Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The research reported on this paper was aimed at improving the overall efficiency of a PDO certified artisanal cheese production process. Being a PDO certified foodstuff by the EU, it is considered to have properties and qualities determined by the geographical environment in which is made, with its production taking place in a specific and determined geographical location, in this case the Serra da Estrela region. In that sense, the authors conducted a mapping according to a systemic perspective of the processes involved in the context of manufacturing and distribution of certified Serra da Estrela cheese. Numerous methods were used throughout the process, such as a systemic design analysis, and techniques derived from ethnographic methods, which led to the collection of data in the field and consequently provided the immersion of the researcher in genuine work situations. Critical points were identified and emphasized in the systemic map with the purpose of encouraging initiatives to address and overcome the gaps and inefficiencies detected. The systemic design analysis triggered the development of design work. Observations following an ethnographic approach identified ergonomic risks in cheese making during the process of cutting excess chips, fostering the emergence of musculoskeletal disorders at the wrist. A tool that fits best to the task at hand was developed. A prototype of the new tool enabled collecting feedback from use in the work context, in order to inform product development. The domains of agricultural production and microbiology, considering the specific microorganisms developed trough the ripening process of the cheese, turned out to be aspects of high importance for the issue under focus, contributing to a broader understanding of the ripening process and its risks, simultaneously improving the efficiency and success of cheese production. If it were not for the systemic analysis, which served as a link between the boundaries of distinct domains such as the risk of microorganism contamination, ergonomics, energy efficiency, legislation and regulation policies, transportation challenges and economic viability, approached throughout the research. Simultaneously creating bridges between them, the various problems might not have been detected in the first place, as they are usually addressed in specialized disciplines, predetermined by the restrictions of each specific area of knowledge. As a consequence of the development of this research, which was based on an analysis that sought to establish possible connections between various disciplines and tried to constantly maintain a holistic perspective, making new connections and observing the issues from a new angle, apart from the already established methodologies. All this allowed to lay out the seeds for the development of a plan to tackle the critical points identified by the systemic analysis reported in this paper.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

This paper investigates an Energy Neutral System using Micro Energy Harvesters for a Health Monitoring Wireless Sensor Node (HM-WSN). We have implemented HM-WSN consisting of a solar cell energy harvester, a Power Management Unit (PMU) and the ucontroller, sensor and transmitter acting as load. A battery extender and a switching logic circuit for sensor node is designed to evaluate the efficiency of the proposed system. The HM-WSN senses body temperature with improvement in lifetime of coincell. The HM-WSN is built using commercially available off the shelf (COTS components and consumes 47.2uW for data being updated every 134s. It can be operated for approximately 1.32 years only on a coincell. Furthermore, the HM-WSN can be operated with solar energy at 200lux, achieving 96.36 years with a combination of a coincell with an additional capacitor of 2.2mF. It attains 4.07 years to 16.87 years lifetime with the load capacitor varying from 1mF to 1.5mF at 350lux lighting condition. With the same ambient condition and a 2mF load capacitor, HM-WSN attains complete energy autonomy.

The pharmacological effects of the fruiting body of Ophiocordyceps sinensis (Os) exerted antioxidant, anti-virus, and immunomodulatory, whereas the anti-inflammatory effects and active components of Os mycelial submerged culture (OMSC) are not known. This study aimed to investigate the active compounds in the fermented liquid (FLOS), hot water (WEOS), and 50-95% (EEOS-50, EEOS-95) ethanol extracts of OMSC and their anti-inflammatory effects and potential mechanisms in LPS-stimulated microglial BV2 cells. The results demonstrated that all of the OMSC extracts could inhibit NO production in BV2 cells. EEOS-95 exhibited the strongest inhibitory effects (41 % inhibitory ability at 500 µg/mL), and its ergosterol, GABA, total phenolic, and total flavonoid contents were significantly higher than those of the other extracts (18.60, 18.60, 2.28, and 2.14 mg/g, p < 0.05, respectively). EEOS-95 also has a strong inhibitory ability against IL-6, IL-1β and TNF-α with IC50 of 617, 277 and 507 µg/mL, respectively, which is higher than that of 1 mM melatonin. The anti-inflammatory mechanism of EEOS-95 seems to be associated with up-regulation of PPAR-γ/Nrf-2/HO-1 antioxidant-related expression and down-regulation of NF-κB/COX-2/iNOS pro-inflammatory expression signaling. Therefore, we hypothesized that EEOS-95 can prevent neurodegenerative diseases, but the effect on the application in vivo should be further investigated.

Despite the efforts made to stop the tuberculosis (TB) epidemic, it still remains one of the leading causes of death from an infectious disease. Previous work in the group uncovered a new family of amides which showed promising activities against Mycobacterium tuberculosis. A closer look at the literature showed that these compounds are structurally related to the DNB family of DprE1 inhibitors, so, we decided to study a wide range of substituted amides and determine their activity, focusing on unexplored structures related to the dinitrobenzamides (DNB) found in the literature. To synthesize our library of compounds we started from 3,5-dinitrobenzoic acid to form the nitroaromatic core that is characteristic of the DNB’s, to which we then added linear or cyclic amine moieties. Additionally, the impact of terminal aromatic moieties was also assessed for some derivatives, via an ether, ester, or amide bond. In order to obtain the desired derivatives, multiple synthetic approaches were used, mainly focused on nucleophilic addition/elimination reactions, SN2 reactions and Mitsunobu reactions. The activity was impacted mainly by two structural features, the addition of an aromatic moiety as a terminal group and the type of the linker. The most interesting compounds exhibited activities comparable to isoniazid and DNB1. Computational studies were also performed aimed at understanding their possible interactions with DprE1. The most active compounds are a good starting point for further development, and we plan to study an extended family of compounds based in those structures.

