Taiwan developing offshore wind power to promote green energy and self-electricity production. In this study, a Light Detection and Ranging (Lidar) was set up at Chang-Hua development zone one on the sea and 10km away from the seashore. At Lidar location, WRF (3.33km & 2km grid lengths) model and WAsP were used to simulate the wind speed at various elevations. Three days mean wind speed of simulated results were compared with Lidar data. From the four wind data sets, developed five different comparisons to find an error% and R-Squared values. Comparison between WAsP and Floating Lidar was shown good consistency. Lukang meteorological station 10 years wind observations at 5m height were used for wind farm energy predictions. The yearly variation of energy predictions of traditional and TGC wind farm layouts are compared under purely neutral and stable condition. The one-year cycle average surface heat flux over the Taiwan Strait is negative (-72.5 (W/m2) and 157.13 STD), which represents stable condition. At stable condition TGC (92.39%) and 600(92.44%), wind farms were shown higher efficiency. The Fuhai met mast wind data was used to estimate roughness length and power law exponent. The average roughness lengths are very small and unstable atmosphere.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

The information data accuracy affects the working reliability of production management system directly. Mobile equipment is an important part of integrated manufacturing system, in the course of its works, due to the complex working environment and the dynamic change of its position, it lead to the important problem of information detection distortion. Because the application of fractional differential operator has the dual functions of enhancing signal strength and reducing data error, we puts forward a data processing method of obtaining production information data of various accuracy by changing the parameters of fractional differential operator. Establish a mobile equipment detection data fusion processing model based on fractional order partial differential equations and apply it in the processing experiment of mobile equipment testing information detection data in an integrated manufacturing system, the feasibility and effectiveness of the method are verified. We conclude that the fractional order partial differential equations used in the processing of mobile equipment monitoring information data of an integrated manufacturing system has the function of obtaining production information data of various accuracy, which are of great significance to improve the working reliability in integrated manufacturing system. which is of great significance to improve the working reliability and scientific decision of integrated manufacturing system.

In engineering practice, various types of information data are affected by many factors during the collection process. For example, information data measurement errors are caused by equipment performance and the working environment. During the transmission of detection information, the signal distortion caused by energy loss and signal interference causes unpredictable detection errors in the collected information data. Through the study of fractional calculus theory, it was found that it is suitable for studying nonlinear, non-causal, and non-stationary signals, and has the dual functions of improving detection information and enhancing signal strength. Therefore, under the influence of many factors, we applied the fractional difference algorithm to the field of information data processing. Multi-sensor detection data fusion algorithm based on the fractional partial differential equation was adopted to establish its online detection data. A multi-sensor detection data fusion algorithm based on a fractional partial differential equation is established, which effectively fuses the information data detection errors caused by various influencing factors and greatly improves the detection accuracy of information data. The effectiveness of this method is proved through its application in an experiment.

This study explores the implementation of an interdisciplinary curriculum in product and media design education and its impact on knowledge innovation and competency development. The curriculum is based on scaffolding theory, incorporating design proposals, workshops, digital design, marketing tests, and marketing activities guided by teachers and mentors from a branded ceramic workshop. The research findings demonstrate that the interdisciplinary curriculum facilitates knowledge innovation and fosters the development of students' professional skills, creativity, and problem-solving skills. The study also highlights the importance of stable scaffolding, including artefact, peer, and teacher support, which significantly contributes to cultivating transformational competencies, as outlined in the 2030 OECD Learning Compass. Additionally, the collaboration with Shanshing Four Seasons Celadon Studio on a patented ceramic product, "Funny Monkey," is a tangible example of the journey towards a triple-helix knowledge economy. This research underscores the importance of interdisciplinary curricula in promoting knowledge innovation and integrating transformational competencies in education. Scaffolding theory provides practical guidance for student learning and teaching strategies, presenting a sustainable roadmap for developing interdisciplinary curricula and offering a concrete and transferable pedagogical prototype for educational innovation.

Applied talent is not only a builder of human civilization but also a promoter of economic development. They not only need systematic and solid engineering theoretical knowledge but also rich engineering practical experience. Applied undergraduate colleges are the cradle for cultivating applied talent and shoulder the important mission of cultivating various types of applied talent for society. With the rapid development of higher education, the number of applied undergraduate institutions has sharply increased, but the quality of applied talent cultivated by them has shown a significant decline, which greatly restricts the pace of industrial development in the world. This article proposes a new concept of promoting the "three certificates" (graduation certificate, degree certificate, and skill certificate) education model in applied undergraduate colleges, which is of great significance for the country to cultivate composite talents with the ability of "product design, production management, and product processing" at the same time.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

The quality of underground space information has become a major problem that endangers the safety of underground spaces. Currently, the main methods for the high-precision and long-distance transmission of detection information are radar and optical methods. However, in practical applications, we found that the radar method has the shortcomings of large energy loss and poor anti-jamming ability, which limit the accuracy of information data transmission and distance. The optical method has the shortcomings that the weather has a great impact on its accuracy and can only be applied to static objects above ground; therefore, it has the limitation of application objects and use environment. More importantly, the current high-precision information remote detection methods are limited to the detection of overground space objects and are not applicable to the detection of various information data in underground space. In this study, we analyze the spectral properties of the fractional differential operator and find that it is suitable for studying non-linear, non-causal, and non-stationary signals. The theory of fractional calculus is applied to the field of data processing, and a mathematical model of remote transmission and high-precision detection of information based on fractional difference is established, which realizes the functions of high-precision and remote detection of information. By fusing the information data to detect the mathematical model over a long distance and with high accuracy, a mathematical model for stratum data processing used to provide long-distance and high-accuracy data was established. Through application in engineering practice, the effectiveness of this method for underground space information data detection was verified.

Quantum coherence is an important physical resource in quantum information science, and also as one of the most fundamental and striking features in quantum physics. In this paper, we obtain a symmetry-like relation of relative entropy measure $C_r(\rho)$ of coherence for $n$-partite quantum states $\rho$, which gives lower and upper bounds for $C_r(\rho)$. Meanwhile, we discuss the conjecture about the validity of the inequality $C_r(\rho)\leq C_{\ell_1}(\rho)$ for any state $\rho$. We observe that every mixture $\eta$ of a state $\rho$ satisfying $C_r(\rho)\leq C_{\ell_1}(\rho)$ and any incoherent state $\sigma$ also satisfies the conjecture. We also note that if the von Neumann entropy is defined by the natural logarithm $\ln$ instead of $\log_2$, then the reduced relative entropy measure of coherence $\bar{C}_r(\rho)=-\rho_{\rm{diag}}\ln \rho_{\rm{diag}}+\rho\ln \rho$ satisfies the inequality ${\bar{C}}_r(\rho)\leq C_{\ell_1}(\rho)$ for any mixed state $\rho$.

We construct a real square system related to a given over-determined real system. We prove that the simple real zeros of the over-determined system are the simple real zeros of the related square system and the real zeros of the two systems are one-to-one correspondence with the constraint that the value of the sum of squares of the polynomials in the over-determined system at the real zeros is identically zero. After certifying the simple real zeros of the related square system with the interval methods, we assert that the certified zero is a local minimum of the sum of squares of the input polynomials. If the value of the sum of the squares of the input polynomials at the certified zero is equal to zero, it is a zero of the input system. As an application, we also consider the heuristic verification of the isolated zeros of polynomial systems and their multiplicity structures. Notice that a complex system with complex zeros can be transformed into a real system with real zeros.

Neuronal cells are believed to rely on autophagy to maintain cellular homeostasis. Nevertheless, autophagy may be a therapeutic target for neurodegenerative diseases because of the role it plays in neuronal cell death. Despite Beclin 1 association with autophagy and apoptosis, the molecular mechanisms that underlie Tau-induced vesicular pathology and Tau protein aggregates in humans remain poorly understood. Here, we set out to examine the role of three genes-ATG14L, Beclin 1 and VPS34- in autophagy nucleation failure-associated Tau disorders in fruit fly models. We found that either reduced ATG14L levels improve neuronal outcomes, or transgenic expression of ATG6/Beclin 1 greatly reduced age-dependent neurodegeneration and Tau pathology; whereas, the loss of Beclin 1 exacerbated these effects. Prior to p-Tau accumulation, the neuronal Beclin 1 network is critical for reducing p-Tau accumulation, indicating that the loss of Beclin 1 causes Tau pathology and neurodegeneration. As neurodegeneration progressed, glial cells showed an upregulation of vesicular Beclin 1 immunoreactivities. The reduced VPS34 also resulted in p-Tau accumulation, suggesting that neurons require both Beclin 1 and VPS34 to reduce p-Tau accumulation. Our results provide mechanistic insight into the molecular pathways that cause age-dependent Tau pathology and neurodegeneration due to an excess of autophagy nucleation processes and autophagy activity, and we derive novel inferences on the therapeutic possibilities of rebalanced Beclin 1 network by reducing autophagic specific nucleation component of ATG14L.

Selenium nanoparticles (SeNPs) has higher bioavailability and safety than inorganic selenium, and was widely used in medical, agricultural, nutritional supplements, and antibacterial fields. The present study screened a strain L11 producing SeNPs from a selenium rich dairy cow breeding base in Hubei Province, China. The strain was identified as Bacillus subtilis through physiological, biochemical, and molecular biology analysis. Through optimization of cultivation conditions, the optimal cultivation parameters for L11 to produce SeNPs were pH=6, cultivation temperature of 37 °C, 4 mmol/L Na2SeO3, and cultivation for 48 hours. XPS, SEM-EDS, and TEM were used to verify that the Se particles produced by L11 are SeNPs with diameters ranging from 50 to 200 nm. The combination of protein analysis of different cell components and TEM analysis showed that L11 mainly produces SeNPs through the transformation of the cell's periplasmic space, cell membrane, and cell wall. Adding L11 SeNPs complex to sheep feed can significantly enhance the antioxidant activity and immunity of sheep, and increase the Se content in the neck muscles, liver, and spleen tissues.

Cloud Manufacturing (CMfg) has attracted lots of attention from scholars and practitioners. The purpose of quality of service (QoS)-aware manufacturing cloud service composition (MCSC), as one of the key issues in CMfg, is to combine different available manufacturing cloud services(MCSs) to generate an optimized MCSC that can meet diverse requirements of customers. However, many available MCS, deployed in the CMfg platform, have same function but different QoS attributes. It is a great challenge to achieve optimal MCSC with high QoS. In order to obtain better optimization results efficiently for the QoS-MCSC problems, a whale optimization algorithm(WOA) with adaptive weight, Lévy flight, and adaptive crossover strategies (ASWOA) is proposed. In the proposed ASWOA, the adaptive crossover inspired by the genetic algorithm is developed to balance the exploration and exploitation. The Lévy flight is designed to expand the search space of WOA and accelerate the convergence of WOA with adaptive crossover. The adaptive weight is developed to extend the search scale of the exploitation. Simulation and comparison experiments are conducted on different scale QoS-MCSC problems. The experimental results demonstrate that the proposed ASWOA outperforms other compared cutting-edge algorithms.

