the health effect of the methanol exposure among co-workers of the methanol poisoning cases, we performed a cross sectional study on 155 workers at the five aluminum CNC cutting factories. Air and urinary methanol concentration were measured by gas chromatography, and health examination included symptoms, ophthalmological examinations and neurobehavioral tests. Multiple logistic regression analyses controlled for age and sex were conducted for revealing association of employment duration with symptoms. Air concentrations of methanol in factory A and E were ranged from 228.5 to 2220.0 ppm. Mean urinary methanol concentrations of the workers in each factory were from 3.5 mg/L up to 91.2 mg/L. The odds ratios for symptom of deteriorating vision and CNS increased, according to the employment duration, after adjusting for age and sex. Four cases with injured optic nerve and two cases with decreased neurobehavioral function were founded among co-workers of the victims. This study showed that the methanol exposure under poor environmental control not only produce eye and CNS symptoms but also affect neurobehavioral function and optic nerve.

This research studies the impact of shopping tourism on retail sales and rents, using the Covid-19 pandemic as a quasi-experiment. Shopping tourism refers to individuals who travel primarily for shopping purposes, and their spending patterns can have significant effects on the retail sector. The Covid-19 pandemic disrupted global travel and resulted in a decline in shopping tourist arrivals, leading to a downturn in sales for retailers dependent on shopping tourism. Additionally, the decline in shopping tourism affected retail rents, as the reduced demand for retail spaces posed challenges for property owners in attracting tenants. The study focuses on Hong Kong, a prominent shopping destination, which experienced a significant decline in tourist arrivals and retail sales during the pandemic. The research analyzes the relationship between tourist arrivals, retail sales, and rents using time series analysis and identifies the impact of shopping tourism on retail spaces and rents. The findings suggest a positive association between tourist arrivals and retail sales, particularly during the period of shopping tourism growth. However, the pandemic severely reduced this effect, revealing the impact of shopping tourists on the retail sector. The study concludes by discussing the implications on retail resilience and highlighting the need for further research on the impacts of shopping tourists on retail sales and rents.

Background The purpose of this study was to evaluate the prevalence of velamentous cord insertion (VCI) and the actual association between pathologically confirmed VCI and perinatal outcomes in twins based on the chorionicity. Methods All twin pregnancies who received prenatal care at a specialty clinic for multiple pregnancies, from less than 12weeks of gestation until delivery in a single institution between 2015 and 2018 were included in this retrospective cohort study. Results A total of the 941 twins were included in the study. The prevalence of VCI in dichorionic (DC) twins and monochorionic diamniotic (MCDA) twins was 5.8% and 7.8%, respectively (p=0.251). In all study population, the prevalence of vasa previa and placenta accreta were higher in VCI group compared to that of non-VCI group (p=0.008 and 0.022). In MCDA twins with VCI, birth weight, 1 and 5-minute Apgar score were lower compared to DC twins with VCI (p=0.010, 0.002 and 0.000). There was no significant association between VCI and selective fetal growth restriction (p=0.708), twin-to-twin transfusion syndrome (p=0.400) and birth-weight discordance (>20% and >25%) (p= 0.378 and 0.161) in MCDA twins. Conclusion VCI in twins was not a risk factor for adverse perinatal outcomes and twin-specific complications.

Regulatory T cells are key immune cells to initiate tolerable immune responses. TGFβ is the key cytokine of regulatory T cells. TGFβ is also the master cytokine to stimulate tissue fibrosis. Systemic sclerosis is an autoimmune disease related to overt organ fibrosis. Thus, systemic sclerosis is a disease related to regulatory T cell over-representation. Besides, many end stage organ failures including heart failure, liver cirrhosis, uremia, and pulmonary fibrosis also related to tissue fibrosis. Thus, TGFβ producing regulatory T cells are also involved in the pathogenesis of these end stage organ failure. Once we know the significance of TGFβ and it induced tolerable immune reactions in the pathophysiology of end organ failure, we can develop better prevention or therapeutic strategies to combat these detrimental disorders.

In previous researches, Job Crafting questionnaire to develop is consists of 3 factors which are Task Crafting, Cognitive Crafting, and Relationship Crafting with 12 to 17 items. The purpose of study is to develop JCQ for leisure sports instructor of Korean. 274 valid samples are used for analysis. Data collecting is purposeful sampling. At result, for Korean Sports Instructor Job Crafting Scale is constructed 3 factors with 12 items is constructed by 3 step procedure. KSIJCQ is confirmed on convergent discriminant validity evidence. In conclusion, KSIJCQ is a valid scale of the measuring and distributes Job Crafting of generalization in sports.

Bat feces were reported in ancient Chinese medicine books to have the effect of reducing heat and improving eyesight, but the mechanism of vision improvement still needs further research. To this end, we used 2,2-diphenyl-1-picrylhydrazyl (DPPH) and liquid chromatography/tandem mass spectrometry (LC/MS/MS) to analyze the antioxidant capacity of and the types of vitamins in bat feces. We hoped to screen the pharmacological components of bat feces, and to explain the role that these components may play in the treatment of visual deterioration. Our results found that bat feces had a good antioxidant capacity and mainly contain vitamins B1 (thiamine), B2 (riboflavin), B3 (nicotinamide), B3 (nicotinic acid), and B5 (pantothenic acid). Although these vitamins may help maintain the health of the optic nerve and cornea, the vitamin content of bat feces is low, but the heavy metal content is high, as shown using inductively coupled plasma mass spectrometry (ICP-MS) analysis. Therefore, we suggest that the use of bat feces as traditional Chinese medicine to improve vision should be strictly restricted.

The mechanism of immune activation and de-activation is very important. Host should trigger effective immunity against pathogen infection. And, host cannot trigger immunity against self-antigens that will lead to detrimental autoimmune disorders. Spleen and liver have opposite roles in mediating immune responses. Spleen is the organ involving in immune activation, and liver is the organ involving in immune de-activation. Sympathetic nerve system and parasympathetic nerve system have opposite roles in mediating immune responses. Sympathetic nerve system is involving in pro-inflammatory, and parasympathetic nerve system is involving in anti-inflammatory. ACTH and glucocorticosteroid have opposite roles in mediating immune responses. ACTH is involving in activating adaptive immunity with inhibiting innate immunity, and glucocorticosteroid is involving in activating innate immunity with inhibiting adaptive immunity. The molecular chaperons, heat shock proteins, which are induced by fever, have the vital roles in immune activation. On the contrary, IgD B cells and gamma-delta T cells are causing immune de-activation via the mechanism of clonal anergy. These mechanism can help us the know the work of immunological pathways better for better control of infectious diseases and autoimmune disorders.

Blockchain technology (BCT) has the potential for sustainable development, enhancing business efficiency, reducing costs, and strengthening data security. Despite its potential, adoption among small and medium-sized enterprises (SMEs) is low due to the need for significant changes in technology infrastructure and the challenge of interoperability. A cross-sectional survey was done with 226 Hong Kong SMEs. The PLS-SEM results highlighted favorable transformation conditions as the most critical factor for SMEs considering the adoption of BCT. These conditions address both internal and external readiness for adopting the disruptive strategy. Other contributing factors to BCT adoption include trust in BCT developers, perceived usefulness and ease of use, government support, and perceived security. The research results contributed to the literature on disruptive technology acceptance, adoption, transformation conditions, technology readiness, and SMEs’ technology adoption. Government-supported policies and initiatives can promote BCT adoption, including educational programs, case studies, and resources for readiness. Financial support and regulatory frameworks can further encourage adoption. BCT developers can demonstrate the value of their systems, effectively communicate potential ROI and cost savings, and provide user-friendly interfaces to increase SMEs’ intention to adopt BCT.