This paper proposes a position recognition method for the receiver coil by the secondary coil current. Based on the practical value of the current of the receiver coil, the position recognition of the receiver coil in the WPT system is realized. This paper proposes a 3×3 array multi-transmitter coil grouping and control logic. The mathematical model of mutual inductance between the receiver and transmitter coil at different positions on the X-Y plane is established. A method for identifying the position of the receiver coil according to the current of the receiver coil is proposed. Compared with the traditional position recognition method of the receiver coil, this method does not need to add a detection coil and position sensor and can realize the position recognition of the receiver coil on the 2D plane.

Introduction: Novel robotic surgery systems (da Vinci Xi) are superior to classical open and laparoscopic techniques with its clear and three-dimensional view. We aimed to present the first case low anterior resection of rectal cancer and vaginal specimen extraction with Da Vinci Xi.Case: A 75-year-old female patient with rectum adenocarcinoma was undergone robotic-assisted low anterior resection (LAR) of the rectum, vaginal removal of the specimen, colorectal anastomosis and loop ileostomy. The operation time was 190 minutes. There were no postoperative complications. Pathological tumor stage was stage pT1N0 with negative proximal, distal and radial resection margins. The patient was discharged on the third postoperative day.Conclusion: Robot-assisted LAR, total mesorectal excision, vaginal removal of the specimen, colorectal anastomosis, and loop ileostomy can be performed easily and safely with Da Vinci Xi at early stage rectal cancer. And the vaginal extraction of the specimen avoids us from a traditional abdominal incision.

Lung cancer (LC) stands as the foremost cause of cancer-related fatality rates worldwide. Early diagnosis significantly enhances patient survival rate. Nowadays, low dose computed tomography (LDCT) is widely employed on chest as a tool for large-scale lung cancer screening. Nonetheless, a large amount of chest radiographs causes an onerous burden on radiologists. Some computer-aided diagnostic (CAD) tools can provide insights to medical images for diagnosis and augmenting diagnostic speed. However, due to variation in parameter settings across different patients, substantial discrepancies in image voxels persist. We find different voxel-size causing a compromise between model generalization and diagnostic efficacy. This study investigates the performance disparities of diagnostic models trained on original images and LDCT images reconstructed to different voxel-sizes but isotropic. The application is to differentiate a nodule to be benign or malignant. Using 11 features, a support vector machine (SVM) is trained on LDCT images with an isotropic voxel having side-length of 1.5 mm for 225 patients in house. The result yields a favorable model performance with an accuracy of 0.9596 and an area under the receiver operating characteristic curve (ROC/AUC) of 0.9855. In addition to furnish CAD tools for clinical applications, future research is encouraged to include LDCT images from multi-centers.

Glucose is a simple sugar molecule. The sugar molecule is chemically symbolised as C6H12O6. This means that the glucose molecule contains 6 carbon atoms (C), 12 hydrogen atoms (H) and 6 oxygen atoms (O). In human blood, the molecule glucose circulates as blood sugar. Normally after eating or drinking, our body breaks down the sugars in food and uses them to obtain energy for our cells. To do this, our pancreas produces insulin. Insulin "pulls" sugar from the blood and puts it into the cells for use. If someone has diabetes, their pancreas can't produce enough insulin. As a result, the level of glucose in the blood rises. This can lead one to many potential complications, including blindness, disease, nerve damage, amputation, stroke, heart attack and damage to blood vessels etc. In this study, a non-invasive method for monitoring blood glucose has been developed and is therefore easily usable. The device developed can measure the glucose level continuously and eliminates the disadvantages of the invasive system. Near-IR sensors (optical sensors) were used to estimate the concentration of glucose in the blood; these sensors have a wavelength of 940 nm. The sensor is placed on the tip of the finger and the output of the optical sensor is then connected to the microcontroller at the analogue input. Another sensor used, but only to provide more medical information was the heartbeat sensor. After processing and regression analysis, the glucose level is predicted, and data is sent via the Bluetooth network to a developed APP. The results of the implemented device were compared with available invasive methods. The study consists of a hardware platform inserted into an armband and then a small black parallelepiped-shaped box in which the optical sensors are inserted. The hardware consists of a microcontroller, a Near-IR optical sensor, a heartbeat sensor and a Bluetooth module.

Introduction Emergency laparotomy is a surgical procedure associated with significantly higher mortality rates compared to elective surgeries. Awake laparotomy under neuraxial anaesthesia has recently emerged as a promising approach in abdominal surgery to improve patient outcomes. This study aims to evaluate the feasibility and potential benefits of using lumbar spinal anaesthesia as the primary anaesthetic technique in emergency laparotomies. Methods We conducted a case series involving 16 patients who underwent emergency laparotomy for bowel ischemia, perforation, or occlusion. Lumbar spinal anaesthesia was employed as the main anaes-thetic technique. We analysed patient demographics, clinical characteristics, intraoperative details, and postoperative outcomes. The primary outcome measures included the adequacy of postoper-ative pain control, the incidence of postoperative complications, and mortality rates. Results Among the 16 patients, adequate postoperative pain control was achieved, with only 2 patients requiring additional analgesia. Postoperative complications, including sepsis, wound dehiscence, and pneumonia, were observed in 7 patients (44%). The observed mortality rate was relatively low at 6% (1 patient). Notably, conversion to general anaesthesia was not necessary in any of the cases, and no early readmissions were reported. Discussion Our findings highlight the feasibility and potential benefits of using neuraxial anaesthesia in emergency laparotomies. The observed low mortality rate and the avoidance of conversion to general anaesthesia suggest that lumbar spinal anaesthesia may be a useful alternative in emer-gency settings. However, the occurrence of postoperative complications in 44% of patients indi-cates the need for cautious patient selection and close monitoring. Further research with larger sample sizes is warranted to fully elucidate the efficacy, safety, and potential impact of this tech-nique on patient outcomes in emergency laparotomies.

