Taiwan developing offshore wind power to promote green energy and self-electricity production. In this study, a Light Detection and Ranging (Lidar) was set up at Chang-Hua development zone one on the sea and 10km away from the seashore. At Lidar location, WRF (3.33km & 2km grid lengths) model and WAsP were used to simulate the wind speed at various elevations. Three days mean wind speed of simulated results were compared with Lidar data. From the four wind data sets, developed five different comparisons to find an error% and R-Squared values. Comparison between WAsP and Floating Lidar was shown good consistency. Lukang meteorological station 10 years wind observations at 5m height were used for wind farm energy predictions. The yearly variation of energy predictions of traditional and TGC wind farm layouts are compared under purely neutral and stable condition. The one-year cycle average surface heat flux over the Taiwan Strait is negative (-72.5 (W/m2) and 157.13 STD), which represents stable condition. At stable condition TGC (92.39%) and 600(92.44%), wind farms were shown higher efficiency. The Fuhai met mast wind data was used to estimate roughness length and power law exponent. The average roughness lengths are very small and unstable atmosphere.

Dysregulation of cartilage homeostasis and the changes in the density and the architecture of the subchondral bone were postulated as a potent mechanically pathological activity contributing to osteoarthritis (OA) pathogenesis. Extracorporeal shockwave therapy (ESWT) is a new, none invasive and effective method in the treatment of animal OA model. In the current study, we demonstrated that shockwave induced the expression of protein-disulfide isomerase-associated 3 (Pdia-3) which is a multifunctional protein hypothesized to be a significant mediator for 1α,25-Dihydroxyvitamin D3 (1α,25(OH)₂D₃) signaling pathway using two-dimensional electrophoresis. Histological analysis and quantitative polymerase chain reaction (qPCR) were verified and observed that the expression of Pdia-3 at 2 weeks was significantly higher than that of any other group at 4 weeks, 8 weeks, and 12 weeks post-shockwave treatment in early OA knee of rat. The other factors of the 1α,25(OH)₂D₃ rapid membrane signaling pathway including extracellular signal-regulated protein kinases 1 (ERK1), osteopontin (OPG), alkaline phosphatase (ALP), and matrix metallopeptidase 13 (MMP13) were measured and significantly increased by qPCR at 2 weeks post-shockwave treatment in early OA knee. Our proteomic data revealed significant Pdia-3 expression in microenvironments of joint tissue that could be actively responded to ESWT, which may potentially regulate biological function of chondrocytes and osteoblasts in the treatment of OA knee.

Increasing clinical and preclinical evidences implicate gut microbiome (GM) dysbiosis as a key susceptibility factor for neurodegenerative disorders, including Alzheimer’s disease (AD) and Parkinson’s diseases (PD). In recent years, neurodegenerative diseases have not been viewed as driven solely by defects in brain, and the role of GM in modulating the central nervous system function via gut-brain axis has attracted considerable interest. Encouraged by GM researches, the next-generation probiotics may lead to tangible impacts on the treatment of neurodegenerative disorders. This review summarizes the current understandings of GM composition and characteristics associated with neurodegenerative diseases, and the demonstrations of molecules from GM affecting neurodegeneration. Particularly, applications of next-generation probiotics such as Clostridium butyricum, Akkermansia muciniphila, Faecalibacterium prausnitzii, and Bacteroides fragilis for remediation of neurodegenerative diseases are discussed.

When a microgrid is grid-tied to a distribution system, it can provide surplus power generation to the distribution system, if any abnormality or interruption occurs in the distribution system, the microgrid can operate in standalone mode to isolate the impact of the abnormality or interruption. However, if the microgrid can not collect enough information from the distribution system, it may cause the failure of generation transferring of distribution feeders, or even further influence the stability of the distribution system. In this paper, a strategy for the resilient control of a microgrid is proposed. It can solve the above-mentioned problem, reduce the duration of the outage of loads. This strategy is experimented in the microgrid in the Institute of Nuclear Energy Research (INER), the reliability is also analyzed to evaluate the unavailability of the microgrid in INER, and it is verified that the proposed strategy can reduce the duration of the outage of loads, and hence the reliability of a microgrid can be upgraded.

Metamorphosis is a critical process for most anurans to transition from water to land. The appearance of air-breathing lungs occurs during the change in oxygen medium from water to air. Revealing the structural construction and molecular switches of lung organogenesis is essential to understand the realization of air-breathing function. In this study, histology and transcriptomics were combinedly conducted to explore these issues in Microhyla fissipes lungs during metamorphosis. During the pro-metamorphic phase, histological structure improving of the alveolar wall was accompanied by robust substrate metabolism and protein turnover. The lungs, at the metamorphic climax phase, are characterized by an increased number of cilia in the alveolar epithelial cells and collagenous fibers in the connective tissues, corresponding to the transcriptional upregulation of cilia and extracellular matrix-related genes. The post-metamorphic lungs strengthen the contracting function, as suggested by the thickened muscle layer and the upregulated expression of genes involved in muscle contraction. The blood–gas barrier is fully developed in adult lungs whose transcriptional features are tissue growth and differentiation regulation and immunity. Importantly, significant transcriptional switches of pulmonary surfactant protein and hemoglobin facilitate air-breathing. Our results illuminated four key steps of lung development for amphibians to transition from water to land.

In this paper, the quality change of scallop (Patinopecten yessoensis) in the process of anhydrous storage and transportation after cold-acclimation and induced dormancy was studied, and the regulation mechanism of quality degradation in the storage and transportation in the process of gradient chilling stress and drying exposure was further explored. The results show that while being transferred from anhydrous storage and transportation from hydrous storage and transportation, the breathing pattern of scallops were changed from aerobic to anaerobic. Their gill filaments were altered, and the apparent vitality was constantly declining, which was reflected by the edge shrinkage of pallium and the direct proportion between the edge reduction rate and the stimulus response period. After being in the anhydrous state for 4d, the AEC value dropped to 67.59%. At this time, if they were under hydration again, they would resume a nice growth state. By virtue of proteomics, it was revealed from the analysis that cold acclimation and dry exposure mainly led to changes in biological functions and pathways such as mitochondrial inner membrane and ATP hydrolysis activity. In addition, it can be seen from the functional annotation and enrichment analysis of the metabolite KEGG that cold acclimation promoted the purine metabolism of scallops, while dry exposure inhibited the metabolism of saturated fatty acids. Besides, in this study, the infrared sensing mode was used for the first time to record the heart rate changes of the scallops during circulation, which provides feasibility for the nondestructive vitality monitoring of Lamellibranchia.

Various vaccines have been developed in response to the SARS-CoV-2 pandemic, and the safety of vaccines has become an important issue. COVID-19 vaccines-related central nervous system inflammatory demyelinating diseases (CNS IDDs) have been reported recently. We present one case of AstraZeneca vaccine-related myelin oligodendrocyte glycoprotein (MOG) antibody-associated disease and literature review another 78 patients published from January 2020 to October 2022. Patients were divided into three vaccine groups (viral vector, mRNA and inactivated vaccines) for further analyses. Among 79 patients with COVID-19 vaccines-related CNS IDDs, 49 (62%) cases received viral vector vaccines, 20 (25.3%) received mRNA vaccines and 10 (12.7%) received inactivated vaccines. Twenty-seven cases (34.2%) were confirmed with autoantibodies, including 15 patients (19%) with anti-MOG, 11 (13.9%) with anti-aquaporin 4 (AQP4), and one (1.3%) with both antibodies. Significantly, more males developed CNS IDDs post viral vector vaccines compared to mRNA and inactivated vaccines. Patients receiving mRNA vaccines were older than other groups. Furthermore, mRNA and inactivated vaccines correlated more with anti-AQP4 antibodies, while viral vector vaccines showed higher MOG positivity. The research suggests potential associations between COVID-19 vaccines-related CNS IDDs and gender, age, and autoantibodies, contingent on vaccine types. Protein sequence analysis implies similarities between the S protein and AQP4/MOG. Further studies may elucidate the mechanisms of CNS IDDs, aiding vaccine selection for specific groups.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Taiwan’s auditors have suffered from processing excessive audit data, including drawing audit evidence. This study advances sampling techniques by integrating machine learning with sampling. This machine learning integration helps avoid sampling bias, keep randomness and variability, and target the risker samples. We first apply a Naive Bayes classifier to classify data into some classes. Next, a user-based, item-based, or hybrid approach is employed to draw audit evidence. The representativeness index is the primary metric for measuring the representativeness of audit evidence. The user-based approach denotes the selection of samples between two percentiles in a class as audit evidence. It may be equivalent to a combination of monetary and variable sampling methods. The item-based approach represents the choice of risky samples as audit evidence. It may be identical to a combination of non-statistical and monetary sampling methods. Auditors can hybridize those user-based and item-based approaches to balance representativeness and riskiness in selecting audit evidence. Three experiments show that sampling using machine learning integration has the benefits of drawing unbiased samples, handling complex patterns, correlations, and unstructured data, and improving efficiency in sampling big data. However, the limitations are the classification accuracy output by machine learning algorithms and the range of prior probabilities.

Mechanical ventilation (MV), used in patients with acute lung injury (ALI), induces diaphragmatic myofiber atrophy and contractile inactivity, termed ventilator-induced diaphragm dysfunction. Phosphoinositide 3-kinase- (PI3K-) is crucial in modulating fibrogenesis during the reparative phase of ALI; however, the mechanisms regulating the interactions among MV, myofiber fibrosis, and PI3K- remain unclear. We hypothesized MV with or without bleomycin treatment would increase diaphragm muscle fibrosis through the PI3K- pathway. Five days after receiving a single bolus of 0.075 units bleomycin intratracheally, C57BL/6 mice were exposed to 6 or 10 mL/kg MV for 8 h after receiving 5 mg/kg of AS605240 intraperitoneally. In wild-type mice, bleomycin exposure followed by MV 10 mL/kg prompted significant increases in disruptions of diaphragmatic myofibrillar organization, transforming growth factor-1, oxidative loads, Masson’s trichrome staining, extracellular collagen levels, positive staining of -smooth muscle actin, PI3K- expression, and myonuclear apoptosis (P < 0.05). Decreased diaphragm contractility and peroxisome proliferator activated receptor- coactivator-1 levels were also observed (P < 0.05). MV-augmented bleomycin-induced diaphragm fibrosis and myonuclear apoptosis were attenuated in PI3K-γ-deficient mice and through AS605240-induced inhibition of PI3K- activity (P < 0.05). MV-augmented diaphragm fibrosis after bleomycin-induced ALI is partially mediated through PI3K-γ. Therapy targeting PI3K-γ may ameliorate MV-associated diaphragm fibrosis.

Multi-threshold image segmentation is a relevant research field in further higher-level image preprocessing and computer vision. This paper adopts the Bayesian Forecasting Evolutionary Algorithm (BFEA) for natural scenery image segmentation using multilevel thresholding. An update method for the prediction vector is designed for image segmentation. The design idea of the BFEA algorithm for multilevel thresholding is based on the basic principle of Evolutionary Computation, the probability distribution of promising solutions, and the Bayesian theorem. BFEA could effectively solve the curse of dimensionality. Extensive experiments have demonstrated that the proposed algorithm dominated the state-of-the-art population-based thresholding method in term of the quality of image, function fitness value, optimal threshold value, SSIM value, PSNR value, computation time, dimensionality issue and convergence rate. The proposed method is very effective for color image segmentation.

According to many research groups, high glucose induces over production of superoxide anions, and reactive oxygen species (ROS) in general is the link between high glucose levels and the toxicities seen at cellular levels. Respiratory complex anomalies could lead to the production of ROS. Calcium [Ca2+], at physiological levels serves as a second messenger in many physiological functions. Accordingly, mitochondrial calcium [Ca2+]m overload leads to ROS production which could be lethal to the mitochondria through various mechanisms. The F1F0-ATPase (ATP syn-thase or complex V) is the enzyme that is responsible for catalyzing the final step of oxidative phosphorylation. It does so by coupling the translocation of protons in the mitochondrial in-termembrane space and shuttling them to the mitochondrial matrix for ATP synthesis to take place. Mitochondrial complex V T8993G mutation specifically blocks the translocation of protons across the intermembrane space thereby blocking ATP synthesis leading to Neuropathy, Ataxia and Retinitis Pigmentosa Syndromes (NARP). This study seeks to explore the possibility of [Ca2+]m overload mediating the pathological roles of high glucose in defective respiratory chain mediated mitochondrial stress. The NARP cybrids are the in vitro experimental models for the cells with F1FO-ATPase defects, these cells harbor 98% of mtDNA T8993G mutation. Their coun-terparts 143B osteosarcoma cell lines are the parental cell lines used for comparisons. We uncov-ered that, NARP cells mediated and enhanced the death of the cells (apoptosis) when incubated with hydrogen peroxide (H2O2) and high glucose respectively as depicted by the MTT assay of cell viability. Furthermore, using the fluorescence probe-coupled laser scanning confocal imag-ing microscopy, NARP cells significantly enabled mitochondrial reactive oxygen species (mROS) formation and enhanced the depolarization of the mitochondrial membrane potential (ΔΨm). Elucidating the mechanisms of sugar enhanced toxicity on mitochondria would help in the fu-ture to alleviate the symptoms of patients associated with (NARP) syndromes.