This study presents an innovative analytical method for the detection and quantification of 14 β-agonists in pork using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The method involves the use of a solid phase microextraction (SPME) probe, consisting of a wooden tip coated with polyacrylonitrile (PAN) and molecularly imprinted polymer (MIP). This probe has been integrated into an automated extraction device, designed in our laboratory to extract the target analytes prior to LC-MS/MS analysis. Compared to the traditional solid-phase extraction (SPE) procedure, the proposed approach significantly reduces the costs related to adsorbent ma-terial and solvent consumption, and shortens purification time, thereby reducing both the tech-nical workload and associated expenses. The methodology has been carefully validated in ac-cordance with the National Standard of the People's Republic of China (GB/T 22286-2008), evalu-ating key parameters including the limit of detection (LOD), limit of quantification (LOQ), matrix effects, linearity, and both intra-day and inter-day precision. The average recovery rates for all β-agonists were observed to lie between 71.6% and 82.2%, with relative standard deviations (RSDs) consistently below 15% for both types of precision. The LOD and LOQ values were found to range from 0.09 to 0.39 μg/kg and 0.27 to 0.99 μg/kg, respectively. In terms of accurate detection of positive samples, the developed method demonstrated a closer approximation to the true value of the sample compared to the National Standard method GB/T 31658.22-2022. Overall, the proposed method exhibits substantial promise for the routine assessment of β-agonists in pork and presents a practical alternative for compliance monitoring in regulatory settings.

Marek’s disease (MD) is an important neoplastic disease caused by serotype 1 Marek's disease virus (MDV-1), which results in severe economic losses worldwide. Despite vaccination practices that have controlled the MD epidemic, current increasing MD-suspected cases indicate the persistent viral infections circulating among vaccinated chicken farms in many countries. However, the lack of available information about phylogeny and molecular characterization of circulating MDV-1 field strains in Taiwan reveals a potential risk in MD outbreaks. This study investigated the genetic characteristics of 18 MDV-1 isolates obtained from 17 vaccinated chicken flocks in Taiwan between 2018 and 2020. Based on the sequences of the meq oncogene, phylogenetic analysis demonstrated that the circulating Taiwanese MDV-1 field strains were predominantly in a single cluster that showed high similarity with strains/isolates from countries of East Asian region. Because the isolated strains were obtained from CVI988/Rispens vaccinated chicken flocks and the molecular characteristics of the Meq oncoprotein showed the features like vvMDV and vv+MDV strains, the circulating Taiwanese MDV-1 field strains may have higher virulence compared with vvMDV pathotype. In conclusion, the presented data demonstrate the circulation of hypervirulent MDV-1 strains in Taiwan and highlight the importance of routine surveillance and precaution strategies in response to the emergence of enhanced virulent MDV-1.

Cafestol, a bioactive compound found in coffee, has attracted considerable attention due to its potential impact on cardiovascular health. This review aims to comprehensively explore the association between cafestol and cardiovascular diseases. We delve into the mechanisms through which cafestol influences lipid metabolism, inflammation, and endothelial function, all of which are pivotal in cardiovascular pathophysiology. Moreover, we meticulously analyze epidemiological studies and clinical trials to elucidate the relationship between cafestol and cardiovascular outcomes. Through a critical examination of existing literature, we aim to provide insights into the potential benefits and risks associated with cafestol concerning cardiovascular health.

The operation status of manufacturing equipment is directly related to the reliability of the operation of manufacturing equipment and the continuity of operation of the production system. Based on the analysis of the operation status of manufacturing equipment and its characteristics, it is proposed that the concept of assessing the operation status of manufacturing equipment can be realized by applying real-time acquisition of accurate inspection data of important parts of weak motion units and comparing them with their motion status evaluation criteria. Through the study of the application characteristics of fractional-order calculus theory, a differential data fusion model based on the fractional-order differential operator is established. The advantages of Internet of Things (IoT）technology and fractional order differential fusion algorithm are integrated to obtain real-time high-precision data of the operating parameters of manufacturing equipment, and the research objective of operating condition assessment of manufacturing equipment is realized. The feasibility and effectiveness of the method are verified by the application of the method in machining center operation status assessment.

Aluminum wire is a common material for wire bonding due to its resistance to oxidation and low price. It does not melt when becoming a free air ball (FAB) during the electronic flame-off (EFO) process with wettability, and is applied by wedge bonding. This study used 20μm Zn-Coated Al-0.5wt.%Si (ZAS) wires to improve the FAB shape after the EFO process, while maintaining stability of the mechanical properties, including the interface bonding strength and hardness. In order to test circuit stability after ball bonding, the current-tensile test was performed. During the experiment, it was found that 80nm ZAS with wire bonding has lower resistance and higher fusing current. For the bias tensile test, the thicker Zn film diffused into the Al-Si matrix easily, after which the strength was reduced. The ball-bond interfaces had no change in their condition before and after the bias. Accordingly, ZAS could be a promising candidate for ball bonding in the future.

We introduce a series of twisted donor-acceptor (D-A) carbazole-benzophenone based electroactive bipolar derivatives that were synthesized through the reaction of 4-fluorobenzophenone with various partially alkylated 3,3’-bicarbazoles. The comprehensive structural characterization of these compounds is provided. These amorphous materials exhibit suitable glass transition temperatures ranging from 57 to 102 °C and demonstrate high thermal stability, with decomposition temperatures reaching 400 °C. Moreover, the developed materials exhibit elevated photoluminescence quantum yields (PLQY) of up to 75.5% and favorable HOMO-LUMO levels, along with suitable triplet-singlet state energy values. Due to their good solubility and suitable film-forming properties, all the compounds were evaluated as blue emitters dispersed in 4,4’-bis(N-carbazolyl)-1,10-biphenyl (CBP) host for the fabrication of organic light-emitting diodes (OLEDs) in concentration dependent experiments. Among these experiments, the device containing 15 wt% of the guest 4-(9’-{2-ethylhexyl}-[3,3’]-bicarbazol-9-yl)benzophenone demonstrated the best characteristics, achieving maximum brightness of 3581 cd/m2, current efficiency of 5.7 cd/A, power efficiency of 4.1 lm/W and external quantum efficiency of 2.7%.

Various vaccines have been developed in response to the SARS-CoV-2 pandemic, and the safety of vaccines has become an important issue. COVID-19 vaccines-related central nervous system inflammatory demyelinating diseases (CNS IDDs) have been reported recently. We present one case of AstraZeneca vaccine-related myelin oligodendrocyte glycoprotein (MOG) antibody-associated disease and literature review another 78 patients published from January 2020 to October 2022. Patients were divided into three vaccine groups (viral vector, mRNA and inactivated vaccines) for further analyses. Among 79 patients with COVID-19 vaccines-related CNS IDDs, 49 (62%) cases received viral vector vaccines, 20 (25.3%) received mRNA vaccines and 10 (12.7%) received inactivated vaccines. Twenty-seven cases (34.2%) were confirmed with autoantibodies, including 15 patients (19%) with anti-MOG, 11 (13.9%) with anti-aquaporin 4 (AQP4), and one (1.3%) with both antibodies. Significantly, more males developed CNS IDDs post viral vector vaccines compared to mRNA and inactivated vaccines. Patients receiving mRNA vaccines were older than other groups. Furthermore, mRNA and inactivated vaccines correlated more with anti-AQP4 antibodies, while viral vector vaccines showed higher MOG positivity. The research suggests potential associations between COVID-19 vaccines-related CNS IDDs and gender, age, and autoantibodies, contingent on vaccine types. Protein sequence analysis implies similarities between the S protein and AQP4/MOG. Further studies may elucidate the mechanisms of CNS IDDs, aiding vaccine selection for specific groups.

This study aimed to investigate the relationship between sleep duration, dementia severity, age, and ANS regulation. This cross-sectional pilot study included 27 older patients with probable Alzheimer’s disease, hospitalized at a psychiatric center. We measured heart rate variability to assess ANS regulation at night, evaluated dementia severity using the Clinical Dementia Rating scale, and obtained sleep duration data from sleep diaries maintained by psychiatric nurses. The data were analyzed using repeated-measures generalized linear models with age, sex, dementia severity, and medication (antipsychotics) as covariates. A sleep duration of 7–8 h per night was associated with better ANS regulation than other sleep durations, as indicated by sympathovagal balance (p = 0.005). ANS dysregulation was characterized by a 20.7% increase in sympathetic nervous system activity and a 14.8% decrease in parasympathetic nervous system (PSNS) activity. We found a significant correlation between dementia severity and PSNS activity (p = 0.04) and observed an inverted U-shaped association between sleep duration and ANS regulation. This pilot study demonstrated that a sleep duration of 7–8 h per night may be critical in maintaining optimal ANS regulation. Bidirectional associations between sleep duration, inadequate sleep duration, aging, and ANS regulation warrant further investigation.

Objective: Identify factors associated with excessive day time sleepiness (EDS) in individuals with obstructive sleep apnea (OSA), and analyze the effects that obesity and gender have on excessive daytime sleepiness in such individuals. Methods: A total of 160 people were selected for this study. All the people have completed a clinical evaluation, and whose apnea-hypopnea index (AHI) > 10 events/hour of sleep on polysomnography were included in the study from the Department of otolaryngology. Results: The Mean age was 43.87±11.34 years, mean EDS score was 14.09± 4.91, and mean AHI was 43.88±20.66 events/hour of sleep. Male presented lower mean age, higher EDS scores, and more time in apnoea, whereas females presented with higher mean age, lower EDS scores, and less time in sleep apnea. The EDS score showed best correlation with duration of apnoea (r = 0.448; p < 0.01), peripheral oxygen saturation (SpO₂; r = -0.458; p < 0.01) and AHI (r = 0.484; p < 0.01). The mean body mass index (BMI) was 27.41±3.86 kg/m². Normal, Overweight, obese, and morbidly obese were observed in 20%, 61%, 18%, and 0.6% of cases, respectively. Severity of the disease best correlated with BMI (r = 0.421; p < 0.01). Conclusions: OSA is predominant in males (M/F 5:1), and obese population. Females diagnosed with OSA have higher mean age. However, EDS scores and time spent in sleep apnoea is lower in females. Higher BMI is associated with EDS, irrespective of gender.

This study aims to implement a SSDBI (single-stage differential boost inverter, SSDBI) applying in a single-stage BESS (battery energy storage system, BESS) topology, which can supply power from lower voltage battery module to AC load. Compared with the common two-stage topology, which has a two-stage converter and higher voltage battery module array, the single-stage topology can reduce the number of cells and components, and improve the power density. In addition, a modified SPWM control was proposed to reduce the control complexity of the SSDBI while improving the THD of the inverter. The modified SPWM control can reduce the duty ratio of the SSDBI and the stress on the components to improve the AC voltage output waveform and reduce the THD value about 2.654%.

The parameter estimation problem for polynomial phase signals (PPSs) arises in a number of fields, including radar, sonar, biology, etc. In this paper, a fast algorithm of parameter estimation for monocomponent PPS is considered. We propose the so-called LSU-EKF estimator, which combines the least squares unwrapping (LSU) estimator and the extended Kalman filter (EKF). First, the coarse estimates of the parameters of PPS are obtained by the LSU estimator using a small number of samples. Subsequently, these coarse estimates are used to initial the EKF. Monte-Carlo simulations show that the computation complexity of the LSU-EKF estimator is much less than that of the LSU estimator, with little performance loss. Similar to the LSU estimator, the proposed algorithm is able to work over the entire identifiable region. Moreover, in the EKF stage, the accurate estimated results can be output point-by-point, which is useful in real applications.