Over the last two decades, a considerable amount of equipment has been acquired (spreaders, seeders, sprayers, among others) to respond to the challenges of Precision Agriculture (PA) concept. Most of this equipment has been purchased at a high cost. However, many of them, despite still being functional and equipped with sensors, actuators, and electronic processing units capable of adjusting to variations in speed, have become obsolete in terms of communication, and incompatible with new monitoring and control systems based on the “Isobus” protocol. This work aims to present a solution for updating the control system (“Ferticontrol”) of a “Vicon RS-EDW” spreader with variable rate application (VRA), making it compatible with the “InCommand” system from “Ag Leader”. The solution includes low-cost “Arduino” and “Raspberry Pi” microcontrollers and open-source software. The development shows that it is possible to implement a solution that is accessible to farmers in general. It also provides a niche business opportunity for young researchers to set up small technology-based enterprises associated with universities and research centers. These partnerships guarantee permanent innovation and represent a decisive step towards modern, technological, competitive, and sustainable agriculture.

Severe malaria is a major public health concern in Angola, particularly among adults, with limited data on clinical outcomes and manifestations. The study therefore assessed the clinical manifestations and outcome of severe Plasmodium falciparum malaria in adult patients admitted to Hospital Central Dr. António Agostinho Neto of Lubango, Angola. The study retrospectively reviewed the individual records of patients over 14 years old, admitted for severe malaria during the first trimester of 2021 and 2022. World Health Organization (WHO) criteria were used to define severity. A total of 640 patients were recorded into the study, 167 in 2021 and 473 in 2022, distributed across the departments; Intensive Care Unit (ICU; n=81), Medicine (MED; n=458) and Infectiology (INF; n=101). The median age was 26 years and 59.4% were males. The most common manifestation of severe malaria was renal impairment (37.4%). The overall mortality rate was 7% and decreased considerably from 10.2% in 2021 to 5.9% in 2022. The increase in malaria cases during 2022 with increased in prevalence of life-threatening signs like renal impairment, jaundice and impaired conscience, underscores the urgent need for enhanced malaria control and surveillance strategies to mitigate morbidity and mortality, highlighting the potential for antimalarial drug resistance.

Fungal infections caused by Candida spp. are responsible for high hospital morbidity and mortality rates. Therefore, there is a continuous search for new antifungal medicines, particularly ones with anti-Candida activity. This review analyzed articles published between 2002 and 2023 considering the anti-Candida activity of chemical compounds identified or isolated in plants of the Anacardiaceae family. In addition, the in-silico prediction of the isolated compounds described was performed. The analysis of 35 studies showed that extracts, essential oils, and compounds from the anti-Candida activity were frequently determined in vitro using the minimum inhibitory concentration (MIC). The most commonly tested species were Candida albicans, C. tropicalis, C. parapsilosis, C. glabrata, C. krusei, and C. guilliermondii, respectively. Essential oils were the most used form (37% of the studies). The isolated compounds with antifungal effects include cardanol, estragole, trans-anethole, β-caryophyllene, myrcene, catechin-3-o-rhamnoside, β-sitosterol-3-O-glucoside, 24Z-isomasticadienolic acid, oleanolic acid, and oleanolic aldehyde. The in-silico evaluation of those isolated compounds revealed the compounds' drug-likeness and possible antifungal activity. However, some of them showed high toxicity. In conclusion, compounds from the Anacardiaceae family show promise for developing new therapeutic antifungal drugs, especially in combination with conventional antifungals.

Saltwater intrusion in the rapidly developing city of Da Nang in central Vietnam is currently causing various water-related challenges, including inadequate water supply and water pollution. An integrated SWAT-MODFLOW numerical model was used to investigate the origin and mechanism of saltwater in Holocene and Pleistocene aquifers. Geophysical and isotopic approaches were used to validate the SEAWAT model applied for simulating saltwater intrusion. The results suggest that the ebb and flow of tides, as well as water levels in rivers primarily impact coastal aquifers. However, effective water resource planning and management, along with maintaining the natural recharge of fresh water from local rain during the rainy season, could enable the rational and efficient utilization of groundwater, reducing saltwater intrusion in many areas. During the dry season, groundwater is recharged from higher altitude areas. The current saltwater intrusion mainly occurs along the rivers up to the hydraulic dam. Simulated models, using scenarios of stop abstracting groundwater, but changing to the use of surface water for drinking water, show that the area of saline water shrinks quickly after 30 years, reducing from 59.6 km2 to 39.5 km2 and from 40.2 km2 to 28.6 km2 in Holocene and Pleistocene, respectively.

This paper analyses the application of deep learning techniques for predicting wave overtopping events in port environments using sea state and weather forecasts as inputs. The study was conducted in the outer port of Punta Langosteira, A Coruña, Spain. A video recording infrastructure was installed to monitor overtopping events from 2015 to 2022, identifying 3709 overtopping events. The data collected was merged with actual and predicted data for the sea state and weather conditions during the overtopping events, creating three datasets. We used these datasets to create several machine learning models to predict whether an overtopping event would occur based on sea state and weather conditions. The final models achieved a high accuracy level during the training and testing stages: 0.81, 0.73, and 0.84 average accuracy during training and 0.67, 0.48, and 0.86 average accuracy during testing, respectively. The results of this study have significant implications for port safety and efficiency, as wave overtopping events can cause disruptions and potential damage. Using deep learning techniques for overtopping prediction can help port managers take preventative measures and optimize operations, ultimately improving safety and helping to minimize the economic impact that overtopping events have on the port's activities.