Antibiotic beads were used to treat surgical infections. In this study, polylactide–polyglycolide (PLGA) was mixed with vancomycin, osteogenic enhancer lithium chloride (LiCl), and hot com-pressing to form PLGA-vancomycin-LiCl delivery beads to treat bone infection. An elution method was employed to characterize the in vitro release characteristics of the vancomycin and the Li over a 42-day period. The released profiles lasted for more than 42 days for vancomycin and 28 days for Li. The concentration of vancomycin in each sample was well above the breakpoint sensitivity. Lithium co-treatment enhanced the bactericidal effect of vancomycin. Released Li and vancomycin increased mRNA or protein expressions of osteogenic markers of mesenchymal stem cells (MSCs). In vivo, the PLGA delivery systems were implanted into the rabbit distal femoral cavities and the cavity fluid content was aspirated and analyzed at each time point. The released Li and vancomycin lasted more than 6 weeks, and vancomycin concentrations were much above the breakpoint sensitivity. Four rabbits in each group were killed at 8 weeks for histologic observation. More mature bone tissue was shown in the Li treatment group. This study provides a PLGA drug delivery system to meet the requirements of patients with bone infections.

Seedling emergence is crucial for the establishment and growth of crops and is influenced by topsoil temperature and moisture. Mulching has been widely used to promote seedling emergence in areas with a cold spring. This study was conducted to determine and simulate the effects of transparent plastic film mulch on surface soil moisture, temperature, and seedling emergence of spring maize in Northwest China. Four treatments were used: no mulching (CK), full plastic film mulch (PMF), and partial plastic film mulch, 60 cm in width (PM60, 40 cm uncovered between rows of mulch) or 30 cm in width (PM30, 20 cm uncovered between rows of mulch). The effects of soil water conservation and temperature enhancement gradually decreased as the plastic film width decreased, but there was little difference between PMF and PM60 treatments. Soil-water-modified growing degree days (WGDD) described the beneficial effects of soil moisture and temperature with respect to seedling emergence under mulching conditions. Plastic film mulching markedly accelerated seedling emergence and increased final seedling emergence rate because mulching can shorten the autotrophy duration and maintain surface soil moisture, which leads to increased germination. The effects of seedling emergence improvement decreased as the plastic film width decreased. The relationship between WGDD and cumulative relative seedling emergence (CRE) was adequately described by a Gompertz function.

This paper introduces a novel framework for zero-shot learning (ZSL), i.e., to recognize new categories that are unseen during training, by distilling knowledge from foundation models. Specifically, we first employ ChatGPT and DALL-E to synthesize reference images of unseen categories from text prompts. Then, the test image is aligned with text and reference images using CLIP and DINO. Finally, the predicted logits are aggregated according to their confidence to produce the final prediction.Experiments are conducted on multiple datasets, including CIFAR-10, CIFAR-100, and TinyImageNet. The results demonstrate that our model can significantly improve classification accuracy compared to previous approaches, achieving AUROC scores above 96\% across all test datasets. Our code is available at https://github.com/1134112149/MICW-ZIC.

Entanglement is one of the most striking features in quantum systems. Today, quantum entanglement plays a vital role in quantum technology, the non-classical correlation of quantum entanglement is an important resource for quantum communication and quantum computing. Entanglement can be divided into two categories: between multi-particle systems and between various degrees of freedom in a single-particle system (intraparticle entangled states). This work first analogized the distinctions and connections between two kinds of entangled states. Then it designed three types of entanglement-swapping methods based on Bell state joint measurement, cross-Kerr medium, and linear optical elements for intraparticle entangled states by analogizing the entanglement swapping between multiple particles. Intraparticle entanglement swapping can be applied in super quantum dense encoding, quantum information transmission, and quantum teleportation. This work is beneficial for promoting the development of quantum information technologies.

Xinjiang, as a climate-sensitive region in northwest China, holds significant importance in studying extreme weather events for agricultural production and socioeconomic development. Based on data from 52 meteorological stations and 23 extreme climate indicators in Xinjiang from 1960 to 2021, the 5a moving average, linear trend estimation, climate tendency rate, and GIS spatial analysis methods are used to analyze the distribution and change characteristics of extreme climate. The results revealed that from 1960 to 2021, TXx, TNx, TXn, TNn, FD, ID, TN10p, TX10p, and WSDI showed a significant upward trend, while SU, TR, TN90p, TX90p, and CSDI showed a significant downward trend. What is more, the range of changes in the extreme temperature indexes from 1990 to 2021 is higher than that of 1960 to 1989. The high-value areas of extreme indexes are primarily concentrated in the northern part, while the high-value areas of cold event indexes are mainly distributed in the southern part. The upward/downward trends all accounting for over 80.00% of the entire region. The Rx1day, Rx5day, PRCPTOT, R95p, R99p, R10, R20, and R25 showed a significant growth trend from 1960 to 2021, and the range of change in the extreme precipitation indexes from 1990 to 2021 was lower than that from 1960 to 1989. Moreover, their high-value areas and high climate tendency areas are mainly concentrated in the northern and western parts of Xinjiang, with upward trends all accounting for over 71.00% of the entire region. The research results provide theoretical foundations for formulating climate risk strategies in the northwest region of China.

Chronic obstructive pulmonary disease (COPD) patients are particularly susceptible to respiratory infections like influenza, which exacerbate symptoms and increase healthcare utilization. While smoking cessation and influenza vaccination are recommended preventive measures, their combined impact on healthcare resource utilization is underexplored. The Charlson Comorbidity Index (CCI) assesses comorbidity burden in COPD patients and may influence healthcare outcomes. We conducted a retrospective analysis of 357 COPD patients, evaluating smoking cessation success over one year and influenza vaccination receipt, stratifying patients by CCI scores. Healthcare utilization outcomes included emergency room visits, hospitalizations, and medical expenses. Results showed that 51.82% of patients quit smoking and 59.66% received influenza vaccination, with higher comorbidity prevalence in advanced COPD stages (p=0.002). Both smoking cessation and influenza vaccination independently correlated with decreased emergency room visits, hospital admissions, days, and costs. Patients who both quit smoking and received influenza vaccination exhibited the lowest healthcare utilization rates. In conclusion, smoking cessation and influenza vaccination significantly reduce healthcare resource utilization in COPD patients, with the combination yielding synergistic benefits, particularly in those with lower CCI scores. Integrating these interventions and comorbidity management in COPD strategies is essential for optimizing patient outcomes and healthcare efficiency.

A fast and effective determination method of different species of vegetable seeds oil is vital in the plant oil industry. The near-infrared reflectance spectroscopy (NIRS) method was developed in this study to massively analyze the oil and moisture contents of Camellia gauchowensis Chang and C. semiserrata Chi seeds kernels. In the prediction models of NIRS, the levels of accuracy obtained were sufficient for C. gauchowensis Chang and C. semiserrata Chi, the correlation coefficient of which oil were 0.983 and 0.962, respectively, while which of moisture were 0.937 and 0.907, respectively. The near infrared spectrum of crush seeds kernels was more precise compared to intact kernels. Based on the calibration models of the two Camellia species, the NIRS predictive oil contents of C. gauchowensis Chang and C. semiserrata Chi seeds kernels were 48.71 ± 8.94% and 31.71 ± 7.39%, respectively, and the NIRS predictive moisture contents were 4.39 ± 1.08% and 3.49 ± 0.71%, respectively. Compared with the traditional chemical measurement, the rapid, precise measurement of oil and moisture of C. gauchowensis Chang and C. semiserrata Chi seeds kernels can be actualized by NIRS method.

Ginkgolic acids (GA) have been reported to exhibit anticancer properties, however, the mechanisms remain unclear. This study aims to investigate the mechanisms of GA C13:0 that was isolated from Ginkgo biloba exocarp (GBE) for anti-proliferation, pro-apoptosis and anti-migration effects in human MCF-7 and mouse 4T-1 breast cancer cells. The cytotoxic effect, apoptosis induction and migration inhibition were measured using MTT, TUNEL and Wound healing assays. The expression of mRNA and protein were determined using qPCR and Western blot. Our results showed that no cytotoxicity was found at concentrations of C13:0 below 100µM. The effects of GA C13:0 was further demonstrated by up-regulation of the Bax/Bcl-2 apoptosis pathway and the expression of Apaf-1 protein in the mitochondria. In addition, GA C13:0 also suppressed cell migration and epithelial to mesenchymal transition (EMT) with the increase of E-cadherin expression accompanied by the decrease of Snail, MMP-2, MMP-9 and Vimentin expression. Moreover, GA C13:0 induced cytochrome P450 (CYP) 1B1 expression in aryl hydrocarbon receptor (AhR) pathway. Notably, the up-regulation of CYP1B1 also might play a pivotal regulatory role in mitochondrial and EMT pathways in MCF-7 and 4T-1 cells. Our results may have implications for the development of anticancer agents containing GA as functional additives.

Two-dimensional (2D) of transition metal dichalcogenides (TMDCs) are potential candidates for thermoelectric (TE) applications due to their unique structural properties. In this paper, we constructed an 2D monolayer TMDCs semiconductor γ-PbSn2(X=S, Se, Te) and first-principles calculations and Boltzmann transport theory are used to study the thermoelectric performance. We found that γ-PbSnX2 had an ultra-high carrier mobility up to 4.04×103 cm2V−1s−1 leading to a metal-like electrical conductivity. Meanwhile, γ-PbSnX2 both have high Seebeck coefficients, resulting in high power-factors, and also shows intrinsic low lattice thermal conductivity of 6-8 W/mK at room temperature. The lower lattice thermal conductivity and high power-factors resulted in excellent thermoelectric performance. The high ZT values of γ-PbSnS2 and γ-PbSnSe2 were as high as 2.65 and 2.96 at 900 K, respectively. The result suggests that the monolayer γ-PbSnX2 are better candidates for excellent thermoelectric performance.

Antibiotic-loaded bone cement (ALBC) plays a pivotal role in infection prevention and treatment related to musculoskeletal surgery. The release efficacy of antibiotics from ALBC is closely tied to its surface area, yet little is known about the effective release depth. To investigate the relationship between surface area, volume, and antibiotic elution, spheric ALBC specimens with consistent outer diameters but different internal metal sphere diameters were prepared. Two vancomycin doses were utilized in ALBC specimens with an outer diameter of 35 mm: high (4 g) and low (1 g). Each dosage group included five specimens containing embedded metal spheres with diameters of 15, 25, 29, 32, or 33 mm. The resulting shell-like ALBC specimens had thicknesses of 10 mm, 5 mm, 3 mm, 1.5 mm, or 1 mm, respectively. The specimens were immersed in sterile phosphate buffer solution, and antibiotic elution was measured at designated sampling times (1, 3, 6, 10, 24, 48, 72, and 168 hours). Methylene blue was employed to visualize penetration depth. Vancomycin elution did not display statistically significant differences between high- and low-dose groups. In both groups, specimens with 1 mm thickness exhibited a higher vancomycin release efficiency (high-dose group: 18560±5474 μg, 6.7%; low-dose group: 2017±419 μg, 2.6%), decreasing sharply in thicker ALBC specimens. Methylene blue penetration depth showed no apparent difference between high-dose and low-dose groups. ALBC thickness does not significantly impact antibiotic elution, while surface area and antibiotic dose exert notable effects. These in vitro findings offer potential applications in clinical treatments for musculoskeletal infections.

The log interpretation and evaluation of Chang 8 tight sandstone reservoir in Longdong West area, Ordos Basin, is facing great challenges due to the existence of low resistivity contrast oil pays. To better guide the exploration of oil resources in this area, the characteristics and control mechanism of low resistivity contrast oil pays were studied in this research. Firstly, according to the relative value of apparent resistivity increase rate of the target formation, the reservoir was divided into two types: low resistivity contrast oil pay (LRCP) and high resistivity oil pay (HRP). Then, the reservoir characteristics were studied by comparing and analyzing the experimental data, formation water data and logging data collected from the two reservoir types. On this basis, the control mechanism of LRCP was studied and summarized into reservoir micro factors and regional macro factors, respectively. It is found that the reservoir rock composition between LRCP and HRP is basically the same. Compared with HRP reservoir, the average porosity and permeability of LRCP reservoir are relatively better, but the pore structure is relatively poorer because of the high content of micro pores. When the filling pressure of crude oil is sufficient enough, the high oil saturation can be formed in LRCP reservoir. The high irreducible water saturation and high formation water salinity are the main micro factors reduced the reservoir resistivity. Besides, the difference of hydrocarbon expulsion capacity of source rock and the regional difference of formation water salinity are the macro factors influenced the distribution of LRCP and HRP from vertical and horizontal of the region. The formation of LRCP is controlled by the comprehensive influence of reservoir micro factors and regional macro factors. And the comprehensive consideration of the influence of micro factors and macro factors on LRCP is suggested during the log interpretation and evaluation.

