This paper uses the complex regression analysis method to establish the customer’s load regression models, which consider economic indicators, temperature and rainfall. Furthermore, the proposed models are used to study the forecasting feasibility of the future energy sales and summer peak load demand. At first, this paper used least-squares techniques to derive regression models for considering economic indicators and temperature of 34 customer energy sales and total energy sales. Besides, the AMI high voltage customer demand data and system generating capacity for 24 hours were adopted to forecast summer peak load. The above-mentioned data analysis tool is used by EViews software to achieve, in order to verify the feasibility of the research framework. The study found that although its forecasting model accuracy is low only when mixed with temperature and high voltage demands. So, when mixed with high voltage demand data and system generating capacity for 24 hours to forecast peak load, the average error is ± 0.87% and in the majority of its energy sales forecasting model of average error is ±3%. This result can provide power company as future reference.

Based on collected power generation data associated with solar irradiance, PV system conversion efficiency and cell temperature, an hourly solar PV power estimation model by a parallel artificial neural network (ANN) and particle swarm optimization (PSO) algorithm is proposed. Weight matrices related to different seasons and geographic areas for estimation power generations have been trained by real measured operation data. The parallel PSO algorithm with heuristic global optimization technique assists the ANN training process to get near optimal solutions precisely. The accuracy and reliability of estimation is audited by actual details of photovoltaic power stations in various regions and scales. The results of estimation model can not only assist the electricity dispatcher to explicitly monitor the trend of solar power generation in different areas, but also coordinate with traditional power plants to meet load demand more accurately. The presented model will bring benefits to power dispatching for larger scales of intermittent and unstable solar power generation.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

A twin-screw extruder was used to fabricate poly(butylene succinate) (PBS)/high density polyethylene (HDPE) blends (7:3 weight ratio) and blend-based nanocomposites. Carbon nanotubes (CNTs), graphene nanoplatelets (GNPs) and organoclays (15A and 30B) served as the nanofiller, while maleated HDPE (PEgMA) acted as an efficient compatibilizer for the blend. In the composites, individual nanofillers were mostly localized in HDPE domains, but some fillers were also observed at PBS-HDPE interfaces. The sea-island morphology of compatibilized blend evolved into a pseudo-co-continuous morphology in the composites. Differential scanning calorimetry results confirmed that PEgMA with HDPE evidently accelerated the crystallization of PBS in the blend. The possible nucleation effect of added fillers on PBS crystallization was obscured by the formation of quasi-connected HDPE domains, causing less PBS nucleation sites. The presence of nanofillers improved the thermal stability and burning anti-dripping behavior of the parent blend. The anti-dripping efficiency of added fillers followed the sequence: CNT>15A>30B>GNP. Rigidity of the blend was increased after formation of nanocomposites. In particular, adding GNP resulted in 31% increase in flexural modulus. Development of a pseudo-network structure in the composites was confirmed by measurement of rheological properties. Electrical resistivity of the blend was reduced by more than 6 orders of magnitude at 3 phr CNT loading, demonstrating the achievement of double percolation morphology.

The objective of this study is to investigate the use of excavation behavior prediction and analysis software in the field of civil en-gineering. PLAXIS and SoilWorks, widely used in the engineering and academic communities, were employed as research tools for analyzing gravel layers and deriving appropriate ranges of soil elastic modulus for different software programs. By collecting excavation cases in the Xindian area of New Taipei City, Taiwan, and conducting deep excavation analysis using the displacement of retaining walls, this study provides recommended ranges for localized selection of soil elastic modulus. The suggested range for PLAXIS is 7,840 N/m² to 9,800 N/m², while Soil-Works suggests a range of 2,450 N/m² to 3,430 N/m². These ranges allow for reasonable estimation of maximum deformations during the final excavation stage. Based on the research findings, it is recommended that engineers refer to the provided ranges when selecting soil elastic modulus for excavation analysis in gravel layers using different soft-ware programs in the Xindian area of Taiwan to improve the accuracy of deformation predictions during the final excavation stage. These results serve as important references for engineers and contribute to the effective prediction and management of excavation behavior in civil engineering projects.

Within the spectrum of a natural image, the amplitude of modulation decreases with spatial frequency. The speed of such an amplitude decrease, or the amplitude spectrum slope, of an image affects the perceived aesthetic value. Additionally, a human observer would consider a symmetric image more appealing than they do an asymmetric one. We investigated how these two factors jointly affect aesthetic preferences by manipulating both the amplitude spectrum slope and the symmetric level of images to assess their effects on aesthetic preference on a 6-point Likert scale. Our results showed that the preference ratings increased with the symmetry level but had an inverted U-shape relation to amplitude spectrum slope. In addition, a strong interaction existed between symmetry level and amplitude spectrum slope on preference rating, in that symmetry can amplify the amplitude spectrum slope’s effects. Such effects can be described by a quadratic function of the spectrum slope. That is, preference is an inverted U-shape function of spectrum slope whose intercept is determined by the number of symmetry axis. In addition, the interaction between the two factors is manifested as the modulation depth of the quadratic function.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The survival analysis of the Cancer Genome Atlas (TCGA) dataset is a well-known method to discover the gene expression-based prognostic biomarkers of head and neck squamous cell carcinoma (HNSCC). A cutoff point is usually used in survival analysis for the patients' dichotomization in the continuous gene expression. There is some optimization software for cutoff determination. However, the software's predetermined cutoffs are usually set at the median or quantiles of gene expression value to perform the analyses. There are also few clinicopathological features available on their pre-processed data sets. We applied an in-house workflow, including data retrieving and pre-processing, feature selection, sliding-window cutoff selection, Kaplan-Meier survival analysis, and Cox proportional hazard modeling for biomarker discovery. In our approach for the TCGA HNSCC cohort, we scanned human protein-coding genes to find optimal cutoff values. After adjustment with confounders, the clinical tumor stage and the surgical margin involvement are independent risk factors for patients' prognosis. According to the resulting tables with Bonferroni-adjusted P value under the optimal cutoff and the hazard ratio, three biomarker candidates, CAMK2N1, CALML5, and FCGBP, are significantly associated with the patients' overall survival. We validated this discovery by using the other independent HNSCC dataset (GSE65858). Thus, we suggest the transcriptomic analysis could help for biomarker discovery.

(1)Background: This report was an effective evaluation of using multimedia educational program for self-care and quality of life in patients with a stoma at postoperative and established a simple threshold for enterostomy self-care skills.(2)Methods:108 patients with enterostomy were randomly assigned to receive either the intervention multimedia education program (including information about preparation for enterostomy care, cleaning method, manual bag replacement steps and precautions). The primary outcome was self-care ability and quality of life (defined as overall enterostomy self-care ability and overall quality of life), which was assessed at 2 weeks after intervention via an interview.(3)Results: Compared with those who in the conventional stoma education program, patients received the multimedia education program significantly improved their overall self-care ability and quality of life in statistically. The threshold of the enterostomy self-care skill scale was 20 points, and its corresponding sensitivity was 77.8%, and the specificity was 75.7%.(4)Conclusions: According to our study, the multimedia education program could enhance self-care ability of home care and quality of life in patients with enterostomy.

In kidney, epithelial barrier has diverse functions in body fluid and electrolyte homeostasis, and urine production. Maintaining epithelial integrity fundamentally builds up physiological functionality of the renal epithelial barrier (REB). Specially, the REB) states regularly in osmotic dynamics. The osmotic dynamics gives rise of osmotic pressure that is a physical force. Overloading of osmotic pressure can crack epithelial integrity and damage REB. How REB endures the osmotic pressure force yet remains enigmatic. LMO7 (LIM domain only 7) is a protein associated with cell-cell junctional complex and cortical F-actin. LMO7 upregulation was observed in cells cultured in hypertonic condition. In kidney, LMO7 predominantly distributes in epithelial cells in renal tubules. Hypertonic stimulation leads to assembly of LMO7 and F-actin in cortical stress fibers in renal epithelial cells. Hypertonic-isotonic alternation as pressure force pushing plasma membrane inward/outward was set as osmotic disturbance and was applied to test FAK signaling and LMO7 functioning in maintaining junctional integrity. Along with junctional integrity, LMO7 depleted cells resulted in loss of junctional integrity in the epithelial sheet cultured hypertonic medium or hypertonic-isotonic alternation. On the other hand, FAK inhibited by PF-573228 leads to failure in robust cortical F-actin assembly and association of LMO7 with cortical F-actin in epithelial cells responding upon hypertonic stress. Epithelial integrity in context of osmotic stress, LMO7 and FAK signaling both involves in assembling robust cortical F-actin and maintaining junctional integrity. The LMO7 elaborately manages FAK activation in renal epithelial cells, which was evidently demonstrated in NRK-52E cells who have excessive FAK activation and lost epithelial integrity when cells with LMO7 depletion exposed to hypertonic environment. Our data suggests that LOM7 manages FAK activation and is responsible for maintaining REB under osmotic disturbance.

In the TANGO study, the long-term noninferior efficacy of switching to dolutegravir/lamivudine (DTG/3TC) compared to continuing tenofovir alafenamide–based regimens was demonstrated in treatment-experienced adults with HIV. However, there is limited real-world data comparing the effectiveness and safety of bictegravir/emtricitabine/tenofovir alafenamide fumarate (BIC/FTC/TAF) and DTG/3TC in Asia. This retrospective observational study, conducted at a designated HIV-care hospital from March 2019 to January 2023, aimed to address this gap. Demographic, clinical, and laboratory data, including HIV viral loads and lipid profiles, were collected and analyzed. The primary outcome was the proportion of patients with HIV RNA <50 copies/mL at week 48 in both groups, utilizing a snapshot, per-protocol–exposed population. A total of 1086 patients were included, with 511 in the DTG/3TC group and 575 in the BIC/FTC/TAF group. At week 48, 98% of patients in the DTG/3TC group and 94% in the BIC/FTC/TAF group achieved HIV RNA <50 copies/mL (p <0.01). Logistic regression analysis identified risk factors for detectable viral loads at week 48, including HIV RNA >100,000 copies/mL (AOR 5.13, 95% CI 1.42–18.53), low-level viremia (AOR 3.91, 95% CI 1.07–14.25), and record of virologic failure ≥2 times (AOR 4.21, 95% CI 1.64–10.85) before the switch. Furthermore, no significant difference was found between the DTG/3TC and BIC/FTC/TAF regimens (AOR: 1.51, 95% CI 0.70–3.24). In conclusion, the study demonstrates that the effectiveness and safety profiles of DTG/3TC and BIC/FTC/TAF were comparable in treatment-experienced adults with HIV, particularly among those with undetectable viral loads at baseline.