Diastolic dysfunction, a prevalent condition characterized by impaired relaxation and filling of the left ventricle, significantly contributes to heart failure with preserved ejection fraction (HFpEF). Galectin-3, a β-galactoside-binding lectin, has garnered attention as a potential biomarker and mediator of fibrosis and inflammation in cardiovascular diseases. This comprehensive review investigates the impact of galectin-3 on diastolic dysfunction. We explore its molecular mechanisms, including its involvement in cellular signaling pathways and interaction with components of the extracellular matrix. Evidence from both animal models and clinical studies elucidates galectin-3's role in cardiac remodeling, inflammation, and fibrosis, shedding light on the underlying pathophysiology of diastolic dysfunction. Additionally, we examine the diagnostic and therapeutic implications of galectin-3 in diastolic dysfunction, emphasizing its potential as both a biomarker and a therapeutic target. This review underscores the significance of comprehending galectin-3's role in diastolic dysfunction and its promise in enhancing diagnosis and treatment approaches for HFpEF patients.

Plant endophytic fungi and rhizosphere soil fungi are often reported as biocontrol agents against plant pathogens or with plant growth promotion potential. Four treatments were performed in field and greenhouse experiments where cucumber plants were inoculated with Trichoderma harzianum and Fusarium oxysporum in 2022. The roots, stems and leaves of cucumber plants and their rhizosphere soil were collected twice individually from the field and greenhouse for isolation of cucumber endophytic and rhizosphere soil fungi. All 74 genera and 1275 fungal strains were sequenced by rDNA ITS. The PDA media yielded the highest number of genera isolated from cucumber plants, rhizosphere soil and both compared to other media. There were no significant differences among the 4 media for the isolation of cucumber endophytic fungi. The best media for isolating fungi from roots and stems were MRBA and PDA, respectively. PDA and CZA had higher isolation efficiency for the rhizosphere soil fungi than MRBA. The 28 fungal genera had high isolation efficiency, and the endophytic Trichoderma strains were best isolated by MEA. It is suggested that PDA can be used as a basic medium, and different media can be considered for specific fungal genera.

The uncertainty in the secondary path of an Active Noise Control (ANC) headphone affects the waterbed effect and stability of the feedback system. This study focuses on the uncertainty of the secondary path when real users wear headphones, and proposes a new uncertainty constraint based on the measured results of the secondary path transfer function under different wearing conditions of dummy head and limited subjects. This constraint and a cascaded second-order infinite impulse response filter with fixed coefficients are used to formulate a control strategic function, which is optimized by the Improved Grey Wolf Optimizer (IGWO) algorithm to obtain the optimal controller with better noise reduction performance. The proposed method and simulation model are validated based on the experimental test results. The results demonstrate that the safety factor and waterbed suppressing factor contained in the proposed uncertainty constraint ensures more stable noise reduction and effective suppression of the waterbed effect for new subjects without a priori data.

This paper develops a novel energy universal service bus system (EUSBS) based on emerging energy Internet (E-net) technologies. This EUSBS is a unified identification and plug-and-play interface platform to which high penetration distributed energy and equipment (DEE), including photovoltaic (PV), fans, electric vehicle charging stations (EVCSs), energy storage equipment (ESE), and commercial and residential users (CRUs), can access in a coordinated control and optimized utilization mode. First, the functions design, overall framework and topology architecture design of the EUSBS are expounded, among which the EUSBS is mainly composed of a hardware system and a software platform. Moreover, several future application scenarios are presented. Then, the hardware part of EUSBS is designed and developed, including the framework design of this hardware subsystem, and development of the hardware equipment for PV access, fans access, EVCS access, ESE access, and CRU access. The hardware subsystem consists of smart socket, and household/floor/building concentrators. Based on this, the prototypes development of EUSBS hardware equipment is completely demonstrated. Third, the software part of the EUSBS is developed as a cloud service platform for electricity use data analysis of DEE. This software subsystem contains the power quality & energy efficiency analysis module, optimization control module, information and service module, and data monitoring and electricity behavior analysis module. Based on this design, the software interfaces are developed. Finally, an application study on energy management and optimization of a smart commercial building is conducted to evaluate the functions and practicality of this EUSBS. The EUSBS developed in this paper is able to overcome difficulties in big data collection and utilization on sides of distribution network and electricity utilization, and eventually implement a deep information-energy fusion and a friendly supply-demand interaction between the grid and users. This contribution presents a detailed and systematic development scheme of the EUSBS, and moreover, the laboratory prototypes of the hardware and software subsystems have been developed based on E-net technologies. This paper can provide some thoughts and suggestions for the research of active distribution network and comprehensive energy management and optimization in power systems, as well as references and guidance for researchers to carry out research regarding energy management, optimization and coordinated control of the smart buildings.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

The prediction of drug--target interactions is always a key task in the field of drug redirection. However, traditional methods of predicting drug--target interactions are either mediocre or rely heavily on data stacking. In this work, we merged heterogeneous graph information and obtained effective node information and substructure information based on mutual information in graph embeddings. We then learned high quality representations for downstream tasks, and proposed an end--to--end auto--encoder model to complete the task of link prediction. Experimental results show that our method outperforms several state--of--art models. The model can achieve the area under the receiver operating characteristics (AUROC) curve of 0.959 and area under the precise recall curve (AUPR) of 0.848. We found that the mutual information between the substructure and graph--level representations contributes most to the mutual information index in a relatively sparse network. And the mutual information between the node--level and graph--level representations contributes most in a relatively dense network.

In prostate cancer, p53 maximizes apoptosis in response to severe DNA damage, not DNA replication stress. Here, we examined the apoptotic response of two glioblastoma cells, p53-wild type U87 and a p53-mutated T98G cell, for the same stresses. We ascertained that p53 intensified apoptosis in response to severe DNA damage, not DNA replication stress in glioblastoma. We further asked if p53-mediated apoptosis can be induced by cellular stress other than severe DNA damage. We analyzed two compounds, bortezomib and vorinostat, respective inhibitors of 26S proteasome and histone deacetylase, to evaluate their capacity to activate p53-mediated apoptosis. The cellular stress incited by bortezomib, not vorinostat, activated p53-mediated apoptosis. Next, we asked if the cellular stress generated by combining the two compounds had a synergistic effect on apoptosis. Our results demonstrated that doxorubicin with bortezomib or CFS-1686, or bortezomib with vorinostat have a significant synergistic effect on apoptosis only in p53-wild type cell. Under high stress, p53 translocates from cytosol into the nucleus to cause apoptosis possibly. Together, p53 maximizes apoptosis for cellular stress caused by severe DNA damage, disruption of protein turnover, and for the stress induced by drug combination including doxorubicin with bortezomib or CFS-1686, and bortezomib with vorinostat.

Deep learning methods have been widely used in PolSAR image classification. To learn the polarimetric information, many deep learning methods expect to learn high-level semantic features from original PolSAR data. However, only original data cannot learn multiple scattering features and complex structures for extremely heterogeneous terrain objects. In addition, deep learning methods always cause edge confusion due to the high-level features. To overcome these shortages, we propose a double-channel CNN network combined with an edge-preserving MRF model(DCCNN-MRF) for PolSAR image classification. Firstly, to combine complex matrix data and multiple scattering features together, a double-channel convolution network(DCCNN) is developed, which consists of a Wishart-based complex matrix and multi-feature subnetworks. The Wishart-based complex matrix network can learn the statistical characteristics and channel correlation well, and the multi-feature network can learn high-level semantic features well. Then, a unified network framework is designed to fuse two kinds of features to enhance advantageous features and reduce redundant ones. Finally, an edge preserving MRF model is designed to combine with the DCCNN network. In the MRF model, a sketch map-based edge energy function is designed by defining adaptive weighted neighborhood for edge pixels. Experiments are conducted on four real PolSAR data sets with different sensors and bands. Experimental results demonstrate the effectiveness of the proposed DCCNN-MRF method.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

Conical emission is a typical nonlinear phenomenon that occurs when the femtosecond laser pulses interact with transparent media. In this work, the conical emission induced by two kinds of typical vortex beams (i.e., Laguerre-Gaussian (LG) and Bessel-Gaussian (BG) beams) in water is experimentally studied. By recording the light spots of different wavelengths on the screen, the characteristics of the conical emission induced by femtosecond vortex beams are studied. It is found that the spots of the supercontinuum induced by the two kinds of vortex beams differ greatly from each other: The spots of the supercontinuum induced by the BG beam are a set of concentric rings like a rainbow with a white center, while the whit light spot in the case of the LG beam are a circular white disk, which is different from the commonly observed white light spots. By measuring the maximum divergence angle, it is observed that the divergence angle increases with the decrease of the wavelength, while the TC merely affects the divergence angle, which is explained from the formation mechanism of conical emission in terms of self-phase modulation. We hope this work can be helpful to the understanding of interaction between the intense laser pulses and matters.

Novel multifunctional fluorescent chemosensors composed of electrospun (ES) nanofibers with high sensitivity toward pH, mercury ions (Hg²⁺), and temperature were prepared from poly(N-Isopropylacrylamide-co-N-methylolacrylamide-co-rhodamine derivative) (poly(NIPAAm-co-NMA-co-RhBN2AM)) by employing electrospinning process. NIPAAm and NMA moieties provide hydrophilic and thermo-responsive properties (absorption of Hg²⁺ in aqueous solutions), and chemical cross-linking sites (stabilization of the fibrous structure in aqueous solutions), respectively. The fluorescent probe, RhBN2AM is highly sensitive toward pH and Hg²⁺. Synthesis of poly(NIPAAm-co-NMA-co-RhBN2AM) with different compositions were carried on via free-radical polymerization. ES nanofibers prepared from sensory copolymers with a 71.1:28.4:0.5 NIPAAm: NMA: RhBN2AM ratio (P3 ES nanofibers) exhibited significant color change from nonfluorescent to red fluorescence while sensing pH or Hg²⁺, and high reversibility of on/off switchable fluorescence emission when Hg²⁺ and ethylenediaminetetraacetic acid (EDTA) were sequentially added. The P3 ES nanofibrous membranes had a higher surface-to-volume ratio to enhance their performance than did the corresponding thin films. In addition, the fluorescence emission of P3 ES nanofibrous membranes exhibited second enhancement above the lower critical solution temperature. Thus, the ES nanofibrous membranes prepared from P3 with on/off switchable capacity and thermo-responsive characteristics can be used as multifunctional sensory devise for specific heavy transition metal (HTM) in aqueous solutions.

Transition-metal-catalyzed amide bond formation from alcohols and amines is an atom-economic and eco-friendly route. Herein, we identified a highly active in situ N-heterocyclic carbene (NHC)/ruthenium (Ru) catalytic system for this amide synthesis. Various substrates, including sterically hindered ones, could be directly transformed into the corresponding amides with the catalyst loading as low as 0.25 mol%. In this system, we replaced the p-cymene ligand of the Ru source with a relatively labile cyclooctadiene (cod) ligand so as to more efficiently obtain the corresponding poly-carbene Ru species. Expectedly, the weaker cod ligand could be more easily substituted with multiple mono-NHC ligands. Further HR-MS analyses revealed that two tetra-carbene complexes were probably generated from the in situ catalytic system.

Strigolactones (SLs) are a novel emerging plant hormones, which play important roles in regulating plant organ development and environmental stress tolerance. Even though the SL related genes have been identified and well characterized in some plants. The information of SL related genes in soybean is not fully established yet, especially in response to salt stress. In this study, we identified nine SL biosynthesis genes: two D27, two CCD7, two CCD8, and three MAX1, and seven SL signaling genes: two D14, two MAX2 and three D53 in soybean genome. We found that SL biosynthesis and signaling genes are conserved during evolution in different species. Syntenic analysis of these genes revealed their location on nine chromosomes as well as existence of ten pairs of duplication genes. Moreover, plant hormone and stress-responsive elements were identified in the promoter regions of SL biosynthesis and signaling genes. By using quantitative real-time PCR (qRT-PCR), we confirmed that SL genes have different tissue expression in roots, stems and leaves. Further, we also explored the expression profiles of SL biosynthesis and signaling genes under salt stress. These results suggested that SL signaling genes may play important regulatory roles in response to salt stress. In conclusion, we identified and provided valuable information on the soybean SL biosynthesis and signaling genes, and established a foundation for further functional analysis of soybean SL related genes in response to salt stress.