In Taiwan, mountainous areas account for approximately two-thirds of the total area. The steep terrain and concentrated rainfall during typhoons cause landslides, which pose a considerable threat to mountain settlements. Therefore, models for analyzing rainfall-induced landslide hazards are urgently required to ensure adequate land use in mountainous areas. In this study, focusing on Pingtung County in southern Taiwan, we developed a landslide hazard index (IRL) to land use. Using FORMOSA-2 and SPOT-5 satellite images, data were collected before and after four typhoons (one in 2009 and three in 2013). The ArcGIS random tree classifier was used for interpreting satellite images to explore surface changes and disasters, which were used to analyze slope disturbances. The product of the maximum 3-h rolling rainfall intensity and effective accumulated rainfall was used as a rainfall trigger index (IRT). Considering environmental and slope disturbance factors, an index of slope environmental strength potential (ISESP) was developed through logistic regression (LR). Landslide hazard to land use was estimated using IRT and ISESP. The average coefficient of agreement (Kappa) was approximately 0.71 (medium to high accuracy); the overall accuracy of slope environmental strength potential analysis was approximately 80.4%. At a constant ISESP, IRT increased with the increasing hazard potential of rainfall-induced landslides. Furthermore, IRT and ISESP were positively correlated with landslide occurrence. When large ISESP values occur (e.g., fragile environment and high land development intensity), small IRT values may induce landslides.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

The objective of this work is to analyze the improvement of heat transfer in trapezoidal fin heat exchangers using numerical simulation. Heat exchangers are essential components frequently used in contemporary electronic gadgets to effectively disperse heat produced by high-power components. Nevertheless, as electronic devices continue to advance and become more powerful, the heat transfer capacity of heat exchangers is facing more requirements, therefore requiring enhanced heat dissipation efficiency. Afterwards, various fin angles were adjusted, and the heat transmission efficiency was compared. Modifying the angles can significantly improve the effi-ciency of convective heat dissipation. Moreover, it has been found that employing an optimized trapezoidal fin structure can further enhance the efficiency of heat transfer. The results indicate that trapezoidal fin heat exchangers provide superior heat dissipation efficiency compared to conventional heat exchangers. This is important for enhancing the thermal dissipation capabili-ties of electrical gadgets, hence guaranteeing steady functionality and extending their longevity. Subsequent study might explore supplementary methods to boost heat transmission in different heat exchanger configurations in order to meet the growing requirements for heat dissipation.

Globally increasing antibiotic resistance has been connected to the use of antibiotics in medical, veterinary, and agricultural medicine, contributing to the burden of antibiotic resistance in Asia and Europe. The main objective of this study was to correlations of antimicrobial-resistant of various pathogens in three compartments: humans, animals and the environment in India and Germany. A systematic search was carried out in Medline via PubMed, Google Scholar, and science direct, including studies published in 2022. Out of 532 papers, 24 were considered for meta-analysis. This study reveals that in India, β-lactam is highly resistant in animals. Quinolone, on the other hand, was highly resistant in humans. Furthermore, in the environment and integrated studies, aminoglycosides and β-lactams is resistant. While in Germany, a high rate of AMR resistance in all three sectors was reported in β-lactam. However, E. coli was the most frequent pathogen in both countries and is highly resistant to β-lactam, followed by cephalosporin in all the compartments. Monitoring and evaluating antibiotic-sensitivity patterns and developing proper antibiotic regimens may lead to improved outcomes for inhibiting and controlling E. coli infections in various parts of the world.

Human activities mostly impact the trend and direction of surface water, groundwater, and other river basin resources in the watershed in Africa. Human activities influence river flows and the water quality at both highlands and lowlands. A watershed is indeed a conserved area of land that collects rain and snow and empties or penetrates into ground water sources. The act of managing the activities around the watershed is the Integrated Watershed Management while considering the social, economic, and environmental issues, as well as community interests to manage water resources sustainably. These watersheds, river basins, and groundwater resources provide important services for communities and biodiversity. This paper reveals that the best way to protect groundwater resources is on a watershed basis using IWM. This technique enables us to handle a variety of concerns and objectives while also allowing us to plan in a complicated and uncertain environment. IWM involves cooperation and participation from a wide range of community interests and water users, including municipalities, companies, people, agencies, and landowners, for stakeholders' input to be successful. All of the strategies and plans are produced concerning one another, as well as the overall conditions of the watershed, local land uses, and specific issues.

The allocation of funding for higher education typically focuses on competition in neoliberal mechanisms. Surprisingly, much less attention has been paid to considering the effect of fund locations for sustainable development through public goods purposes in neoliberal contexts. This study aims to examine specific funding schemes and determine the influential factors impacting funding for teaching, research, and public goods transformation. Taking Taiwan's Higher Education Sprout Project (HESP) as an example, we explored the effect of policy initiatives on public goods transformation towards sustainable development. The data were collected from the Ministry of Education and Scopus databases. First, a regression analysis was conducted to determine which factors influence the effect of funding allocations in academic institutes. Second, we used logistic regression to detect the effects of the system and the sector. Third, we used partial least square structural equation modeling (PLS-SEM) to explore the causal effects among the selected impact variables on expected outcomes. Finally, we used the bootstrap method to demonstrate the model’s robustness. Our study found that only diversity was shown in private technology groups receiving less HESP funding. At the same time, it did not widen the differences in the sector and system in the transformation process. Our findings suggest that funding allocations will not affect teaching and research based on sectors and systems. In contrast, this study demonstrates that transforming public goods through special funding can play a critical role in leading sustainable development in higher education.

Abstract: Research Highlights: This study is among the first to investigate ozone levels in urban forests in China. It establishes that urban forest air quality in Yuanshan Forest Park, Shenzhen, is suitable for recreational activities and identifies spatial, seasonal, and diurnal O3 patterns and relationships with micrometeorological parameters, suggesting the possibility of manipulating relevant forest characteristics to reduce O3 levels. Background and Objectives: An understanding of O3 levels of urban forest environments is needed to assess potential effects on human health and recreational activities. Such studies in China are scarce. This study investigated urban forest O3 levels to improve understanding and support residents engaging in forest recreational activities. Materials and Methods: We monitored O3 levels in 2015–2016 for three urban forests representing common habitats (foothill, valley, and ridge) in Yuanshan Forest Park, Shenzhen, and for an adjacent square. Results: The overall mean daily and daily maximum 8-h mean (MDA8) O3 concentrations were highest for the ridge forest and lowest for the valley forest. Each forest’s O3 concentrations were highest in summer. Diurnally, forest O3 concentrations peaked between 13:00 and 17:00 and reached a minimum between 03:00 and 09:00. The correlation between forest O3 concentrations and air temperature (AT) was strongly positive in summer and autumn but negative in spring. In each season, O3 concentration was negatively correlated with relative humidity (RH). No MDA8 or hourly O3 concentrations in the forests exceeded National Ambient Air Quality Standard Grade I thresholds (100 and 160 μg m−3, respectively). Conclusions: O3 accumulation is present in ridge urban forest in all seasons. Foothill and valley urban forests have better air quality than ridge forestation. Urban forest air quality is better in spring and autumn than in summer and is better from night-time to early morning than from noon to afternoon.

This paper aims to develop a hierarchical risk assessment model using the newly-developed evidential reasoning (ER) rule, which constitutes a generic conjunctive probabilistic reasoning process. In this paper, we first provide a brief introduction to the basics of the ER rule and emphasize the strengths for representing and aggregating uncertain information from multiple experts and sources. Further, we discuss the key steps of developing the hierarchical risk assessment framework systematically, including (1) formulation of risk assessment hierarchy, (2) representation of both qualitative and quantitative information, (3) elicitation of attribute weights and information reliabilities, (4) aggregation of assessment information using the ER rule and (5) quantification and ranking of risks using utility-based transformation. The proposed hierarchical risk assessment framework can potentially be implemented to various complex and uncertain systems. A case study on the fire/explosion risk assessment of marine vessels demonstrates the applicability of the proposed risk assessment model.

Abstract. Graphene family (GF)-Calcium phosphate (CaP) composites, holds great potential as components of bone regeneration materials. GF nanomaterials can be modified physically as well as chemically, which are to be biomimetic, mechanically to be hard due to their capability to support exceptional mechanical, thermal and electronic properties. These biocompatible GF composites coated on the calcium phosphate can enhance and tolerate stem cell growth and differentiation, proliferation into various lineages or interact with bioorganisms. The development in CF-CaP materials and their physicochemical/biointeractions and strategies towards osteoblasts is a great concern to promote faster healing and reconstructions of large bone imperfections or defects. In this review, we explain the influence of the CF-CaP and summarize recent developments on designing CF-CaP architectures as multifunctional bone regeneration platforms. We have also explored the typical biological applications concerning these CF-CaP based bioactive nanocomposites. Furthermore, the future viewpoints and evolving challenges will also be emphasized. Due to the shortage of full-length reviews in this emerging research field, this review would be caught great attention and encourage various new chances across a wider range of disciplines.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

As noted in the introductory quotation, an ideal map was long ago seen as the map of the map, the map of the map, of the map, and so on endlessly. This recursive perspective on maps, however, has received little attention in cartography. Cartography, as a scientific discipline, is essentially founded on Euclidean geometry and Gaussian statistics, which deal with respectively regular shapes, and more or less similar things. It is commonly accepted that geographic features – such as rivers, cities, streets and building – are not regular and that the Earth’s surface is full of fractal or scaling or living phenomena with far more small things than large ones at different levels of scale. This paper argues for a new paradigm in mapping, based on fractal or living geometry and Paretian statistics, and – more critically – on the new conception of space, conceived and developed by Christopher Alexander, that space is neither lifeless nor neutral, but a living structure capable of being more living or less living. The fractal geometry is not limited to Benoit Mandelbrot’s framework, but is extended towards Christopher Alexander’s living geometry and based upon the third definition of fractal: A set or pattern is fractal if the scaling of far more small things than large ones recurs multiple times. Paretian statistics deals with far more small things than large ones, so it differs fundamentally from Gaussian statistics, which deals with more or less similar things. Under the new paradigm, I make several claims about maps and mapping: (1) Topology of geometrically coherent things – in addition to that of geometric primitives – enables us to see a scaling or fractal or living structure; (2) Under the third definition, all geographic features are fractal or living, given the right perspective and scope; (3) Exactitude is not truth – to paraphrase Henri Matisse – but the living structure is; and (4) Töpfer’s law is not universal, but scaling law is. All these assertions are supported by evidence, drawn from a series of previous studies. This paper demands a monumental shift in perspective and thinking from what we are used to on the legacy of cartography and GIS.

Nuclear Magnetic Resonance (NMR) and its various forms are extensively utilized in both research and clinical settings to analyse molecules. NMR data pre-processing, while essential to NMR data analysis, can be uniquely complex. Despite the availability of software tools, understanding these processes can be challenging, complicating the selection of appropriate pre-processing steps. In this review, we elucidate pre-processing steps in the time domain from a mathematical and statistical perspective, explaining direct current offset removal, eddy current correction, shift and linear prediction, weighting, zero filling, and domain transformation using plain language and fundamental mathematical formulas. Our objective is to clarify these processes in simple terms and provide general guidance.

Magnetic Resonance Imaging (MRI) is widely used in clinics and research due to its accurate disease identification and non-invasive nature. MRI is based on Nuclear Magnetic Resonance (NMR), which is also extensively employed in various fields. NMR and its modern versions involve intricate pre-processing steps before data analysis. These steps are initially processed in the time domain and subsequently in the frequency domain. While our previous review focused on time domain pre-processing (https://www.preprints.org/manuscript/202310.2032/v1), this review delves into the mathematical and statistical aspects of frequency domain pre-processing. We discuss essential pre-processing steps like phase error correction, baseline correction, solvent filtering, calibration and alignment, reference deconvolution, binning/bucketing and peak picking, peak fitting/deconvolution and compound identification, integration and quantification, normalization and transformation. Furthermore, we offer practical recommendations for each step.

Entrepreneurship has been viewed as an opportunity for economic development and changing economic scenarios in global markets. Women are viewed as a reservoir of entrepreneurial talent, so they can be growth engines in novel markets. Previous studies have considered entrepreneurship as the most effective way towards the economic empowerment of women. Female students engaged in entrepreneurial education have been addressed persistently, while what transforms them in an education process is still unclear. Considering the transforming global economy and its influence on higher education, this study aims to detect female students transforming entrepreneurial competency, mindset, and intention into sustainable entrepreneurship. Using a self-compiled survey, we targeted 752 female students to investigate their entrepreneurial competency, mindset, and intention. SPSS and AMOS were used to transform the data for interpretation. We assumed that the impact of female students’ entrepreneurial competency could be modified by an entrepreneurial mindset and result in entrepreneurial intention. To detect this causal relationship, this study employed reliability, factor, structural equation modeling (SEM), and bootstrap-ping analyses to verify the evidence. The result of the SEM confirms that female students’ entrepreneurial competency will, through their entrepreneurial mindset, impact entrepreneurial intention. With bootstrapping, 5000 samples were collected, and it was demonstrated that the measure constructs were still reliable in the model. This study found that there is a mediation effect between entrepreneurial competency and entrepreneurial intention. The entrepreneurial mindset plays a crucial role in the transformation process. Without an entrepreneurial mindset, entrepreneurial competency cannot exert a significant effect on entrepreneurial intention. The findings can help reinvent related entrepreneurial education in higher education.