Helicobacter pylori (H. pylori) is known to play a significant role in the development of peptic ulcer diseases and gastric cancer. Previous studies have reported the existence of polymorphism in the ureC gene of H. pylori. However, the relationship between genetic sequence variations in ureC and the pathogenesis of peptic ulcer diseases remains unclear. We aimed to investigate the associations between ureC sequence variations and the development of gastric ulcer and gastric cancer. PCR amplification and DNA sequencing to analyze ureC sequences, and conducted phylogenetic analysis using MEGA X software. Samples from Taiwanese patients with gastric ulcer and gastric cancer were included in this study. PCR was used to amplify the ureC gene from these samples, followed by DNA sequencing. The obtained sequences were then subjected to phylogenetic analysis using MEGA X software. In addition, ureC sequences from different geographical regions, including China and other countries, were included in the analysis for comparison. Analysis of the ureC se-quences from Taiwanese samples revealed that 6 out of 7 gastric ulcer samples clustered together in one group, while the sequences from 7 out of 8 gastric cancer samples were distributed across other groups. Phylogenetic analysis incorporating ureC sequences from different geographical regions showed that Taiwanese ureC sequences could be divided into two distinct groups, although the bootstrap values supporting this separation were low. Notably, the ureC sequences from China formed a distinct group with a high bootstrap value, separate from sequences from all other countries. There are two genotypes of ureC sequences present in Taiwanese samples, with one genotype showing a closer association with gastric cancer. Additionally, the ureC sequences from China appear to be unique and separate from those obtained from other countries, indicating the presence of genetic diversity in ureC sequences among H. pylori strains from different regions, potentially contributing to differences in disease outcomes. Further research is needed to elucidate the specific mechanisms by which ureC sequence variations may influence the pathogenesis of peptic ulcer diseases and gastric cancer.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The universal health insurance system in Taiwan was formed with good intentions to help vulnerable groups. However, the possibility of bankrupting the system due to wasted medical resources. In this study, using the medical expenditures of the Taiwanese Government and gross domestic product (GDP) as variables, the wavelet analysis method was used to empirically study the correlations and leading-lagging relationships in quarterly data in the period from 1996 to 2016. In addition, the dependent population of the insured was used as the control variable. This population had no income and had high medical demands. Results: After the dependent population was included as a control variable, there was a period of low-frequency (one to four years short-term) linkage correlation, as well as a period of high-frequency (four to eight years long-term) linkage correlation. In addition, for more than eight years, there was also a high degree of linkage correlation, indicating that the linkage between medical expenditures and GDP occurred over the long term. Moreover, since medical expenditures positively affected GDP, one-way causality was observed. However, after 2008, regardless of whether a long or short term was examined, there was almost no linkage correlation. Before 2008, the medical expenditures of the government were positively correlated with economic growth; i.e., they enhanced economic growth. But, after 2008, this effect had already disappeared. The universal health insurance system has long been denounced as a waste of medical resources, and the waste must be immediately stopped. The government urgently needs to find a new solution.

Background: Cancer patients require cross-professional care during the diagnosis and treatment periods. Therefore, methods for effectively carrying out case management are essential to tumor care. Purpose: To investigate the effects of using the community software LINE Official Ac-count on oral cancer case management. Methods: An experimental design was used; 100 patients were randomly divided into two groups by using a computer-generated random number table. The experimental group used LINE Official Account, which gave them self-care information, timely messages, and one-on-one health-care consultations. The control group followed standard healthcare practices. Results: The experimental group was satisfied with the self-care information provided by LINE Official Account (86.9%), patients regularly checked the self-care information (89.4%) and would check the information when receiving a push notification (54.3%). Ten patients used the one-on-one consultation(20.0%). LINE Official Account had a significant effect on the rate of participation in support groups. Generalized estimating equations indicated a significant difference between the two groups regarding the overall quality of life over 7 days (P = 0.023). Conclusion: Community software applications used in oncological case management can improve self-management and empower, also enable tracking of long-term follow-up effectiveness and reinforce the case manager’s role as a family therapist. Therefore, this study recommends that case manager systems be incorporated into mobile applications to increase the sustainable management, accessibility, effectiveness, and satisfaction of oncological management systems. This study also provides the value of Sustainable Development Goals (SDGs) with Good Health and Well-being, and decreased social withdrawal among patients with oral cancer.

: In the realm of data management, data preservation stands as a critical undertaking aimed at preserving and upholding the integrity of data. Regardless of whether it concerns personal or enterprise data, the detrimental effects of malicious alterations implemented by attackers cannot be overlooked. Particularly in conventional industrial control environments, the prevalent practice involves the transmission of data from sensors to databases for storage purposes. However, it is essential to recognize that this process exposes the data to various vulnerabilities. Thus, to ensure the long-term security and reliability of the data, it becomes imperative to implement robust data preservation strategies within these industrial control systems. However, the reliance of these databases on physical hard disks introduces inherent vulnerabilities, including the potential for data loss due to disk damage or targeted malicious attacks. Consequently, it becomes imperative to prioritize the implementation of robust data preservation measures. These measures are crucial in mitigating the risk of disruptions and protecting critical data from compromise. By establishing effective data backup systems, employing advanced security protocols, and implementing proactive monitoring mechanisms, organizations can bolster their data preservation capabilities and safeguard against potential threats to data integrity and availability. As a result, many enterprises opt to store their data with third-party providers to ensure data integrity. However, this approach carries inherent risks. If the third-party service experiences an attack or if the data is tampered with, it becomes challenging to verify the integrity of the data. To address these concerns and ensure data preservation within the context of the Internet of Things (IoT), a growing number of individuals are integrating IoT with Distributed Ledger Technology (DLT). By leveraging DLT, the integrity of data can be ensured, reducing reliance on centralized third-party storage and enhancing security in the IoT ecosystem. In this article, IOTA is the DLT, which employs Directed Acyclic Graph (DAG) to store transaction information. Compared to Ethereum or other blockchain technologies, IOTA offers notable advantages in terms of transaction verification speed, making it highly suitable for real-time IoT environments. However, the conventional transmission path from sensors to IOTA nodes entails a complex route, involving multiple hardware devices before reaching the intended destination. This complexity poses challenges in ensuring data integrity during transmission and introduces vulnerabilities such as man-in-the-middle attacks or SQL injection attacks. To address these issues, we propose a method to streamline the transmission path between sensors and IOTA, specifically tailored for industrial fields with numerous IoT devices. Our approach involves preprocessing the data stored on the server using our method before uploading, ensuring data confidentiality, and leveraging IOTA to guarantee data integrity. To achieve the shortest path between IoT and DLT nodes, it becomes necessary to establish IOTA nodes on lower-level devices, such as Raspberry Pi or IoT controllers. By simplifying the transmission path, we can reduce the potential for tampering and enhance overall data security. Implementing our proposed method enables the assurance of data confidentiality and integrity during both transmission and storage on the server, strengthening the trustworthiness of the IoT, and IOTA integration.

A novel five-surface phosphor-in-ceramic (FS-PiC) for high illumination and excellent color uniformity in larger-scale LEDs for sensor light source application is demonstrated. YAG phosphor (Y3Al5O12:Ce3+) was uniformly mixed with ceramic and sintered at 680°C to form a phosphor wafer. A sophisticated laser engraving was employed on the phosphor wafer to form a saddle-shaped large-scale FS-PiC LEDs. The performance of the FS-PiC LEDs exhibited the illumination of 401lm, average color temperature (CCT) of 5488K±110K, and color coordinates (CIE) of (0.3179±0.003, 0.3352±0.003). In contrast to convention single-surface phosphor-in-ceramic (SS-PiC) LEDs, the performance exhibited the illumination of 380lm, average CCT of 5830K±758K, and CIE of (0.3083±0.07, 0.3172±0.07). These indicated that the performance of the FS-PiC LEDs was higher than the SS-PiC LEDs for illumination, CCT, and CIE of 1.1, 7, and 23 times, respectively. Furthermore, the FS-PiC LEDs demonstrate lower lumen loss of 2% and less chromaticity shift of 5.4x10-3 under accelerated aging at 350°C for 1008 hours, owing to the high ceramic melting temperature of up to 510°C. In this study, the proposed FS-PiC larger-scale LEDs having excellent optical performance and high reliability may be the promising candidates to replace the convention phosphor-in-organic silicone material used in high-power LEDs for the next generation of sensor light sources, display, and headlight applications.

A typical white-light light-emitting diode (LED) can achieve a sunlight-like spectral profile in the visible spectrum by means of using an optical filter, with an inverted transmission profile to the white LED, fabricated using a deposition coating process. The unfiltered white LED generates white light by mixing light emitted by a blue LED (450 nm) with emission from the yellow phosphorescence excited by the blue light and differs significantly from the characteristics of the full-spectrum natural light. In this study, the spectral characteristics of the filtered LED light can be improved to reach a general color rendering index value (Ra) of 95.6 at the D65.

Unmanned aerial vehicles (UAVs) are one of the most promising innovative technologies invented in recent years to promote precision agriculture and smart farming. UAVs can not only reduce labor requirements but also increase production output, reduce the use of pesticides, and protect the environment. However, previous studies on agricultural UAVs have mostly focused on technical problems such as software and hardware design. Few studies have examined users’ behaviors in the implementation process. On the basis of Orlikowski and Gash’s technological frames, this study explored the participants’ cognition and expectation of farmers, pesticide, sprayers, and agriculture officials, who are three key groups of stakeholders involved in the application of UAVs to pesticide spraying, regarding agricultural UAVs and examined how the conflicts between their cognition and expectation influenced the choice of using pesticide spraying UAVs. The conclusions of this study contributed to supplement the content and broaden the scope of application of technological frame theory and provided a crucial reference for the promotion of agricultural UAVs in practice.