Mosquito-borne diseases (MBDs) are a group of illnesses transmitted by mosquitoes and can be caused by bacteria, viruses, or parasites. These diseases represent a significant global burden of infectious diseases, including morbidity and mortality. This systematic review delves into the multifaceted factors contributing to the spread of mosquito-borne diseases (MBDs) in the Middle East and North Africa (MENA) region. Following PRISMA guidelines, a thorough analysis of peer-reviewed articles from May 1990 to Jan 2023 was conducted, highlighting the interplay of population, environmental, disease, and mosquito factors in disease transmission and prevalence. The review incorporated 31 studies that revealed a complex relationship between various risk factors and the presence of MBDs. Significant associations were observed with age, certain occupations, environmental conditions such as rainfall and temperature, sanitation practices, specific pathogen variants, clinical symptoms, and Aedes aegypti mosquitoes. Conversely, gender, socioeconomic status, educational status, and certain sanitation-related factors showed inconsistent association with the spread of MBDs. The review underscores the need for targeted interventions, including vector control, improved sanitation, and educational campaigns to mitigate the spread of MBDs in the MENA region. This review could guide research studies to address data gaps and assist in developing effective surveillance programs in the MENA region. This work emphasizes the need for region-specific public health strategies and further research to understand and curb the burden of these diseases effectively.

After Frankland first synthesized organotin compounds for the first time in 1849, their broad range of applications, including in industry and agriculture, resulted in a substantial increase in demand for organotin (IV) compounds after the 1940s. Because of the broad range of coordination numbers and molecular geometry that could result in numerous features, the structural diversity of organotin (IV) compounds is of great interest. Organotin (IV) dithiocarbamate has recently received attention as a therapeutic agent among organotin (IV) compounds. The hybrid complex individual properties of organotin (IV) and the dithiocarbamate moieties form a synergy of action stimulating increased biological activity. Organotin (IV) components have been shown in cytotoxicity studies to play a crucial role in cytotoxicity. Ligands serve to target and react to molecules while preventing unwanted changes in biomolecules. Organotin (IV) dithiocarbamate compounds have also been discovered to exhibit a broad range of cellular, biochemical, and molecular effects, with their toxicity largely determined by their structure. This review discusses the potential cytotoxicity effect of organotin(IV) dithiocarbamate, as well as its synthesis, elemental and spectroscopy analysis.

This paper addresses a mode-dependent state-feedback H∞ control for descriptor hybrid systems, considering both the absence and presence of actuator saturation. Firstly, the necessary and sufficient conditions for the stochastic admissibility criterion with H∞ performance ? of the closed-loop system is proposed. Given the proposed non-convex condition, the author reformulates it into linear matrix inequalities (LMIs). Then, to extend the result to the systems with actuator saturation, the actuator saturated control input is expressed as a linear combination of given state-feedback control input and a virtual control input that remains under the saturation level. To verify this expression, the set invariant condition is also suggested by using the singular mode-dependent Lyapunov function candidate. Therefore, the LMI conditions for the existence of the mode-dependent state-feedback H∞ control and the ellipsoidal shape of invariant set are successfully derived. Two numerical examples demonstrate the effectiveness of the proposed approach in optimizing H∞ performance $\gamma$ and identifying the largest invariant set.

Purpose The COVID-19 pandemic, triggered by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has resulted in over 160 million infections and 3.5 million fatalities worldwide. Evidence of SARS-CoV-2 presence in the highly vascularized penile tissue and the established correlation between COVID-19 and subsequent erectile dysfunction (ED) has emerged. Robot-assisted radical prostatectomy (RARP) is a popular procedure for prostate cancer because of its reliability and swift recovery rate. However, the ED prevalence post-surgery is believed to be comparable to open surgery, and postoperative ED significantly affects the patient's quality of life. Our study aimed to explore the effect of COVID-19 on ED recovery in patients undergoing bilateral nerve preservation during RARP. Materials and Methods We conducted a retrospective study on 85 patients who underwent bilateral nerve-sparing RARP (nsRARP) at our institution between December 2017 and May 2021. Chart reviews and the International Index of Erectile Function-5 (IIEF-5) questionnaire facilitated the analysis. Our objective was to contrast ED recovery after surgery between SARS-CoV-2–infected and non-infected patients using preoperative IIEF-5 scores and scores at 6, 12, and 24 months post-surgery. We defined successful ED recovery as an IIEF-5 score of 17 or higher and successful sexual intercourse. We also compared ED recovery rates between the two groups, regardless of the timing of COVID-19 diagnosis. IBM's SPSS version 18.0 assisted in the statistical analysis, with Fisher's exact test and chi-square test used for comparing categorical variables. Independent t-tests determined mean differences between baseline and postoperative IIEF-5 scores. A p-value less than 0.05 was considered statistically significant. Results From December 2017 to May 2021, our institution executed 213 RARP cases, with 185 of these involving nerve preservation. Among these patients, 133 had an IIEF-5 score of 17 or higher during preoperative EF assessment. We included 85 patients with consistent IIEF-5 records before surgery and at 6, 12, and 24 months post-surgery in this study. Of these, 44 and 41 patients comprised the COVID-19–positive and COVID-19–negative groups, respectively. The COVID-19–positive group had a higher proportion of diabetes mellitus (DM) patients (24 (54.55%) vs. 7 (17.07%), p<0.001). There was no significant difference in preoperative IIEF-5 scores or scores up to 6 months after surgery between the two groups. However, the IIEF-5 scores of the COVID-19–positive group were statistically lower after 12 and 24 months post-surgery. Additionally, the COVID-19–negative group showed a more considerable score increase between 6 and 12 months post-surgery, and the EF recovery rate was lower in the COVID-19–positive group starting from the 12th month after surgery. Within the COVID-19–positive group, no statistically significant difference in IIEF-5 scores was found between single infection and multiple reinfection groups. Conclusions Principal component analysis revealed the impact of COVID-19 on ED recovery in patients who underwent nsRARP. The most substantial changes in IIEF-5 scores occurred between 6 and 12 months. From 12 months onwards, the COVID-19–positive group had significantly lower scores, and fewer patients had IIEF-5 scores above 17. However, the number of COVID-19 diagnoses did not significantly affect the IIEF-5 scores.

Hybrid carbon-silicon, carbon-nitrogen, and carbon-boron clathrates are new classes of Type I carbon-based clathrates that have been identified by first-principles computational methods by substituting atoms on the carbon clathrate framework with Si, N, and/or B atoms. The hybrid framework is further stabilized by embedding appropriate guest atoms within the cavities of the cage structure. Series of hybrid carbon-silicon, carbon-boron, carbon-nitrogen, and carbon-silicon-nitrogen clathrates have been shown to exhibit small positive values of the energy of formation, indicating that they may be metastable compounds and amenable to fabrication. In this overview article, the energy of formation, elastic properties, and electronic properties of selected hybrid carbon-based clathrates are summarized. Theoretical calculations that explore the potential applications of hybrid carbon-based clathrates as energy storage materials, electronic materials, or hard materials are presented. The computational results identify compositions of hybrid carbon-silicon and carbon-nitrogen clathrates that may be considered candidate materials for use as either electrode materials for Li-ion batteries or as hydrogen storage materials. Prior processing routes for fabricating selected hybrid carbon-based clathrates are highlighted and difficulties encountered are discussed.

In situ aircraft observations in typhoons have been scarce. This paper documents and analyses the aircraft and dropsonde data collected in Super Typhoon Saola (2023) over the northern part of the South China Sea. The wind and turbulence structures of the typhoon are investigated. The turbulence intensities are quantified in terms of turbulent kinetic energy (TKE) and eddy dissipate rate (EDR), and these data are compared with other available estimates of turbulence intensities, such as those based on weather radars, meteorological satellites, and numerical weather predic-tion (NWP) models. It is found that the TKE and EDR are closely correlated, and they are con-sistent with the weather radar/satellite observations as well as NWP-based outputs. Furthermore, the boundary layer inflow, vertical wind profiles, and atmospheric stability are analysed based on the dropsonde observations. The analysed results would advance the understanding of typhoon structures and offer references for the validation of remote sensing observations and NWP models.