The increased consumption of high fat-containing foods has been linked to the prevalence of obesity and abnormal metabolic syndromes. Rhizopus oligosporus, a fungus in the family Mucoraceae, is widely used as a starter for homemade tempeh. Although R. oligosporus can prevent the growth of other microorganisms, it grows well with lactic acid bacteria (LAB). Lactobacillus plantarum can produce β-glucosidase, which catalyzes the hydrolysis of glucoside isoflavones into aglycones (with greater bioavailability). Therefore, the development of a soybean-based functional food by the co-inoculation of R. oligosporus and L. plantarum is a promising approach to increase the bioactivity of tempeh. In this study, the ameliorative effect of L. plantarum in soy tempeh on abnormal carbohydrate metabolism in high-fat diet (HFD)-induced hyperglycemic rats was evaluated. The co-incubation of L. plantarum with R. oligosporus during soy tempeh fermentation reduced the homeostatic model assessment of insulin resistance, HbA1c, serum glucose, total cholesterol, triglyceride, free fatty acid, insulin, and low-density lipoprotein contents and significantly increased the high-density lipoprotein content in HFD rats. It also increased the LAB counts as well as the bile acid, cholesterol, triglyceride, and short-chain fatty acid contents in the feces of HFD rats. Our results suggested that the modulation of serum glucose and lipid levels by LAB occurs via alterations in the internal microbiota, leading to the inhibition of cholesterol synthesis and promotion of lipolysis. Tempeh, produced with both L. plantarum and R. oligosporus, may be a beneficial dietary supplement for individuals with abnormal carbohydrate metabolism.

Commuting is a vital travel channel for college students throughout their higher education career; nevertheless, excessive commute time negatively impacts students’ school satisfaction, academic achievement, health, and quality of life. Meanwhile, few studies have explored students’ commute time, covering a large population and scope. Therefore, this study analyzes the dwelling type that influences college and graduate students’ school commute times in the Seoul Metropolitan Area, using data from the 2016 Household Travel Diary Survey. This study uses spatial data on housing development to classify five dwelling types (i.e., new town, housing site development, Seoul, Incheon, and Gyeonggi-do). A multiple linear regression model empirically analyses students’ household and personal characteristics. The results reveal that dwelling type significantly affects students’ commute time. Specifically, Students living in Seoul have a shorter commute to school than those living in new towns. Socioeconomic characteristics have less effect on college and graduate students' school commute time. This study discusses the problem of excessive commuting of college and graduate students in new towns.

As Christopher Alexander conceived and defined through his life’s work – The Nature of Order – wholeness is a recursive structure that recurs in space and matter and is reflected in human minds and cognition. Based on the definition of wholeness, a mathematical model of wholeness, together with its topological representation, has been developed, and it is able to address not only why a structure is beautiful, but also how much beauty the structure has. Given the circumstance, this paper is attempted to argue for the wholeness as the scientific foundation of sustainable urban design and planning, with the help of the mathematical model and topological representation. We start by introducing the wholeness as a mathematical structure of physical space that pervasively exists in our surroundings, along with two fundamental laws – scaling law and Tobler’s law – that underlie the 15 properties for characterizing and making living structures. We argue that urban design and planning can be considered to be wholeness-extending processes, guided by two design principles of differentiation and adaptation, to transform a space – in a piecemeal fashion – into a living or more living structure. We further discuss several other urban design theories and how they can be justified by and placed within the theory of wholeness. With the wholeness as the scientific foundation, urban design can turn into a rigorous science with creation of living structures as the primary aim.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

The Cav3.2 T-type calcium channel is implicated in various pathological conditions, including cardiac hypertrophy, epilepsy, autism, and chronic pain. Phosphorylation of Cav3.2 by multiple kinases plays a pivotal role in regulating its calcium channel function. The calcium/calmodulin-dependent serine/threonine phosphatase, calcineurin, interacts physically with Cav3.2 and modulates its activity. However, it remains unclear whether calcineurin dephosphorylates Cav3.2, the specific spatial regions on Cav3.2 involved, and the extent of the quantitative impact. In this study, we elucidated the serine/threonine residues on Cav3.2 targeted by calcineurin using quantitative mass spectrometry. We identified six serine residues in the N-terminus, II-III loop, and C-terminus of Cav3.2 that were dephosphorylated by calcineurin. Notably, a higher level of dephosphorylation was observed in the Cav3.2 C-terminus, where calcineurin binds to this channel. Additionally, a previously known CaMKII-phosphorylated site, S1198, was found to be dephosphorylated by calcineurin. Furthermore, we also discovered that a novel CaMKII-phosphorylated site, S2137, underwent dephosphorylation by calcineurin. In CAD cells, a mouse central nervous system cell line, membrane depolarization led to an increase in the phosphorylation of endogenous Cav3.2 at S2137. Mutation of S2137 affected the calcium channel function of Cav3.2. Our findings advance the understanding of Cav3.2 regulation not only through kinase phosphorylation but also via calcineurin phosphatase dephosphorylation.

The rapid advancement of large language models (LLMs), such as ChatGPT, has revolutionized natural language processing, enabling these models to generate coherent and contextually relevant text. These capabilities hold significant potential for various applications, particularly in the medical field. LLMs can assist healthcare professionals by providing accurate information, supporting diagnostic processes, and enhancing medical education. However, the implementation of LLMs in clinical settings faces several barriers, including technical limitations, ethical concerns, regulatory constraints, and practical challenges. Ensuring accuracy, reliability, and interpretability is crucial, along with addressing biases, ensuring data privacy, and establishing ethical guidelines. Future research should focus on improving training techniques, developing explainable AI methods, and creating efficient, resource-saving models. Expanding applications through domain-specific models and multi-modal integration can further unlock the potential of LLMs. By addressing these challenges and prioritizing responsible development, LLM technology can be safely and effectively integrated into various domains, driving innovation and improving outcomes. This paper explores the current state of LLM technology, its medical applications, barriers to implementation, and directions for future research and development

This study explores the public library service evaluation domain through user-generated content on Google Maps, highlighting digital feedback's significant yet underexplored potential in understanding public library patronage across Taiwan's six major cities. Utilizing a mixed-methods research design, this study integrates Google Maps review content analysis with Social Network Analysis to delineate public perceptions and identify areas for service enhancement in public libraries. It innovatively leverages personal experiences extracted from over 60,000 Google Maps reviews to evaluate public library services in cities such as Taipei, New Taipei, Taoyuan, Taichung, Tainan, and Kaohsiung. The research taps into the National Library of Taiwan's National Library Statistics System to provide a robust analysis of library performance and user satisfaction, offering a novel perspective by emphasizing user-centric feedback from Google Maps as a primary data source. This approach provides quantitative data on library usage and geographic distribution and enriches our understanding of the qualitative experiences of library users. In analyzing the keywords from Google Maps reviews of public libraries, we categorize and interpret these under the three core LibQUAL+ dimensions—Affect of Service, Information Control, and Library as Place. The findings expose variances in perceived service quality among the cities, with Kaohsiung and Taichung receiving the highest accolades for service satisfaction. Simultaneously, the study identifies potential areas for improvement, particularly in cities with lower satisfaction ratings like Taipei. This personalized feedback illustrates the intimate relationship between public libraries and their communities, offering invaluable insights for policymakers and library management to enhance service delivery and user experience.

Concrete cracks and local damage can affect the bond performance between concrete and steel bars, thereby reducing the durability of reinforced concrete structures. Compared with general concrete crack repair methods, biomineralization repair not only has effective bonding capabilities but is also particularly environmentally friendly. In view of this, this study aimed to apply biomineralization technology to repair damaged fiber-reinforced lightweight aggregate concrete (LWAC). Two groups of LWAC specimens were prepared. The control group used lightweight aggregates (LWAs) without bacterial spores and nutrient sources, and the experimental group used LWAs containing bacterial spores and nutrient sources. These specimens were first subjected to compression tests and pull-out tests, respectively, and thus were damaged. After the damaged specimen healed itself in different ways for 28 days, secondary compression and pull-out tests were conducted. The self-healing method of the control group involved placing the specimens in an incubator. The experimental group was further divided into experimental group I and experimental group II. The self-healing method of experimental group I was the same as that of the control group. The self-healing method of experimental group II involved soaking the specimen in a mixed solution of urea and calcium acetate for two days, and then taking it out and placing it in an incubator for two days, with a cycle of four days. The test results showed that, compared with the control group specimens, the relative bond strength ratio of the experimental group II specimens increased by 17.9%. Moreover, the EDS and XRD analysis results confirmed that the precipitate formed at the crack was calcium carbonate, which improved the compressive strength and bond strength after self-healing. This indicates that the biomineralization maintenance method used in experimental group II is more effective.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Abstract: Chronic Obstructive Pulmonary Disease (COPD) is a continually advancing respiratory disorder, characterized by enduring airflow limitation along with long-lasting inflammation in the airways. An expanding pool of evidence is emphasizing how mitochondrial dysfunction directly impacts the development and progression of COPD. This comprehensive review delves deeper into the intricate cellular and molecular biology of mitochondria within the framework of COPD, spotlighting significant alterations in structure and function that accompany mitochondrial dysfunction. In this narrative, we delve into the observed changes in mitochondrial shape, behavior, and respiratory chain complex alterations seen in individuals afflicted with COPD. The discussion includes implications on cellular signaling pathways and how this affects the natural process of programmed cellular death (apoptosis) and cellular aging, particularly in reference to COPD. Additionally, we consolidate ongoing therapeutic strategies, honing in on the management of COPD through a focus on mitochondrial dysfunction. Prominent among these strategies is the potential role of antioxidants and mitochondrial biogenesis inducers, which are emerging as promising fields of intervention. Furthermore, we embark on an overview of the possible use of mitochondrial biomarkers as innovative tools in diagnosing COPD, evaluating disease progression, and monitoring the efficacy of COPD treatments. As we unravel the rather complex interplay between mitochondrial biology and COPD, this review highlights the critical importance of formulating treatments that target mitochondrial dysfunction. The ultimate goal of these strategic interventions is to slow down the rate of COPD progression and significantly improve patient outcomes. Lastly, though our understanding of the nexus between COPD and mitochondrial dysfunction has significantly enhanced, ample scope remains for further investigation. Improved insights into the mechanisms of mitochondrial dysfunction, discovered biomarkers, and targeted therapies could encompass a revolutionary step towards comprehensive disease management. The future of COPD treatment seems to lean towards a combination of strategies, prioritizing not only the management of symptoms but also focused on preserving and restoring lung function, improving physical capacity, and enhancing quality of life for COPD patients.

Conceived and developed by Christopher Alexander through his life’s work: The Nature of Order, wholeness is defined as a mathematical structure of physical space in our surroundings. Yet, there was no mathematics, as Alexander admitted then, that was powerful enough to capture his notion of wholeness. Recently, a mathematical model of wholeness, together with its topological representation, has been developed that is capable of addressing not only why a space is good, but also how much goodness the space has. This paper develops a structural perspective on goodness of space – both large- and small-scale – in order to bridge two basic concepts of space and place through the very concept of wholeness. The wholeness provides a de facto recursive definition of goodness of space from a holistic and organic point of view. A space is good, genuinely and objectively, if its adjacent spaces are good, the larger space to which it belongs is good, and what is contained in the space is also good. Eventually, goodness of space – sustainability of space – is considered a matter of fact rather than of opinion under the new view of space: space is neither lifeless nor neutral, but a living structure capable of being more living or less living, or more sustainable or less sustainable. Under the new view of space, geography or architecture will become part of complexity science, not only for understanding complexity, but also for making and remaking complex or living structures.

The existence of palindrome numbers of arbitrary length greater than 2 that are divisible by the prime number 37 is proven in this paper. The method to construct such a palindrome is also described. It turns out that a palindrome number divisible by 37 is also divisible by 3 and, consequently, divisible by 111.

Frontotemporal dementia (FTD) is the second most common form of presenile dementia; however, its diagnosis has been poorly investigated. Previous attempts to diagnose FTD using quantitative electroencephalography (qEEG) have yielded inconsistent results in both spectral and functional connectivity analyses. This study aimed to introduce an accurate qEEG marker that could be used to diagnose FTD and other neurological abnormalities. We used open-access electroencephalography data from OpenNeuro to investigate the power ratio between the frontal and temporal lobes in the resting state of 23 patients with FTD and 29 healthy controls. Spectral data were extracted using a Fast Fourier Transform in the delta (1–4 Hz), theta (4–8 Hz), alpha (8–13 Hz), beta (13–32 Hz), and gamma (32–45 Hz) bands. We found that the spectral power ratio between the frontal and temporal lobes is a promising qEEG marker of FTD. Frontal/temporal (F/T) theta/alpha, alpha/theta, al-pha/gamma, and gamma/alpha showed a consistently high discrimination score for the diagnosis of FTD for different parameters and referencing methods. The study findings can serve as reference for future research focused on diagnosing FTD and other neurological anomalies.

Since first described by Dr. Tomisaku Kawasaki in 1967, the clinical diagnosis of Kawasaki disease (KD) has remained relatively unchanged. However, studies since then have suggested that diagnoses using only that original clinical criteria may lead to underdiagnosis. In this review, updated KD diagnostic methods, diagnostic methods for “atypical” KD, diagnostic pitfalls, and other differential diagnoses are discussed. Peripheral blood eosinophil showed important in distinguishing KD from febrile children. We review herein the current literature regarding new biomarkers, scoring systems, and microRNA panels that may aid in the diagnosis of KD, the importance of eosinophil and treatment updates.