Due to the numerous heat sources in electronic equipment, the periodic nature of stream-wise flow occurs in a cooling channel so often, necessitating the development of an effective technique to improve the heat-cooling convection in such a situation. This paper investigates thermal convection enhancement in a heated-block duct through the periodic boundary conditions using the element-by-element (EBE) treatment in a semi-implicit projection finite element method (FEM) through preconditioned conjugate gradient (PCG) solver. This paper used the time-mean Nusselt number ratio, friction factor, and thermal performance to study how installing rectangular cylinders in the channel works with periodic boundary conditions varying Reynolds numbers (100, 175, and 250). The outcomes show that the rectangular cylinders installed stream-wise above an upstream block promote thermal convection in the heated-block duct. However, increasing the number of rectangular cylinders can raise friction factor. As a result, the case for periodic boundary conditions with a rectangular cylinder above every two blocks has the best thermal performance.

The management of blunt abdominopelvic trauma with combined hemoperitoneum and pelvic fractures is challenging for trauma surgeons. Although angioembolization can achieve hemostasis in most visceral organ injuries and pelvic fractures after blunt abdominal trauma, it cannot effectively control hemorrhage in patients with blunt bowel mesenteric injury (BBMI). This study aimed to determine the risk factors associated with hemodynamically unstable patients with BBMI and to test the hypothesis that pelvic fracture is an independent risk factor for patients with unstable BBMI and concomitant pelvic fracture to guide the therapeutic sequence for difficult-to-manage patients. This retrospective study reviewed the data of hospitalized patients with trauma between 2009 and 2021 and included 158 adult patients with surgically proven BBMI. The patients were divided on the basis of the presence of a shock episode before emergency laparotomy. The shock group included 44.3% of all patients in the study (n = 70). Clinical injury severity and prognosis for patients in the shock group were poorer than those for patients in the non-shock group, and more invasive treatments and transfusions were performed for patients in the shock group than for those in the non-shock group. Pelvic fractures were more frequently associated in the shock group than in the non-shock group (21.4% vs. 5.7%; p = 0.003). In multivariate analysis, the presence of intracerebral hemorrhage (odds ratio [OR] = 10.87, 95% confidence intervals [CIs]: 1.70–69.75) and rib fracture (OR = 5.94, 95% CIs = 1.06–33.45) were identified as independent predictors of shock, whereas the effect of pelvic fracture did not achieve statistical significance (OR = 2.94, 95% CIs = 0.66–13.13) after adjusting for confounding factors. For patients with BBMI, outcomes need to be improved during early diagnosis and treatments should be expeditiously performed on the basis of the rapid identification of unstable hemodynamic status. In unstable patients with concomitant pelvic fractures, we support the current management algorithm that recommends performing laparotomy first.

The NCO functional group of 3-isocyanatoproply triethoxysilane (IPTS) and the OH functional group of DOPO-BQ were used to conduct an addition reaction. Following completion of the reaction, triglycidyl isocyanurate (TGIC) was introduced to conduct a ring-opening reaction. Subsequently, a sol-gel method was used to take place a hydrolysis- condensation reaction on TGIC-IPTS-DOPO-BQ to form a hyperbranched nitrogen–phosphorous–silicon (HBNPSi) flame retardant. This flame retardant was incorporated into a polyurethane (PU) matrix to prepare a hybrid material. Fourier-transform infrared spectroscopy (FT-IR), thermogravimetric analysis (TGA), limiting oxygen index (LOI), UV-VIS spectrophotometry, and Raman analysis were conducted to structure characterization and analyzed transparency, thermal stability, flame retardancy, and residual char to understand the flame retardant mechanism of prepared hybrid materials. After the flame retardant was added, the maximum degradation rate decreased from −36 wt%/min to −17 wt%/min, the integral procedure decomposition temperature (IPDT) increased from 348 ℃ to 488 ℃, and the char yield increased from 0.7 to 8.1 wt%. The aforementioned results verified that thermal stability of PU can be improved after adding HBNPSi. The LOI analysis indicated that the pristine PU was flammable because the LOI of pristine PU was only 19. When the content of added HBNPSi was 40%, the LOI value was 26; thus the PU hybrid became nonflammable.

Recently, design of electric scooters (ESs) has commonly adopted brushless DC motors (BLDCMs) in place of brushed DC motors. This invention develops a new anti-lock braking system (ABS), based on a slip-ratio estimator, for ES utilizing the braking force generated by the BLDCM when electrical energy releases to the load yielding an analogous effect of ABS control in gas-engine vehicles. Comparing to mechanical ABS, the design possesses the advantages of rapid torque responses due to fast actuating response. The electrical ABS is realized by associating with kinematic and Short-circuit braking. A current controller is used to adjust the braking force, while the sliding mode control strategy is adopted to regulate the slip ratio for best road adhesion while braking. Real-world experiments have been conducted for functional and performance verification.

To quantify damage to reinforced concrete (RC) column members after an earthquake, an engineer needs to know the maximum applied force that was generated by the earthquake. Therefore, in this work, piezoceramic transducers are used to detect the applied force on an RC column member under dynamic loading. To investigate the use of post-embedded piezoceramic sensors in detecting the force that is applied to RC columns, eight full-size RC column specimens with various failure modes are tested under specific earthquake loadings. Post-embedded piezoceramic sensors are installed at a range of depths (70-80 mm) beneath the surface of a column specimen to examine the relationship between the signals that are obtained from them and the force applied by the dynamic actuator. The signals that are generated by the post-embedded piezoceramic sensors, which correlate with the applied force, are presented. These results indicate that the post-embedded piezoceramic sensors have great potential as tools for measuring the maximum applied force on an RC column in an earthquake. Restated, signals that are obtained from post-embedded piezoceramic sensors on an RC column in an earthquake can be used to determine the applied force and corresponding damage or residual seismic capacity.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Heat dissipation from Li-ion batteries is a potential safety issue for large-scale energy storage applications. Maintaining low and uniform temperature distribution, and low energy consumption of the battery storage is very important. We studied the fluid dynamics and heat transfer phenomena of a single cell, 16-cell modules, battery packs, and cabinet through computer simulations and experimental measurements. The results show that the temperature distribution of single cell is relatively uniform when the cell is facing the air flow. In a module, very high air flow rate and large gap between the cells can reduce the cell temperature. A pack with a good thermally conductive case is very important to ensure good heat dissipation of the battery module. Due to limited space in the cabinet, additional air inlets and outlets can be opened outside of the cabinet to slightly lower the pack temperature. Installing fins outside the cabinet can also slightly reduce the temperature inside the cabinet. Liquid cooling medium, such as water, is much better than the air-cooling medium.

Hyperuricemia (HC) was one of the important risk factors for gout, arteriosclerosis, and cardiovascular disease. Animal studies have shown that Lactobacillus plantarum can improve the microbiota, immune regulation, and inhibit the uric acid production. However, it was not clear whether L. plantarum can improve HC and intestinal microbiota. We used potassium oxonate (PO) to induce HC in male SD rats, and then treated L. plantarum TCI227 in a dose dependent (HC+LD, HC+MD, HC+HD) for 4 weeks, and examined weight organs, biochemical examination of blood and urine, and analyzed the intestinal microbiota in feces by 16s rDNA sequence analysis. In this study, TCI227 improved body weight, decreased creatinine, serum uric acid, and increased urine uric acid compared to the HC group. Furthermore, TCI227 increased short-chain fatty acids (SCFAs). In fecal microbiota (family), TCI227 increased the level of Lactobacillaceae, and then decreased the level of Deferribacteres and Prevotellaceae compared to the HC group. Finally, in fecal microbiota (genus), TCI227 decreased the level of Prevotella, and then increased the level of Lactobacillus and Ruminococcus compared to the HC group. This study suggested that TCI227 can improve HC and change the compositions of the intestinal microbiota in PO induced male HC SD rats.

Background: The evolution of names, from “medical informatics” to “connected health”, implies that the evolvement of technology in health care has been shifted from technology-oriented to healthcare-oriented implementation. Connected healthcare, a healthcare platform of remote monitoring and self-management through technological measures, is suggested to contribute to the efficiency, cost effectiveness, and satisfaction of healthcare recipient enhancement. However, limited understanding of related connected health (CH) terminology may constrain its implementation. Whether CH is a Buzzword only or a practice that can contribute to an ageing society is controversial. Objective: This study aims to distinguish CH-related terminology and to identify the trend of CH through reviewing its definition, initiation, development, and evolvement, in order to offer management insights and implications. The objective is to understand what is connected and who is cared about in the connected health model, so that better applications can be addressed for the benefit of society. Method: This study reviews the evolution of names, from “medical informatics” in the 1970s to “connected health” after 2000, as well as relevant literature of CH, including e-health, telemedicine, telehealth, telecare, and m-health, to discover the trend of technology-related healthcare implementation. The current status and issues facing CH will be presented and its future trends will be explored through reviewing how changes in healthcare are managed, in addition to its operation and practice. Issues of accessibility, quality, and cost will be discussed, as well as its market status. Results: Preconditions and requirements for implementing CH are identified to select a typical case to study. Areas with a complete business ecosystem, including advanced technology and medical services, a payment system, an ageing population, geographic isolation, integrated health, and social care, are prevalent. These findings may be beneficial to designing and establishing comprehensive CH implantation and environments. Conclusion: The evidence and tendency of technological convergence create a demand for innovation and partnering with start-up companies that offer a competitive advantage in innovation. Specifically, it is necessary to innovate both the public and private operation model of the CH ecosystem. This focus will be further explored in future work.

Background: Patients in the postoperative period following bariatric surgery are at risk of developing eating disorders. This study aims to analyse the relation between bariatric surgery and the development and recurrence of eating disorders. Material and methods: Literature review was done on 15th November 2020. Fourteen studies that met the eligibility criteria were included for qualitative synthesis, and 7 studies for meta-analysis. Results: The prevalence of eating disorders in the postoperative period was 7.83%, based on the 7 studies in the meta-analysis. Binge eating disorder alone was 3.81%, which was the most significant factor, and addressed in 6 of these studies. Conclusion: The investigated studies have significant methodological limitations in assessing the relation between bariatric surgery and eating disorders, since they mostly present data on prevalence. PROSPERO CRD42019135614.