Perilla frutense var. acuta (Lamiaceae) has been used to treat indigestion, asthma, and allergies in traditional medicine. In this study, luteolin 7-O-diglucuronide (1), apigenin 7-O-diglucuronide (2), and rosmarinic acid (3) were isolated from the leaves of P. frutescens var. acuta. Various approaches were performed to investigate the anti-inflammatory activity of the isolated compounds (1-3) and their working mechanisms. In silico docking simulation demonstrated that 1-3 would work as a PPAR-α/δ/γ agonist, and in vitro PPAR-α/δ/γ transcriptional assay showed that the Perilla extract and 3 increased PPAR-α luciferase activity [1.71 and 1.61 times of the control (PPAR-α + PPRE, p < 0.001)]. In the NF-κB luciferase assay, 1 suppressed NF-κB activity the most (56.83 % at 5 µM; 74.96 % at 10 µM; 79.86 % at 50 µM). In addition, 1 and 2 inhibited the mRNA expression of NF-κB target genes, including Il6, Mcp1, and Tnfa, at 50 µM, and 3 suppressed the genes at the mRNA level in a dose-dependent manner. We report that 1 and 2 exert anti-inflammatory effects through NF-κB inhibition, and PPAR-α/NF-κB signaling pathway is related to the anti-inflammatory activity of 3.

Environmental estrogen pollution and estrogen effects on the female reproduction system are well-recognized scientifically. Among the estrogens, 17 β-estradiol is a priority in environmental estrogen pollution, and it is also a major contributor to estrogen which regulates the female reproduction system. 17 β-estradiol is carcinogen and has a tumor promotion effect relating to breast cancer, lung cancer and others. It also affects the psychological well-being such as depression, fatigue and others. Thus, a simple method of detection of 17 β-estradiol will be important for both environmental estrogen pollution and women’s health care. This study demonstrates a simple-use, cost effective 17 β-estradiol biosensor system which can be used for both environment and women’s health care applications. The bio-recognition mechanism is based on the influence of the redox couple, K₃Fe (CN) ₆/K₄Fe (CN) ₆ by the interaction between 17 β-estradiol antigen and its α-receptor (ER- α; α-estrogen antibody). The transduction mechanism is an electrochemical analytical technique, differential pulse voltammetry (DPV). The levels of 17 β-estradiol antigen studied was between 2.25 pg/mL to 2,250 pg/mL, Phosphate buffered saline (PBS), tap water from the Cleveland regional water district, and simulate urine were used as the test media covering the potential application areas for 17 β-estradiol detection. An interference study by testosterone which has a similar chemical structure and molecular weight as those of 17 β-estradiol was carried out, and this 17 β-estradiol biosensor showed excellent specificity without any interference by similar chemicals.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

Abstract: This study estimates consumers’ willingness to pay (WTP) for sustainability turfgrass attributes such as low-input and stress-tolerance attributes, while considering potential trade-off relationships between aesthetic attributes and sustainability attributes. To address our objectives, our study conducts a choice experiment and estimates two mixed logit models. The first model includes low-input, winter kill, and shade-tolerance attributes as predictor variables, and the second model extends the first model by adding interaction terms between aesthetic and sustainability attributes. Another choice experiment is conducted under water policies with various water rate increase and watering restriction scenarios. Results from the mixed logit models show that overall, higher low-input cost reduction, less winter-damaged, and more shade-tolerance grasses are preferred, the direct effect of aesthetic attributes on consumers’ preference is strong, but the indirect effect represented by the interaction terms are generally statistically insignificant. Our results indicate that consumers like to have a pretty lawn, but no strong consideration is given to the aesthetics of their lawn when selecting low-input and stress-tolerance turfgrasses. Our choice experiment under water policy scenarios suggests that water pricing is more effective than watering restriction in increasing consumer demand for water-conserving turfgrasses.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

In this work, we report the electric energy storage properties of (1-x)Bi0.5(Na0.8K0.2)0.5TiO3-xBi0.2Sr0.7TiO3 (BNKT-BST; x = 0.15-0.50) relaxor ferroelectric ceramics enhanced via a domain engineering method. A rhombohedral–tetragonal phase, the formation of highly dynamic PNRs, and a dense microstructure are confirmed from XRD, Raman vibrational spectra, and microscopic investigations. The relative dielectric permittivity (2664 at 1 kHz) and loss factor (0.058) were gradually improved with BST (x=0.45). The incorporation of BST into BNKT can disturb the long-range ferroelectric order, lowering the dielectric maximum temperature Tm and inducing the formation of highly dynamic polar nano-regions. In addition, the Tm shifts toward high temperature with frequency and a diffuse phase transition, indicating relaxor ferroelectric characteristics of BNKT-BST ceramics, which is confirmed by the modified Curie Weiss law (γ=1.83). The rhombohedral–tetragonal phase, fine grain size, and lowered Tm with relaxor properties synergistically contribute to a high recoverable energy density Wrec of 0.81 J/cm3 and a high energy efficiency η of 86.95% at 90 kV/cm for x = 0.45.

Pulmonary arterial hypertension is a rare disease with high mortality despite recent therapeutic advances. The disease is caused by both genetic and environmental factors, and likely gene x environment interactions. While PAH can manifest across the lifespan, pediatric-onset disease is particularly challenging because it is frequently associated with a more severe clinical course and comorbidities including lung/heart developmental anomalies. In light of these differences, it is perhaps not surprising that emerging data from genetic studies of pediatric-onset PAH indicate that the genetic basis is different than that of adults. There is a greater genetic burden in children, with rare genetic factors contributing to at least 36% of pediatric-onset idiopathic PAH (IPAH) compared to ~11% of adult-onset IPAH. De novo variants are frequently associated with PAH in children, and contribute to at least 15% of all pediatric cases. The standard of medical care for pediatric PAH patients is based on extrapolations from adult data. However, the increased etiologic heterogeneity, poorer prognosis and increased genetic burden for pediatric-onset PAH calls for a dedicated pediatric research agenda to improve molecular diagnosis and clinical management. A genomics-first approach will improve the understanding of pediatric PAH and how it is related to other rare pediatric genetic disorders.

Mumps is the second-most reported infectious disease in South Korea; however, due to the low pathogen confirmation rate in laboratory diagnoses, we proposed a method for reevaluating the high incidence rate via the laboratory verification of other viral diseases. In 2021, 63 cases of pharyngeal or cheek mucosal swabs of suspected mumps cases in Gwangju, South Korea, were assessed for causative pathogens using massive simultaneous pathogen testing (TaqManTM Array Cards). More than one respiratory virus was detected in 60 cases (95.2%), 44 (73.3%) of which were co-detected. Human rhinovirus was detected in 47 cases, followed by human herpesvirus (HHV)6 in 30; HHV4 (17), human bocavirus (17), HHV5 (10), and human parainfluenza virus 3 (6) were also detected. Our findings suggest the need for further investigations on the pathogenesis of diseases mimicking mumps, which are considered to aid with appropriate public health responses, treatment, and the prevention of infectious disease outbreaks.

Systemic lupus erythematosus (SLE) is a prevalent autoimmune condition, yet its alignment with a specific host immunological pathway remains unclear. The THαβ host immunological pathway, recognized for its defense against viruses and prions, has recently emerged as a response to DNA, RNA, and protein pathogens. SLE patients often produce anti-double strand DNA antibodies and anti-nuclear antibodies, suggesting a potential association with the THαβ host immune reaction. Throughout the course of SLE, elevated levels of type 1 interferons, type 3 interferons, interleukin-10, IgG1, and IgA1 are commonly observed. These cytokines and antibody isotypes are indicative of the THαβ host immunological pathway. Similarly, Myasthenia gravis, Grave’s disease, Graft versus host disease, autoimmune hemolytic anemia, immune thrombocytopenia, dermatomyositis, and Sjogren’s syndrome are also linked to THαβ-related type 2 hypersensitivities. Considering the potential association of these diseases with dysregulated THαβ immune responses, therapeutic strategies such as anti-interleukin-10 or anti-interferons α/β could be explored to manage these disorders effectively.