To assess if SARS-CoV-2 infection induces changes in the urinary volatilomic fingerprint able to be used in the non-invasive COVID-19 diagnosis and management, urine samples of SARS-CoV-2 infected patients (62), recovered COVID-19 patients (30), and non-infected individuals (41) were analysed using solid-phase microextraction technique in headspace mode, combined with gas chromatography hyphenated with mass spectrometry (HS-SPME/GC-MS). In total, 101 volatile organic metabolites (VOMs) from 13 chemical families were identified, being terpenes, phenolic compounds, norisoprenoids, and ketones the most represented groups. Overall, a decrease in the levels of terpenes and phenolic compounds was observed in the control group, whereas norisoprenoids and ketones showed a significant increase. In turn, a remarkable increase was noticed in norisoprenoids and ketones and a milder increase in alcohols, furanic, and sulfur compounds in the recovery group than in the COVID-19 group. Multivariate statistical analysis identified sets of VOMs with the potential to constitute volatile signatures for COVID-19 development and progression. These signatures are composed of D-carvone, 3-methoxy-5-(trifluoromethyl)aniline (MTA), 1,1,6-trimethyl-dihydronaphthalene (TDN), 2-heptanone, and 2,5,5,8a-tetramethyl-1,2,3,5,6,7,8,8-octahydro-1-naphthalenyl ester acetate (TONEA) for COVID-19 infection and nonanoic acid, α-terpinene, β-damascenone, α-isophorone, and trans-furan linalool for patients recovering from the disease. This study provides evidence that changes in the urinary volatilomic profile triggered by SARS-CoV-2 infection constitute a promising and valuable screening and/or diagnostic and management tool for COVID-19 in clinical environment.

Leonardo da Vinci (1452-1519) is considered one of the greatest geniuses of the Renaissance. His studies developed advanced ideas for his time, even in its most unknown aspects, such as: architecture, urban planning and restoration. He never studied formally, but he learned everything due to his method of observation, the study of other treatises and especially the group of artists with whom he collaborated. After the study of its codices a great interest and knowledge is detected, related to the design, the structural calculation, the materials and the constructive systems, in such a way that their proposals influenced the architecture of the Renaissance, through the work of other authors of your time. The purpose of this article is to make a critical analysis of its excellent architectural proposal in the cupola of the Duomo of Milan and the reasons why it was not carried out under its name. This proposal is included within a discipline in which it has never been recognized as such, but which demonstrated the same qualities as in other fields where it is recognized prestigiously.

Falls are considered a significant cause of disability, pain, and premature deaths in older adults, often due to sedentary lifestyles and various risk factors. Combining immersive virtual reality (IVR) with physical exercise, or exergames, enhances motivation and personalizes training, effectively preventing falls by improving strength and balance in older people. IVR technology may increase the ecological validity of the assessments. The main goal of our study was to assess the feasibility of using a KAVE-based VR platform combining simulations of Levadas and a Cable Car to perform a balanced assessment and profiling of the older adult population for high risk-of-falls and the related user experience. A VR-based platform using a Wii balance board and a CAVE was developed to assess balance and physical fitness. Validated by the Biodex Balance System (BBS), 25 older adults participated in this study. The usability and presence were measured through the System Usability Scale and ITC-SOPI questionnaires, respectively. The IVR system showed a high presence and a good usability score of 75. Significant effects were found in the maximum excursion of the Centre of Pressure (COP) on the anterior-posterior axis during the Cable Car Simulation (CCS), correlating with BBS metrics. Multiple discriminative analysis models and the support vector machine classified fall risk with moderate to high accuracy, precision, and recall. The system accurately identified all high-risk participants using the Leave-One-Out method. This study suggests that an IVR-based platform based on simulations with high ecological validity can be used to assess physical fitness and identify individuals at a higher risk of falls.

The number of physical devices connected to the Internet such as vehicles, household appliances and other "things" has been steadily increasing in recent years, thus forming the basis for the Internet of Things (IoT). IoT ecosystem extends beyond country borders and application domains, combining thousands of versatile devices that differ in terms of their structures, capabilities, and available resources. It is therefore not surprising that the landscape of wireless communication technologies and the degree of IoT devices available today is excessively broad and diverse. Interference between networks leads to frame collisions and consequent packet loss. Frame collisions occur when two or more packets overlap in time and frequency and use the same LoRa parameters, i.e. the same spreading factor (SF), bandwidth (BW) and carrier frequency (CF). When most devices use the same configuration, collision probability is higher. The probability of frame collisions is also affected by traffic characteristics, particularly the periodicity of the transmission and the payload size. Larger payload sizes and more frequent transmissions accumulate with higher time on air (ToA) and channel occupancy [1]. Transmission powers and the location of the gateways also influences this situation. The aim of this experimental work is to verify the effects of collisions and interference in LoRaWAN, regarding the periodicity of transmissions and the payload sizes. The hardware used is an Arduino board programmed in C/C++, a LoRa Bee module operating at a frequency of 868 MHz and a LoRaWAN LG02 gateway. Different scenarios were tested in an outdoor environment, with Line of Sight and Non-Line of Sight, and different variables such as: SFs equal to 7, 9 and 12; distances of 20, 40 and 60 meters and different data sizes of 14, 32 and 51 bytes, over the same channel. The packets with different SF’s and different data sizes were transmitted in a (pseudo) random way, one after the other, overlapping different SFs in the same channel and testing this way (theoretical) orthogonality among them. By fixing the bandwidth in 125 kHz, and testing different SFs we intend to increase the probability of cause packet loss by applying to our connection a combination of emitted power/short distance that leaves an interference power received, strong enough [2] for the effect. We validate our conclusions by analyzing ToA according with RSSI and different data sizes, the RSSI for different SFs and different data sizes and finally the packet loss through the PDR-Packet Delivery Ratio for a better understanding of the reliability of packet transmission in our link.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Senna rugosa is a species found in the Cerrado and used in folk medicine as a vermifuge and in the treatment of poisonous snakebites accidents. In this work, we identified the main secondary metabolites present in ethanolic extracts of the leaves (ELSR) and roots (ERSR) of S. rugosa and evaluated the potential cytoprotective effect against cellular macromolecular damage, as well as the cytotoxic properties of the extracts on the K562 and Jurkat leukemic cell lines. The identification of metabolites was done by liquid chromatography coupled with mass spectrometry. The antioxidant activities were investigated by direct ABTS•+ and DPPH• radical scavenging methods, protection against oxidative damage in proteins and DNA. The cytotoxic properties were investigated against healthy cells, isolated from human peripheral blood (PBMC) and leukemic cell lines. The leaf extract contains catechin, rutin, epigallocatechin derivatives, kaempferol glycosides, luteolin, and dimeric and trimeric procyanidins, while the root extract profile shows obtusichromoneside derivatives, 2-methoxystypandrone, stilbene derivatives, naphthopyranones, and flavanone derivatives. The extracts showed antioxidant activity, with IC50 of 4.86 ± 0.51 µg/mL and 8.33 ± 0.90 µg/mL in the ABTS assay for ELSR and ERSR, respectively. And in the DPPH• assay, the IC50 was 19.98 ± 1.96 µg/mL for ELSR and 13.37 ± 1.05 µg/mL for ERSR. The extracts protected macromolecules against oxidative damage at concentrations of 5 µg/mL. The cytotoxicity test against leukemic strains was observed after 24 and 48 hours of treatment. After 48 h, results against the K562 cell line demonstrate IC50 of 242.54 ± 2.38 µg/mL and 223.00 ± 2.34 µg/mL for ELSR and ERSR , respectively. While against the Jurkat cell line, these extracts showed IC50 of 171.45 ± 2.25 µg/mL and 189.30 ± 2.27 µg/mL, respectively Results on PBMC viability, demonstrate that the extracts showed selectivity for the leukemic cell lines. Together, our results reveal that the leaves and roots of S. rugosa have completely distinct and complex chemical compositions. This study expands the repertoire of identified chemical compounds and underscores their significant pharmacological potential in conditions related to oxidative stress and leukemia.