The risk of lung exposure to silica nanoparticles (SiNPs) and related lung inflammatory injury is increasing with the wide application of SiNPs in a variety of industries. A growing body of research has revealed that cyclooxygenase (COX)-2/ prostaglandin E2 (PGE2) up-regulated by SiNPs toxicity has a role during pulmonary inflammation. The detailed mechanisms underlying SiNPs-induced COX-2 expression and PGE2 synthesis remain unknown. The present study aims to dissect the molecular components involved in COX-2/PGE2 up-regulated by SiNPs in human pulmonary alveolar epithelial cells (HPAEpiCs) which are one of the major targets while SiNPs are inhaled. In the present study, we demonstrated that SiNPs induced COX-2 expression and PGE2 release, which were inhibited by pretreatment with a reactive oxygen species (ROS) scavenger (edaravone) or the inhibitors of proline-rich tyrosine kinase 2 (Pyk2, PF-431396), epidermal growth factor receptor (EGFR, AG1478), phosphatidylinositol 3‑kinase (PI3K, LY294002), protein kinase B (Akt, Akt inhibitor VIII), p38 mitogen-activated protein kinase (MAPK) (p38 MAPK inhibitor VIII), c-Jun N-terminal kinases (JNK)1/2 (SP600125), Forkhead Box O1 (FoxO1, AS1842856), and activator protein 1 (AP-1, Tanshinone IIA). In addition, we also found that SiNPs induced ROS-dependent Pyk2, EGFR, Akt, p38 MAPK, and JNK1/2 activation in these cells. These signaling pathways induced by SiNPs could further cause c-Jun and FoxO1 activation and translocation from the cytosol to the nucleus. AP-1 and FoxO1 activation could increase COX-2 and PGE2 levels induced by SiNPs. Finally, the COX-2/PGE2 axis might promote the inflammatory responses in HPAEpiCs. In conclusion, we suggested that SiNPs induced COX-2 expression accompanied by PGE2 synthesis mediated via ROS/Pyk2/EGFR/PI3K/Akt/p38 MAPK- and JNK1/2-dependent FoxO1 and AP-1 activation in HPAEpiCs.

Infectious keratitis (IK) represents a major cause of corneal blindness. This study aims to investigate the demographics, risk factors, microbiological characteristics and antibiotic susceptibility patterns of IK in Taiwan over the past 15 years. A retrospective population-based study was conducted using the Chang Gung Research Database. Patients with IK were identified by diagnostic codes for corneal ulcer from 2004 to 2019. Of 7807 included subjects, 45.2% of patients had positive corneal cultures. The proportion of contact lens-related IK declined, while that of IK related to systemic diseases grew. The percentage of isolated gram-positive bacteria surpassed that of gram-negative bacteria in the 15-year period. The prevalence of Pseudomonas aeruginosa showed a decreasing trend (p = 0.004), whereas coagulase-negative Staphylococcus (CNS) and Propionibacterium species were increasingly detected (p &lt; 0.001). Overall, the trend of antibiotic susceptibility of both gram-positive and gram-negative bacteria did not change throughout the study period. The susceptibility to the test antibiotics maintained over 90% in gram-negative isolates during 15 years. Vancomycin preserved 100% susceptibility to all gram-positive isolates. Since most tested antibiotics exhibited stable susceptibility over decades, this study reinforced that fluoroquinolones and fortified vancomycin continue to be good empiric therapies for treating bacterial keratitis in Taiwan.

This study presents an instant preview and analysis system implementation of intelligent stereo cameras (ISCs). A parameter optimization prototype adopted the instant preview and analysis system of the ISCs has been achieved the automatic alignment function, and obtained optimal stereo films with the automatic alignment function by adjusting gap and angle between dual cameras. The instant preview and analysis system of the ISCs with parameter optimization can enhance the quality of stereo films effectively and reduce filmed errors and save retouched cost and time in harsh filmed environment.

Background and Aims: The impact of antibody response after direct-acting antiviral (DAA) therapy in hepatitis C virus (HCV)-infected recipients before and after liver transplantation (LT) is still undetermined. Methods: In this observational cohort study, we aimed to explore the association of changes in anti-HCV antibody titers after pre-LT DAA therapy with allograft injury, including biliary complications (BCs) and acute cellular rejection (ACR). Results: A total of 153 cases were enrolled from January 2015 to February 2021. Serum anti-HCV antibody titers were assessed before and after (day 30) LT. Among all recipients, 31/153 (20.3%) had pre-LT DAA therapy (DAA group) and 122/153 (79.7%) did not undergo pre-LT DAA therapy (DAA-naïve group). Higher incidence of post-LT BCs was observed in the DAA group (P = 0.028). Compared with the DAA-naïve group, the DAA group had a significantly higher mean level of anti-HCV titer upregulation (P = 0.0024); furthermore, among the recipients with BCs (n = 28) and ACR (n = 41), those in the DAA group exhibited significantly higher mean levels of anti-HCV antibody titer upregulation (P < 0.005). Conclusion: In conclusion, we speculated that anti-HCV antibody titer upregulation, which might have been induced by restoration of HCV-specific immune responses with pre-LT DAA therapy, were associated with post-LT allograft injury.

Patients with Peripheral-artery-disease (PAD) are prone to risks of major-adverse-limb-events (MALE), and major-adverse-cardiovascular-events (MACE). CHA2DS2-VASc is a prognostic score for Atrial fibrillation stroke risk, however, no study exists that evaluated its predictability for MALE and MACE in PAD patients. In this study, patients with PAD were stratified into four risk groups based on CHA2DS2-VASc score. Cox-proportional hazards models,10-fold cross-validation and Receiver operating characteristic (ROC) analyses were utilized to evaluate the predictability of CHA2DS2-VASc for predicting MALE, MACE, and MALE+MACE. Kaplan-Meier analysis estimated the survival-probability of risk-groups. CHA2DS2-VASc was found to be a significant predictor of MACE (hazard ratio (95% confidence interval; P) = 3.47 (0.99 - 12.18; 0.052), 4.12 (1.19 - 14.14; 0.024), and 5.06 (1.48 – 17.28; 0.009), for moderate-, high- and very-high-risk groups, respectively, while for MALE and MALE+MACE significance was achieved only for high-risk group. MACE demonstrated AUC > 0.8, good-discrimination (c-index > 0.8) and good-calibration. However, MALE and MALE+MACE models failed to achieve good performances. Based on all findings, CHA2DS2-VASc could potentially serve as a risk stratification score for predicting MACE in patients with PAD but failed to qualify as a good predictor for MALE.

STAT3 is an oncoprotein which has been shown to contribute to drug resistance in multiple myeloma (MM). Nonetheless, the clinical utility of STAT3 inhibitors in treating MM has been limited, partly related to some of their pharmacologic properties. To overcome these challenges, our group had previously packaged STAT3 inhibitors using a novel formulation of nanoparticles (NP) and found encouraging results. In this study, we aimed to further improve the pharmacologic properties of these NP by decorating them with monoclonal anti-CD38 antibodies. NP loaded with S3I-1757 (a STAT3 inhibitor), labeled as S3I-NP, were generated. S3I-NP decorated with anti-CD38 (labeled as CD38-S3I-NP) were found to have a similar nanoparticular size, drug encapsulation and loading as S3I-NP. The release of S3I-1757 at 24 hours was also similar between the two formulations. Using Cy5.5 labeling of the NP, we found that the decoration of anti-CD38 on these NP significantly increased the cellular uptake by two MM cell lines (p<0.001). Accordingly, CD38-S3I-NP showed a significantly lower inhibitory concentration at 50% (IC50) compared to S3I-NP in two IL6-stimulated MM cell lines (p<0.001). In a xenograft mouse model, CD38-S3I-NP significantly reduced the tumor size by 4 folds compared to S3I-NP on day 12 after drug administration (p=0.006). The efficacy of CD38-S3I-NP in suppressing STAT3 phosphorylation in the xenografts was confirmed by using immunocytochemistry and western blot analysis. In conclusion, our study suggests that the decoration of anti-CD38 on NP loaded with STAT3 inhibitors can further improve their therapeutic effects against MM.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

Surface-enhanced Raman spectroscopy (SERS) is commonly used for super-selective analysis through nanostructured silver layers in the environment, food quality, biomedicine, and materials science. To fabricate a high-sensitivity but more accessible device of SERS, dc magnetron sputtering technology was used to realize high sensitivity, low cost, stable deposition rate, and rapid mass production. This study investigated various thicknesses of a silver film ranging from 3.0 to 12.1 nm by field-emission-scanning-electron microscope, X-ray diffraction, and X-ray photoelectron spectroscopy. In the rhodamine 6G (R6G) testing irradiated by a He-Ne laser beam, the analytical enhancement factor (AEF) of 9.35x108, the limit of detection (LOD) of 10-8 M, and the relative standard deviation (RSD) of 1.61% were better than other SERS substrates fabricated by the same dc sputtering process because the results show that the 6 nm thickness silver layer has the highest sensitivity, stability, and lifetime. The paraquat and acetylcholine analytes were further investigated and high sensitivity was also achievable. The proposed SERS samples were evaluated and stored in a low humidity environment for up to forty weeks, and no spectrum attenuation could be detected. Soon, the proposed technology to fabricate high sensitivity, repeatability, and robust SERS substrate will be an optimized process technology in multiple applications.

Change orders have received considerable attention from researchers thus far, but none have considered pricing strategies of change orders through the interaction between general contractors and subcontractors. Previous studies found that contractors’ opportunistic bidding considering beyond-contractual reward (BCR) in the execution stage can be reduced by improving the construction management system and strengthening the supervision of contractors’ performance. However, the BCR remains in ecology of construction engineering. This study proposes an integrated evolutionary game theory-system dynamics model (ET-SD model) and simulates the pricing strategy of change orders between general contractors and subcontractors to explore the root cause of BCR phenomenon. Sensitivity analysis on the evolutionary dynamics of payoff is explored. Results reveal that change orders with BCR maintain Nash equilibrium and evolutionary stable strategy (ESS) unless changing the payoff structure between general and subcontractors’ pricing strategies. This study presents important managerial insights from the evolutionary game perspectives, nature of change orders, and payoff of the alternative.