The novel coronavirus 2019 (COVID-19) pandemic is rapidly advancing despite public health measures. Pharmaceutical prophylaxis is an established approach to potentially control infectious diseases and is one solution to the urgent public health challenge posed by COVID-19. Screening and development of new vaccines and antivirals is expensive and time consuming while the repositioning of available drugs should receive priority attention as well as international government and agency support. Here we propose an old drug chloroquine (CQ) to be urgently repositioned as an ideal antiviral prophylactic against COVID-19. CQ has ability to block viral attachment and entry to host cells. Its proven clinical efficacy against a variety of viruses including COVID-19 and its current deployment in COVID-19 therapeutic trials strengthens its potential candidacy as a prophylactic. Furthermore, CQ has a long safety record, is inexpensive and widely available. Here we reviewed CQ's antiviral mechanisms, its laboratory efficacy activity against COVID-19, as well as CQ's pharmacokinetics in its established use against malaria and autoimmune diseases to recommend safe and potentially efficacious dose regimens for protection against COVID-19: a pre-exposure prophylaxis of 250-500mg daily and post-exposure prophylaxis at 8mg/kg/day for 3 days. We recommend further urgent research on CQ for COVID-19 prevention and urge that the above regimens be investigated in parallel with mass deployment by relevant agencies in attempts to contain the pandemic without unnecessary regulatory delays as benefits far outweigh risks or costs.

Dynamic measurement error correction is an effective method to improve the sensor precision. Dynamic measurement error prediction is an important part of error correction, support vector machine (SVM) is often used to predicting the dynamic measurement error of sensors. Traditionally, the parameters of SVM were always set by manual, which can not ensure the model’s performance. In this paper, a method of SVM based on an improved particle swarm optimization (NAPSO) is proposed to predict the dynamic measurement error of sensors. Natural selection and Simulated annealing are added in PSO to raise the ability to avoid local optimum. To verify the performance of NAPSO-SVM, three types of algorithms are selected to optimize the SVM’s parameters, they are the particle swarm optimization algorithm (PSO), the improved PSO optimization algorithm (NAPSO), and the glowworm swarm optimization (GSO). The dynamic measurement error data of two sensors are applied as the test data. The root mean squared error and mean absoluter percentage error are employed to evaluate the prediction models’ performances. The experiment results show that the NAPSO-SVM has a better prediction precision and a less prediction errors among the three algorithms, and it is an effective method in predicting dynamic measurement errors of sensors.

Zearalenone is one of the most prevalent estrogenic mycotoxins produced mainly by Fusarium family fungi, and harmed the heath of animals. Zearalenone hydrolase is an important enzyme capable of degrading zearalenone into a non-toxic compound. Although previous research has investigated the catalytic mechanism of zearalenone hydrolase, information on its dynamic interaction with zearalenone remains unknown. This study aimed to develop a pipeline for identifying the allosteric pathway of zearalenone hydrolase. Using an identity analysis, we identified hub genes whose sequences can generalize a set of sequences in a protein family. We then utilized a neural relational inference (NRI) model to identify the allosteric pathway of the protein throughout the entire molecular dynamics simulation. The production run lasted 1 microsecond, and we analyzed residues 139-222 for the allosteric pathway using the NRI model. We found that the cap domain of the protein opened up during catalysis, resembling a hemostatic tape. We used umbrella sampling to simulate the dynamic docking phase of the ligand-protein complex and found that the protein took on a square sandwich shape. Our energy analysis using both MMPBSA and PMF analysis showed discrepancies, with scores of -8.45 kcal/mol and -1.95 kcal/mol, respectively. MMPBSA, however, obtained a similar score to that of a previous report.

Accurate and reliable mid-long runoff prediction (MLTRP) is of great importance in water re-sources management. However the MLTRP is not suitable in each basin and how to evaluate the applicability of MLTRP is still a question. Therefore, the total mutual information (TMI) index is developed in this study based on the predictor selection method using mutual information (MI) and partial MI (PMI). The relationship between the TMI and the predictive performance of five models is analyzed by applying five models in 222 forecasting scenarios in Australia. The results over 222 forecasting scenarios demonstrate that, compared with the MI, the developed TMI index can better represent the available information in the predictors, and has more significant negative correlation with the RRMSE with the correlation coefficient between -0.62 and -0.85. This means the model's predictive performance will become better along with the increase of TMI, and there-fore the developed TMI index can be used to evaluate the applicability of MLTRP. When TMI is more than 0.1, the available information in the predictors can support the construction of MLTRP models. In addition, the TMI is used to partly explain the difference of predictive performance among five models. In general, the complex models, which can better utilize the contained infor-mation, are more sensitive to the TMI, and have more significant improvement in terms of predic-tive performance along with the increase of TMI. This research can provide support for the study of MLTRP.

The value of an NBA basketball player varies at each crucial point in time, depending on the player’s career and performance. This study constructs a player’s value assessment model. The model comprises two parts. First, from an objective perspective, entropy is employed to measure each player’s achievement in five categories—rebounds, assists, steals, blocked shots, and scores. The total entropy assessment value is calculated and then combined with the players’ scores to develop a player's value matrix to assess the relative value model among players of the same type.

In order to quickly develop a multi ship collaborative collision avoidance plan in multi ship encounter scenarios, a multi ship collision avoidance decision model is proposed in accordance with the requirements of the International Maritime Collision Avoidance Regulations, taking into account the collision avoidance operations in multi ship encounter scenarios. Firstly, the collision risk between ships is determined by the closest encounter distance (DCPA) and closest encounter time (TCPA). Secondly, a decision objective function is established based on rules, degree of ship deviation, and ship risk. Finally, the prediction mechanism is used to calculate the minimum value of the objective function and complete the collision avoidance decision. The simulation results show that in the scenario of multiple ship encounters, the collision avoidance model can achieve safe collision avoidance with a smaller steering frequency and a shorter col-lision avoidance time. The proposed multi ship collision avoidance model can provide reference for collision avoidance decision-making in multi ship encounter scenarios, which helps to im-prove the collision avoidance efficiency in multi ship collision avoidance

In Taiwan, colorectal cancer is ranked second and third in terms of mortality and cancer incidence, respectively. In addition, medical expenditures related to colorectal cancer are considered to be the third highest. While advances in treatment strategies have provided cancer patients with longer survival, potentially harmful second primary cancers can occur. Therefore, second primary colorectal cancer analysis is an important issue with regard to clinical management. In this study, a novel predictive scheme was developed for predicting the risk factors associated with second colorectal cancer in patients with colorectal cancer by integrating five data mining classification techniques, including support vector machine, random forest, multivariate adaptive regression splines, extreme learning machine, and extreme gradient boosting. In total, 4,287 patients in the datasets provided by three hospital tumor registries were used. Our empirical results revealed that this proposed predictive scheme provided promising classification results and the identification of important risk factors for predicting second colorectal cancer based on accuracy, sensitivity, specificity, and area under the curve metrics. Collectively, our clinical findings suggested that the most important risk factors were the combined stage, age at diagnosis, BMI, surgical margins of the primary site, tumor size, sex, regional lymph nodes positive, grade/differentiation, primary site, and drinking behavior. Accordingly, these risk factors should be monitored for the early detection of second primary tumors in order to improve treatment and intervention strategies.

The application of Virtual Reality in a driving simulation is not novel, yet little is known about the use of this technology by senior populations. The effects of age, sex, control device (joystick or handlebar), and task type on wayfinding proficiency using a virtual reality (VR) driving simulation were explored. The driving experimental model involved 96 randomly recruited participants, including 48 young people and 48 seniors (split evenly by gender in each group). The experimental results and statistical analyses indicate that in a VR driving scenario task type significantly affected VR driving performance. Navigational scores were significantly higher for the straight (easy) task than for the curved (difficult) task. The aging effect was the main reason for significant and interacting effects of sex and control device. It was found that interactions between age and sex difference indicated that the young group exhibited better wayfinding performance than the senior group, and in the young group males had better performance than females. Similarly, interactions between age and control device indicated that the handlebar control device type resulted in better performance than the joystick device in the young group, but no difference was found in the senior group due to age or learning effects. Findings provide an understanding of the evaluation of the interface designs of navigational support systems, taking into consideration any effects of age, sex, control device, and task type within three-dimensional VR games and driving systems. With a VR driving simulator, seniors can test drive inaccessible products, such as electric bicycles or cars, using a computer at home.

Among the plethora of financial management tools available, stock investments stand out as the most recognizable and widely accepted option. However, investors often make buying and selling decisions based on unverified information provided by stock analysts. Since the credibility of this information remains uncertain, it frequently results in investment losses. Ordinary investors relying solely on rumors often miss out on prime opportunities for buying and selling stocks. In the current volatile investment landscape, various investment strategies cater to different situations. If individuals can effectively identify opportunities within this complex environment and dynamically adapt suitable investment strategies at any given time, substantial returns can be achieved. The ability of investors to promptly detect shifts in the current stock market environment and make accurate decisions regarding stock selection, timing, and capital allocation strategies is of utmost importance. This study presents a dynamic framework for investment decision support, which utilizes evolutionary strategies to determine the optimal timing for key strategic tools such as stock selection, timing, and capital allocation. By leveraging historical data for training and testing, this approach aims to assist investors in adapting to the ever-changing stock market environment. If investors can successfully identify and implement an appropriate investment strategy to aid in making accurate decisions, it is possible to achieve significant excess returns.

A novel nano-laminated GdB2C2 material was successfully synthesized using GdH2, B4C, and C via an in-situ solid state reaction approach for the first time. The formation mechanism of GdB2C2 was revealed based on the microstructure and phase evolution investigation. A purity of 96.4 wt. % GdB2C2 was obtained at a low temperature of 1500 ℃, while a near full pure GdB2C2 can be obtained at a temperature over 1700 ℃. The as-obtained GdB2C2 presented excellent thermal stability at high temperature of 2100 ℃ in Ar atmosphere due to the stable frame work formed by the high covalent four-members and eight-members B-C rings in GdB2C2. The minimum reflection loss value (RLmin) of -47.01 dB with an effective absorption bandwidth (EAB) of 1.76 GHz at a thickness of 3.44 mm was obtained for the GdB2C2 synthesized at 1500 ℃. The possible EMWA mechanism could be ascribed to the nano-laminated structure and appropriate electrical conductivity, which facilitated to the good impedance matching, remarkable conduction loss, interfacial polarization as well as multiple interface reflection and scattering. The as-obtained GdB2C2, with excellent EMWA performance as well as remarkable ultra-high temperature thermal stability, could be a promising candidate for the EMWA materials applications in extreme ultra-high temperatures.

Nowadays, considering the growing tendency of companies towards e-commerce as well as green production, and dual-channel green supply chain management has become particularly important. This paper investigates pricing decisions within a dual-channel green supply chain framework while considering the capital constraints faced by risk-averse manufacturer. Simultaneously, the impact of the degree of risk aversion, consumer green preferences, and channel preferences on the optimal decision-making process of green supply chain members is analyzed. We address the issue of financial constraints faced by manufacturer through bank loans and trade credit financing and compare the two cases. Our findings illustrate that trade credit financing outperforms bank loan financing in the dual-channel green supply chain. Moreover, pricing decisions under different models are influenced by consumer preferences and risk aversion. Specifically, the greenness of the product, wholesale price, and sale price exhibit negative correlations with manufacturers' risk aversion but positive correlations with consumer preferences.

Background: People with Down syndrome (DS) have a trisomy of chromosome 21 and marked deficits in verbal memory but relatively preserved visuospatial perception. Verbal memories are related to semantic knowledge. Little is known about the organization of semantic knowledge in people with DS, which was the aim of this study. Aims: The extent of false memory in people with DS was examined. Possible differences in the number of false memories induced by nominal and verbal themes were examined. Methods and Procedures: In the study phase, ten word lists with semantically related associates were presented. In the recognition phase, participants made judgments on whether each word had been represented previously as semantically related lures, old words, and semantically unrelated new words. Outcomes and Results: Differences in the processing of nominal and verbal theme-related lures were observed among people with DS. When processing nominal theme-related lures, people with DS showed delayed false positives. When processing verbal theme-related lures, people with DS showed no differences compared to controls. Similar patterns have been observed in people with DS when processing nominal theme-related associates and verbal theme-related associates. People with DS have delayed recognition of associates. When processing unrelated words, they showed significantly higher false positives than controls for both nominal and verbal eliciting themes. Further analyses of the themes revealed differences in false positives across syntactic categories among groups. Conclusions and Implications: People with DS showed a delayed recognition of associates and deviance in recognizing unrelated words in the nominal and verbal theme categories. People with DS were delayed in terms of nouns, but deviated with verbs in associated and unrelated words. Additionally, people with DS showed distinct patterns in processing five nominal lures and three verbal lures, suggesting that they formed false memories differently based on distinct syntactic categories. Thus, it was concluded that people with DS develop a deviant semantic structure. Category-based interventions for people with DS should be implemented in order to improve their semantic knowledge through lexical connections.