Most research on colostrum quality and colostrum management focuses on maternal IgG transfer to the newborn calf. However, in addition to being a source of antibodies, colostrum has other components that influence passive immune transfer, nutrition, gut maturation, and thermoregulation. In this review, the constituents in the bovine colostrum, as well as their variation, are explored and it is discussed the biological role of colostrum on the newborn calf. Protein is the nutrient in higher concentration and fat is the nutrient with the most variation. There is a pronounced amplitude in the total solids content of colostrum, but the average concentration does not vary much between studies (24.7%). Bovine colostrum major components can vary with several factors, such as the region, season, breed, dry period length, and nutritional aspects of the dam. Bioactive components, cells, and microbiome variability are less understood, besides IgG. Regardless, they play crucial distinct roles in the physiological development of the newborn. However, a multi-interactive effect between these components, cells, and microorganisms is more likely to occur. Recently researched components in colostrum like miRNA, nucleo(t)sides, the milk fat globule membrane, oligosaccharides, minor proteins, and the microbiome are examples of promising interest areas of study.

The study aimed to compare the cardiovascular benefits of Omega-3 Polyunsaturated Fatty Acids from fish oil versus krill oil in different forms and dosages. Following PRISMA 2015, data analysis with R software, and databases were searched from 1993 to 2023, (ID PROSPERO: CRD42024502338). Sixty high-quality studies were analyzed, covering various forms of fish oil and krill oil at different dosages (fish oil (ethyl ester-EE, triglyceride-TG, re-esterified triglycerides-rTG, capsules, emulsion-EM); krill oil (phospholipid/free fatty acid-PL/FFA, high concentration phospholipid-HPL, low concentration phospholipid-LPL)). Meta-analysis revealed that krill oil with phospholipid/free fatty acid at doses 2000-2900 mg effectively lowered triglycerides, while fish oil in ethyl ester form at doses above 3000 mg significantly reduced total cholesterol. Fish oil in triglyceride form at doses 2000-2900 mg and other variations positively impacted HDL-C levels. Fish oil in EE form above 3000 mg and triglyceride form below 2000 mg notably reduced LDL-C. However, there was limited effectiveness observed for other interventions. Analysis for LDL-C exhibited publication bias, while other parameters demonstrated reliability (Egger's test). In conclusion, krill oil - PL/FFA, Fish oil - EE above 3000 mg, Fish oil - TG 2000-3000 mg, and fish oil - rTAG 300-1900 mg effectively in reducing heart risk patients.

Cardiovascular diseases (CVDs) a leading cause of mortality worldwide. Therefore, there is in-creasing interest in dietary interventions to reduce risk factors associated with these conditions. Cherries and berries are rich sources of bioactive compounds and have attracted attention for their potential cardiovascular benefits. This review summarizes the current research on the effects of cherries and berries consumption on cardiovascular health, including in vivo studies and clinical trials. These red fruits are rich in phenolic compounds, such as anthocyanins and flavonoids, which have multiple bioactive properties. These properties include antioxidant, anti-inflammatory, and vasodilatory effects. Studies suggest that regular consumption of these fruits may reducing in-flammation and oxidative stress, leading to lower blood pressure, improved lipid profiles, and enhanced endothelial function. However, interpreting findings and establishing optimal dosages is challenge due to the variability in fruit composition, processing methods, and study design. Despite these limitations, the evidence highlights the potential of cherries and berries as components of preventive strategies against CVD. Further research is needed to maximize their health benefits and improve clinical practice.