To avoid loss of information and incorrect ranking, this paper proposes a method for ranking generalized fuzzy numbers, which guarantees both horizontal and vertical values are important parameters affecting the final ranking score. In this method, the normalized height coefficient is introduced to evaluate the influence of the height of fuzzy numbers on the final ranking score. The higher the normalized height coefficient of a fuzzy number is, the higher its ranking. The left area and the right area are presented to calculate the impact of vertical value on the final ranking score. The left area is considered the benefit area. The right area is considered the cost area. The fuzzy number is preferred if the benefit area is larger and the cost area is smaller. The proposed method can be employed to rank both normal and non-normal fuzzy numbers without normalization or height minimization. Numerical examples and comparison with other methods highlight the feasibility and robustness of the proposed method, which can overcome the shortcomings of some existing methods and can support decision-makers to select the best alternative.

As renewable energy generation prediction system has been introduced into the energy trading market, making a model to accurately predict the quantity of solar photovoltaic (PV) energy generation has become a significant problem. Moreover, to encourage an accurate prediction of the quantity of energy generation, an incentive system has been implemented for those who predict the quantity of solar PV energy under the error rate of 8%. Therefore, it has become more important to investigate and analyze current prediction technology numerically and develop more advanced prediction system. In this study, we tried to develop a better model to improve the accuracy of solar PV energy generation quantity by comparing three models made with gradient boosting machine (GBM), Model 1, Model 2, Model 3 respectively. Model 1 was built with the whole training data set without any additional preprocessing. After conducting some additional preprocessing procedure to predict solar energy generation more accurately, we made Model 2 with the whole training data set and Model 3 with only upper 10% of energy generation capacity. To compare the accuracy of three models, normalized mean absolute error (nMAE) was used as an evaluation index. The nMAE of Model 1 was 9.64% while the Model 2 showed 8.41%. Also, Model 3, which was constructed with the training set of upper 10% energy generation capacity, outperformed with the nMAE of 8.08%. For further study, to check the effectiveness of models constructed with GBM, a time series model, autoregressive integrated moving average (ARIMA), was also built and the nMAE was compared.

Background: During pregnancy, major physiological changes occur in every system. Understanding the hemodynamic changes in different stages of pregnancy can help to identify abnormal states during pregnancy. Harmonic analysis could be a useful tool in monitoring the state of the ventricular-arterial system during pregnancy. The aim of this study was to investigate the specific statistical relationships between changes in harmonic indices during different stages of pregnancy. Methods: A Total of 380 women (190 pregnant women and 190 age-matched non-pregnant women), with ages ranging from 20 to 45, were enrolled in the study. The visit measured the subject’s hemodynamic parameters including heart rate, systolic blood pressure (SBP), diastolic blood pressure (DBP) and photoplethysmography (PPG). SBP and DBP were evaluated by an automatic blood pressure monitor. PPG signal were continuously recorded for 12-seconds using a PPG sensor. Spectrum analysis of the PPG signal was performed to evaluate the first five harmonic components (C1 – C5) and harmonic phases (P1 – P5). Result: A comparison between pregnant women and non-pregnant women showed that the non-pregnant women had lower DBP, C3, C5 and P5 (p<0.05). Waist Circumference, Heart rate, C2, C4 and P2 were higher in pregnant women. Logistic regression analysis was used to determine the associations between pregnancy and harmonics indices. C2, C4 and P3 were positively and P1 and P4 were negatively associated with pregnancy after controlling age, BMI, waist circumference, heart rate, SBP and DBP. Conclusion: The results of this study provide information on the changes in the harmonic frequency components during various stages of pregnancy. The harmonic components of the PPG signal have independent predictive value for changes in a woman's physiology during pregnancy. Since non-invasive PPG measurements can be performed frequently and easily, in the future, it is possible that the hemodynamic changes from some pregnancy-related disorders could be studied by harmonic analysis.

This paper proposes a single-stage asymmetrical half-bridge fly-back (AHBF) converter with resonant mode using dual-mode control. The presented converter has an integrated boost converter and asymmetrical half-bridge fly-back converter and operates in resonant mode. The boost-cell always operates in discontinuous conduction mode (DCM) to achieve high power factor. The presented converter operates simultaneously using a variable-frequency-controller (VFC) and pulse-width-modulation (PWM) controller. Unlike the conventional single-stage design, the intermediate bus voltage of this controller can be regulated depending on the main power switch duty ratio. The asymmetrical half-bridge fly-back converter utilizes a variable switching frequency controller to achieve the output voltage regulation. The asymmetrical half-bridge fly-back converter can achieve zero-voltage-switching (ZVS) operation and significantly reduce the switching losses. Detailed analysis and design of this single-stage asymmetrical half-bridge fly-back converter with resonant mode is described. A wide AC input voltage ranging from 90 to 264 Vrms and output 19 V/ 120 W prototype converter was built to verify the theoretical analysis and performance of the presented converter.

Longitudinal image registration of pulmonary computed tomography (PCT) images may serve as an essential tool for investigating the relationship between radiation dose distribution and the occurrence and phenotype of radiation-induced lung disease (RILD). Although numerous longitudinal registration algorithms have been developed for PCT, most similarity-based approaches are not suitable for PCT involving RILD due to the complex tissue variation between two PCT images. Moreover, conventional feature-based approaches might fail to find a sufficient number of matched pairs of feature points due to the disparate lung deformation caused by breathing and RILD. To overcome the challenges resulting from RILD, component structure coherence point drift (CSCPD) was proposed to establish a deformation model by decomposing the chest into several components and matching them with individual parameters based on coherence point drift (CPD). Moreover, a regional vascular point matching (RVPM) algorithm was proposed to generate a vascular subtree and to substantially increase the number of corresponding pairs between two images. Eventually, the components were recomposed and aligned by a thin plate spline algorithm. A performance assessment on 15 pairs of PCT images of patients with RILD yielded recall and precision values of 0.85 and 0.89 for RVPM, respectively. Moreover, the target registration error of CSCPD with RVPM (2.3 ± 1.79) was significantly better than that of conventional CPD with RVPM (2.95 ± 1.89) and conventional CPD (5.04 ± 2.87). Therefore, the proposed registration system is robust enough to address the disparate deformation of lungs with RILD, and it improves registration accuracy within the parenchyma.

Surface-enhanced Raman spectroscopy (SERS) is commonly used for super-selective analysis through nanostructured silver layers in the environment, food quality, biomedicine, and materials science. To fabricate a high-sensitivity but more accessible device of SERS, dc magnetron sputtering technology was used to realize high sensitivity, low cost, stable deposition rate, and rapid mass production. This study investigated various thicknesses of a silver film ranging from 3.0 to 12.1 nm by field-emission-scanning-electron microscope, X-ray diffraction, and X-ray photoelectron spectroscopy. In the rhodamine 6G (R6G) testing irradiated by a He-Ne laser beam, the analytical enhancement factor (AEF) of 9.35x108, the limit of detection (LOD) of 10-8 M, and the relative standard deviation (RSD) of 1.61% were better than other SERS substrates fabricated by the same dc sputtering process because the results show that the 6 nm thickness silver layer has the highest sensitivity, stability, and lifetime. The paraquat and acetylcholine analytes were further investigated and high sensitivity was also achievable. The proposed SERS samples were evaluated and stored in a low humidity environment for up to forty weeks, and no spectrum attenuation could be detected. Soon, the proposed technology to fabricate high sensitivity, repeatability, and robust SERS substrate will be an optimized process technology in multiple applications.

This study was conducted to develop a PID control algorithm considering viscosity for the planting depth control system of a rice transplanter using various hydraulic oils at different temperatures and to evaluate the performance of the control algorithm, and compare the performance of the PID control algorithm without considering viscosity and considering viscosity. In this study, the simulation model of the planting depth control system and a PID control algorithm were developed based on the power flow of the rice transplanter (ERP60DS). The primary PID coefficients were determined using the Ziegler–Nichols (Z–N) second method. Routh’s stability criteria were applied to optimize the coefficients. The pole and double zero points of the PID controller were also applied to minimize the sustained oscillations of the responses. The performance of the PID control algorithm was evaluated for three ISO (The International Organization for Standardization) standard viscosity grade (VG) hydraulic oils (VG 32, 46, and 68). The results show that the control algorithm considering viscosity is able to control the pressure of the proportional valve, which is associated with the actuator displacement for various types of hydraulic oils. It was noticed that the maximum pressure was 15.405 bars at 0, 20, 40, 60, 80, and 100 ℃ for all of the hydraulic oils. The settling time and steady-state errors were 0.45 s at 100 ℃ for VG 32, and 0% for all of the conditions. The maximum overshoots were found to be 17.50% at 100 ℃ for VG 32. On the other hand, the PID control algorithm without considering viscosity could not control the planting depth, because the response was slow and did not satisfy the boundary conditions. The PID control algorithm considering viscosity could sufficiently compensate for the nonlinearity of the hydraulic system and was able to perform for any of temperature-dependent viscosity of the hydraulic oils. In addition, the rice transplanter requires a faster response for accurately controlling and maintaining the planting depth. Planting depth is highly associated with actuator displacement. Finally, this control algorithm considering viscosity could be helpful in minimizing the tilting of the seedlings planted using the rice transplanter. Ultimately, it would improve the transplanter performance.