Industry 4.0 brings advanced technologies and automation, enabling greater productivity and efficiency. However, it also increases energy consumption and carbon emissions. Sustainable manufacturing in the era of Industry 4.0 is vital for addressing the environmental impact by minimizing resource consumption, optimizing energy efficiency, and adopting eco-friendly practices. CNC (Computer Numeric Control) 5-axis milling plays a significant role in the machining of precision molds and dies, aerospace, consumer electronics, etc. This research aims to explore the potential of the artificial intelligence (AI) technique in improving energy efficiency on CNC 5-axis milling process for sustainable manufacturing. The experiments were carried out using a CNC 5-axis milling machine with various machining parameters, toolpath planning, and dry cutting condition. Data on energy consumption of CNC 5-axis milling machine were collected, then the relationship between the machining parameters, toolpath planning, and energy consumption was analyzed and built. Furthermore, an AI-based optimization algorithm was developed that uses machine learning and optimization techniques to identify energy-efficient machining strategies. The developed algorithm was implemented within a simulation framework, the algorithm was rigorously assessed using machine learning analysis to effectively reduce energy consumption, all while ensuring the accuracy of machining result. Finally, verification experiments were carried out to evaluate the applicability and performance of the AI-based energy optimization approach on a CNC 5-axis milling machine. By integrating AI into the CNC machining process, manufacturers can achieve significant energy savings, leading to reduced carbon emissions and improved sustainability.

The objectives of the research are to investigate the characteristics of the board of directors on the financial performance of the enterprise. Using a sample data from 52 construction and real estate enterprises listed on Vietnam stock exchange in the period 2006-2020. Using typical regression methods such as pooled OLS, FEM, REM and assessing the defects of the research model, the FGLS method is selected. At the same time, due to the existence of endogenous phenomena and the nature of interdependence among enterprises in Vietnam, research using the instrumental variables two-step generalized method of moments (IV-GMM) in order to correct for cross-sectional dependence, autocorrelation, endogeneity, and heteroskedasticity in the analysis. Research results suggest that board size, female board members, meeting frequency, and board members' education have a positive influence on financial performance. Moreover, the independence of the Board of Directors increases, the business efficiency decreases. The research also found a positive relationship of tangible fixed assets, and a negative relationship between capital structure choice, firm size and corporate financial performance.

This study focuses on the impact of weak partial discharges (PDs) on defect recognition accuracy in epoxy resin through phase-resolved partial discharge (PRPD) analysis. Two measurement conditions are compared until PRPD pattern saturation: one-minute and one-hour durations. The PD data specifically target three void types located at different positions within the epoxy material. The aim is to evaluate how the presence of weak PDs at the PD extinction voltage (PDEV) influences defect recognition accuracy. This research sheds light on the potential implications of neglecting the significance of weak PD signals in defect detection. A convolutional neural network (CNN) model is trained using PRPD data recorded at the PD inception voltage (PDIV) and tested using the new PRPD data from both conditions recorded from a lower PDIV to a PDEV. The trained CNN model achieves a defect recognition accuracy of 100% for a one-hour duration, highlighting the importance of not neglecting weak PD signals. This emphasizes the significance of extended measurement duration and pattern saturation in capturing and analyzing weak PD signals for improved defect recognition. This study contributes to the advancement of practical applications by understanding the behavior of the epoxy material and enhancing defect detection techniques.

Hepatocellular carcinoma (HCC) is one of the most common cancers and the main cause of cancer-related death globally. Immune dysregulation of CD4+ T cells has been identified as a role in the development of HCC. Nevertheless, the underlying molecular pathways of CD4+ T cells in HCC are not completely known. Thus, a better understanding of the dysregulation of lncRNA-miRNA/mRNA network might yield novel insights into the etiology or progression of HCC. In this study, circulating CD4+ T cells were isolated from the whole blood of 10 healthy controls and 10 HCC patients for next-generation sequencing of the expression of lncRNAs, miRNAs, and mRNAs. Our data showed that there was different expression of 34 transcripts (two lncRNAs, XIST and MIR222HG, 29 mRNA, and 3 other types of RNA) and 13 miRNAs in the circulating CD4+ T cells of HCC patients. The expression of the lncRNA XIST-related miRNAs and their target mRNAs was confirmed using real-time quantitative polymerase chain reaction (qPCR) on samples from 100 healthy controls and 60 HCC patients. The lncRNA–miRNA/mRNA regulation network was created using interaction data generated from ENCORI and revealed there are positive correlations in the infiltration of total CD4+ T cells and negative correlations in the infiltration of Th1 CD4+ T cells.

This paper proposes a method to utilize weather and land cover models to generate future environmental scenarios, and presents the watershed models to simulate the hydrological impact on watershed-scale hydrology. The Weather Generator model and General Circulation Model were applied to produce rainfall and local temperature under different climate conditions, and the Conservation and Land Use and its Effects model was incorporated to simulate future land cover variability. The circumstances of future climate and land cover changes were used as inputs to drive the HEC-HMS rainfall runoff model for obtaining surface runoff in a mountainous area. The WASH123D model was then utilized for the entire watershed simulation. Modeling results were then examined to discuss hydrological impacts on three different time periods: near future (2020-2039), future (2050-2069), and distant future (2080-2099). The Fengshan Creek basin in northern Taiwan was selected as study site. Simulations results indicated that the influence of climate change revealed more relevant effects when compared to local land cover changes. The ground water levels tended to diminish as the land cover area changed. In addition, both river and groundwater levels reveal that it is drier in dry season and wetter in wet season in future.

Oral cancer ranks sixth among Taiwan's top 10 cancers, and most patients with poor prognosis acquire metastases. The essential fatty acid alpha-linolenic acid (ALA) has been found to diminish many cancer properties. However, the anti-cancer activity of ALA in oral cancer has yet to be determined. Migration and invasion assays confirmed OSCC cells' EMT capabilities, whereas flow cytometry and Western blotting identified the molecular pathways. ALA dramatically reduced cell growth in a concentration dependent manner, according to the findings. Low concentrations of ALA (100 or 200 μM) inhibit colony formation, expression of Twist and EMT-related proteins, expression of MMP2/-9 proteins and enzyme activity, as well as cell migration and invasion. Treatment with high concentrations of ALA (200 or 400 μM) greatly increases JNK phosphorylation and c-jun nuclear accumulation, then upregulates the FasL/caspase8/caspase3 and Bid/cytochrome c/caspase9/caspase3 pathways, leading to cell death. Low concentrations of ALA inhibit SAS and GNM cell migration and invasion by suppressing Twist and downregulating EMT-related proteins, or by decreasing the protein expression and enzyme activity of MMP-2/-9, whereas high concentrations of ALA promote apoptosis by activating the JNK/FasL/caspase 8/caspase 3-extrinsic pathway and the Bid/cytochrome c/caspase 9 pathway. ALA demonstrates potential as a treatment for OSCC patients.

The increased global incidence of myopia requires the establishment of therapeutic approaches. Previous studies have suggested that inflammation plays an important role in the development and progression of myopia. We used human retinal pigment epithelial cell to study the molecular mechanisms on how FJE and PVE lowering the inflammation of the eye. The effect of FJE and PVE in MFD induced hamster model and explore the role of inflammation cytokines in myopia. Expression levels of IL-6, IL-8, and TNF-α were upregulated in retinal pigment epithelium (RPE) cells treated with IL-6 and TNF-α. FJ extract (FJE) + PV extract (PVE) reduced IL-6, IL-8, and TNF-α expression in RPE cells. Furthermore, FJE and PVE inhibited inflammation by attenuating the phosphorylation of protein kinase B (AKT), and nuclear factor kappa-light-chain-enhancer of activated B (NF-κB) pathway. In addition, we report two resveratrol + ursolic acid compounds from FJ and PV and their inhibitory activities against IL-6, IL-8, and TNF-α expression levels in RPE cells treated with IL-6 and TNF-α. FJE, PVE, and FJE + PVE were applied to MFD hamsters and their axial length was measured after 21 days. The axial length showed statistically significant differences between phosphate-buffered saline- and FJE-, PVE-, and FJE + PVE-treated MFD eyes. FJE + PVE suppressed expressions of IL-6, IL-8, and TNF-α. They also inhibited myopia-related transforming growth factor-beta (TGF)-β1, matrix metalloproteinase (MMP)-2, and NF-κB expression while increasing type Ⅰ collagen expression. Overall, these results suggest that FJE + PVE may have a therapeutic effect on myopia and be used as a potential treatment option.

A facile iridium/graphene-catalyzed methodology providing an efficient synthetic route for C-N bond formation is reported. This catalyst can directly promote the formation of C-N bonds, without pre-activation steps, and without solvents, alkalis and other additives. This protocol provides a direct N -alkylation of amines using a variety of primary and secondary alcohols with good selectivity and excellent yields. Charmingly, the use of diols resulted in intermolecular cyclization of amines, and such products are privileged structures in biologically active compounds. Two examples illustrate the advantages of this catalyst in organic synthesis: the tandem catalysis to synthesize hydroxyine, and the intermolecular cyclyzation to synthesize cyclizine. Water is the only by-product, which makes this catalytic process sustainable and environmentally friendly.

It is well known that that there is an intrinsic link between the financial and energy sectors, which can be analyzed through their spillover effects, which are measures of how the shocks to returns in different assets affect each other’s subsequent volatility in both spot and futures markets. Financial derivatives, which are not only highly representative of the underlying indices, but can also be traded on both the spot and futures markets, include Exchange Traded Funds (ETFs), a tradable spot index whose aim is to replicate the return of an underlying benchmark index. When ETF futures are not available to examine spillover effects, “generated regressors” are useful for constructing both Financial ETF futures and Energy ETF futures. The purpose of the paper is to investigate the co-volatility spillovers within and across the US energy and financial sectors in both spot and futures markets, by using “generated regressors” and a multivariate conditional volatility model, namely Diagonal BEKK. The daily data used are from 1998/12/23 to 2016/4/22. The data set is analyzed in its entirety, and are also subdivided into three distinct subsets. The empirical results show there is a significant relationship between the Financial ETF and Energy ETF in the spot and futures markets. Therefore, financial and energy ETFs are suitable for constructing a financial portfolio from an optimal risk management perspective, and also for dynamic hedging purposes.