In this paper, we investigate the Green measure for a class of non-Gaussian processes in $\mathbb{R}^{d}$. These measures are associated with the family of generalized grey Brownian motions $B_{\beta,\alpha}$, $0

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The menopausal transition often accompanies distressing manifestations, including vasomotor symptoms, sleep disruptions, and depressive syndrome. Omega-3 fatty acids have emerged as a potential intervention to alleviate these symptoms. This review aimed to comprehensively assess the impact of omega-3 supplementation on vasomotor symptoms, sleep quality, and depression among postmenopausal women. We conducted a systematic search focusing on randomized control trials across the Cochrane Library, Web of Science, PubMed, CINAHL, EMBASE, and SCOPUS databases from inception to August 2023. Among the initial pool of 163 studies, 9 studies met the inclusion criteria and were incorporated into this review. Four studies suggested potential benefits of omega-3 intake for improving hot flashes and night sweats. Sleep quality outcomes displayed heterogeneity across the studies. Incorporating diverse scales such as the Hamilton Depression Rating Scale-21, the Patient Health Questionnaire depression scale, and Generalized Anxiety Disorder-7 for depression outcomes, the review found inconclusive evidence on omega-3's impact on depression. Overall, the combined analysis of these studies did not provide substantial evidence to support the efficacy of omega-3 fatty acids in improving vasomotor symptoms, sleep quality, and depression. Further well-designed RCTs with larger participant groups are crucial to validate and generalize these results.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The study of the impact of polyQ expansion driven proteotoxicity on cell metabolism has evi-denced NAD molecule as a central player in regulating metabolic response and cell repair in neurodegeneration. The decline in NAD intracellular levels represents a hallmark of ageing aris-ing from a dysregulation between NAD-consuming and biosynthetic enzymatic reactions in which NMNAT plays a key role. By an integrated bioanalytical and proteomic experimental design, the derangement of NAD metabolism deriving from the accumulation of polyQ-Htt protein has been analysed in Saccha-romices cerevisiae harbouring a 103Q-Htt and compared with wild-type Htt, in absence and in presence of a phenolic extract from EVOO, as a source of antioxidant bioactive compounds. Quantification of NAD and its precursors and proteomic analysis of the differential protein ex-pression has been performed by LC-DAD-MS. Chronological lifespan and NAD homeostasis was strongly impaired by proteotoxic polyQ-Htt, eliciting a depletion of NAD levels and accumulation of NaMN. In parallel a downregulation of Sirt2 expression levels has been observed. Phenolic extract administration had no meaningful ef-fects on NAD replenishment to prevent proteotoxicity. NaMN can represent a biomarker of accel-erated aging, and/or a signaling molecule for cell repair.

Malaria remains an important and challenging infectious disease, and novel antimalarials are required. Benzyl isothiocyanate (BITC), the main breakdown product of benzyl glucosinolate, is present in all parts of Tropaeolum majus L. (T. majus) and has antibacterial and antiparasitic activities. To our knowledge, there is no information on the effects of BITC against malaria. The present study evaluates the antimalarial activity of BITC and T. majus seeds, leaves, and stems aqueous extracts. We used flow cytometry to calculate the growth inhibition (GI) percentage of the extracts and BITC against unsynchronized cultures of chloroquine-susceptible Plasmodium falciparum (P. falciparum) 3D7-GFP strain. Extracts and/or compounds with at least 70% GI were validated by IC50 estimation against P. falciparum 3D7-GFP and Dd2 (chloroquine-resistant strain) unsynchronized cultures by flow cytometry, and the resistance index (RI) was determined. T. majus aqueous extracts showed some antimalarial activity higher in seeds than in leaves or stems. BITC’s GI was comparable to chloroquine’s. BITC’s IC50 was similar in both strains, thus a cross-resistance absence with aminoquinolines was found (RI < 1). BITC presented features that could open new avenues for malaria drug discovery.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The Serra da Estrela Natural Park (NPSEs) in Portugal stands out as a well-preserved region abundant in medicinal plants, particularly known for their pharmaceutical applications in diabetes prevention and treatment. This comprehensive review explores these plants' botanical diversity, traditional uses, pharmacological applications, and chemical composition. The NPSEs boast a rich diversity with 138 medicinal plants across 55 families identified as traditionally and pharmacologically used against diabetes globally. Notably, the Asteraceae and Lamiaceae families are prevalent in anti-diabetic applications. In vitro studies reveal their significant inhibition of carbohydrate-metabolizing enzymes, and certain plant co-products regulate genes involved in carbohydrate metabolism and insulin secretion. In vivo trials demonstrate anti-diabetic effects, including glycaemia regulation, insulin secretion, antioxidant activity, and lipid profile modulation. Medicinal plants in NPSE exhibit various activities beyond anti-diabetic, such as antioxidant, anti-inflammatory, antibacterial, anticancer, and more. Chemical analysis identifies over fifty compounds like phenolic acids, flavonoids, terpenoids, and polysaccharides responsible for their efficacy against diabetes. The findings underscore the potential of NPSE medicinal plants as anti-diabetic candidates, urging further research to develop effective plant-based anti-diabetic drugs, beverages, and supplements.

Ginkgolic acids (GA) have been reported to exhibit anticancer properties, however, the mechanisms remain unclear. This study aims to investigate the mechanisms of GA C13:0 that was isolated from Ginkgo biloba exocarp (GBE) for anti-proliferation, pro-apoptosis and anti-migration effects in human MCF-7 and mouse 4T-1 breast cancer cells. The cytotoxic effect, apoptosis induction and migration inhibition were measured using MTT, TUNEL and Wound healing assays. The expression of mRNA and protein were determined using qPCR and Western blot. Our results showed that no cytotoxicity was found at concentrations of C13:0 below 100µM. The effects of GA C13:0 was further demonstrated by up-regulation of the Bax/Bcl-2 apoptosis pathway and the expression of Apaf-1 protein in the mitochondria. In addition, GA C13:0 also suppressed cell migration and epithelial to mesenchymal transition (EMT) with the increase of E-cadherin expression accompanied by the decrease of Snail, MMP-2, MMP-9 and Vimentin expression. Moreover, GA C13:0 induced cytochrome P450 (CYP) 1B1 expression in aryl hydrocarbon receptor (AhR) pathway. Notably, the up-regulation of CYP1B1 also might play a pivotal regulatory role in mitochondrial and EMT pathways in MCF-7 and 4T-1 cells. Our results may have implications for the development of anticancer agents containing GA as functional additives.