The productivity of forests is often considered to be limited by the availability of phosphorus (P). Knowledge of the role of organic and inorganic P in humid subtropical forest soils is lacking. In this study, we used chemical fractionation and 31P nuclear magnetic resonance (NMR) spectroscopy to characterize the form of P and its distribution in undisturbed perhumid Chamaecyparis forest soils. The toposequence of transects was investigated for the humic layer from summit to footslope and lakeshore. The clay layer combined with a placic-like horizon in the subsoil may affect the distribution of soil P because both total P and organic P (Po) contents in all studied soils decreased with soil depth. In addition, Po content was negatively correlated with soil crystalline Fe oxide content, whereas inorganic P (Pi) content was positively correlated with soil crystalline Fe oxide content and slightly increased with soil depth. Thus, Pi may be mostly adsorbed by soil crystalline Fe oxides in the soils. Among all extractable P fractions, the NaOH-Po fraction appeared to be the major component, followed by NaHCO3-Po; the resin-P and HCl-Pi fractions were lowest. In addition, we found no typical trend for Pi and Po contents in soils with topographical change among the three sites. From the 31P-NMR spectra, the dominant Po form in soils from all study sites was monoesters with similar spectra. The 31P-NMR findings were basically consistent with those from chemical extraction. Soil formation processes may be the critical factor affecting the distribution of soil P. High precipitation and year-round high humidity may be important in the differentiation of the P species in this landscape.

The ingestion of ethanol presents a significant global public health challenge. Chronic alcohol consumption is associated with the development of conditions such as cancer, cirrhosis, hepatic diseases, cardiovascular diseases, and diabetes, as well as neurological impairments that may predispose individuals to dementia, schizophrenia, and behavioral disorders such as violence and suicide. Alcohol-related fatalities constitute 5.3% of worldwide deaths annually, totaling approximately 3 million. Notably, alcohol consumption is implicated in 25% of cirrhosis-related deaths and 4.1% of cancer-related deaths. Taurine (2-aminoethanesulfonic acid) is a non-protein β-amino acid essential for cellular homeostasis, possessing antioxidant, anti-inflammatory, and cytoprotective properties crucial for life maintenance. This study aimed to evaluate the effects of taurine administration on hippocampal neurogenesis, neuronal preservation or reverse damage in rats exposed to forced ethanol consumption. Results demonstrated the neuroprotective effects of taurine on ethanol-treated rats, promoting tissue regeneration and suggesting its pivotal role in this process. However, this aminoacid failed to induce neurogenesis in the tissues of healthy rats, implying that its activity may be contingent upon post-injury stimuli.

Gymnema sylvestre is a pharmacological plant which has a rich source of bioactive compounds specifically gymnemic acid (GA) and phenolic compounds (PC) that used for pharmaceutical industries. Sources for naturally occurring bioactive compounds are limited, due to geographical and seasonal variations; on the other hand, it is commercially in demand. Biosynthesis of G. sylvestre phytochemicals through in vitro culture often enhanced by elicitation. The use of cell suspension cultures (CSC) has interested serious attention on the production of essential phytochemicals. The current study is aimed at improving the contents of GA and PC in G. sylvestre CSC using the copper oxide nanoparticles (CuO NPs). Callus was obtained on MS medium with 2.0 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.1 mg/L kinetin (KIN), phytoagar (8.0 g/L), and sucrose (30 g/L). The above medium devoid of agar was used for the initiation of CSC. The CSC was treated with three levels of CuO NPs (1, 3 or 5 mg/L) to enhance the production of GA and PC. The greatest amount of GA (89.25 mg/g dry cell mass, DCM), total phenolic (245.10 mg/g), and flavonoid (4.57 mg/g) in CSC were achieved when G. sylvestre cells were treated for 48 h with 3 mg/L CuO NPs. Also, the biomedical potential (antioxidant, antidiabetic, anti-inflammatory, antibacterial, antifungal and anticancer activities) were also high in the CuO NPs (3 mg/L) treated CSC extracts of G. sylvestre. CuO NPs elicitation of CSC significantly increased production of GA (9-fold), and PC than non-elicited CSC in G. sylvestre.

This paper presents a deep learning-based multi-guidance line detection approach, enabling an autonomous four-wheeled agricultural robot to navigate strip farmland. The integration of Proportional-Integral-Derivative (PID) and Fuzzy Logic Control (FLC) systems optimizes the velocity and heading angle of robot, facilitating smooth navigation along identified guidance line. Enhance cornering maneuverability with real-time kinematics (RTK)-assisted Global Navigation Satellite System (GNSS) (RTK-GNSS) positioning. Additionally, the spraying system combined with deep learning can effectively identify weeds and crop nutrient deficiencies to achieve precise spraying. The guidance system prioritizes irrigation lines for navigation, with additional guidance from crop and furrow lines. Trigonometric analysis determines the angular deviation between the identified guidance line and the vertical line of the top view image. Experiments under diverse weather conditions demonstrate the stable navigation of robot at 12.5 cm/s, achieving up to 90% accuracy in weed and nutrient deficiency identification. The spraying accuracy for weeds and deficiencies averages 87% and 73%, respectively, underscoring the system's contribution to sustainable and precision horticulture practices.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

Recently, design of electric scooters (ESs) has commonly adopted brushless DC motors (BLDCMs) in place of brushed DC motors. This invention develops a new anti-lock braking system (ABS), based on a slip-ratio estimator, for ES utilizing the braking force generated by the BLDCM when electrical energy releases to the load yielding an analogous effect of ABS control in gas-engine vehicles. Comparing to mechanical ABS, the design possesses the advantages of rapid torque responses due to fast actuating response. The electrical ABS is realized by associating with kinematic and Short-circuit braking. A current controller is used to adjust the braking force, while the sliding mode control strategy is adopted to regulate the slip ratio for best road adhesion while braking. Real-world experiments have been conducted for functional and performance verification.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