Background: Recently we demonstrated that Astragalus polysaccharide (PG2), the active ingredient in dried roots of astragalus membranaceus, ameliorates cancer symptom clusters and improve quality of life (QoL) in patients with metastatic disease by modulating inflammatory cascade, against the background that inflammatory cells including macrophages, dendritic cells (DCs), and cytotoxic T lymphocytes (CTLs) in tumor initiation, metastasis, and progression. Nevertheless, the role of PG2 in the modulation of anticancer immunogenicity and therapeutic response remains relatively underexplored and unclear. Purpose: The present study investigates how and to what extent PG2 modulates cellular and biochemical components of the inflammatory cascade, enhance anticancer immunity, and the therapeutic implication of same in patients with lung cancer. Methods and Results: Herein, we demonstrated that PG2 significantly increased the M1/M2 macrophage polarization ratio in non-small cell carcinoma (NSCLC) H441 and H1299 cells. This PG2-induced preferential pharmacologic up-regulation of tumoral M1 population in vitro, positively correlated with the downregulation of tumor-promoting IL-6 and IL-10 expression in NSCLC cell-conditioned medium, with concomitant marked inhibition of cell proliferation, clonogenicity and tumorsphere formation. Our ex vivo results, using clinical sample from our NSCLC cohort, demonstrated that PG2 also promoted the functional maturation of DCs with consequent enhancement of T cell-mediated anticancer immune responses. Consistent with the in vitro and ex vivo results, our in vivo studies showed that mice treated with PG2 exhibited significant time-dependent depletion of the tumor-associated M2 population, synergistically enhanced the anti-M2-based anticancer effect of cisplatin, and inhibition of xenograft tumor growth in the NSCLC mice models. Moreover, in the presence of PG2, cisplatin-associated dyscresia and weight-loss was markedly suppressed. Conclusion: These results do indicate a therapeutically-relevant role for PG2 in modulating the M1/M2 macrophage pool, facilitating DC maturation, and synergistically enhancing the anticancer effect of conventional chemotherapeutic agent, cisplatin; thus laying the foundation for further exploration of the curative relevance of PG2 as surrogate immunotherapy and/or clinical feasibility of its use for maintenance therapy in patients with lung cancer.

Epigallocatechin-3-gallate (EGCG) is the most abundant polyphenol in green tea. In this study, the effects of dietary EGCG on oxidative stress and the metabolism and toxicity of acetaminophen in liver were investigated. Rats were fed the diets with (0.54 %) or without EGCG supplementation for four weeks and were then intraperitoneally injected with acetaminophen (1g/kg). Results showed EGCG lowered hepatic oxidative stress and cytochrome P450 (CYP) 1A2, 2E1, and 3A, and UDP-glucurosyltransferase activities prior to acetaminophen injection. After acetaminophen challenge, the elevations in plasma alanine aminotransferase activity and histological changes in liver were ameliorated by EGCG treatment. EGCG reduced acetaminophen-induced apoptosis by increasing the Bax/Bcl2 ratio in liver. EGCG mildly increased autophagy by increasing the LC3B II/I ratio. Lower hepatic acetaminophen-glutathione and acetaminophen-protein adducts contents were observed after EGCG treatment. EGCG increased glutathione peroxidase and NAD(P)H quinone 1 oxidoreductase activities and reduced organic anion-transporting polypeptides 1a1 expression in liver after acetaminophen treatment. Our results indicate that EGCG may lower oxidative stress and reduce the metabolism and toxicity of acetaminophen. The reductions in CYP-mediated acetaminophen bioactivation and uptake transporter, as well as enhanced antioxidant enzyme activity, may limit the accumulation of toxic products in liver and thus lower hepatotoxicity

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Because imbalanced power will cause the loss of the propulsion motor of the railway vehicle, and the increase in temperature will shorten the service life of the electric vehicle. Not only this, but also increase the cost of electricity and maintenance. In the past, the industry only focused on methods to improve power quality such as load capacity, relay setting, and harmonic resolution. Now, the consider of three-phase unbalance rate (TPUR) must be applied. I propose special transformers wiring (STW) to improve the three unbalance rates and provide different transformer wiring methods. According to the IEEE Committee, in the future, power companies will need to install balanced relay stations to improve three-phase unbalance rate. the internal regulations of Taipower must be less than 4.5% (voltage unbalance rate (NPSUR)of 2.5% and motor temperature rise of 12.5%). the derivation of the transformer "three-phase unbalance rate" model is the focus of the railway system. This research is based on the model derivation of different wiring methods to improve the hot problem caused by the three-phase imbalance and improve the service life of the train. And pointed out that Scott, Le-Blanc, Modified-Woodbridge three wiring methods can be applied to future railway system routes to improve the three-phase unbalance rate, in line with the IEEE standard of less than 2%.

Mechanical ventilation (MV), used in patients with acute lung injury (ALI), induces diaphragmatic myofiber atrophy and contractile inactivity, termed ventilator-induced diaphragm dysfunction. Phosphoinositide 3-kinase- (PI3K-) is crucial in modulating fibrogenesis during the reparative phase of ALI; however, the mechanisms regulating the interactions among MV, myofiber fibrosis, and PI3K- remain unclear. We hypothesized MV with or without bleomycin treatment would increase diaphragm muscle fibrosis through the PI3K- pathway. Five days after receiving a single bolus of 0.075 units bleomycin intratracheally, C57BL/6 mice were exposed to 6 or 10 mL/kg MV for 8 h after receiving 5 mg/kg of AS605240 intraperitoneally. In wild-type mice, bleomycin exposure followed by MV 10 mL/kg prompted significant increases in disruptions of diaphragmatic myofibrillar organization, transforming growth factor-1, oxidative loads, Masson’s trichrome staining, extracellular collagen levels, positive staining of -smooth muscle actin, PI3K- expression, and myonuclear apoptosis (P &lt; 0.05). Decreased diaphragm contractility and peroxisome proliferator activated receptor- coactivator-1 levels were also observed (P &lt; 0.05). MV-augmented bleomycin-induced diaphragm fibrosis and myonuclear apoptosis were attenuated in PI3K-γ-deficient mice and through AS605240-induced inhibition of PI3K- activity (P &lt; 0.05). MV-augmented diaphragm fibrosis after bleomycin-induced ALI is partially mediated through PI3K-γ. Therapy targeting PI3K-γ may ameliorate MV-associated diaphragm fibrosis.

The challenges to sustainability governance across multiple geographical/cultural contexts lead us to the “piecemeal engineering” idea advocated by the philosopher Karl Popper, which explicitly considers context. We argue for adopting the piecemeal engineering approach, augmented by adaptive policies and modern (online) collaboration platforms to maximize the prospects of sustainable practices worldwide. This recommended course is not intended to be a theory in itself. Rather, it is a well-grounded, practical and practicable stop-gap measure in times when complexity and change outpace theories and strategies. We present a philosophical foundation for this “Augmented Popperian Experimentation.” Focusing on The Water Network (the largest collaborative platform for water researchers and professionals), we show that sustainability-oriented organizations in the water realm and others are inching toward the practice we advocate. We discuss implications.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The Cav3.2 T-type calcium channel is implicated in various pathological conditions, including cardiac hypertrophy, epilepsy, autism, and chronic pain. Phosphorylation of Cav3.2 by multiple kinases plays a pivotal role in regulating its calcium channel function. The calcium/calmodulin-dependent serine/threonine phosphatase, calcineurin, interacts physically with Cav3.2 and modulates its activity. However, it remains unclear whether calcineurin dephosphorylates Cav3.2, the specific spatial regions on Cav3.2 involved, and the extent of the quantitative impact. In this study, we elucidated the serine/threonine residues on Cav3.2 targeted by calcineurin using quantitative mass spectrometry. We identified six serine residues in the N-terminus, II-III loop, and C-terminus of Cav3.2 that were dephosphorylated by calcineurin. Notably, a higher level of dephosphorylation was observed in the Cav3.2 C-terminus, where calcineurin binds to this channel. Additionally, a previously known CaMKII-phosphorylated site, S1198, was found to be dephosphorylated by calcineurin. Furthermore, we also discovered that a novel CaMKII-phosphorylated site, S2137, underwent dephosphorylation by calcineurin. In CAD cells, a mouse central nervous system cell line, membrane depolarization led to an increase in the phosphorylation of endogenous Cav3.2 at S2137. Mutation of S2137 affected the calcium channel function of Cav3.2. Our findings advance the understanding of Cav3.2 regulation not only through kinase phosphorylation but also via calcineurin phosphatase dephosphorylation.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Dry eye syndrome (DES) has become increasingly prevalent due to the prolonged use of digital devices in modern society. Individual supplementation with lutein or docosahexaenoic acid (DHA) demonstrated potential benefits for eye health. This study aimed to investigate the effects of lutein plus DHA complex supplementation on DES, visual function, and memory in healthy individuals. Thirty-four participants, aged 40~60 years, received lutein/DHA complex supplements (containing 10 mg free-form lutein, 200 mg DHA, 30 mg red algae extract (astaxanthin), phosphatidylserine, and vitamin A) for 12 weeks. Ophthalmological examinations and memory tests were carried out, and a questionnaire was administered at weeks 0, 6, and 12 of the study. After 12 weeks of the intervention, the tear break-up time had significantly increased, and intraocular pressure (IOP) had significantly decreased. This suggests that lutein/DHA complex supplementation may reduce the IOP and offer potential benefits for DES, as indicated by improved tear stability.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

The identification of biomarkers is crucial for cancer diagnosis, understanding the underlying biological mechanisms, and developing targeted therapies. In this study we propose a machine learning approach to predict the outcome and platinum resistance status of ovarian cancer patients using public available gene expression data. Six classical machine learning algorithms are compared on their predictive performance. Those with the highest score are analyzed by their feature importance using the SHAP algorithm. We were able to select multiple genes that were correlating with the outcome and platinum resistance status of the patients and validated those using Kaplan-Meier plots. In comparison to similar approaches the performance of the models were higher and different genes using feature importance analysis were identified. The most promising identified genes that could be used as biomarkers are: TMEFF2, ACSM3, SLC4A1 and ALDH4A1.