Rheumatoid arthritis (RA) is a chronic, systemic, abnormal inflammatory immune response. It is characterized by the involvement of the synovium and multiple organs and the destruction of joints and articular cartilage. Over the past 30 years, several promising novel compounds and antibodies have been developed for the treatment of RA. The introduction of new drugs and precision medicine for all forms of RA raises several issues related to access to novel treatments by patients, optimal regimen selection, cost-effectiveness, prognosis monitoring and outcome surveillance, particularly with regarding to the development of low drug response rates, drug resistance and adverse side effects. Tremendous attention has been given to the identification of optimized drug combinations for the treatment of RA, particularly in early high-risk vulnerable and early individuals. Addressing these issues requires novel therapeutic approaches with new mechanisms and the establishment of accurate guidelines for drug selection, drug recombination, and non-chemical therapeutic efforts. In this study, we reviewed the most exciting recently established or ongoing novel drugs and methods according to the clinical trial database maintained by the United States National Library of Medicine and discussed the trends in RA drug development and challenges in the treatment, providing a reference significant for the accurate treatment of RA and the research direction in the future.

Allocations of funding for higher education have typically focused on competition in neoliberal mechanisms. Surprisingly, much less attention has been paid to considering the effect of fund allocations for public goods purposes in neoliberal contexts. This study aims to examine specific funding schemes and determine the influential factors impacting the funding for teaching, research, and public goods intention. Taking Taiwan's Higher Education Sprout Project (HESP) as a unique example, we explored the effect of policy initiatives on public goods transformation. The data was collected from the Ministry of Education and Scopus database. First, the t-test and ANOVA were used to detect the differences between the system and sector; Second, regression analysis was used to determine influential factors for funding allocations; Final, structural equation modeling (SEM) was used to explore the causal effects among the selected variables. The study found that only diversity was shown in private technology groups receiving less HESP funding. The findings suggest that the funding allocation may not affect teaching and research based on sectors and systems. In contrast, this study demonstrates that transforming the public good through special funding can play a critical role in policy intention in neoliberal higher education.

The digital economy (DE) has become a major force driving the optimization and upgrading of industrial structures (ISOU), and research on the driving mechanism has yet to be verified. To this end, the driving influence of DE on the ISOU is targeted, and the role played by economic resilience (ER) and innovation is explored. Based on the panel data of 31 provinces in China from 2011 to 2020, the driving influence of the DE on the ISOU is analyzed using a two-way fixed-effects model. The empirical study finds that the DE presents a positive driving effect on both industrial structure advancement and rationalization, and the driving effect is still significant after the addition of control variables and the robust-type test with one period of lag; the DE presents regional differences in ISOU, with the driving effect of the DE on industrial structure advancement in the eastern region having a more significant performance than that of the central and western regions, and the driving influence on the rationalization of industrial structure in the eastern and western regions exceeds that in the central region; the impact of DE on the ISOU has a mediating role through innovation, ER has a moderating role in the process, and innovation as a partial mediator also has a threshold effect, and finally countermeasure suggestions are put forward.

As the natural resources are getting exhausted, the concept of sustainable development of region has received increasing attentions, especially for resource-dependent cities. In this paper an innovative method that emergy analysis and IPAT (Human Impact Population Affluence Technology) model were combined in order to analyze the quantitative relationship of economic growth and energy consumption and further to evaluate its overall sustainability level. Taiyuan, a traditional, resource-dependent city in China, is selected as the case study region. The main results show that total emergy of Taiyuan increased from 9.023× 1023 sej in 2007 to 9.116× 1023sej in 2014, with 38% reduction on non-renewable emergy and 125% growth on imported emergy. Regional emergy money ratio (RMB) was reduced by 48% from 5.31× 1013sej/$ in 2007 to 2.74× 1013sej/$ in 2014, indicating that the increasing speed of consuming resources and energy was faster than the increase of GDP, and that Taiyuan’s money purchasing power declined. The lower emergy sustainability index (ESI) indicates that Taiyuan was explored and produced large quantities of mineral resources, which puts more stress on the environment as a consequence, and that this is not sustainable in the long run. The IPAT analysis demonstrates that Taiyuan sticks to the efforts of energy conservation and environmental protection, in order to promote regional sustainable development, it is necessary to take an integrated effort. Policy insights suggest that resourceful regions should improve include energy and resource efficiency, optimizing energy and resourceful structure.

Background: primary sclerosing cholangitis (PSC) is a chronic cholestatic disease characterized by inflammation and fibrosis of the bile ducts. Cholestasis may lead to hepatic inflammation and fibrosis, and amelioration of cholestasis may allow recovery from inflammatory and fibrotic pathological damage. Prevotella copri (P. copri) intervention have been reported could significantly improve cholestasis and liver fibrosis in DDC-induced PSC mice model. Despite alone P. copri treatment could not recover DDC-induced inflammation, it increased the abundance of Lactobacillus murinus (L. murinus) compared to DDC treatment, which has been reported to have anti-inflammatory effects. The abundance of L. murinus still not recover to normal level may underlie hepatic inflammation in P. copri+DDC mice. Method: alone or in combination interventions of P. copri and L. murinus were used to investigate the molecular mechanism of improvement of PSC inflammation and fibrosis. Results: P. copri and L. murinus significantly reduced the hepatic inflammatory cell aggregation and inflammatory factor expression, as well as the hepatic collagen content and fibrin factor expression in PSC mice. Further analysis of phosphorylation and dephosphorylation levels revealed that P. copri and L. murinus combined intervention in PSC mice inhibited the activity of DDC-activated TGF-β1/Smad pathway, thereby reducing liver inflammation and fibrosis. Conclusion: combination of P. copri and L. murinus inhibits the TGF-β1/Smad pathway and reduces inflammation and fibrosis in PSC.

The three-pronged sliding universal coupling is a new kind of three-pronged coupling. To study its kinematic and dynamic characteristics, directional cosine matrices are utilized as tools to analyze the coordinate systems by establishing simplified geometric models and corresponding motions. Through the analysis of the motions of the input and output shafts and employing the method of single-force element, a set of equilibrium equations for the forces acting on the output shaft and the input shaft are formulated for solution analysis. The research indicates that during the rotation process, there exists a small angular difference between the input shaft and the intermediate shaft, demonstrating the quasi-constant angular velocity characteristics of the new tripod sliding universal coupling. The curves of the forces and torques acting on each component of the coupling approximate sinusoidal curves. The optimal operating angle range for the new tripod universal coupling is at angle , during which the system exhibits good transmission and mechanical performance.

In the ground-based infrared optical remote sensing system, the target signal is very weak due to the dynamic strong light background and the movement of small and small targets. In order to improve the limit detection capability, the background suppression and target enhancement methods are required to be more suitable for this scene. To solve this problem, we first analyze the image features in the current scene, and propose a more perfect point target and noise model. Then, we propose a new WY distribution function based on the Fermi Dirac distribution function, and propose an anisotropic filtering method based on this function, and further suppress the back-ground through the difference results of two steps. Then, based on the distribution function, we further designed an energy concentration accumulation strategy in 9 scale directions, through which the SNR of the target is effectively improved and the suppression ability of the background is enhanced. Through quantitative and qualitative experimental analysis, compared with the same type of algorithms, the proposed method has better robustness against extremely weak targets and dynamic backgrounds.

Image encryption based on chaotic maps is an important way to ensure the secure communication of digital multimedia on the Internet. To improve the encryption performance and security of image encryption systems, a new image encryption algorithm is proposed by employing a compound chaotic map and random cyclic shift. Firstly, an improved Hybrid chaotic system is designed by coupling Logistic, ICMIC, Tent, and Chebyshev maps (HLITC). Comparison tests with previous chaotic maps in terms of chaotic trajectory, Lyapunov exponent, and Kolmogorov entropy illustrate the new hybrid chaotic map has better chaotic performance. Then the proposed HLITC chaotic system is used to develop a new chaotic image encryption scheme with the double cyclic shift. The improved HLITC chaotic system is performed to generate key sequences used in the image scrambling and diffusion stage. The spiral transformation controlled by chaotic sequence is used to scramble the pixels of the plaintext image, while the XOR operation based on a chaotic map is used for pixel diffusion. Extensive experiments of statistical analysis, key sensitivity, and keyspace analysis are conducted. Experimental results show the proposed encryption scheme has good robustness against brute force attacks, statistical attacks, and differential attacks, and is more effective than many existing chaotic image encryption algorithms.

In a single-center, retrospective study, 22 cases were enrolled and divided into two groups: those who underwent surgical wide excision (group A) and those who did not (group B). The study included 13 cases in group A and 9 cases in group B. In group A, 6 cases solely underwent surgical wide excision, while 7 cases received additional treatments like radiotherapy or chemotherapy. Conversely, in group B, 4 cases received chemotherapy, 4 cases received radiotherapy, and 1 case was managed through observation alone. The mean follow-up time was 60.15 months in group A and 43.44 months in group B, with no significant difference observed. In group A, 9 cases resulted in mortality, whereas 6 cases died within the follow-up period in group B. Lesion-free intervals post-operation were observed predominantly in group A, while 7 cases in group B never experienced freedom from skin lesions. Kaplan-Meier survival curve analysis demonstrated a significant difference between the survival curves of the two groups (P = 0.046). Among non-HIV Kaposi’s sarcoma patients, surgical wide excision appears to have a role in treatment. Patients in group A exhibit a more favorable outcome in the survival curve analysis.

There is an overall scientific consensus that public space and, mainly, space with a high ecological index – most notably experienced in green areas – positively affects individual and collective well-being and urban dwellers’ physical and mental health. However, the ‘reality check’ indicates difficulties in translating the assumed benefits of green space into implementable interventions in urban environments. To examine such an ‘implementation gap’ on the case of Zurich seems valid, given that the ‘green urban agenda’ debate has been embedded in numerous Swiss policies (from the federal to the municipal levels). In narrow terms, the research first focuses on Zurich’s district 9 consisting of two neighborhoods (Altstetten and Albisrieden) – the area under ongoing densification yet with a variety of green spaces, to then elucidate four green space clusters and their 400-meter catchment areas in the mentioned district. The mixed-method approach has been applied at three analytical levels: 1) documentary analysis of multi-scale national policy toolkits, to identify the critical tenets associated with the ‘green urban agenda’, 2) assessment of green spaces in Zurich’s district 9 based on online available quantitative data and on-site observation, to determine their provision, types, size and mutual connectivity, and 3) analysis of four green space clusters within the mentioned district through on-site observation, to identify green space attributes and main activities. Through critical mutual examination of the identified ‘green urban agenda’ principles in the national policies, on the one hand, and green space attributes, on the other, the research findings reveal the extent of the convergence and/or divergence between the ‘green urban agenda’ policy trends and their implementation in practice.

Sustainable urban design or planning is not a LEGO-like assembly of prefabricated elements, but an embryo-like growth with persistent differentiation and adaptation towards a coherent whole. The coherent whole has a striking character – called living structure – that consists of far more small substructures than large ones. To detect the living structure, natural streets or axial lines have been previously adopted to be topologically represent an urban environment as a coherent whole. This paper develops a new approach to detecting the underlying living structure of urban environments. The approach takes an urban environment as a whole and recursively decomposes it into meaningful subwholes at different levels of hierarchy or scale ranging from the largest to the smallest. We compared the new approach to natural street and axial line approaches and demonstrated, through four case studies, that the new approach is better and more powerful. Based on the study, we further discuss how the new approach can be used not only for understanding, but also for effectively designing or planning the living structure of an urban environment to be more living or more livable.

To address the insufficient mechanical properties of calcined phosphogypsum, this research aims to investigate the utilization of basalt fiber and calcium carbonate whiskers as reinforcing agents. The study examines their impact on the flexural and compressive strength, toughness, water resistance, and tensile strength of calcined phosphogypsum. In the individual tests, basalt fibers with different lengths (3 mm, 6 mm, 9 mm, and 18 mm) were added at dosages of 0%, 0.5%, 1.0%, and 1.5% respectively. The findings demonstrate that basalt fiber effectively enhances the flexural and compressive strength, toughness, and tensile strength of calcined phosphogypsum, albeit potentially compromising water resistance. Among the various fiber lengths, the 6 mm fibers exhibit the most advantageous influence on the performance of calcined phosphogypsum. A subsequent test was conducted to investigate the impact of cross-scale fibers on the properties of calcined phosphogypsum by mixing 6 mm basalt fibers and calcium carbonate whiskers. The results illustrate that calcium carbonate whisker refines the pores, thereby improving the flexural strength and toughness of calcined phosphogypsum. Furthermore, it compensates for the water resistance limitations associated with the sole utilization of basalt fiber while further augmenting the tensile strength and strain capacity. However, it should be noted that increasing the dosage of both calcium carbonate whiskers and basalt fibers concurrently leads to increased porosity of phosphogypsum and reduced compressive strength.