According to statistics from the Food and Agriculture Organization, the world population will increase to about 91 million (Asia 51 million, Africa 19 million). A rise in the world’s population means an increased need for food. However, climate change has caused desertification and unpredictable weather, creating problems in the supply and demand of food. Sweet potato (Ipomoea batatas) is an alternative to solving the food problem, as it is one of the world’s most important food crops, especially in developing countries. The tuberous roots of sweet potato are usually used as staple food, animal feed, industrial material, or raw material for alcohol production. In the future, more variations of sweet potato will be needed for breeding this crop. Recently, molecular markers developed for sweet potato have demonstrated good potential for use in genetic selection. In this study, a cDNA library was constructed from the total RNA of sweet potato leaves. A total of 789 copies of the cDNA were cloned in Escherichia coli by employing the pGEM-T Easy vector. Sequencing was carried out by Solgent Co. (Korea). As many as 579 expressed sequence tag–simple sequence repeat (EST-SSR) markers were designed (73.38%) from the known cDNA nucleotide base sequences. The lengths of the developed EST-SSR markers ranged from 100 to 499 bp (average length 238 bp). Their motif sequence types were varied, with most being dinucleotides and pentanucleotides, and the most commonly found motifs were CAGAAT (29.0%) and TCT (2.8%). Based on these SSR-containing sequences, 619 pairs of high-quality SSR primers were designed using WebSat and Primer3web. The total number of primers designed was 144. Polymorphism was evident in 82 EST-SSR markers among 20 Korean sweet potato cultivars tested and in 90 EST-SSR markers in the two parents of a mapping population, Yeseumi and Annobeny. In this study, the hexaploid sweet potato (2n = 6x = 90) EST-SSR markers were developed in the absence of full-sequence data. Moreover, by acting as a molecular tag for particular traits, the EST-SSR marker can also simultaneously identify information about the corresponding gene. These EST-SSR markers will allow the molecular analysis of sweet potato to be done more efficiently. Thus, we can develop high-quality sweet potato while overcoming the challenges from climate change and other unfavorable conditions.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Retinal apoptosis plays a critical role in the progression of diabetic retinopathy (DR), a common diabetic complication. Currently, the tight control of blood glucose levels is the standard approach to prevent or delay the progression of DR. However, prevalence of DR among diabetic patients remains high. Focusing on natural nutrients or herbal medicines that can prevent or delay the onset of diabetic complications, we administered an ethanol extract of the aerial portion of Osteomeles Schwerinae (OSSCE), a Chinese herbal medicine, over a period of 17 weeks to spontaneously diabetic Torii (SDT) rats. OSSCE was found to ameliorate retinal apoptosis through the regulation of advanced glycation end products (AGEs) accumulation, oxidative stress, and mitochondrial function via inhibition of NF-κB activity, in turn through the downregulation of PKCδ, P47phox, and ERK1/2. We further demonstrated in 25 mM glucose-treated human retinal microvascular endothelial cells (HRMECs) that hyperoside (3-O-galactoside-quercetin), quercitrin (3-O-rhamnoside-quercetin), and 2''-O-acetylvitexin (8-C-(2''-O-acetyl-glucoside)-apigenin) were the active components of OSSCE that mediated its pharmacological action. Our results provide evidence that OSSCE is a powerful agent that may directly mediate a delay in development or disease improvement in patients of DR.

The incidence of human papillomavirus (HPV)-associated oropharyngeal squamous cell carcinoma (OPSCC) is rising in the West, but little is known in Asia. This study elucidated changes in the incidence and HPV-positive portion of OPSCC in Hong Kong. Data from population-based cancer registry were used to analyze the incidence of OPSCC in associate with other head and neck cancers. Archived tumour tissues were tested for HPV. From 1986 to 2020, there was a marked decrease in the incidence of nasopharyngeal and laryngeal cancers, but a persistent increase in OPSCC from 36 cases in 1986 to 116 cases in 2020. The average positive rate for high-risk HPV was 36.1% (112/310) among OPSCC diagnosed in 2010-2020. The HPV positive rate in recent years was significantly higher than earlier cases (tonsil SCC: 64.7% (55/85) in 2016-2020 vs. 40.4% (19/47) in 2010-2015, P = 0.007). Patients with HPV-positive tonsil cancers were significantly younger than those negative (mean [SD]: 58.9 [9.9] vs. 64.3 [13.3] years, P = 0.006), but no significant difference between genders. A persistent increase in the incidence of oropharyngeal cancer over the last few decades was observed in Hong Kong, which can be explained by the remarkable increase in HPV-positive tonsil cancers.

Since 2007, highly pathogenic clade 2.3.2 H5N1 avian influenza A [A(H5N1)] viruses have evolved to clade 2.3.2.1a, b and c, and currently only 2.3.2.1c A(H5N1) viruses circulate in wild birds and poultry. During antigenic evolution, clade 2.3.2.1a and c A(H5N1) viruses acquired both S144N and V223I mutations around the receptor binding site of hemagglutinin (HA), with S144N generating an N-glycosylation sequon. We introduced single or combined reverse mutations, N144S and/or I223V, into the HA gene of clade 2.3.2.1c A(H5N1) virus and generated PR8-derived, 2 + 6 recombinant A(H5N1) viruses. When we compared replication efficiency in embryonated chicken eggs, mammalian cells and mice, the recombinant virus containing both N144S and I223V mutations showed increased replication efficiency in avian and mammalian hosts and pathogenicity in mice. The N144S mutation significantly decreased avian receptor affinity and egg white inhibition, but not all mutations increased mammalian receptor affinity. Interestingly, the combined reverse mutations dramatically increased the thermostability of HA. Therefore, the adaptive mutations possibly acquired to evade avian immunity may decrease viral thermostability as well as mammalian pathogenicity.

Background: Only few studies have studied the link between risk perception and sleep in the context of the COVID-19 pandemic. This study investigates the effect of two distinct risk appraisals—risk perception and perception of collective coordinated defense (PCCD) on Chinese adults’ sleep quality during the COVID-19 pandemic, and tested COVID-19-related fear and rumination as potential mediators of the relationships. Methods: Data were collected using a self-report online questionnaire from a sample of 224 Chinese adults during the fourth wave of the COVID-19 pandemic in Hong Kong. Results: COVID-19 risk perception and PCCD were related to poor sleep quality. Mediation analysis showed that both fear and rumination mediated the relationship between risk perception and sleep quality, whereas only fear mediated the relationship between PCCD and sleep quality. The model showed an excellent fit to the data and accounted for 44% of the variance in sleep quality in Chinese adults. Conclusions: This study demonstrates the distinct perceptual processes—risk appraisals in particular—contributed to poor sleep quality in Chinese adults during the COVID-19 public emergencies. These findings would be helpful for policy makers to address the sleep problems induced by psychological consequences of the pandemic.

On October 18, 2017, Chinese President Xi Jinping presented the blueprint for building a modernized socialist nation through the realization of the Xiao Kang (Every nation enjoys a peaceful and affluent life, it is meaningless to eliminate the poor) social construction at the 19th Congress of China. Subsequent to the 2008 financial crisis, the world has moved on to the new economic status of the New Normal. China has also entered the era of “Xinchang Thai,” which is moving from the high-growth to the moderate-growth phase. Therefore, the government of China emphasizes privatization, liberalization, and deregulation. China is also influenced by government policies due to the nature of socialism. This study confirms China’s current stage of economic development based on Barro’s theory. Thus, we use a quantile regression model and examine the correlation between economic growth and functional classification of government expenditure during Xi Jinping's term of office. Furthermore, we selected Korea as a comparative country as the two countries have common features.

Community-based case managers in health have been compared to glue which holds the dynamic needs of clients to a disjointed range of health and social services. However, case manager roles are difficult to understand due to poorly defined roles, confusing terminology, and low visibility in New Zealand. This review aims to map the landscape of case management work to advance workforce planning by clarifying the jobs, roles, and relationships of case managers in Aotearoa New Zealand (NZ). Our scoping and mapping review includes peer-reviewed articles, grey literature sources, and interview data from 15 case managers. Data was charted iteratively until convergent patterns emerged and distinctive roles identified. A rich and diverse body of literature describing and evaluating case management work in NZ (n=148) is uncovered with at least 38 different job titles recorded. 18 distinctive roles are further analysed with sufficient data to explore the research question. Social ecology maps highlight diverse interprofessional and intersectoral relationships. Significant innovation and adaptations are evident in this field, particularly in the last five years. Case managers also known as health navigators, play a pivotal but often undervalued role in NZ health care, through their interprofessional and intersectoral relationships. Their work is often unrecognised which impedes workforce development and the promotion of person-centred and integrated health care.

Hong Kong was under the direct hit of Severe Typhoon Koinu (2314) on 8 and 9 October 2023, necessitating the issuance of the Increasing Gale or Storm Signal, No. 9. Koinu was a very challenging case for TC forecasting and warning services due to its compact size and erratic movement over the northern part of the South China Sea. This paper reviews the difficulties and challenges on the forecasting aspect of the severe typhoon. The predicted tropical cyclone track and intensity from both conventional models and emerging artificial intelligence models are examined, as well as local wind and rainfall forecast. Experience in this case study showed that while deterministic global models only performed moderately and were not able to adequately support early warning, a regional model and AI models could more effectively support decision making for operational tropical cyclone warning service.