In response to injury, vascular smooth muscle cells (VSMCs) of the arterial wall dedifferentiate into a proliferative and migratory phenotype, leading to intimal hyperplasia. The ERK1/2 pathway participates in cellular proliferation and migration while dual-specificity phosphatase 6 (DUSP6, also named MKP3) can dephosphorylate activated ERK1/2. We showed that DUSP6 was expressed in low baseline levels in normal arteries; however, arterial injury significantly increased DUSP6 levels in the vessel wall. Compared with wild-type mice, Dusp6-deficient mice had smaller neointima. In vitro, IL-1β induced DUSP6 expression and increased VSMC proliferation and migration. Lack of DUSP6 diminished IL-1β-induced VSMC proliferation and migration. DUSP6 deficiency did not affect IL-1β-stimulated ERK1/2 activation. Instead, ERK1/2 inhibitor U0126 prevented DUSP6 induction by IL-1beta, indicating that ERK1/2 functions upstream of DUSP6 to regulate DUSP6 expression in VSMCs rather than downstream as a DUSP6 substrate. IL-1β decreased levels of cell cycle inhibitor p27 and cell-cell adhesion molecule N-cadherin in VSMCs whereas lack of DUSP6 prevented their downregulation, revealing novel functions of DUSP6 in regulating these two molecules. Taken together, our results indicate that lack of DUSP6 attenuated neointima formation following arterial injury by reducing VSMC proliferation and migration, which were likely mediated via maintaining p27 and N-cadherin levels.

In Taiwan, mountainous areas account for approximately two-thirds of the total area. The steep terrain and concentrated rainfall during typhoons cause landslides, which pose a considerable threat to mountain settlements. Therefore, models for analyzing rainfall-induced landslide hazards are urgently required to ensure adequate land use in mountainous areas. In this study, focusing on Pingtung County in southern Taiwan, we developed a landslide hazard index (IRL) to land use. Using FORMOSA-2 and SPOT-5 satellite images, data were collected before and after four typhoons (one in 2009 and three in 2013). The ArcGIS random tree classifier was used for interpreting satellite images to explore surface changes and disasters, which were used to analyze slope disturbances. The product of the maximum 3-h rolling rainfall intensity and effective accumulated rainfall was used as a rainfall trigger index (IRT). Considering environmental and slope disturbance factors, an index of slope environmental strength potential (ISESP) was developed through logistic regression (LR). Landslide hazard to land use was estimated using IRT and ISESP. The average coefficient of agreement (Kappa) was approximately 0.71 (medium to high accuracy); the overall accuracy of slope environmental strength potential analysis was approximately 80.4%. At a constant ISESP, IRT increased with the increasing hazard potential of rainfall-induced landslides. Furthermore, IRT and ISESP were positively correlated with landslide occurrence. When large ISESP values occur (e.g., fragile environment and high land development intensity), small IRT values may induce landslides.

In recent years, governments applied intelligent transportation system (ITS) technique to provide several convenience services (e.g., garbage truck app) for residents. This study proposes a garbage truck fleet management system (GTFMS) and data feature selection and data clustering methods for travel time prediction. A GTFMS includes mobile devices (MD), on-board units, fleet management server, and data analysis server (DAS). When user uses MD to request the arrival time of garbage truck, DAS can perform the procedure of data feature selection and data clustering methods to analyses travel time of garbage truck. The proposed methods can cluster the records of travel time and reduce variation for the improvement of travel time prediction. After predicting travel time and arrival time, the predicted information can be sent to user’s MD. In experimental environment, the results showed that the accuracies of previous method and proposed method are 16.73% and 85.97%, respectively. Therefore, the proposed data feature selection and data clustering methods can be used to predict stop-to-stop travel time of garbage truck.

Despite recent advancements, therapies remain ineffective against advanced oral squamous cell carcinoma (OSCC), resulting in unsatisfactory therapeutic outcomes. Cold atmospheric plasma (CAP) offers a promising approach in the treatment of malignant neoplasms. Yet, the exact mechanisms driving CAP-induced cancer cell death are not fully understood. This study revealed a significant reduction in the viability of OSCC cell lines, inactivation of AKT and ERK, and the downregulation of the miR-21, miR-31, miR-134, miR-146a and miR-211 expression followed the CAP treatment. Pretreatment with ZVAD, 3-MA, and Fer-1 synergistically reduced CAP-induced cell death, indicating a combined induction of variable death pathways by CAP. Activation of AKT and ERK, alongside combined treatments using death inhibitors and miRNA mimics, counteracted the cell mortality associated with CAP. CAP-induced downregulation of miR-21, miR-31, miR-187 and miR-211 expression was rescued by AKT and ERK activation. Additionally, CAP treatments notably inhibited the growth of SAS cell xenografts on nude mice. The reduced expression of oncogenic miRNAs in vivo aligned with in vitro findings. In conclusion, our study indicates that CAP jet treatment diminishes OSCC cell viability by abrogating survival signals and oncogenic miRNA expression.

The black hole (BH) phenomenon is an intraluminal restenotic lesion. It was identified by intravascular ultrasound (IVUS) and optical coherence tomography (OCT) after intracoronary brachytherapy and drug-eluting stent implantation. Despite the similarity in the mode of action of brachytherapy and drug-eluting stent implantation, the BH phenomenon appears to be uncommon after drug-eluting stent implantation. Specifically, the BH phenomenon is better identified by OCT than by IVUS. Herein, we present a case of in-stent restenosis with suspected BH phenomenon on IVUS confirmed by OCT.

We address weighted composition operators ψCφ from α-Bloch spaces to Bers-type spaces of bounded holomorphic functions on Y, where Y is a generalized Hua domain of the first kind, and obtain some necessary and sufficient conditions for the boundedness and compactness of those operators.

In wideband radar systems, the performance of motion parameters estimation can significantly affect the performance of object detection and the quality of inverse synthetic aperture radar (ISAR) imaging. Although the traditional motion parameters estimation methods can reduce the range migration (RM) and Doppler frequency migration (DFM) effects in ISAR imaging, the computational complexity is high. In this paper, we propose a new fast non-searching motion parameters estimation method based on cross-correlation of adjacent echoes (CCAE) for wideband LFM signals. A cross-correlation operation is carried out for two adjacent echo signals, then the motion parameters can be calculated by estimating the frequency of the correlation result. The proposed CCAE method can be applied directly to the stretching system, which is commonly adopted in wideband radar systems. Simulational results demonstrate that the new method can achieve better estimation performances, with much lower computational cost, compared with existing methods. The experimental results on real radar data sets are also evaluated to verify the effectiveness and superiority of the proposed method compared to the state-of-the-art existing methods.

Studies on the neurobiological causes of anxiety disorders suggest that the GABA system in-creases synaptic concentration and enhances the affinity of GABAA (type A) receptors for ben-zo-diazepine ligands. Flumazenil antagonizes the benzodiazepine binding site of the GABA (γ-aminobutyric acid) type /benzodiazepine receptor (BZR) complex in the central nervous sys-tem (CNS). The integration of the metabolites of flumazenil by LC-tandem mass spectrometry will complete understanding of the in vivo metabolism of flumazenil and accelerate radio-pharmaceutical inspection and registration. The main goal of our study was to investigate using reversed-phase HPLC (PR-HPLC) coupled with electrospray ionization triple quadrupole tan-dem mass spectrometry (ESI-QqQ MS) for the identification of flumazenil and its metabolites in a hepatic matrix. And a carrier-free nucleophilic fluorination with automatic synthesizer for [18F]flumazenil which applied to in vivo nano-positron emission tomography (Nano-PET)/computed tomography (CT) imaging and ex vivo bio-distribution used to analyze in normal rats. The study showed that 50% of the flumazenil was bio-transformed at 60 min by the rat liver homogenate, while one metabolite (M1) was a methyl transesterification product of flumazenil. In a rat liver microsomes system, two metabolites were identified (M2 and M3) as its carboxylic acid and hydroxylated ethylester forms, respectively. [18F]flumazenil in vivo nanoPET/CT imag-ing and ex vivo bio-distribution assay also showed significant effects on GABAA receptor availa-bility in the amygdala, prefrontal cortex, cortex, and hippocampus in the rat brain, worriless about the formation of metabolites. We showed completion of the bio-transformed course of flumazenil by the hepatic system; and [18F]flumazenil can be a good ligand and serve as a PET agent for determination of GABAA/BZR complex for multiplex neurological syndromes in the clinical stage.

Periostracum cicadae, the cast-off shell of the cicada Cryptotympana pustulata Fabricius, is used in traditional Chinese medicine for its diaphoretic, anticonvulsive, sedative, antipyretic, and antiallergic effects. However, the exact pathogenesis of immunoglobulin A nephropathy (IgAN) remains unclear, thereby hindering investigations to identify novel therapeutic agents. A rat IgAN model was established by administration of bovine serum albumin, lipopolysaccharide, and carbon tetrachloride, which simultaneously established blood stasis and a heat syndrome model. The animals were sacrificed to detect changes in protein levels in urine and blood. Immunofluorescence was performed to assess IgA deposition in the glomeruli. Tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin 6 (IL-6) levels were measured in bronchoalveolar lavage fluid (BALF) by enzyme-linked immunosorbent assay. Hematology and eosin, periodic acid-Schiff, TUNEL, and immunohistochemical staining were performed to evaluate histopathological changes in kidney tissues. Additionally, target-related proteins were measured by western blotting. Periostracum cicadae resulted in a reduction in blood and urine protein levels. Serum TNF-α, IL-1β, and IL-6 levels significantly decreased in the periostracum cicadae-treated groups compared to the IgAN group. Furthermore, a reduction in MCP-1, TLR4, and IgA expression levels and a dose- dependent increase in caspace-3 expression were observed in response to periostracum cicadae treatment. TGF-β1 levels decreased, whereas that of Fas increased in the kidney tissues of the periostracum cicadae-treated groups. The findings of the present study indicate that periostracum cicadae induces apoptosis and improves kidney inflammation and fibrosis in IgA nephropathy rat models.

Viruses can induce the fusion of infected and neighboring cells, leading to the formation of syncytia. Cell-cell fusion is mediated by viral fusion proteins on the plasma membrane of infected cells that interact with cellular receptors on neighboring cells. Viruses use this mechanism to spread rapidly to adjacent cells or escape host immunity. For some viruses, syncytium formation is a hallmark of infection and a known pathogenicity factor. For others, the role of syncytium formation in viral dissemination and pathogenicity remains poorly understood. Human cytomegalovirus (HCMV) is an important cause of morbidity and mortality in transplant patients and the leading cause of congenital infections. Clinical HCMV isolates have broad cell tropism but differ in their ability to induce cell-cell fusions, and little is known about the molecular determinants. We developed a system to analyze HCMV glycoprotein B (gB) variants in a defined genetic background. HCMV strains TB40/E and TR were used as vectors to compare the fusogenicity of six gB variants from congenitally infected fetuses with those from three laboratory strains. Five of them conferred the ability to induce fusion of MRC-5 human embryonic lung fibroblasts to one or both backbone strains, as determined by a split GFP-luciferase reporter system. The same gB variants were not sufficient to induce syncytia in infected ARPE-19 epithelial cells, suggesting that additional factors are involved. The system described here allows a systematic comparison of the fusogenicity of viral envelope glycoproteins and may help to clarify whether fusion-promoting variants are associated with increased pathogenicity.