Background: Glioblastoma (GBM), a malignant grade IV tumor, is the most malignant brain tumor due to its hyper-proliferative and apoptosis-evading characteristics. The signal transducer and activators of transcription (STAT) family genes, including STAT3 and STAT5A, have been indicated to play important roles in GBM progression. Increasing number of reports suggest that Garcinol, a polyisoprenylated benzophenone and major bioactive component of Garcinia indica contains potent anti-cancer activities. Material & Methods: The present study investigated the anti-GBM effects of garcinol, focusing on the STAT3/STAT5A activation, using a combination of bioinformatics, in vitro, and ex vivo assays. Results: Our bioinformatics analysis of TCGA - GBM cohort (n=173) showed that STAT3 and STAT5A are preferentially elevated in primary and recurrent GBM, compared to non-tumor brain tissues, and is significantly correlated with reduced overall survival. In support, our immunohistochemical staining of a GBM cohort (n=30) showed an estimated 5.3-fold (p<0.001) elevation in STAT3 and STAT5A protein expression in primary and recurrent GBM versus the non-tumor group. In vitro, garcinol treatment significantly suppressed the proliferative, invasive, and migratory potential of U87MG or GBM8401 cells, dose-dependently. In addition, garcinol anticancer effect significantly attenuated the GBM stem cell-like phenotypes, as reflected by diminished ability of U87MG or GBM8401 to form colonies and tumorspheres and suppressed expression of OCT4 and SOX2. Furthermore, analysis on GBM transcriptome revealed an inverse correlation between the level of STAT3/5A and hsa-miR-181d. Garcinol-mediated anti-GBM effects were associated with an increased hsa-miR-181d/STAT3 and hsa-miR-181d/5A ratio. Conclusion: We present evidence of anti-GBM efficacy of garcinol mediated by enhancing the hsa-miR-181d/STAT3 and hsa-miR-181d/5A ratios in GBM cells. Our findings suggest a potential new therapeutic agent for combating aggressive GBM.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

This work reports the first nanocrystalline SnON (7.6 % Nitrogen content) n-type nanosheet Field-Effect Transistor (nFET) with transistor’s effective mobility (µeff) as high as 357 and 325 cm2/V-s at electron density (Qe) of 5×1012 cm-2 and ultra-thin body thickness (Tbody) of 7 and 5 nm, respectively. At the same Tbody and Qe, these µeff values are significantly higher than single crystalline Si, InGaAs, thin-body Si-on-Insulator (SOI), two-dimensional (2D) MoS2 and WS2. New discovery of slower µeff decay rate at high Qe than SiO2/bulk-Si universal curve was found, owing to one order of magnitude lower effective field (Eeff) by more than 10 times higher dielectric constant () in channel material, which keeps the electron wave-function away from the gate-oxide/semiconductor interface and lowers the gate-oxide surface scattering. In addition, the high µeff is also due to the overlapped large radius s-orbitals, low 0.29 mo effective mass (me*) and low polar optical phonon scattering. SnON nFETs with record-breaking µeff and quasi-2D thickness enable potential monolithic three-dimensional (3D) integrated circuit (IC) and embedded memory for 3D biological brain-mimicking structures.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

3D printing is a non-traditional additive manufacturing process. It is different from the traditional subtractive manufacturing process. It offers exceptional rapid prototyping capabilities and results that traditional subtractive manufacturing methods cannot attain, especially in applications involving curved or intricately shaped components. Despite its advantages, metal 3D printing will face porosity, warpage, and surface roughness issues. These issues will affect the future practical application of the parts indirectly, for example, the structural strength and the parts assembly ca-pability. Therefore, this study compares the qualities of the warpage, weight, and surface rough-ness after milling and grinding processes under the same materials (316L stainless steel) between general rolled steel and 3D additive steel. Experimental results show that 3D printing parts are approximately 13% to 14% lighter than the general rolled steel. The surface roughness performance of 3D printing steel is better than general rolled steel under the same material after milling or grinding processing. The hardness of the 3D printing steel is better than that of the gen-eral rolled steel. The research verifies that 3D additive manufacturing can use surface processing to optimize surface performance and achieve the functions of lightness and hardness.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

Policymakers, academics, and industry players have been focused on determining whether connected health (CH) is a fad or a trend by looking at its sustainability. Although the significance of innovation in healthcare is gradually rising, a definitive identification and systematic comprehension of the core drivers, structure, content, and pattern of innovation in CH are missing. To bridge this gap, this study re-examines and analyses CH from the perspectives of its industrial chain and structure, to assess its future prospects and sustainability by focusing on how its structures and participants act in the ecosystem. This study involves an inductive theory building approach based on multi-stage, semi-structured interviews (n=60 in total). The results indicate that the core drivers, constituents, and components of CH need to be identified and restructured. A valid discourse, which is missing in the current literature, should be proposed with regard to the sustainability of CH. A sustainable business model innovation (BMI) system and the methods employed to achieve sustainability are suggested to discover indicators for future success. This study enriches the current CH understanding from a technology perspective and suggests some implications for practitioners as well as policymakers to enhance sustainable development in the healthcare sector.

Hydroa vacciniforme (HV) is a rare form of photosensitivity disorders in children and is frequently associated with Epstein-Barr virus (EBV) infection, whereas HV-like lymphoproliferative disorders (HVLPD) describe a spectrum of EBV-associated T-cell or NK-cell lymphoproliferations with HV-like cutaneous manifestations, including EBV-positive HV, atypical HV, and HV-like lymphoma. Classic HV occurs in childhood with vesiculopapules on sun-exposed areas, which is usually induced by sunlight and ultraviolet irradiation, and mostly resolves by early adult life. Unlike classic HV, atypical or severe HV manifests itself as recurrent papulovesicular eruptions in sun-exposed and sun-protected areas associated occasionally with facial edema, fever, lymphadenopathy, oculomucosal lesions, gastrointestinal involvement, and hepatosplenomegaly. Notably, atypical or severe HV may progress to EBV-associated systemic T-cell or natural killer (NK)-cell lymphoma after a chronic course. Although rare in the United States and Europe, atypical or severe HV and HV-like lymphoma are predominantly reported in children from Asia and Latin America with high EBV DNA levels, low numbers of NK cells, and T cell clones in the blood. In comparison with the conservative treatment used for patients with classic HV, systemic therapy such as immunomodulatory therapy is recommended as the first-line therapy for patients with atypical or severe HV. This review aims to provide an integrated, overview of current evidence and knowledge of HV and HVLPD to elucidate the pathophysiology, practical issues, environmental factors, and the impact of EBV infection.

This paper reports the efforts made and experiences gained in developing the Flood Prevention and Emergency Response System (FPERS) powered by Google Earth Engine, with focus on its applications at the three stages of floods. At the post-flood stage, FPERS integrates various remote sensing imageries, including Formosat-2 optical imagery, to detect and monitor barrier lakes, synthetic aperture radar imagery to derive an inundation map, and high-spatial-resolution photographs taken by unmanned aerial vehicles to evaluate damage to river channels and structures. At the pre-flood stage, a huge amount of geospatial data are integrated in FPERS and are categorized as typhoon forecast and archive, disaster prevention and warning, disaster events and analysis, or basic data and layers. At the during-flood stage, three strategies are implemented to facilitate the access of the real-time data: presenting the key information, making a sound recommendation, and supporting the decision-making. The example of Typhoon Soudelor in August of 2015 is used to demonstrate how FPERS was employed to support the work of flood prevention and emergency response from 2013 to 2016. The capability of switching among different topographic models and the flexibility of managing and searching data through a geospatial database are also explained, and suggestions are made for future works.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

This study explored drivers’ emotion-based impressions of car-borne central control platforms (CBCCPs) personal-use vehicles. Thus, this preference-based study examined experts’ and drivers’ opinions regarding CBCCPs’ appeal from the perspective of Miryoku engineering. To this end, this study analyzed data via the EGM (evaluation grid method (EGM) and quantification theory type I. Results: Drivers’ preferences for specific CBCCP design characteristics were categorized into the factors “legible,” convenient,” and “tasteful,” which comprised the core of the EGM semantic hierarchical diagram. In addition, the importance of CBCCPs’ appeal factors and characteristics was assessed through quantification theory type I.The findings of this study provide valuable insights for designers, manufacturers, and researchers interested in the design of CBCCPs. Additionally, the results of this study can contribute to research on applied psychology, human-computer interactions, and car interface design.

The framework of product life cycle (PLC) cost analysis is one of the most important evaluation tools for a contemporary high-tech company in an increasingly competitive market environment. The PLC-purchasing strategy provides the framework for a procurement plan and examines the sourcing strategy of a firm. The marketing literature emphasizes that ongoing technological change and shortened life cycles are important elements in commercial organizations. From a strategic viewpoint, the vendor has an important position between supplier, buyer and manufacturer. The buyer seeks to procure the products from a set of vendors to take advantage of economies of scale and to exploit opportunities for strategic relationships. However, previous studies have seldom considered vendor selection (VS) based on PLC cost (VSPLCC) analysis. The purpose of this paper is to solve the VSPLCC problems considering the situation of a single-buyer-multiple-supplier. For this issue, a new VSPLCC procurement model and solution procedure are derived by this paper to minimize net cost, rejection rate, late delivery and PLC cost subject to vendor capacities and budget constraints. Moreover, a real case in Taiwan is provided to show how to solve the VSPLCC procurement problem.