In this review, the following information describes the manifestation of sleep deprivation by human beings and its adverse effect on their health. Sleep deprivation has been demonstrated into namely two types known as REM sleep and NREM sleep affecting our health in so a problematic way that it is making our body immune to many diseases leading to lethal problems. Therefore, great research by many scientists has discovered that the turmeric “Curcuma longa” which is been used in every Indian kitchen since ancient times, has shown a remarkable effect on the problem caused by sleep deprivation but due to its poor solubility and low bioavailability drawn it into a great disadvantage. But the help of the study of nanotechnology and the evolution of curcumin into nano–curcumin made the possibility of the remarkable effect by making the curcumin more potent and enhancing its stability. Immunological changes due to sleep deprivation lead to Alzheimer’s disease, glioma, neuropathic pains, and many more. Therefore, this review has been summarized as it is been providing information related to curcumin and its affection for sleep deprivation.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

We examine the global legal entity identifier (LEI) system for the identification of participants in financial markets. Semi-structured interviews with data professionals reveal the many ways in which the LEI can improve both business process efficiency and counterparty and credit risk management. Larger social benefits, including monitoring of systemic financial risk, are achievable if it becomes the accepted universal standard for legal entity identification. Our interviews also review the substantial co-ordination and investment barriers to LEI adoption. To address these, a clear regulatory-led road map is needed for its future development with widespread application in regulatory reporting.

The risk of lung exposure to silica nanoparticles (SiNPs) and related lung inflammatory injury is increasing with the wide application of SiNPs in a variety of industries. A growing body of research has revealed that cyclooxygenase (COX)-2/ prostaglandin E2 (PGE2) up-regulated by SiNPs toxicity has a role during pulmonary inflammation. The detailed mechanisms underlying SiNPs-induced COX-2 expression and PGE2 synthesis remain unknown. The present study aims to dissect the molecular components involved in COX-2/PGE2 up-regulated by SiNPs in human pulmonary alveolar epithelial cells (HPAEpiCs) which are one of the major targets while SiNPs are inhaled. In the present study, we demonstrated that SiNPs induced COX-2 expression and PGE2 release, which were inhibited by pretreatment with a reactive oxygen species (ROS) scavenger (edaravone) or the inhibitors of proline-rich tyrosine kinase 2 (Pyk2, PF-431396), epidermal growth factor receptor (EGFR, AG1478), phosphatidylinositol 3‑kinase (PI3K, LY294002), protein kinase B (Akt, Akt inhibitor VIII), p38 mitogen-activated protein kinase (MAPK) (p38 MAPK inhibitor VIII), c-Jun N-terminal kinases (JNK)1/2 (SP600125), Forkhead Box O1 (FoxO1, AS1842856), and activator protein 1 (AP-1, Tanshinone IIA). In addition, we also found that SiNPs induced ROS-dependent Pyk2, EGFR, Akt, p38 MAPK, and JNK1/2 activation in these cells. These signaling pathways induced by SiNPs could further cause c-Jun and FoxO1 activation and translocation from the cytosol to the nucleus. AP-1 and FoxO1 activation could increase COX-2 and PGE2 levels induced by SiNPs. Finally, the COX-2/PGE2 axis might promote the inflammatory responses in HPAEpiCs. In conclusion, we suggested that SiNPs induced COX-2 expression accompanied by PGE2 synthesis mediated via ROS/Pyk2/EGFR/PI3K/Akt/p38 MAPK- and JNK1/2-dependent FoxO1 and AP-1 activation in HPAEpiCs.

Although the dockless bike-sharing system, which can be regarded as a typical example of the resource-sharing system, has been increasingly popular for years with people especially in China, the imbalanced distribution of shared bikes gradually becomes a major problem for both bike-sharing companies and their customers. To solve the imbalance problem, we aim to investigate the long-term performance of a system under the influence of some key factors (with an emphasis on the unequal demand between different nodes), which can guide us to discover the causes of the problem and offer several valuable suggestions to the operators. According to the fundamental principle of a dockless bike-sharing system, we propose a model reduction method to reduce the complexity of the theoretical network models, which are developed based on the Markovian queueing theory with the consideration of higher-demand nodes and lower-demand nodes. The theoretical network models provide us with steady-state probabilities of having a certain number of bikes at one node, which are used as an important part of the optimization model for solving the imbalance problem by carrying out an operator-based relocation strategy. The objective of the optimization model is to maximize the total profit and determine the optimal relocation frequency. It is found that most of the shared bikes are possible to gather at one low-demand node eventually in the long run under the influence of the different arrival rates at different nodes, but the decrease of the number of bikes at the high-demand nodes is more sensitive to the unequal demands and may cause a great loss for operators, which should be payed attention to especially when solving the relocation problems.

Clinical and histological similarities between sarcoidosis and tuberculosis have driven repeated investigations looking for a mycobacterial cause of sarcoidosis. Over 50 years ago “anonymous mycobacteria” were suggested to have a role in the etiology of sarcoidosis. Both tuberculosis and sarcoidosis have a predilection for lung involvement though each can be found in any area of the body. A key histopathologic feature of both sarcoidosis and tuberculosis is the granuloma – while the tuberculous caseating granuloma has an area of caseous necrosis with a cheesy consistency; the non-caseating granuloma of sarcoidosis does not have this feature. This article reviews and reiterates the complicity of the infectious agent, Mycobacterium avium ss. paratuberculosis (MAP) as a cause of sarcoidosis. MAP is involved in a parallel story as the putative cause of Crohn’s disease, another disease featuring noncaseating granulomas. MAP is a zoonotic agent infecting ruminant animals and is found in dairy products and in environmental contamination of water and air. Despite increasing evidence tying MAP to several human diseases, there is a continued resistance to embracing its pleiotropic roles. "Who Moved My Cheese" is a simple yet powerful book that explores the ways in which individuals react to change. Extending the metaphor, the “non-cheesy” granuloma of sarcoidosis actually contains the difficult-to-detect “cheese”, MAP; MAP did not move, it was there all along.

Anti-interferon (IFN)-γ autoantibodies are linked to varicella-zoster virus (VZV) infection. Given the elevated risks of herpes zoster (HZ) in rheumatoid arthritis (RA) patients treated with Janus kinase inhibitors (JAKi), we aimed to examine the relationship between anti-IFN-γ autoantibodies with HZ development in JAKi-treated patients. In twenty-four RA patients with new-onset HZ and forty-two without HZ, serum titers of anti-IFN-γ autoantibodies, plasma levels of IFN-γ, monocyte chemoattractant protein-1 (MCP-1), and IFN-γ inducible protein-10 (IP-10) were measured by ELISA. Significantly lower MCP-1 levels were observed in patients with HZ compared to those without (median, 98.21pg/ml, interquartile range (IQR) 77.63-150.30pg/ml versus 142.3pg/ml, IQR 106.7-175.6pg/ml, p&lt;0.05). There was no significant difference in anti-IFN-γ titers, IFN-γ levels, or IP-10 levels between patients with and without HZ. Three of 24 patients with HZ had severe HZ with multi-dermatomal involvement. Anti-IFN-γ titers were significantly higher in patients with severe HZ than in those with non-severe HZ (median 24.8ng/ml, IQR 21.0-38.2ng/ml versus 10.5ng/ml, IQR 9.9-15.0ng/ml, p&lt;0.005). In conclusion, patients with HZ had significantly lower MCP-1 levels than those without HZ, and patients with severe HZ had significantly higher titers of anti-IFN-γ than those with non-severe HZ. Given small sample size, our results need further validation in future studies.

Taxanes, particularly docetaxel (DTX), has been widely used for combination therapy of head and neck squamous cell carcinoma (HNSCC). For locally advanced unresectable HNSCC, DTX combined with cisplatin and 5-fluorouracil as a revolutionary treatment revealed an advantage in improvement of patient outcome. In addition. DTX plus immune check inhibitors (ICIs) showed low toxicity and increased response of patients with recurrent or metastatic HNSCC (R/M HNSCC). Accumulating data indicate that taxanes not only function as antimitotics but also impair diverse oncogenic signalings including angiogenesis, inflammatory response, ROS production, and apoptosis induction. However, despite an initial response, development of resistance remains a major obstacle to treatment response. Taxane resistance could result from intrinsic mechanisms such as enhanced DNA/RNA damage repair, increased drug efflux, and apoptosis inhibition, and extrinsic effects such as angiogenesis and interactions between tumor cells and immune cells. This review provides an overview of taxanes therapy applied in different stages of HNSCC and describe the mechanisms of taxane resistance in HNSCC. Through a detailed understanding the mechanisms of resistance may help developing the potential therapeutic methods and the effective combination strategies to overcome drug resistance.