Simultaneous Localization and Mapping (SLAM), as one of the core technologies in intelligent robotics, has gained substantial attention in recent years. Addressing the limitations of SLAM systems in dynamic environments, this research proposes a system specifically designed for plant factory transportation environments, named GY-SLAM. GY-SLAM incorporates a lightweight target detection network GY based on YOLOv5, which utilizes GhostNet as the backbone network. This integration is further enhanced with CoordConv coordinate convolution, CARAFE up-sampling operators, and SE attention mechanism, leading to simultaneous improvements in detection accuracy and model complexity reduction. While improving [email protected] by 0.514%, the model simultaneously reduces the number of parameters by 43.976%, computational cost by 46.488%, and model size by 41.752%. Additionally, the system constructs pure static octree maps and grid maps. Tests conducted on the TUM dataset and a proprietary dataset demonstrate that GY-SLAM significantly outperforms ORB-SLAM3 in dynamic scenarios in terms of system local-ization accuracy and robustness. It shows a remarkable 92.58% improvement in RMSE for Absolute Trajectory Error (ATE). Compared to YOLOv5s, the GY model brings a 41.5944% improvement in detection speed and a 17.7975% increase in SLAM operation speed to the system, indicating strong competitiveness and real-time capabilities. These results validate the effectiveness of GY-SLAM in dynamic environments and provide substantial support for the automation of logistics tasks by robots in specific contexts.

Dissolved organic matter (DOM) derived from organic fertilizers may increase soil phosphorus (P) availability. However, the frequently observed correlation between soil P availability and dissolved organic carbon (DOC) content has led to an excessive focus on DOC content at the expense of DOM properties. The present study investigated the influence of DOM characteristics on soil P availability by using a 6-year field experiment and microcosms of P sorption in paddy soil. Our results showed that partial replacement of chemical P fertilizer with manure or crop straw increased P fertilizer-use efficiency, even when decreasing chemical P input by 34 %, compared to normal chemical fertilization. The microcosm experiment demonstrated that DOM properties, rather than total DOC content, determine soil P sorption capacity, despite the significant correlation between DOC content and P availability observed in the field experiment. Manure-DOM exerted stronger inhibitory effects on P sorption than straw-DOM, and high molecular weight (HMW)-fractionated DOM exerted stronger inhibitory effects on P sorption than low-molecular-weight-fractionated DOM by 16-20%. The mechanism was rooted in the HMW DOM with unique characteristics (e.g., strong aromaticity, hydrophobicity, abundant humic-like components, carboxyl groups, and benzene ring structures) competing for soil P sorption sites (e.g., reduction in specific surface area and micropore volume), decreasing the soil surface charge (e.g., zeta potential), and thereby suppressing P sorption in paddy soil. Our study points out a promising avenue for regulating organic matter properties with organic fertilization to improve P use efficiency in agricultural soils.

Extracorporeal membrane oxygenation (ECMO), in conjunction with its life-saving benefits, carries a significant risk of acute brain injury (ABI). Hypoxic-ischemic brain injury (HIBI) is one of the most common types of ABI in ECMO patients. Various risk factors such as history of hypertension, high day 1 lactate level, low pH, cannulation technique, large peri-cannulation PaCO2 drop (∆PaCO2), and early low pulse pressure, have been associated with the development of HIBI in ECMO patients. The pathogenic mechanisms of HIBI in ECMO are complex and multifactorial, attributing to the underlying pathology requiring initiation of ECMO and the risk of HIBI associated with ECMO itself. HIBI is likely to occur in the peri-cannulation or peri-decannulation time secondary to underlying refractory cardiopulmonary failure before or after ECMO. Current therapeutics target pathological mechanisms, cerebral hypoxia and is-chemia, by employing targeted temperature management in the case of extracorporeal cardiopulmonary resuscitation (eCPR), and optimizing cerebral O2 saturations and cerebral perfusion. This review describes the pathophysiology, neuromonitoring, and therapeutic techniques to improve neurological outcomes in ECMO patients so as to prevent and minimize the morbidity of HIBI. Further studies aimed at stand-ardizing the most relevant neuromonitoring techniques, optimizing cerebral perfusion, and minimizing the severity of HIBI once it occurs will improve long-term neurological outcomes in ECMO patients.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

The microspheres constituted by proteinoids synthesized from Fox’s simulation experiments. They had peptide bond structure and weak catalysis, as well as proliferated themselves. Such microspheres were believed the models for primitive life. Due to lack of metabolism and self-reproduction, the microspheres could not meet requirements of life. Thus, how microspheres could evolved into primitive life remain unsolved mysteries. The microspheres were supposed a dissipative structure and the processes of absorption and hydrolysis could be balanced to maintain their stability by consuming proteinoid. Proteinoid molecules differed in their life spans, which were mainly determined by their multi-space structures. Consequently, molecule selection and retention could occur spontaneously in microspheres and lead to a more organized and stabilized structure of the whole microsphere with time through dissipative process. More complex chain network of chemical reactions could happen in microspheres because the proteinoid with complex, ordered multi-space structure and relatively high catalytic activity would retain. In such microspheres, nucleotides could produce and further aggregate into RNA. The synthesis of real proteins could take place with RNA as the template catalyzed by proteinoids or RNA inside microspheres. When template-based protein molecules replaced the proteinoid inside the microspheres, a protein-based self-catalyzed network of chemical reactions could take place. It is plausible if Fox’s proteinoids microspheres is to dawn on a dissipative structure, then molecule selection could occur spontaneously by “dissipative” proteinoids, and the microspheres would acquire catalytic activity due to preserved the proteinoid with a large molecular weight and relatively complex and ordered multi-space structure, and relatively high catalytic activity. Thus the microspheres would spontaneously go to self-organizing, and evolve into primitive life.

Fully mechanized mining face production involves complex geological conditions; mining pressure; gas, water, fire and other mining environments. The working face needs a shearer, hydraulic support, a scraper conveyor and other equipment for coordination. The deep integration of intelligent technology with factors such as "humans, machines, the environment, and management" in the workplace is the core content of intelligent coal mines. This paper puts forward an advanced framework for coal mining robot technology systems, including single robots, robotized equipment, robot clusters and unmanned systems. The framework clarifies the common key technologies of coal mining robot research and development and cross-integration with new technologies such as 5G, the industrial internet, big data, artificial intelligence, and digital twins to improve the autonomous and intelligent application of coal mining robots. By establishing a scientific and complete standard system for coal mining robots, we aim to achieve customized research and development and standardized production of various types of robots. A specific analysis was conducted on the research progress of common key technologies such as explosion-proof design, mechanical system innovation, power drive, intelligent sensing, positioning and navigation, and underground communication of coal mining robots. The current research and application status of various types of coal mining robots in China are summarized. A new direction for future coal mine robot research and development is proposed. Moreover, robotic mining systems should be promoted to enhance the overall intelligence level and mining efficiency of mining equipment. To develop human‒machine environment-integrated robots to improve the autonomy and collaboration level of coal mining robots. The digital twinning of the entire mine robot system should be accelerated, the normalized operation level of coal mine robots should be improved, research on coal mining robots, support robots, and transportation robots should be carried out, intelligence should be achieved in fully mechanized mining faces, and equipment support for fewer and unmanned fully mechanized mining faces should be provided. The practical process of implementing coal mining robotization has been summarized, and the technical and engineering feasibility of the coal mining machine population has been verified.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The vegetation types on the Qinghai-Tibet Plateau are complex and diverse, and the ecological environment is fragile and sensitive. It is very important to study the dynamic changes in vegetation and the main factors related to these changes to grasp the present state of the regional ecosystem, maintain the balance of the ecosystem and promote the sustainable development of the ecosystem. Therefore, this paper is based on SPOT/VEG NDVI (normalized difference vegetation index) data, land use data, topographic data and meteorological data from 1999 to 2019. The spatiotemporal variation in the NDVI over the Tibetan Plateau in the last 21 years and its response to different driving factors were investigated by using the Sen slope method, Mann–Kendall mutation test, partial correlation analysis and geographical detector method. The results showed that (1) the vegetation coverage on the Qinghai-Tibet Plateau showed an increasing trend from 1999 to 2019, with increases in approximately 67.00% of the plateau area. (2) The spatial differences in vegetation coverage were large; notably, low-density vegetation areas decreased obviously, moderate-density vegetation areas accounted for approximately 50% of the total area, high-density vegetation areas were the least common, and the overall growth rate was significant. (3) The NDVI was positively correlated with temperature and precipitation, and a positive correlation was observed in more than 66% of the region. (4) The order of the influence of single driving factors on the NDVI was as follows: precipitation > soil type > altitude > temperature > gradient > slope > population density > GDP. (5) The effect of multiple factors was significantly higher than that of single driving factors, with a notable nonlinear influence. The interactions between meteorological factors, such as precipitation, and topographic factors, such as altitude, were important, with a q value over 0.79.

Major depressive disorder (MDD) and generalized anxiety disorder (GAD) exert significant burdens on individuals and society, underscoring the importance of accurate predictions using advanced machine learning (ML) algorithms. Leveraging electronic health records (EHRs) and survey data, these algorithms offer potential in forecasting such mental health conditions. Yet, the precision of these predictions can be compromised by biases or inaccuracies inherent in subjective survey responses. In this research, we assess the reliability of four prominent ML algorithms—Random Forest, XGBoost, Logistic Regression, and Naïve Bayesian—in predicting MDD and GAD. Our dataset encompasses a rich array of information, from biomedical metrics and demographic details to self-reported survey insights. A focal point of our investigation is the algorithms' performance under scenarios with varying degrees of subjective response inaccuracies, such as memory recall biases or subjective interpretation. Our findings reveal that while all algorithms exhibit commendable accuracy with pristine survey data, their performance diverges when faced with erroneous or biased responses. Notably, XGBoost remains stable and excels in identifying true positive cases, even in the presence of such noise. These observations underscore the criticality of algorithmic resilience in mental health prediction, especially when relying on subjective data. The robustness of certain algorithms to noisy inputs positions them as more reliable choices for predicting mental health conditions based on self-reported data, emphasizing the need for careful algorithm selection in such contexts.

Effective biomarkers are essential to the early diagnosis of non-small cell lung cancer (NSCLC). Herein, a retrospective study of 49 newly diagnosed and recurrent NSCLC patients, 31 patients with benign pulmonary disease and 24 healthy volunteers was conducted, to evaluate the diagnostic value of circulating rare cells for NSCLC. The expression of circulating tumor cells (CTCs) and circulating tumor-derived endothelial cells (CTECs) in peripheral blood were measured by subtraction enrichment-immunostaining-fluorescence in situ hybridization (SE-iFISH). The level of CTCs (P＜0.001) and CTECs (P＜0.001) was significantly higher in NSCLC group than that in benign pulmonary disease group. The proportion of small CTCs (P＜0.001) and CTECs (P＜0.0001) significantly increased from benign lung disease individuals to NSCLC patients. The AUC of ROC curves of total CTCs and CTECs were 0.815 (95%CI: 0.722~0.907), 0.739 (95%CI: 0.618~0.860), respectively. The cut-off values for discriminating NSCLC with benign lung disease patients were total CTCs 11.5 units/6ml and total CTECs 10.5 units/6ml, with sensitivity and specificity being 67.3% and 83.9%, 77.6% and 77.4%, respectively. When CTCs and CTECs were combined, predictive value significantly increased to 82.6% as measured by the area under the curve. Small CTCs and triploid CTCs had high positive predictive value (PPV) and positive likelihood ratio (LR+) of the diagnosis of NSCLC in early stage. CTCs and CTECs can not only be used as new biomarkers for the diagnosis of NSCLC, but can also improve diagnostic performance of the early stage NSCLC. Moreover, the combined examination of CTCs and CTECs is be superior to the single.