The Limpopo estuary mangrove forest covers about 928 ha, however 382 ha remain intact and 546 ha were degraded after the 2000 floods. Mangrove replanting campaigns have been carried out at the site. This article aims to evaluate the structure and carbon pool of aboveground and belowground living biomass and soil carbon in natural and replanted mangrove forests (2016, 2014 and 2010). The methodology consisted of selecting 40 strata where structural data were collected. Living biomass above and below ground and soil carbon was obtained based on the methodology described by Kauffman and Donato (2012). The results showed that A. marina was the most observed species in all study areas. The carbon reserve of living biomass above and below ground in the natural forest was 67.9±100.9 MgCha -1 and 65.0±77.1MgC ha -1 , respectively; and in the planted forests (2016, 2014, 2010) it was 1.1±0.5MgCha-1 and 2.1±1.0MgCha-1, 1.8±1.0MgCha-1 and 3.6±2.0MgCha-1, 3.7±2.0MgCha-1 and 5.3±2.5MgCha-1 . Soil carbon reserve was 229.4±119.4 MgCha-1 in natural forest and 230.3±134.8 MgCha-1 , 234.8±132.7MgC ha-1, 229.4±119.4 MgCha-1 in planted forests (2016, 2014, 2010). The total carbon reserve in the natural forest was 362.3 MgCha-1 and in the planted forestsn(2016, 2014, 2010) it was 233.5 MgCha-1 , 240.2 MgCha-1, 246.4 MgCha-1. Natural and restored forests had similar anoumts of soil carbon, which reinforces the idea that soil is a stabel carbon pool. Morever, restored forests failed to store the same amount of live biomass (an carbon), which supports the idea that it is better to prevent habitat degradation than to restore it.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

This article explores the apologetic discourse towards the convergence between Pure Land Buddhism and science of the contemporary Chinese Buddhist monk Da An (1959- ). Faced with the formidable challenge posed by contemporary science towards public acceptance of Buddhism, Da An endeavors to employ science as a medium for propagating Pure Land teachings, seeking to accommodate the preferences of scientifically inclined individuals. He utilizes several theoretical physics concepts to validate that certain ostensibly miraculous accounts within Pure Land Buddhist texts are not incompatible with contemporary science. Further, he asserts that certain supernatural narratives therein indicate that some physical principles still residing in theoretical conjectures on Earth have already been validated and can be utilized at will by the celestial beings in Sukhāvatī, thus asserting the supremacy of Pure Land teachings over science. The article endeavors to examine the contemporary dialogue between Pure Land Buddhism and science, which has been overlooked in the current research realm of the interaction between Buddhism and science.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Microencapsulation by atomization can be used to minimize the loss of bioactive compounds, improving the characteristics and applicability of the powdered product. This study evaluates the effect of different encapsulating agents (maltodextrin, gum arabic, and chitosan) and three spray nozzle diameters (1.0, 1.2, and 1.5 mm) on the atomization of guavira (Campomanesia adamantium) pulp with added 6% bocaiuva (Acrocomia aculeata) dehydrated pulp in the green maturation stage. The experiment followed a simplex-centroid mixed design, with carrier agent concentrations and spray nozzle diameters as independent variables and powder yield, solubility, hygroscopicity, and vitamin C content as dependent variables. The results show that gum arabica increased powder yield and vitamin C retention. The addition of maltodextrin resulted in powders with increased solubility and low hygroscopicity. Furthermore, the optimization tool indicated that the best process conditions were achieved with the addition of gum arabic (10.8%) and chitosan (7.2%), resulting in powders with 29.48% yield, 82.96% solubility, 15.90% hygroscopicity and 741.11 mg/100g vitamin C. Furthermore, the 1.0 mm diameter spray nozzle was considered the most suitable for obtaining guavira pulp microparticles with higher ascorbic acid content.

Considering the health benefits of the kombucha, already widely studied, the objective of the study was to development of the beverage with the addition of infusion of special arabica coffee from the first fermentation varying the proportion of special coffee (2% a 13%) and evaluate the pH, volatile acidity, degree of alcohol, centesimal composition, sodium contents, colour parameters as like acceptability of the beverages. With respect to the pH, all the formulations conformed with the kombucha identity standard, but K3 and K4 were below the established minimum for volatile acidity. Except for K4, all the other formulations were classified as alcoholic kombuchas, although the values were very close to the limit for non-alcoholic. The formulations presented low sugar and sodium content, which corroborated the low caloric value. Therefore, coffee-flavored kombucha fermented for 18 days becomes an option for consumers looking for low-calorie, refreshing and healthy drinks. The luminosity of the beverages decreased as the proportion of coffee increased, and consequently the values for a* and b* increased, indicating a strong tendency for a yellowish red colour. Sensorially, the formulations K4 and K3 were the most well accepted in all respects and can therefore be considered formulations with high commercialization potential.

In this work, we proposed a novel design of microfluidic mixer utilizing the amplified Marangoni chaotic advection induced by AC continuous electrowetting of a metal droplet situated in electrolyte solution, due to the linear and quadratic voltage-dependence of flow velocity at small or large voltages, respectively. Unlike previous researchers exploiting the unidirectional surface stress with DC bias at droplet/medium interface for pumping of electrolyte where the resulting flow rate is linearly proportional to the field intensity, dominance of another kind of dipolar flow pattern caused by local Marangoni stress at the drop surface in sufficiently intense AC electric field is demonstrated by both theoretical analysis and experimental observation, which exhibits a quadratic growth trend as a function of the applied voltage. The dipolar shear stress merely appears at larger voltages and greatly enhances the mixing performance by inducing chaotic advection between the neighboring laminar flow. The mixer design developed herein, on the basis of amplified Marangoni chaotic advection around a liquid metal droplet at larger AC voltages, has great potential for chemical reaction and MEMS actuator applications, because of generating high-throughput and excellent mixing performance at the same time.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