The negative impact of the modern-day lifestyle on the environment is aggravated during the COVID-19 pandemic through the increased use of single-use plastics from food takeaways to medical supplies. Similarly, the closure of food outlets and disrupted supply chains have also resulted in significant food wastage. As the pandemic rages on, the aggravation of increased waste becomes an increasingly urgent problem that threatens the biodiversity, ecosystems, and human health worldwide through pollution. While there are existing methods to deal with the organic and plastic waste, many of the solutions also cause additional problems. Increasingly proposed as a natural solution to man-made unnatural problems, there are insect solutions for dealing with the artificial and organic waste products towards a circular economy, making the use of natural insect solutions commercially sustainable. This review discusses the findings and how some of these insects, particularly the Hermetia illucens, Tenebrio molitor, and Zophobas morio, can play an increasing important role in food and plastics, with a focus on the latter.

Background: The infant mortality rate (IMR) is an important reflection of the well-being of infants and the overall health of the population. This study aims to examine the macroeconomic (ME), sociodemographic (SD), and health status and resources (HSR) effects on IMR, as well as how they may interact with each other. Methods: A retrospective time-series study using yearly data for Oman from 1980 to 2022. Partial Least Squares-Structural Equation Modelling (PLS-SEM) was utilized to develop the exploratory model of the determinants of IMR. Results: The model indicates that HSR determinants directly but negatively affect IMR (= -0.617, p&lt;0.001). SD directly and positively affects IMR (= 0.447, p&lt;0.001). ME only indirectly affects IMR (=-0.854, p&lt;0.001). ME determinants also exert some direct influences on both HSR (= 0.722, p&lt;0.001) and SD (= -0.916, p&lt;0.001) determinants. Conclusions: These findings indicate that an integrated policy that addresses socioeconomic and health-related factors and the overall ME environment is necessary for the health and well-being of the children and the population overall in Oman.

High-methoxyl apple pectin (AP) derived from apple was employed as the main ingredient facilitating rheological modification features for developing dysphagia-friendly fluidized alimentary matrices. Xanthan gum (XG) was also included as a composite counterpart to modify the viscoelastic properties of the thickened system under different thermal processes. The results indicate that AP is extremely sensitive to thermal processing, and the viscosity is greatly depleted under a neutral pH level. Moreover, the inclusion of calcium ions echoed a modification effect on the rheological properties of AP, and both the elastic property and viscosity value are promoted after thermal processing. The modification effect of viscoelastic properties (Gʹ and Gʹʹ) is observed while XG is incorporated into the composite formula. By promoting the XG ratio from 7: 3 to 6: 4 (AP: XG), it triggers the rheological transformation from a liquid-like form to a solid-like state, and the viscosity value shows that the AP-XG composite system exhibits better thermal stability after thermal processing. The ambient modifiers of pH (pH &lt; 4) and calcium chloride concentration (7.5%) with an optimal AP-XG ratio of 7:3 lead to weak-gel-like behavior (Gʹʹ &lt; Gʹ), helping to maintain the texture properties of dysphagia-friendly features similar to those prior to the thermal processing.

Data-driven models (DDMs) are extensively used in environmental modeling but face challenges due to limited training data and potential results not adhering to physical laws. To address this challenge, this study developed a process-guided deep learning (PGDL) model, integrating a long short-term memory (LSTM) neural network and a process-based model (PBM), CE-QUAL-W2 (W2), to predict water temperature in a stratified reservoir. The PGDL included an energy constraint term from W2's thermal energy equilibrium into the cost function of the LSTM, besides the mean square error term. In PGDL, parameters were optimized by penalizing deviations from the energy law, ensuring adherence to physical constraints. Compared to LSTM, PGDL demonstrated enhanced satisfaction with the energy balance and superior performance in water temperature prediction. Even with less field data for training, PGDL outperformed both LSTM and calibrated W2 after pre-training with data generated using the uncalibrated W2. Therefore, integration of DDM with a PBM ensured physical consistency in water temperature prediction for complex stratified reservoirs with limited data. Moreover, pre-training the PGDL with PBM proved highly effective in mitigating bias and variance due to insufficient field measurement data.

The severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) viral genome is an RNA virus consisting of approximately 30,000 bases. As part of testing efforts, whole genome sequencing of human isolates has resulted in over 1,600 complete genomes publicly available from GenBank. We have performed a comparative phylogenetic analysis of the sequences, in order to detect common mutations within the population. Analysis of variants occurring within the assembled genomes yields 417 variants occurring in at least 1% of the completed genomes, including 229 within the 5’ untranslated region (UTR), 152 within the 3’UTR, 2 within intergenic regions and 34 within coding sequences.

This work presents emission line flux and kinematic structure mapping based on IFU data of the planetary nebulae Abell 30 (A30). The IFU has a field of view (FoV) of 16" x 12.3" and was used to partially cover knots J1 and J2, and completely cover knots J3 and J4 of A30. Our emission line flux map shows recombination species C II, C III, He I, O II as well as forbidden line species [O III], [Ne III] and [Ne IV] of high excitation level are all distributed in different parts of the knots. The kinematic structure shows considerable variation in both the velocities and spatial locations of these knots with positive and negative velocity excursions from the systematic value. Forbidden line species [O III], [Ne III] are distributed in both knots J3 and J4 but they are travelling at different speeds in opposite directions. Despite variation in distribution of the species, the velocities of [Ne IV] and [O III] are similar and travelling in the same direction while the other species [Ne III], He I, and O II share similar velocity of 200kms−1 up in the opposite direction. The complexity of distribution and kinematic structure of the knots revealed in this work indicates a strong tendency towards the hypothesis of multiple triggering events in the past history of A30.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Individual users' payment behaviors have changed. The diffusion of mobile devices makes people suitable for proximity mobile payment (PMP) services without the need for traditional payment. Existing mobile payment literature mainly focuses on users' adoption and continuous usage behavior, nevertheless, switching behavior on payment received little attention, especially focusing on why users switch from traditional payment to PMP. Thus, the objective of the current research is to investigate factors influencing users’ traditional payment - PMP switching to comprehend how these factors shape users’ switching intentions. We developed a traditional payment - PMP transition model based on the push-pull-mooring framework derived from migration theory. This research adopted a structural equation modeling analysis on 311 valid data. The findings indicate that a push factor drives users away from traditional payment in terms of dissatisfaction. The pull factors, including perceived substitutability and perceived usefulness, attract users to PMP. Furthermore, in terms of perceived technical compatibility, a positive mooring factor facilitates users' switching to PMP. The negative mooring factor, in terms of perceived risk, hinder users' switching intention. However, another pull factor - perceived ease of use, failed to influence switching intention significantly. This study found some distinctions between mobile payment switching and mobile payment adoption. These findings provide pivotal insights for mobile payment service providers.

Considering the isotropic release process of nanoelectromechanical systems (NEMS), defining the active region of NEM memory switches is one of the most challenging process technologies for the implementation of monolithic-three-dimensional (M3D) CMOS-NEM hybrid circuits. In this paper, we propose a novel encapsulation method of NEM memory switches. It uses alumina (Al2O3) passivation layers which are fully compatible with CMOS baseline process. The Al2O3 bottom passivation layer can protect intermetal dielectric (IMD) and metal interconnection layers from vapor hydrogen fluoride (HF) etch process. Thus, the controllable formation of the cavity for the mechanical movement of NEM memory switches can be achieved without causing any damage to CMOS baseline circuits as well as metal interconnection lines. As a result, NEM memory switches can be located in any places and metal layers of an M3D CMOS-NEM hybrid chip, which makes circuit design easier and more volume-efficient. The feasibility of our proposed method is verified based on experimental results.