Multimodal remote sensing data classification can enhance the model’s ability to distinguish land features through multimodal data fusion. In this context, how to help models understand the relationship between multimodal data and target tasks is the focus of researchers. Inspired by human feedback learning mechanisms, causal reasoning mechanisms, and knowledge induction mechanisms, this paper integrates causal learning, reinforcement learning, and meta learning into a unified remote sensing data classification framework and proposed the causal meta-reinforcement learning (CMRL). First, based on feedback learning mechanisms, we have overcome the limitations of traditional implicit optimization of fusion features and customized a reinforcement learning environment for multimodal remote sensing data classification tasks. Through feedback interactive learning between agents and the environment, we help them understand the complex relationships between multimodal data and labels, thereby achieving full mining of multimodal complementary information. Second, based on the causal inference mechanism we designed causal distribution prediction action, classification reward, and causal intervention reward, capturing pure causal factors in multimodal data and cutting off false statistical associations between non-causal factors and class labels. Finally, based on the knowledge induction mechanism, we designed a bi-layer optimization mechanism based on meta-learning. By constructing a meta training task and meta validation task simulation model in the generalization scenario of unseen data, we helped the model induce cross-task shared knowledge, thereby improving its generalization ability for unseen multimodal data. The experimental results on multiple sets of multimodal datasets show that the proposed method achieved state-of-the-art performance in multimodal remote sensing data classification tasks.

Disposal and treatment of excess sludge is a huge problem in waste water treatment plants. Discharge plasma oxidation is an effective approach for sludge dewatering and digestion. In this study, the excess sludge disintegration by non-thermal discharge plasma coupled with thiosulfate (TSA) was investigated. The soluble chemical oxygen demand (SCOD) increased to 404.93 mg L-1 after 20 min of single discharge plasma treatment, and it further increased to 549.08 mg L-1 after adding 15 mmol L-1 of TSA; the water content of filter cake also further decreased in the presence of TSA. There existed an appropriate TSA dosage. In the discharge plasma coupled with TSA system, reactive oxygen species (·OH and ·O2-) were produced and played important roles in sludge disintegration. The addition of TSA promoted the production of ·OH. These reactive oxygen species destroyed the floc structures and promoted the transformation of organic substances, leading to reduction in average size of sludge flocs. The ratio of soluble extracellular polymer substances (S-EPS) was enhanced, while the ratio of tightly bound fraction was reduced after treatment. Thus, discharge plasma coupled with TSA promoted the lysis of microbial cells and released intracellular organic matter and bound water, finally improving sludge dewaterability.

The aims of this study are to measure the technical efficiency (TE) of Cambodian household’s rice production and trying to determine its main influencing factors using the stochastic frontier production function. The study utilized primary data collected from 301 rice farmers in three selected districts of Battambang by structured questionnaires. The empirical results indicated the level of household rice output varied according to differences in the efficiency of production processes. The mean TE is 0.34 which means that famers produce 34% of rice at best practice at the current level of production inputs and technology, indicates that rice output has the potential of being increased further by 66% at the same level of inputs if farmers had been technically efficient. Furthermore, between 2013-2015 TE of household’s rice production recorded -14.3% decline rate due to highly affected of drought during dry season of 2015. Moreover, evidence reveals that land, fertilizer, and pesticide are the major influencing input factors of household’s rice production, while disaster, education of household head, family size and other crops’ cultivated area are core influencing factors decreasing TE. Conversely, the main influencing factors increasing TE are irrigated area, number of plot area and sex of household head.

The aims of this study are to measure the technical efficiency (TE) of Cambodian household’s rice production and trying to determine its main influencing factors using the stochastic frontier production function. The study utilized primary data collected from 301 rice farmers in three selected districts of Battambang by structured questionnaires. The empirical results indicated the level of household rice output varied according to differences in the efficiency of the production processes. The mean TE is 0.34 which means that famers produce 34% of rice at best practice at the current level of production inputs and technology, indicates that rice output has the potential of being increased further by 66% at the same level of inputs if farmers had been technically efficient. Furthermore, between 2013-2015, TE of household’s rice production recorded -14.3% decline rate due to highly affected of drought during dry season of 2015. Moreover, evidence reveals that land, fertilizer, and pesticide are the major influencing input factors of household’s rice production, while disaster, education of household head, family size and other crops’ cultivated area are core influencing factors decreasing TE. Conversely, the main influencing factors increasing TE are irrigated area, number of plot area and sex of household head.

The present study aims to measure the technical efficiency and establish core factors effecting rice production in Cambodia. Four-years dataset generated from the central government document “Profile on Economics and Social” of entire 25 provinces between 2012-2015 and the stochastic production frontier model (SFA) was applied. The results indicated that the level of output (quantity) of Cambodian rice production varied according to the different level of capital investment in agricultural machineries, total rice actual harvested area, and technically fertilizers application within provinces. Furthermore, evidence revealed the overall mean efficiency of rice production is 78.4% implies that there is still room to further improve technical efficiency by given the same level of inputs and technology. More importantly, the findings revealed that irrigation, production technique and amount of agricultural supporting staffs are being as the most important influencing factors of rice production’s technical efficiency in Cambodia. In conclusion, present study strongly recommends the development of irrigation systems and good water management practices to be considered and bring into more effective actions by the central government as well as related agencies for improving rice production in Cambodia in addition to capital investment and improving technical skills of supporting staffs and rural farmers.

The fluorine-less noble-gas containing anions OBONgO- and OCNNgO-have been studied by correlated electronic structure calculation and density functional theory. The obtained energetics indicates that for Ng = Kr and Xe, these anions should be kinetically stable at low temperature. The molecular structures and electron density distribution suggests that these anions are stabilized by ion-induced dipole interactions with charges concentrated on the electronegative OBO and OCN groups. The current study shows that in additional to the fluoride ion, polyatomic groups with strong electronic affinities can also form stable noble-gas containing anions of the type X-...NgO.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Scaffoldings play a critical role as temporary structures in supporting construction processes. Accidents at construction sites frequently stem from issues related to scaffoldings, including insufficient support caused by deviations from the construction design, insecure rod connections, or absence of cross bracing, which result in uneven loading and potential collapse, leading to casualties. In this study, we introduce a deep-learning-based, augmented reality (AR)-enabled system called scaffolding assembly deficiency detection system (SADDS) to assist field inspectors in identifying deficiencies in scaffolding assemblies. Inspectors have the flexibility to utilize SADDS through various devices, such as video cameras, mobile phones, or AR goggles (i.e., Microsoft HoloLens 2), for automated detection of deficiencies in scaffolding assemblies. The training test yielded satisfactory results, with a mean average precision of 0.89 and individual precision values of 0.96, 0.82, 0.90, and 0.89 for “qualified” frames and frames with the “missing cross-tie rod,” “missing lower-tie rod,” and “missing footboard” deficiencies, respectively. Field tests conducted at two construction sites demonstrated improved system performance compared to that in the training test. However, these field tests also revealed certain limitations of the SADDS system.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Strawberry root rot caused by Neopestalotiopsis clavispora is one of the main diseases of strawberry and significantly impacts the yield and quality of strawberry fruit. There are now no effective control techniques available except for fungicide sprays, which may directly impact consumers. Biological control is becoming an alternative method for the control of plant diseases to replace or decrease the application of traditional synthetic chemical fungicides. Trichoderma is widely used as a biological agent for controlling strawberry root rot. In order to provide resources for screening the highly effective biocontrol fungus for controlling strawberry root rot caused by Neopestalotiopsis clavispora, the biocontrol mechanism,the control effects of Trichoderma asperellum CMT10 against strawberry root rot and growth-promoting effects on strawberry seedlings were investigated by plate culture, microscopy observation and root drenching methods.The results showed that CMT10 had obvious competitive, antibiotic and hyperparasitism effects on Neopestalotiopsis clavispora CMGF3. The CMT10 could quickly occupy nutritional space, and the inhibition rates of CMT10 against CMGF3 in confrontation culture on 7 d was 65.49%. The inhibition rates of volatile metabolite and fermentation metabolite produced by CMT10 against CMGF3 were 79.67% and 69.84%, respectively. The mycelium of strain CMT10 can act as hyperparasites by making contacting, winding and penetrating hyphae of CMGF3. Pot experiment showed that the biocontrol efficacy of CMT10 on strawberry root rot caused by Neopestalotiopsis clavispora was 63.00%. CMT10 had obvious promotion effect on strawberry growth, the plant height, root length, total fresh weight, root fresh weight, stem fresh weight and root dry weight, with the promotion rates were 20.09%, 22.39%, 87.11%, 101.58%, 79.82% and 72.33%, respectively. Overall, this study showed the ability of Trichoderma asperellum CMT10 to control strawberry root rot and their potential to develop as novel biocontrol agents to replace chemical fungicides for eco-friendly, sustainable agriculture.

Background: Autoimmune inner ear disease (AIED) is a rare autoimmune condition characterized by progressive sensorineural hearing loss with hearing fluctuations over weeks to months, presenting significant challenges in both diagnosis and treatment. Due to its rarity, treatment responses and prognosis in AIED remain poorly understood. Methods: This study reviewed medical records from Taipei Medical University Hospital documented between August 2016 and August 2021. Among 67 patients experiencing fluctuating hearing loss, 11 met the diagnostic criteria for AIED and underwent regular follow-up assessments within a 5-year timeframe. ROC curve was used to discriminate the power of these prognostic parameters. Results: In this study, several factors including younger age, milder initial hearing loss, meeting criteria for bilateral Meniere's disease (MD), having an ascending audiogram pattern, longer time interval between hearing impairment attacks in contralateral ears and responding well to steroids were associated with better prognosis. ROC curve demonstrated the diagnostic value of specific parameters such as the presence of bilateral MD (AUC 0.825, 95% CI 0.640–1.000), pretreatment HI ≤ 45 dB HL (AUC 0.808, 95% CI 0.610–1.000), response to steroids (AUC 0.800, 95% CI 0.595–1.000), and ascending audiogram (AUC 0.858, 95% CI 0.683–0.858). Conclusions: This study identified key prognostic factors for AIED, providing valuable insights for predicting AIED prognosis and facilitating personalized patient management.

A microwave-photonics method has been developed for measuring distributed acoustic signals. This method uses microwave-modulated low coherence light as a probe to interrogate distributed in-fiber interferometers, which are used to measure acoustic-induced strain. By sweeping the microwave frequency at a constant rate, the acoustic signals are encoded into the complex microwave spectrum. The microwave spectrum is transformed into the joint time-frequency domain and further processed to obtain the distributed acoustic signals. The method is first evaluated using an intrinsic Fabry Perot interferometer (IFPI). Acoustic signals of frequency up to 15.6 kHz were detected. The method was further demonstrated using an array of in-fiber weak reflectors and an external Michelson interferometer. Two piezo-ceramic cylinders (PCCs) driven at frequencies of 1700 Hz and 3430 Hz were used as acoustic sources. The experiment results show that the sensing system can locate multiple acoustic sources. The system resolves 20 nε when the spatial resolution is 5 cm. The recovered acoustic signals match the excitation signals in frequency, amplitude, and phase, indicating an excellent potential for distributed acoustic sensing (DAS).