The European Union Water Framework Directive (2000/60/EC; WFD) aims to achieve a good ecological and chemical status of all bodies of surface water by 2027. The development of an integrated guidance on surface water chemical monitoring (e.g. WFD Guidance Document No. 7/19) has been transferred into national German law (Ordinance for the Protection of Surface Waters, OGewV). For the majority of compounds, this act requires a monthly sampling frequency to assess the chemical water quality status of a surface water body. To evaluate the representativeness of the sampling strategy under the OGewV, high-frequency online monitoring data is investigated under different sampling scenarios and compared with current, monthly grab sampling strategy. About 23 million data points were analyzed for this study, three chemical parameters (dissolved oxygen, nitrate-nitrogen, chloride concentration) and discharge data were selected from four catchment of different sizes ranging from 51391 km² to 84 km² (Elbe, Vereinigte Mulde, Neiße and two stations at Lockwitzbach). In this paper we proposed short-term online-monitoring (STOM) as a sampling alternative. STOM considers the placement of online sensors over a limited duration and return interval. In general we: (I) compare the results of conventional grab sampling with STOM, (II) investigate the different performance of STOM and grab sampling using discharge data as proxy for analyzing event-mobilized pollutants and (III) investigate the related uncertainties and costs of both sampling methods. Results show, that STOM outperforms grab sampling for parameters where minimum/maximum concentrations are required by law as the probability to catch a single extreme value is higher with STOM. Furthermore, parameters showing a pronounced diurnal pattern, like dissolved oxygen, are also captured considerably better. The performance of STOM showed no substantial improvements for parameters with small concentration variability, as nitrogen-nitrate The analysis of discharge events as a proxy parameter for event-mobilized pollutants proved that the probability of capturing samples during events is significantly increased by STOM.

The popularity and growth of additive manufacturing(AM) in recent years are due to its ability to provide innovative solutions to complex manufacturing challenges and its potential to transform the way products are designed, developed, and produced. In this work, the numerical simulation geometry of the model extruder from nozzle is established along with the material extrusion process. The high gravity material extrusion system (HG-MEX) properties and characteristics during filament fabrication are evaluated. This work investigates the effects of gravity on the material extrusion process from nozzle extrusion. This work is unique in the incorporation of fluid surface characteristics to represent the performance and contact with the material extrusion in additive manufacturing. The use of simulation in high gravity material extrusion in additive manufacturing is a meaningful and valuable approach to improving the quality and efficiency of the process.

The Gulong shale oil reservoir is formed in freshwater to slightly saline lacustrine basins, mainly consisting of pure shale geological structure, which is quite different from other shale reservoirs around the world. Currently, the development of Gulong shale oil mainly relies on hydraulic fracturing, while the subsequent shut-in period for imbibition has been proven to be an effective method for enhancing shale oil recovery. To clarify the characteristics of fluid occurrence space and the variation of fluid occurrence during saltwater imbibition in Gulong shale, this paper carried out porosity and permeability tests on Gulong shale cores, and analyzed the fluid occurrence space characteristics and imbibition oil recovery based on nuclear magnetic resonance (NMR). In the porosity and permeability tests, the porosity measured by saturation method was calibrated using NMR T2 spectra. Combined with the identification of fractures in shale cores using micro-CT and the analysis of porosity and permeability parameters, it was found that the permeability of shale cores was related to the development of fractures in shale cores. Through the testing and analysis of NMR T1-T2 two-dimensional spectra of the shale cores before and after saturation with oil, it was found that the shale mainly contains heavy oil, light oil, and clay-bound water, and they were distributed in different positions in the T1-T2 spectrum. Finally, the T1-T2 two-dimensional spectra of the shale core at different imbibition stages were analyzed, and it was found that the saltwater mainly entered the minuscule inorganic pores of clay minerals during the imbibition process, and squeezed the larger-sized inorganic pores containing light oil through the hydration expansion effect, thus expelling the light oil from the shale core and achieving the purpose of enhanced oil recovery.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

ABSTRACT Background It is important to be able to predict, for each individual patient, the likelihood of later metastatic occurrence, because the prediction can guide treatment plans tailored to a specific patient to prevent metastasis and to help avoid under- or over-treatment. Deep Neural Network (DNN) learning, commonly referred to as deep learning, has become popular due to its success in image detection and prediction, but questions such as whether deep learning outperforms other machine learning methods when using non-image clinical data remain unanswered. Grid search has been introduced to deep learning hyperparameter tunning for the purpose of improving its prediction performance, but the effect of grid search on other machine learning methods are under-studied. In this research, we take the empirical approach to study the performance of deep learning and other machine learning methods when using non-image clinical data to predict the occurrence of breast cancer metastasis (BCM) 5, 10, or 15-years after the initial treatment. We developed DNN models as well as models using 9 other machine learning methods including Naive Bayes (NB), Logistic Regression (LR), Support Vector Machine (SVM), LASSO, Decision Tree (DT), k-Nearest Neighbors (KNN), Random Forrest (RF), AdaBoost (ADB), and XGBoost (XGB). We used grid search to tune hyperparameters for all methods. We then compared the deep learning models to the models trained using the 9 other machine learning methods. Results Based on the mean test AUC results, DNN ranks 6th, 4th, and 3rd when predicting 5-year, 10-year, and 15-year BCM respectively, out of 10 machine learning methods. The top performing methods in predicting 5-year BCM are XGB(1^st), RF(2^nd), and KNN(3^rd). For predicting 10-year BCM the top performers are XGB (1^st), RF(2^nd), and NB(3^rd) . Finally, for 15-year BCM the top performers are SVM (1^st), LR and LASSO (tied for 2^nd), and DNN (3^rd). The ensemble methods RF and XGB outperform other methods when data are less balanced, while SVM, LR, LASSO, and DNN outperform other methods when data are more balanced. Our statistical testing results show that at a significance level of 0.05 DNN overall performs no worse than other machine learning methods when predicting 5-year, 10-year, and 15-year BCM. Conclusions Our results show that deep learning with grid search overall performs at least as well as other machine learning methods when using non-image clinical data. It is interesting to note that some of the other machine learning methods such as XGB, RF, and SVM are very strong competitors of DNN when incorporating grid search. It is also worth noting that the computation time required to do grid search with DNN is way more than that required to do grid search with the other 9 machine learning methods.

In an IoT system, the sheer volume of data generated by numerous sensing devices necessitates a well-designed scheme for storing and retrieving data efficiently, enabling streamlined data processing and analytics. One promising storage architecture involves utilizing solid-state drives (SSDs) to cache data from hard disk drives (HDDs), thereby creating an SSD-based caching storage system. To further enhance access performance, it is possible to employ readahead techniques to minimize data access latency. However, the existing Linux readahead scheme falls short in fully leveraging SSD-based caching storage systems. We address this limitation by introducing a novel cross-layered readahead architecture that effectively communicates with the VFS layer, the file system layer, and the block I/O layer. This communication facilitates the acquisition of readahead timing, readahead data continuity, and readahead data location, respectively. To guide prefetching decisions, our architecture analyzes the degree of data access sequentiality, the performance model of the target storage device, and the access patterns of the I/O workload on the corresponding storage device. The implementation of this new architecture in the Linux kernel yields promising experimental results, demonstrating its robustness by consistently outperforming the stock Linux kernel. Notably, our architecture reduces the total execution time of the stock Linux kernel by up to 49%, except in cases of random workloads where both the stock Linux kernel and our architecture exhibit similar performance.

Civic engagement refers to the ways in which citizens participate in the life of a community to help shape its future or improve conditions for others. While it might have been shaped by the COVID-19 pandemic recovery, this study explored how college students perceive civic engagement on selected campuses that were partially locked down. We sampled 1036 student volunteers from six universities in Taiwan by using a self-designed module of civic engagement and transferable capabilities. The Student’s t-test, ANOVA, regression, factor analysis, and structural equation modeling (SEM) were used to interpret the differences and relationships among these variables. This study provides a more detailed example of the current status of civic engagement and its relative to transferable capabilities in a higher education setting. The related programs and institutes should take responsibility for enhancing students’ civic engagement and transferable capabilities during the pandemic. How to ameliorate the situation? The findings suggest that it should consider a student’s academic major, learning experiences in the department, and time spent on related activities during the pandemic recovery. The findings might prove useful to various campuses for enhancing ongoing practices.

Obtaining classification confidence at the pixel level is a challenging task for accuracy assessment in remote sensing image classification. Among the various methods for estimating classification confidence at the pixel level, interpolation-based methods have drawn special attention in the literature. Even though they have been widely recognized in the literature, their usefulness has not been rigorously evaluated. This paper conducts a comprehensive evaluation of three interpolation-based methods: local error matrix method, bootstrap method, and geostatistical method. We applied each of the three methods to three representative datasets with different spatial resolutions, spectral bands, and the number of classes. We then derive the estimated classification confidence and true classification confidence and compared the results with each other using both exploratory data analysis (bi-histogram) and statistical analysis (Willmott's d and Binned classification quality). The results indicate that the three interpolation methods provide some interesting insights on various aspects of estimating per-pixel classification confidence. Unfortunately, the interpolation assumes that classification confidence is smooth across the space, which is usually not true in practice. In other words, interpolation-based methods have limited practical use.

Authorities define cities – or human settlements in general – through imposing top-down rules in terms of whether buildings belong to cities. Emerging geospatial big data makes it possible to define cities from the bottom up, i.e., buildings determine themselves whether they belong to a city based on the notion of natural cities that is defined based on head/tail breaks, a classification and visualization tool for data with a heavy-tailed distribution. In this paper, we used 125 million building locations – all building footprints of America (mainland) or their centroids more precisely – to derive 2.1 million natural cities in the country (http://lifegis.hig.se/uscities/). These natural cities – in contrast to government defined city boundaries – constitute a valuable data source for city-related research.

This paper discovers that current variational principle and Noether theorem for different physics systems with (in)finite freedom systems have missed the double extremum processes of the general extremum functional that both is deduced by variational principle and is necessarily taken in deducing all the physics laws, but these have not been corrected for over a century since Noether's proposing her famous theorem, which result in the crisis deducing relevant mathematical laws and all physics laws. This paper discovers there is the hidden logic cycle that one assumes Euler-Lagrange equations, and then he finally deduces Euler-Lagrange equations via the equivalent relation in the whole processes in all relevant current references. This paper corrects the current key mistakes that when physics systems choose the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current articles, reviews and (text)books. The real physics should be after choosing the variational extreme values of physics systems, the general extremum functional of the physics systems needs to further choose the minimum absolute extremum zero of the general extremum functional, otherwise, the appearing processes of physics systems are still virtual processes. Using the double extremum processes of the general extremum functionals, the crisis and the hidden logic cycle in current variational principle and current Noether theorem are solved. Furthermore, the new mathematical and physical double extremum processes and their new mathematical pictures and physics for (in)finite freedom systems are discovered. This paper gives both general variational principle and general Noether theorem as well as their classical and quantum new physics, which would rewrite all relevant current different branches of science, as key tools of studying and processing them.

Aiming at the problem of low pollutant concentration in the sewage treatment plant due to external water intrusion into the sewage collection system, which in turn leads to low pollutant reduction efficiency. A sewage system in Zhenjiang City is taken as an example. Analyze the situation of external water intrusion in the sewage pipe network, and determine the external water intrusion proportion based on the water quality and quantity method. First, the dry season flow rate of the sewage pipe is obtained according to the monitoring data of the flowmeter. Then, the key research areas are screened out based on the changes in the concentration of water quality characteristic factors. Furthermore, chemical oxygen demand and electrical conductivity are used as the water quality characteristic indicators to characterize shallow groundwater and river water. In addition, the proportions of groundwater and river water intrusion in the sewage pipe network are quantitatively analyzed based on the chemical mass balance equation. At the same time, the dredging detection method is used to assist in the investigation, and finally the engineering rectification of the problems found in the drainage is carried out. The results show that the water quality and quantity method can effectively identify the types of external water and analyze the proportion of external water intrusion, which is of exemplary significance for the evaluation of sewage collection systems.

A new mesogenic non-symmetric dimeric monomer with a terminal olefin function, forming a twist bend nematic (Ntb) as well as a nematic (N) phase was synthesized, using an enhanced synthetic methodology, which avoids isomerization of the terminal double bond in the preparation of the dimer. This monomer was attached to a pentamethyldisiloxane group, resulting in SmA LC phase behaviour of the ensuing material. Linking the monomer to a siloxane main chain resulted in nematic phase behaviour. Detailed studies with the Ntb phase forming dimer DTC5C7 show full miscibility of the dimer and the new LC polymer in the LC state, suggesting that the side-chain LC polymer forms a Ntb phase as the low temperature nematic phase. Copolymerizing the monomer with a cyanobiphenyl based monomer allows to tune the glass transition and phase behavior further.

Recharge is a crucial section of water balance for both surface and subsurface models in water resource assessment. However, quantifying its spatiotemporal distribution at a regional scale poses a significant challenge. Empirical and numerical modeling are the most commonly used methods at the watershed scales. However, integrated model inherently contain a vast number of unknowns and uncertainties, which can limit their accuracy and reliability. In this work, we have proposed integrated SWAT-MODFLOW and Transient Water Table Fluctuation Method (TWTFM) to evaluate the spatiotemporal distribution of groundwater recharge in Anyang wa-tershed, South Korea. Since TWTFM also uses SWAT model percolation output data, calibration was performed for individual models and coupled model. The coupled model was calibrated using daily streamflow and hydraulic head. SWAT-MODFLOW model performed well during the simulation of streamflow compared SWAT model. The study output showed that the study watershed had significant groundwater recharge variations during the simulated period. A sig-nificant amount of recharge happens in the wet season. It contributes about 34% of the average annual precipitation of the region. The direct flow components (surface and lateral) showed sig-nificant contributions when the water balance components were evaluated in the region. TWTFM showed a glimpse to estimate recharge, which requires representative monitoring wells in the study region. Comprehensively, the SWAT-MODFLOW model estimated groundwater recharge with reasonable accuracy in the region.