The airport ground handling service (AGHS) equipment vendor selection (AGHSEVS) problem is critical for ramp work safety management, because AGHS equipment malfunctions affect airport ramp work safety. Appropriate vendor selection can prevent aircraft damage and delays in airlines schedules, and ensure reliable and high-quality ground handling service. The AGHSEVS problem is a time-consuming and complex process that requires professional knowledge and experience to make judgments. Specifically, AGHSEVS is a multi-criteria decision-making (MCDM) problem. Previous research has seldom integrated MCDM methods with linear and goal programming to solve the AGHSEVS problem. The objective of this study was to develop a new system evaluation model for AGHSEVS by considering both qualitative and quantitative methods. We test the proposed approach on an AGHS company in Taiwan.

Heavy metals contamination in groundwater often occurs in various industrial processes. Stud-ies have confirmed that polysulfide could reduce hexavalent chromium to trivalent chromium, achieving the effect of in-situ stabilization. For other heavy metals contamination in groundwa-ter, whether polysulfide also had a stabilizing ability to achieve in-situ remediation. This re-search focused on heavy metals except for chromium that often contaminated in groundwater, including lead, nickel, zinc, copper, and cadmium to explore the feasibility of using calcium polysulfide (CaSx) as an in-situ stabilization technology for these heavy metals contamination groundwater. Results showed that CaSx had a great removal efficiency for heavy metals lead, nickel, zinc, copper, and cadmium. However, for nickel, zinc, copper and cadmium, when CaSx was added excessively, complexes would be formed, causing the result of re-dissolve and this would also reduce the removal efficiency. Since it is difficult to accurately control the dosage of agents for in-situ groundwater remediation, the concentration of re-dissolved nickel, zinc, cop-per, and cadmium may not be able to meet the groundwater control standards. CaSx had high lead removal efficiency, and it would not cause re-dissolution due to excessive CaSx dosing. CaSx can be used as an in-situ stabilization technique for lead contaminated groundwater.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

The buildup dynamics of diode-pumped passively mode-locked solid-state laser is thoroughly explored by the real-time measurement with temporal sampling rate up to 40 GHz. A concise cavity is developed to ensure the transient dynamics purely arising from the gain medium and saturable absorber. Experimental results reveal that the laser output in the buildup process exhibits numerous passively Q-switched pulses followed with a damped relaxation oscillation prior to the stable mode locking. Furthermore, it is confirmed that the laser output has already displayed single clean mode-locked pulses inside the first several Q-switched envelopes before stepping into the stage of relaxation oscillation. The present real-time exploration is expected to provide important information for practical applications with temporal modulation of the pump intensity.

The prediction of wind power output is part of the basic work of power grid dispatching and energy distribution. At present, the output power prediction is mainly obtained by fitting and regressing the historical data. The medium- and long-term power prediction results exhibit large deviations due to the uncertainty of wind power generation. In order to meet the demand for accessing large-scale wind power into the electricity grid and to further improve the accuracy of short-term wind power prediction, it is necessary to develop models for accurate and precise short-term wind power prediction based on advanced algorithms for studying the output power of a wind power generation system. This paper summarizes the contribution of the current advanced wind power forecasting technology and delineates the key advantages and disadvantages of various wind power forecasting models. These models have different forecasting capabilities, update the weights of each model in real time, improve the comprehensive forecasting capability of the model, and have good application prospects in wind power generation forecasting. Furthermore, the case studies and examples in the literature for accurately predicting ultra-short-term and short-term wind power generation with uncertainty and randomness are reviewed and analyzed. Finally, we present prospects for future studies that can serve as useful directions for other researchers planning to conduct similar experiments and investigations.

Whether and how P2X7 receptor knockout (KO) modulates central post-stroke pain (CPSP) induced by lesions of the ventrobasal complex (VBC) of the thalamus regarding behavioral, molecular, and electrical recording parameters remains unclear. Following the experimental protocols of a rat hemorrhage CPSP model, the VBC of the thalamus of wild-type and P2X7 receptor KO mice was injected with 10 mU/0.2 μl type IV collagenase to produce an animal model of stroke-like thalamic hemorrhage. Behavioral data showed that the CPSP group induced thermal and mechanical pain, while the P2X7 receptor KO group showed reduced thermal and mechanical pain behaviors. Molecular assessments revealed that the CPSP group had lower expression of NeuN and KCC2 and higher expression of GFAP, IBA1, and BDNF. The P2X7 KO group showed lower expression of GFAP, IBA1, and BDNF and higher expression of KCC2 than the CPSP group. The expression of NKCC1, GABAa receptor, and TrkB did not differ significantly between the control, CPSP, and P2X7 receptor KO groups. Muscimol application increased multiunit numbers and [Cl-] influx in the membrane in the CPSP group, while P2X7 receptor KO reduced multiunit activity and [Cl-] outflux. P2X4 receptor expression was significantly decreased in the 100 kb but not the 50 kb site in the P2X7 receptor KO group. Altogether, the P2X7 hypothesis of CPSP was proposed, wherein P2X7 receptor KO changed the CPSP pain behavior, numbers of astrocytes and microglia, CSD amplitude of the anterior cingulate cortex and the medial dorsal thalamus, BDNF and KCC2 expression, [Cl-], and P2X4 activation in 100 kb with P2X7 receptors. The present findings have implications for the clinical treatment of CPSP symptoms.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Skeletal muscle is a specialized tissue consisting of nondividing and multinucleated muscle fibers. Skeletal muscle-specific myostatin (MSTN) is a secreted protein that acts as a negative regulator of muscle mass by inhibiting proliferation and differentiation of myoblasts. In this study, we established a screening platform to monitor myostatin promoter activity in rat L8 myoblasts. Extract of Glycyrrhiza uralensis (GUE), an oriental herbal medicine, was identified through this screening platform and, the active fractions of GUE were identified by process-scale liquid column chromatography system. For in vivo study, the GUE as a feed additive was investigated in growth-finishing pigs. The results showed that GUE significantly increased body weight, carcass weight and lean content in pigs. Microbiota analysis indicated that GUE did not affect the composition of gut microbiota in pigs. In summary, this established rodent myoblast screening platform was used to identify a myogenesis-related phytogenic, GUE, and further demonstrated that the active fractions inhibited MSTN expression. These finding suggest a novel application for GUE in growth performance enhancement through modulation of MSTN expression. Furthermore, this established screening platform has great potential for identification and evaluation of a wide variety of phytogenics involving in myogenesis.

Abstract: Background: The optimal strategy for the microelimination of HCV within community settings remains ambiguous. We evaluated the percentage of participants who achieved linkage to care (LTC) following the conclusion of the screening campaign, and examined the diverse factors influencing LTC among these individuals. The effectiveness of recall intervention for the non-LTC population and its barriers were analyzed. Methods: We initiated an HCV patients recall program to identify the HCV participants who might not be treated after the HCV screening campaign. A program staff recalled HCV participants who lost to follow-up through the telephone from March 2019 to June 2019. They were informed of HCV treatment's importance, efficacy, availability, and safety. Result: Among 185 HCV-infected participants, 109 (58.9%) HCV-infected participants had obtained LTC. Compared with those who had LTC, those without LTC were older, lower education levels, were less aware of their HCV infection, less frequently lived in urban areas, and had less health insurance. At the end of the recall program, 125 (67.6 %) persons had liked to care. The proportion of LTC increased by 8.7 %. 119 persons had an HCV RNA test, and 82 (68.9%) had viremia. Of 82 patients with viremia, 78 (95.1%) received antiviral therapy. 76 (97.4 %) of them achieved a sustained virological response. Conclusion: After a community screening campaign, 59 % of participants with anti-HCV positive had LTC. The recall program can increase by 9 %. However, there were still 32% of HCV participants who couldn't be linked to care. Outreach care for non-LTC patients is a way worth trying to achieve micro-elimination of HCV in the rural community.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Purpose: Glyphosate and glyphosate-based herbicides (GBH), extensively utilized as herbicides worldwide, have been associated with numerous health issues. Previous experimental studies have indicated their potential to disrupt selenium homeostasis by either interfering with uptake or increasing oxidative stress. However, there is a significant research gap concerning the connection between glyphosate exposure and selenium status in epidemiological studies, particularly within nationally representative samples. Methods: In this study, we examined data from the 2013-2018 National Health and Nutrition Examination Survey (NHANES), involving 3011 participants aged 3 and above. Our main objective was to examine the connection between urinary glyphosate levels, whole blood selenium, and selenium intake. Results: Our analysis did not uncover an association between urinary glyphosate and selenium intake. Nevertheless, we observed a negative correlation between urinary glyphosate levels and whole blood selenium, with a ß coefficient of -1.984, S.E. = 0.639, and P = 0.003 in the final model. We also reported a notable decrease in the average concentrations of whole blood selenium as glyphosate tertiles increased, with P-values for trend of 0.033. Furthermore, the association was particularly prominent among females, non-Hispanic whites, and individuals with lower selenium intake. Conclusions: In this thorough examination of NHANES data, our study uncovers a possible detrimental connection between glyphosate exposure and whole blood selenium levels. These findings underscore the importance of further investigation into the health consequences of glyphosate exposure and its potential influence on selenium status, thereby raising awareness of potential implications for public health.

Input noise causes inescapable bias to the weight vectors of the adaptive filters during the adaptation processes. Moreover, the impulse noise at the output of the unknown systems can prevent bias compensation from converging. This paper presents a robust bias compensation method for a sparse normalized quasi-Newton least-mean (BC-SNQNLM) adaptive filtering algorithm to address this issue. We have mathematically derived the biased-compensation terms in an impulse noisy environment. Inspired by the convex combination of adaptive filters' step sizes, we propose a novel variable-mixing-norm method to accelerate the convergence for our BC-SNQNLM algorithm, which is referred to as BC-SNQNLM-VMN. Simulation results confirm that the proposed method significantly outperforms other comparative works regarding normalized mean-squared deviation (NMSD) in the steady state.

As the world faces unprecedented environmental challenges and the rapid advancements of artificial intelligence (AI), it is crucial for universities to adapt their chemistry education to remain relevant and contribute to sustainability and the United Nations' Sustainable Development Goals (SDGs). This report offers critical insights into the development of university chemistry education over the next 10-20 years, forecasts its development over the next 10-20 years, and offers recommendations for the Ministry of Education and universities to ensure the continued relevance of chemistry programs in the face of AI.