Intermetallic compounds are increasingly being expected to utilize in tribological environments, but to date the works are hindered by insufficient ductility at low and medium temperature. This paper presents a novel multiphase intermetallic alloy with the chemical composition of Mo-40Ni-13Si (at.%). Microstructure characterization reveals that a certain amount of ductile Mo phases formed during the solidification process of ternary Mo-Ni-Si alloy melt, which is undoubtedly beneficial to the ductility improvement of intermetallic alloy. Tribological properties of the designed alloy, including wear resistance, friction coefficient and metallic tribological compatibility, were evaluated under dry sliding wear test conditions at room temperature. Results suggested that the multiphase alloy possesses an excellent property for room-temperature wear applications, which is attributed to the unique microstructural features and thereby good combination in hardness and ductility. The corresponding wear mechanism is also reported by observing the worn surface, subsurface and wear debris of alloy, which to be found is soft abrasive wear.

Human epidermal growth factor receptor 2 (HER2), a targetable transmembrane glycoprotein receptor of the epidermal growth factor receptor (EGFR) family, plays a crucial role in cell proliferation, survival, and differentiation. Aberrant HER2 signaling is implicated in various cancers, particularly breast and Gastric cancer, where HER2 overexpression or amplification correlates with aggressive tumor behavior and poor prognosis. Her2 activating mutations contribute to accelerated tumorigenesis and metastasis. This review provides an overview of HER2 biology, signaling pathways, mechanisms of dysregulation, diagnostic approaches, and therapeutic strategies targeting HER2 in cancer. Understanding the intricate details of HER2 regulation is essential for developing effective targeted therapies and improving patient outcomes.

A typhoon-induced storm surge is considered one of the most severe coastal disasters in Taiwan. However, the combination of the storm surge and the astronomical tide called the storm tide can actually cause extreme flooding in coastal areas. This study implemented a two-dimensional hydrodynamic model to account for the interaction between tides and storm surges on the coast of Taiwan. The model was validated with observed water levels at Sauo Fish Port, Hualien Port, and Chenggong Fish Port under different historical typhoon events. The model results are in reasonable agreement with the measured data. The validated model was then used to evaluate the effects of the typhoon's intensity, bathymetric change, and the combination of the typhoon’s intensity and bathymetric change on the maximum storm tide and its distribution along the east coast of Taiwan. The results indicated that the maximum storm tide rises to 1.92 m under a typhoon with an intensity of a 100-year return period. The maximum storm tide increased from a baseline of 1.26 m to 2.63 m for a 90% bathymetric rise at Sauo Fish Port under the conditions of Typhoon Jangmi (2008). The combination of the intensity of a typhoon with a 100-year return period and a 90% bathymetric rise will result in a maximum storm tide exceeding 4 m, 2 m, and 3 m at Sauo Fish Port, Hualien Port, and Chenggong Fish Port, respectively. We also found that the distribution of the maximum storm tide on the east coast of Taiwan can expand significantly subject to the bathymetric rise.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The pathogenicity of grapevine geminivirus A (GGVA), a recently identified DNA virus, to grapevine plants remains largely unclear. Here, we report a new GGVA isolate (named GGVAQN) obtained from grapevine ‘Queen Nina’ plants with severe disease symptoms; the infectious clone of GGVAQN (pXT-GGVAQN) was also constructed. Infection assays indicated that Nicotiana benthamiana plants inoculated with GGVAQN display upward leaf curling and chlorotic mottling symptoms. Direct injection of Agrobacterium tumefaciens cells carrying pXT-GGVAQN into roots of in vitro-grown ‘Red Globe’ grape plantlets by syringe led to systemic infection with GGVAQN, and the plants exhibited chlorotic mottling symptoms on their upper leaves, and downward curling, interveinal yellowing, and leaf-margin necrosis symptoms on their lower leaves. Our results provide insights into the pathogenicity of GGVA, and a simple and efficient inoculation method to deliver infectious viral clones to woody perennial plants.

Heavy metals contamination in groundwater often occurs in various industrial processes. Stud-ies have confirmed that polysulfide could reduce hexavalent chromium to trivalent chromium, achieving the effect of in-situ stabilization. For other heavy metals contamination in groundwa-ter, whether polysulfide also had a stabilizing ability to achieve in-situ remediation. This re-search focused on heavy metals except for chromium that often contaminated in groundwater, including lead, nickel, zinc, copper, and cadmium to explore the feasibility of using calcium polysulfide (CaSx) as an in-situ stabilization technology for these heavy metals contamination groundwater. Results showed that CaSx had a great removal efficiency for heavy metals lead, nickel, zinc, copper, and cadmium. However, for nickel, zinc, copper and cadmium, when CaSx was added excessively, complexes would be formed, causing the result of re-dissolve and this would also reduce the removal efficiency. Since it is difficult to accurately control the dosage of agents for in-situ groundwater remediation, the concentration of re-dissolved nickel, zinc, cop-per, and cadmium may not be able to meet the groundwater control standards. CaSx had high lead removal efficiency, and it would not cause re-dissolution due to excessive CaSx dosing. CaSx can be used as an in-situ stabilization technique for lead contaminated groundwater.

The belief in online news has become a hot topic. Previous studies have shown the role of emotion in susceptibility to believing fake news. However, Few studies have explored the effect of empathy on belief in online news. This study investigated the relationships between trait empathy, state empathy, the belief in online news, and the potential moderating effect of the news type. One hundred and forty undergraduates evaluated 50 online news pieces (25 real, 25 fake) regarding their believability, state empathy, valence, arousal, and familiarity. Trait empathy data were collected using the Chinese version of the Interpersonal Reactivity Index. State empathy was positively correlated with affective empathy in trait empathy and believability, and affective empathy was positively correlated with believability. The influence of affective empathy on news belief was partially mediated by state empathy, regulated by the news type (fake, real). We discussed the influence of empathy on the belief in online news and its internal processes. This study explains some unique insights for researchers, practitioners, social media users, and social media platform providers.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

The International Roughness Index (IRI) is the standard scale for evaluating road roughness in many countries in the world. The Taipei City government actively promotes a Road Smoothing Project and plans to complete the rehabilitation of the main and minor roads within its jurisdiction. This study aims to detect the road surface roughness in Taipei City and recommend appropriate IRI thresholds for road rehabilitation. A total of 171 asphalt concrete pavement sections in Taipei City with a total length of 803.49 km were analyzed and compared by IRI. The longitudinal profile of the detected road sections was measured using an inertial profiler. The statistical analysis showed that the IRI value prior to road leveling was mainly distributed between 5 and 8 m/km, while the IRI value after road leveling was mainly distributed between 3 and 4.5 m/km. This confirms that the implementation of the Road Smoothing Project has a significant effect on improving road smoothness. Moreover, based on the analysis results, it is recommended that the IRI threshold value for road rehabilitation in Taipei City be set at 4.50 m/km.

In the rapidly evolving landscape of genetic engineering, the advent of CRISPR-Cas technologies has catalyzed a paradigm shift, empowering scientists to manipulate the genetic code with unprece-dented accuracy and efficiency. Despite the remarkable capabilities inherent to CRISPR-Cas sys-tems, recent advancements have witnessed the integration of small molecule to augment their functionality, introducing new dimensions to the precision and versatility of gene editing applica-tions. This review delves into the synergy between CRISPR-Cas technologies and small molecule drugs, elucidating the pivotal role of chemicals in optimizing target specificity and editing efficiency. By examining a diverse array of applications, ranging from therapeutic interventions to agricultural advancements, we explore how the judicious use of chemicals enhances the precision of CRISPR-Cas-mediated genetic modifications. In this review we emphasize the significance of small molecule drugs in fine-tuning the CRISPR-Cas machinery, which allows researchers to exert meticulous con-trol over the editing process. We delve into the mechanisms through which these chemicals bolster target specificity, mitigate off-target effects, and contribute to the overall refinement of gene edit-ing outcomes. Additionally, we discuss the potential of chemical integration in expanding the scope of CRISPR-Cas technologies, enabling tailored solutions for diverse genetic manipulation challenges. As CRISPR-Cas technologies continue to evolve, the integration of small molecule drugs emerges as a crucial avenue for advancing the precision and applicability of gene editing techniques. This re-view not only synthesizes current knowledge but also highlights future prospects, paving the way for a deeper understanding of the synergistic interplay between CRISPR-Cas systems and chemical modulators in the pursuit of more controlled and efficient genetic modifications.

There always exist steel cuttings, holes and cracks at the interfaces in the explosive composite plate. Multi-pass friction stir processing (M-FSP) is proposed in this research to optimize the interface microstructure and the interface connection for 1060Al/Q235 explosive composite plate. Results show that the microstructures of 1060Al after M-FSP are fine and uniform owing to the strong stirring effect and recrystallization. Micro-defects formed by the explosive welding can be repaired by the M-FSP. However, M-FSP can also form tunnel defects in the aluminum, especially when the passes are one and two. The melting block and the melting lump in the composite plates are easy to become source of crack. The shear strengths and the bending properties for the 1060Al/Q235 explosive composite plate after M-FSP are the best when the passes are three, with the tool rotation speed of 1200rpm and the forward speed of 60mm/min. The optimized interfaces for the explosive composite plate after M-FSP are mainly by the metallurgical bondings, with a certain thickness and are discontinuous. Therefore, the crack extension stress is the largest and the mechanical properties are the best.

Rice is the most important food crop in Cambodia and its production is the most organized food production system in the country. The main objective of this study is to measure technical efficiency (TE) of Cambodian rice production and also trying to identify core influencing factors of rice TE at both national and household level, for explaining the possibilities of increasing productivity and profitability of rice, by using translog production function through Stochastic Frontier Analysis (SFA) model. Four-years dataset (2012-2015) generated from the government documents was utilized for the national analysis, while at household-level, the primary three-years data (2013-2015) collected from 301 rice farmers in three selected districts of Battambang province by structured questionnaires was applied. The results indicate that level of rice output varied according to the different level of capital investment in agricultural machineries, total actual harvested area, and technically fertilizers application within provinces, while level of household rice output varied according to the differences in efficiency of production processes, techniques, total annual harvested land, and technically application of fertilizers and pesticides of farmers. The overall mean TE was estimated at 78.4% (national-level) and 34% (household-level), indicates that rice output has the potential of being increased further by 21.6% (national production) and 66% (household) at the same level of inputs and technology if farmers had been technically efficient. The TE also recorded -7% decreasing rate at the national-level and -14.3% at household-level due to highly affected of natural disasters and various environmental and social factors during the study periods.

High-methoxyl apple pectin (AP) derived from apple was employed as the main ingredient facilitating rheological modification features for developing dysphagia-friendly fluidized alimentary matrices. Xanthan gum (XG) was also included as a composite counterpart to modify the viscoelastic properties of the thickened system under different thermal processes. The results indicate that AP is extremely sensitive to thermal processing, and the viscosity is greatly depleted under a neutral pH level. Moreover, the inclusion of calcium ions echoed a modification effect on the rheological properties of AP, and both the elastic property and viscosity value are promoted after thermal processing. The modification effect of viscoelastic properties (Gʹ and Gʹʹ) is observed while XG is incorporated into the composite formula. By promoting the XG ratio from 7: 3 to 6: 4 (AP: XG), it triggers the rheological transformation from a liquid-like form to a solid-like state, and the viscosity value shows that the AP-XG composite system exhibits better thermal stability after thermal processing. The ambient modifiers of pH (pH &lt; 4) and calcium chloride concentration (7.5%) with an optimal AP-XG ratio of 7:3 lead to weak-gel-like behavior (Gʹʹ &lt; Gʹ), helping to maintain the texture properties of dysphagia-friendly features similar to those prior to the thermal processing.