We present an investigation on the fracture of a mold, comparing it with a normal part using specific techniques, such as EDX, SEM, and AES. The EDX analysis revealed that the composition of the normal part was consistent with that of low carbon steel, mainly comprising Fe and C. In contrast, the fractured part exhibited cracks due to nonconforming nonmetallic inclusions and reticular carbides, with fractures resulting from microporosity agglomeration and cleavage fracture. The SEM and AES analyses further presented the causes of mold fracture, highlighting the mechanism by which dimples on the specimen edge contributed to the fracture. The EDX analysis confirmed that the mold experienced thermal brittleness during use. To enhance mold durability and extend its lifespan, a double-pulse electrodeposition method was employed to create a NiCo alloy coating as a replacement for the Cr layer on the metal surface. The coating exhibited a smooth and scratch-free surface. The prepared NiCo special coating significantly increased the mold yield strength by approximately 313.8%, facilitated a 13% increase in plastic deformation, and reduced fracture strain by 25%, effectively preventing mold fracture and 3improving its service life.

Two Iron Age settlements, Tuzusai and Taldy Bulak 2 (ca. 500 BCE to 1 CE), located in Southeastern Kazakhstan on the Talgar alluvial fan north of the Tian Shan range, have yielded a small collection of bone, antler/horn, bronze, and stone artifacts with affinity to nomadic art of the first millennium BCE. Both settlements date within the period of late Saka culture. Two pieces have decorative ornamentations with zoomorphic imagery: a small carved fragment of a with carved images of a wing and an ear and a perforated bone disk with the carving of three birds’ heads. The other artifacts include objects associated with Saka weaponry or nomadic economy such as the two antler/horn psalia (cheek pieces) and a bronze amulet. A carnelian bead will also be described as an imported object. These special finds are found on the occupation floors of mud brick houses and pit houses of settlements, not in grave or burial contexts. The objects are placed in stratigraphic sequence in the settlement sites. Then the method for placing these objects within the chronological framework of “animal-style art” is through comparisons with similar objects found throughout Eurasia—a method used in Soviet and Post-Soviet archaeology. The results show that functional and stylistic elements of the six objects indicate that the Talgar settlements were part of a larger world-system of trade and communication along the early Silk Route(s).

Signal preprocessing and feature extraction are two important and necessary steps of data analysis. In signal analysis, typically these two steps are implemented through multiple algorithms. Moreover, the significant parameters in most algorithms are set empirically. We have developed an algorithm that can preserve and highlight characteristic waveforms while attenuating non-feature waveforms. The parameters in the algorithm are set through difference analysis. We have conducted experiments on both clinical and open-source ECG data, obtaining effective test results.

This paper discovers that current canonical variational principle and canonical Noether theorem of (in)finite freedom systems for different physics systems have neglected doublet extreme value processes of the general extreme value functional that both is derived by variational principle and is necessarily be taken in deriving all ( quantum ) physics laws in phase space, but which have not been done for over one century since Noether's showing her distinguished theorem, which lead to the crisis deriving all (quantum) physics laws (necessary) in phase space. We discover there is the hidden logic cycle that people assume canonical equations, and then they finally deduce canonical equations by the equivalent relation in the whole processes in all current references. We correct the current key mistake concepts that when physics systems take the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current references. The real physics should be what after taking the physics systems' variational extreme values, the physics systems' general extremum functional needs to further take the general extremum functional's minimum absolute extremum zero, otherwise, the appearing processes of physics systems still are virtual processes. Conservation current equations and conservation currents, in phase space, of general canonical variational principle and general canonical Noether theorem are, respectively, deduced for the first time. Using the general extremum functionals' doublet extreme value processes, the hidden logic cycle and the crisis in current canonical variational principle and current canonical Noether theorem are solved. Consequently, the new mathematical pictures, classical and quantum new physics in phase space and the new mathematical and physical doublet extremum processes for (in)finite freedom systems are discovered. General canonical variational principle and general canonical Noether theorem naturally are given, which would rewrite all the different sciences in phase space, as key tools of studying and dealing with them.

Our study explores the role of cancer-derived extracellular exosomes (EXs), particularly focusing on collagen alpha-3 (VI; COL6A3), in facilitating tumor dissemination and metastasis in epithelial ovarian cancer (EOC). We found that COL6A3 is expressed in aggressive ES2 derivatives, SKOV3 overexpressing COL6A3 (SKOV3/COL6A3), and mesenchymal-type ovarian carcinoma stromal progenitor cells (MSC-OCSPCs), as well as their EXs, but not in less aggressive SKOV3 cells or ES2 cells with COL6A3 knockdown (ES2/shCOL6A3). High COL6A3 expression correlates with worse overall survival in EOC patients, as evidenced by TCGA and GEO data analysis. In vitro experiments showed that EXs from MSC-OCSPCs or SKOV3/COL6A3 cells significantly enhance invasion ability in ES2 or SKOV3/COL6A3 cells, respectively (both, P <0.001). In contrast, ES2 cells with ES2/shCOL6A3 EXs exhibit reduced invasion ability (p<0.001). In vivo, the average disseminated tumor numbers in the peritoneal cavity were significantly greater in mice receiving intraperitoneally injected SKOV3/COL6A3 cells than in SKOV3 cells (p<0.001). Furthermore, mice intravenously (IV) injected with SKOV3/COL6A3 cells and SKOV3/COL6A3-EXs showed increased lung colonization compared to mice injected with SKOV3 cells and PBS (p=0.007) or SKOV3/COL6A3 cells and PBS (p=0.039). Knockdown of COL6A3 or treatment with EXs inhibitor GW4869 or rapamycin-abolished COL6A3-EXs may suppress the aggressiveness in EOC.

As the number of end-of-life vehicles continues to grow, the field of separation technology for broken copper and aluminium parts of end-of-life vehicles has emerged as a significant area of research. As a key technology for the separation of non-magnetic non-ferrous metals, such as copper and aluminium, eddy current separation can achieve efficient separation of non-magnetic non-ferrous metals according to their differing conductivity and density. Nevertheless, further research is required in the separation of large-scale broken copper and aluminium parts of end-of-life vehicles. This paper presents a novel magnetic roller model comprising circumferential and axial periodic arrangements of permanent magnets. A single permanent magnet was constructed as an equivalent current model, and the magnetic scalar potential equations were solved using simulation tools. This allowed the distribution of the magnetic field outside the magnetic roller to be studied. The results demonstrate that the novel permanent magnet array magnetic roller can enhance the magnetic field intensity and action distance of the external magnetic field, which is more conducive to the separation of large-scale broken copper and aluminium parts of scrap cars. The findings of this research provide a theoretical foundation for the separation of scrap car broken copper and aluminium parts.

Visual data on the geographic distribution of carbon storage helps policy maker to formulate countermeasures on global warming. However, Taiwan, as an island showing diversity in climate and topography, had lacked valid visual data in distribution of forest carbon storage between the last to forest surveys (1993-2015). This study established a model to achieve an estimation that capable to demonstrate the distribution of forest carbon storage. This model uses land use, stand morphology, carbon conversion coefficient databases accordingly for 51 types of major forest in Taiwan. An estimation on 2006 was conducted and shows an overall carbon storage of 165.65 Mt C, with forest carbon storage per unit area of 71.56 t C ha–1, where natural forests and plantations respectively contributed of 114.15 Mt C (68.9%) and 51.50 Mt C (31.1%). By assuming no change in land use type, the carbon sequestration from 2006 to 2007 by the 51 forest types was estimated to be 5.21 Mt C yr–1 using historical tree growth and mortality rates. The result reflects the reality of the land use status and event of coverage shifting with time by combining to the two forest surveys in Taiwan.

The Upper Hunter Valley is a major coal mining area containing approximately 40% of the currently identified total coal reserves in New South Wales (NSW), Australia. Due to the ongoing increase of mining activities, PM10 (air-borne particle with an aerodynamic diameter less than 10 micrometres) pollution has become a major air quality concern in local communities. This paper summarises the spatial and temporal variability modes of PM10 pollution in the region, based on long-term multi-site monitoring data and the application of the rotated principal component analysis (RPCA) and wavelet analysis techniques. RPCA identified two distinct air quality clusters/subregions in the valley, one in the west/northwest, the other in the southeast. Wavelet analysis revealed the annual cycle to be most persistent temporal mode of PM10 variability in both subregions, with intermittent signals observed at time scales of around 120, 30~90 and under 30 days. How these variation modes are related to the effects of local PM10 emissions and the influence of meteorology at different time scales deserves further attention in future work. The findings will be used in air quality reporting and forecasting in NSW. The methodology and results can also be useful for air quality research in similar regions elsewhere.

With the integrated development of the Internet, wireless sensor technology, cloud computing, and mobile Internet, there has been a lot of attention given to research about and applications of the Internet of Things. A Wireless Sensor Network (WSN) is one of the important information technologies in the Internet of Things; it integrates multi-technology to detect and gather information in a network environment by mutual cooperation, using a variety of methods to process and analyze data, implement awareness, and perform tests. This paper mainly researches the localization algorithm of sensor nodes in a wireless sensor network. Firstly, a multi-granularity region partition is proposed to divide the location region. In the range-based method, the RSSI (Received Signal Strength indicator, RSSI) is used to estimate distance. The optimal RSSI value is computed by the Gaussian fitting method. Furthermore, a Voronoi diagram is characterized by the use of dividing region. Rach anchor node is regarded as the center of each region; the whole position region is divided into several regions and the sub-region of neighboring nodes is combined into triangles while the unknown node is locked in the ultimate area. Secondly, the multi-granularity regional division and Lagrange multiplier method are used to calculate the final coordinates. Because nodes are influenced by many factors in the practical application, two kinds of positioning methods are designed: the unknown node is in the positioning unit or not. When the unknown node is on the side of the positioning unit, we use the method of vector similarity. Moreover, we use the centroid algorithm to calculate the ultimate coordinates of unknown node. When the unknown node is not on the side of the positioning unit, we establish a Lagrange equation containing the constraint condition to calculate the first coordinates. Furthermore, we use the Taylor expansion formula to correct the coordinates of the unknown node. In addition, this localization method has been validated by establishing the real environment.

The 3x+1 problem is a problem of continuous iteration for integers. According to the basic theorem of arithmetic and the way of iteration, we derive a general formula for continuous iteration for odd integers. Through this formula, we can construct a loop iteration equation and obtain the result of the equation: the equation has only one positive integer solution. In addition, this general formula can be converted into a linear indeterminate equation. The process of solving this equation shows that the relationship between the iteration result and the odd number being iterated is linear. Extending this result to all positive even numbers, we get the answer to the 3x + 1 question.

Aims: The sequencing data of SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus-2) are rapidly emerging. The mutation profile across SARS-CoV-2 populations is an important inference of the evolution of coronaviruses. Materials & Methods: With 4,521 lines of SARS-CoV-2, we obtained 3,169 unique point mutation sites in the SARS-CoV-2 genome. We counted the numbers and calculated the MAF (minor allele frequency) of each mutation type. Results: Nearly half of the point mutations are C-T mismatches and 20% are A-G mismatches. The MAF of C-T and A-G mismatches is significantly higher than MAF of other mutation types. Conclusions: The excessive C-T mismatches do not resemble the random mutation profile, and are likely to be explained by the cytosine-to-uridine deamination system in hosts. Not only the population analyses in previous studies are questionable, but also the 17% divergence between SARS-CoV-2 and RaTG13 could be erroneous due to the deamination.

Background: Cancer patients require cross-professional care during the diagnosis and treatment periods. Therefore, methods for effectively carrying out case management are essential to tumor care. Purpose: To investigate the effects of using the community software LINE Official Ac-count on oral cancer case management. Methods: An experimental design was used; 100 patients were randomly divided into two groups by using a computer-generated random number table. The experimental group used LINE Official Account, which gave them self-care information, timely messages, and one-on-one health-care consultations. The control group followed standard healthcare practices. Results: The experimental group was satisfied with the self-care information provided by LINE Official Account (86.9%), patients regularly checked the self-care information (89.4%) and would check the information when receiving a push notification (54.3%). Ten patients used the one-on-one consultation(20.0%). LINE Official Account had a significant effect on the rate of participation in support groups. Generalized estimating equations indicated a significant difference between the two groups regarding the overall quality of life over 7 days (P = 0.023). Conclusion: Community software applications used in oncological case management can improve self-management and empower, also enable tracking of long-term follow-up effectiveness and reinforce the case manager’s role as a family therapist. Therefore, this study recommends that case manager systems be incorporated into mobile applications to increase the sustainable management, accessibility, effectiveness, and satisfaction of oncological management systems. This study also provides the value of Sustainable Development Goals (SDGs) with Good Health and Well-being, and decreased social withdrawal among patients with oral cancer.