In the context of the coordinated development of digital economy and environmental protection, we take the strategy of "Broadband China" as a quasi-natural experiment, adopts the panel data of 284 cities from 2007 to 2020, and evaluates the policy effect of digital economy on total factor energy efficiency through the progressive DID model. The results show that: The construction of "Broadband China" demonstration city has significantly promoted the improvement of the total factor energy efficiency of the demonstration city, but there is also significant urban heterogeneity, which is manifested in the significant improvement of the total factor energy efficiency of the eastern city, the southern city, the big city and the non-resource-based city. It has no significant effect on the total factor energy efficiency of central and western cities, northern cities, small and medium-sized cities and resource-based cities. The construction of "Broadband China" demonstration cities can improve total factor energy efficiency by promoting technological progress and strengthening environmental regulations. Therefore, we should further strengthen the construction of digital infrastructure and give full play to its positive effects. Different cities should seek differentiated development paths based on their own resource endowments and development conditions, so that the digital economy can effectively improve the total factor energy efficiency.

The arguments on the origin and evolution of the evergreen broad-leaved forest in eastern Asia, especially in the evolutionary process, exist generally, even contrary in some cases. The origin and evolution of the flora of eastern Asia, the formation time of Asian monsoon, and the implications from phylogenetic and molecular biogeographic studies in some important taxa, as well as in palaeobotanical evidences, are debatable. Most researches from different disciplines suggested that the monsoon in Miocene is a key to diversification of eastern Asian flora and its evergreen broad-leaved forest. The common view is that the evergreen broad-leaved forest of East Asia is closely related to the monsoon intensity and developments, which are caused by the uplift of Himalaya-Tibet, during or after the mid-Miocene. The analysis on the floristic elements show that the present subtropical evergreen broad-leaved forest in eastern Asia could have an early or ancient tropical origin and a tropical Asian affinity, but their species are dominated by the Chinese endemic or eastern Asian distribution, many of which are the tropical sister ones. The time of Himalayan uplift and intensity of monsoon climate is believed the key for the formation of the evergreen broad-leaved forest in eastern Asia. Combined existing palaeobotanical findings, the uplift of Himalayas and the formation of monsoon climate, as well as floristic elements of the subtropical evergreen broad-leaved forest, we believe that it was evolved from a Asian tropical rain forest after mid-Miocene in southeastern region of eastern Asia, while the ancient subtropical evergreen broad-leaved forests in southwestern region continuously evolved into the present subtropical ones.

To address the challenges associated with the difficult electromagnetic (EM) scattering computations of anisotropic dielectric-coated metallic composite targets, we proposed an efficient hybrid algorithm for simulating the EM scattering of complex targets with anisotropic dielectric coatings. This method, based on Impedance Boundary Condition (IBC), utilizes surface impedance vectors to describe the EM properties of the dielectric. It fully leverages the respective advantages of the low-frequency Method of Moments (MoM) and the high-frequency Physical Optics (PO) to achieve high-precision and rapid EM simulation of anisotropic dielectric-coated metallic composite targets. Employing boundary conditions and equivalent principles, we equivalently transform the EM scattering problem of targets with thin dielectric coatings into the radiation problem of equivalent EM current on impedance surfaces. This enables the high-precision and rapid calculation of Radar Cross Sections (RCS) for complex targets with anisotropic dielectric coatings. Using examples such as a square plate structure, a simplified aircraft, and a complex satellite model, the simulation results exhibit a high degree of agreement with full-wave numerical solutions and demonstrate a significant advantage in computational resources. This research convincingly demonstrates the accuracy and effectiveness of the proposed method.

3D printing is a non-traditional additive manufacturing process. It is different from the traditional subtractive manufacturing process. It offers exceptional rapid prototyping capabilities and results that traditional subtractive manufacturing methods cannot attain, especially in applications involving curved or intricately shaped components. Despite its advantages, metal 3D printing will face porosity, warpage, and surface roughness issues. These issues will affect the future practical application of the parts indirectly, for example, the structural strength and the parts assembly ca-pability. Therefore, this study compares the qualities of the warpage, weight, and surface rough-ness after milling and grinding processes under the same materials (316L stainless steel) between general rolled steel and 3D additive steel. Experimental results show that 3D printing parts are approximately 13% to 14% lighter than the general rolled steel. The surface roughness performance of 3D printing steel is better than general rolled steel under the same material after milling or grinding processing. The hardness of the 3D printing steel is better than that of the gen-eral rolled steel. The research verifies that 3D additive manufacturing can use surface processing to optimize surface performance and achieve the functions of lightness and hardness.

Predicting the outcome of a future game between two National Basketball Association (NBA) teams poses a challenging problem of interest to statistical scientists as well as the general public. In this article, we formalize the problem of predicting the game results as a classification problem and apply the principle of maximum entropy to construct NBA maximum entropy (NBAME) model that fits to discrete statistics for NBA games, and then predict the outcomes of NBA playoffs by the NBAME model. The best NBAME model is able to correctly predict the winning team 74.4 percent of the time as compared to some other machine learning algorithms which is correct 69.3 percent of the time.

[Introduction]: In the contemporary international financial environment, marked by intricate complexities and increasing uncertainties, the impact of exchange rate fluctuations on national economies has become increasingly significant. In this context, this study uses the Chinese economy as a case study to delve deeply into the interaction effects between macroprudential and monetary policies, analyzing how these policies jointly address economic instability. The aim is to offer new perspectives and strategies for stabilizing the global economic and financial landscape. [Methods]: This paper constructs an open-economy Dynamic Stochastic General Equilibrium (DSGE) model specifically tailored for China, incorporating Bayesian estimation and numerical simulation techniques. The study meticulously examines how macroprudential and monetary policies can be coordinated to achieve economic stability in response to exchange rate shocks. [Results]: The research finds that (1) targeted coordination of macroprudential and monetary policies towards asset prices and price levels can maintain stability under exchange rate shocks; (2) the effective implementation of such coordinated policies not only mitigates the fluctuations in asset prices due to exchange rate shocks but also enhances the level of societal welfare; (3) in terms of choosing an exchange rate regime, a managed floating rate system can prevent policy overlaps and conflicts that might occur in a floating rate system during the coordination of macroprudential and monetary policies, thus offering comparative advantages. [Discussion]: The findings underscore the importance of policy integration in a dynamic and complex global economic environment. They provide policy recommendations for China and other emerging market countries on how to effectively maintain economic stability through the synergistic interplay of macroprudential and monetary policies amid fluctuations in exchange rates and asset prices.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Developing clinically meaningful nanomedicines for cancer therapy requires the drugs to be effective, safe, simple, cheap, and easy to store. In the present work, we report that a simple cationic Fe(III)-rich salt of [FeIIICl(TMPPH2)][FeIIICl4]2 (Fe-TMPP) exhibits a superior anticancer performance toward a broad spectrum of cancer cell lines, including breast, colorectal cancer, liver, pancreatic, prostate, and gastric cancers, with half maximal inhibitory concentration (IC50) values in the range of 0.098−3.97 μM (0.066−2.68 μg mL−1), and comparable to the best-reported medicines. Fe-TMPP can forms stand-alone nanoparticles in water without the need for extra surface modification or organic-solvent-assisted antisolvent precipitation. Critically, Fe-TMPP is TME-responsive (TME = tumor microenvironment), and can only elicit its function in the TME with overexpressed H2O2, converting H2O2 to the cytotoxic •OH to oxidize the phospholipid of the cancer cell membrane, causing ferroptosis, a programmed cell death process of cancer cells.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

A co-curing resin system consisting of 9368 epoxy resin for prepreg and 6808 epoxy resin for resin transfer molding (RTM) was developed. A corresponding preparation method of novel polymer composite bolted T-joint with internal skeleton and external skin was proposed based on prepreg-RTM co-curing process, and novel T-joints were fabricated. A series of conventional configuration T-joints based on RTM process and T-joints made of 2A12 aluminum alloy were prepared simultaneously. Bending performances were studied on these T-joints experimentally. The results indicate that 9368 epoxy resin and 6808 epoxy resin exhibit good compatibility in rheological and thermophysical properties. The novel T-joints prepared with prepreg-RTM co-curing process show no obvious fiber local winding or resin-rich regions inside, and the interface quality between internal skeleton and external skin is excellent. The main failure modes of the novel T-joint under bending load include separation of skin and skeleton and fracture along the thickness on the base panel; the skeleton carries the main bending load, but there is still load transfer between external skin and internal skeleton through their interface. The internal damages of the novel T-joint are highly consistent with surface damages observed visually, facilitating the detection and timely discovery of damages. The initial stiffness, damage initiation load, and ultimate load of the novel T-joint are 1.65 times, 5.89 times, and 3.45 times that of conventional T-joint, respectively. When considering the influence of density, the relative initial stiffness and relative ultimate load of the novel T-joint are 1.44 times and 2.07 times that of aluminum alloy T-joint, respectively.

A set of polymer composite bolted T-joints with novel configuration consisting of internal skeleton and external skin was fabricated using a prepreg-RTM co-curing molding process. Experiments were conducted to study their mechanical properties under bending load. A finite element model with a polymer resin area between the skin and skeleton was established and verified by the experimental results. Then, the damage propagation process and failure mechanism of the joint and the influence of three factors related to the layer characteristics of the skin and skeleton were investigated by the validated models. The results show that the bending stiffness and the yield limit load of the novel composite T-joint are 0.81 times and 1.65 times that of the 2A12 aluminum T-joint respectively, while at only 55.4% of its weight. The damage of the joint initiates within the resin area and leads to a degradation of the joint bending performances. The preferred stacking sequence of the skeleton is [0/+45/90/-45]ns when primarily subjected to bending loads. The decrease in bending performances is within 5% with the inclining angle of the skeleton less than 12 degrees. The more layers of 90° in the skin, the better bending performances of the joints, while the more layer of 0°, the poorer bending performances.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

A two-step, one-pot synthesis of 3-substituted 1H-dibenzo[e,g]indazoles in good to high yields via a LiOtBu-promoted intramolecular cyclization of 2’-alkynyl-biaryl-2-aldehyde N-tosylhydrazones, formed in situ by the reactions of 2’-alkynyl-biaryl-2-aldehydes with p-methylbenzenesulfonohydrazide was developed. Two kinds of hydrogen bonds forming in several products were observed in DMSO-d6 solution in 1H NMR spectroscopic data, which were assigned to the formation of solvated products and dimers of products, supported by the studies of density functional theory (DFT).

Light sources tend to affect images captured in any automatic optical inspection (AOI) system. In this study, the effectiveness of metal-halide lamps, quartz-halogen lamps, and LEDs as the light sources in AOI systems for the detection of the 3rd and 4th layers electrodes of thin-film-transistor liquid crystal displays (TFT-LCDs) is examined experimentally. The results show that the performance of LEDs is generally comparable or better than that of metal-halide and quartz-halogen lamps. The best optical performance is by the blue LED due to its spectrum compatibility with the time-delay-integration charged-coupled device (TDI CCD) sensor and its better spatial resolution. The images revealed by the blue LED are sharper and more distinctive. Since current LEDs are more energy efficient and environmentally friendly, using LEDs as the light source for AOI is very beneficial. As the blue LED performs the best, it should be adopted for AOI using TDI CCD sensors.