The development of solid-state forms of drugs is an effective mean of solubility enhancement. In this study, two polymorphs named form C, form D, and two co-crystals of sorafenib (SF) with oxalic acid (SF-OA) and malonic acid (SF-MA), by evaporation and slurry method, have been developed and characterized. The single-crystal X-ray diffraction results showed that the structure of form C was similar to of form I. It had similar cellular parameters, but different arrangement of stacking due to π-π conjugation. The drug molecules in SF-OA underwent torsional folding through four hydrogen bonds of intermolecular and intramolecular. The solubility performance of solid-state forms improved significantly. Compared with form I, form C and form D were 1.59, 1.49 times at pH 1.2 HCl, 1.59, 1.87 fold at pH 6.8 PBS. In particular, the SF-OA and SF-MA increased the apparent solubility of SF at pH 1.2 by 8.3 and 6.4 times, at pH 6.8 by 4.0 and 4.5 times respectively. The dissolution mechanisms were analyzed. New solid-state forms showed strong stability at storage conditions of 40 °C/75% RH and 60 °C/0% RH. Notably, the crystal of SF preferred to transform in mixed solvents, and the formation of co-crystals confirmed the ∆pKa rule.

The obtention of simple formulae for the Lebesgue constants arising in the the classical Fourier series approximation is presented. Both even and odd cases are treated enlarging Fejér result. Asymptotic formulae are also obtained.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

We present an analysis of high-resolution, near-infrared (NIR) spectra relative to the solar transit of Venus of 5-6 June 2012, as observed with the Facility Infrared Spectropolarimeter (FIRS) at the Dunn Solar Telescope in New Mexico. These observations offer the unique opportunity to probe the upper layers (between ∼84 and 150 km in altitude) of a thick, CO2-dominated atmosphere with the transmission spectroscopy technique – a proxy for future studies of highly-irradiated atmospheres of Earth-sized exoplanets. We were able to visually identify absorption lines from the two most abundant CO2 isotopologues, and from the main isotopologue of CO in the retrieved spectrum of Venus. Furthermore, we perform a cross-correlation analysis of the transmission spectrum using transmission templates generated with petitRADTRANS. With the cross-correlation technique, it was possible to confirm detections of both CO2 isotopologues and CO. Additionally, we retrieve a cross-correlation signal for O3 on Venus. We demonstrate the feasibility of high-resolution, ground-based observations to study the chemical inventory of planetary atmospheres, employing techniques commonly used in exoplanet characterization.

Monensin and essential oils have antimicrobial properties that may impact silage fermentation. The present study investigates the effects of monensin and essential oils as additives in the ensiling of total mixed ration (TMR). In the first assay, TMR was tested with sheep in growth (65% dry matter - DM) using the following treatments: control (no additive), MON35 (35 mg monensin/kg DM), MON45 (45 mg monensin/kg DM), ELO300 (300 mg essential oil/kg DM), and ELO600 (600 mg essential oil/kg DM). In the second assay, the same treatments were used in TMR for lactating cows under two moisture conditions (30% and 40% DM). The parameters assessed included fermentative losses, short-chain fatty acid profile, aerobic stability, chemical-bromatological composition, and in vitro DM digestibility of the silages. In the first assay, the treatments with ELO had the lowest pH values and the highest lactic acid concentrations, with treatment ELO600 leading to the highest aerobic stability (297.88 h). Only the starch contents of the ELO treatments were lower than the others. In the second assay, the silages with the highest moisture contents and ELO600 exhibited the lowest values of DM recovery, lactic acid, and pH. The highest lactic acid:acetic acid ratios were observed in the silages with the most moisture added with MON35 and MON45. The use of MON and ELO increased aerobic stability, with the highest values observed for ELO600 and MON35. The treatments with MON and ELO resulted in silages with the lowest fiber contents and highest ether extract and starch contents when compared with control. Thus, MON and essential oils improve fermentative quality but ELO should be used in lower doses in humid silages to avoid negative fermentation impacts.

Human T-cell lymphotropic virus (HTLV) infection lacks effective treatment. This review describes the virological, immunological and clinical outcomes of antiretroviral therapy (ART) in people with HTLV infection. This systematic review followed PRISMA reporting guidelines and was registered in PROSPERO: CRD42022350076. The Newcastle-Ottawa Scales, adapted for cross-sectional studies, and Rob-2 were employed to assess the methodological quality of studies. A systematic search was conducted in Medline (PubMed), Scopus (Elsevier), Cochrane Library, and Web of Science (Clarivate Analytics) databases. We retrieved data from 08 methodologically diverse articles, on treatment of patients infected by HTLV-1 or HTLV-2 alone, or coinfected by HIV-1 with Raltegravir, Tenofovir, Lamivudine and Zidovudine. Proviral load decreased in 3 of 7 studies, during 4 to 48 weeks of antiretrovirals use. Cellular immune response (CD4, CD8, CD25, CD69 and CD71 cells) were evaluated in six studies. There was no significant clinical improvement in the studies but all of them detected clinical stability during treatment. Despite the demonstrated antiviral activity of ART, in vitro, clinical improvement was not proven. Most studies showed disease stability during ART use, suggesting potential clinical benefits. There is a need of larger, well-controlled trials, to define the role of ART for treatment of HTLV infection.

Nowadays, the growing concern about improving thermal comfort in textiles, asphalt pavements and buildings has stimulated research into phase change materials (PCMs). However, the incorporation of PCMs directly causes mechanical impacts. Therefore, this study herein reported focuses on designing coaxial phase change fibres using commercial cellulose acetate (CA) or recycled CA obtained from cotton fabrics (CAt) as a coating and polyethylene glycol (PEG) 2000 as a core. The phase change fibres (PCF) were produced by wet spinning, varying the parameters: (i) CA concentration, molecular weight and source (virgin versus recycled); and (ii) PEG concentration and ejection. For phase change recycled fibres (PCFt), PEG concentration and ejection were varied. The fibres were assessed for their optical, chemical, thermal and mechanical properties. Bright-field microscopy images and Scanning Electron Microscopy (SEM) micrographs proved the coaxial structure. Fourier Transform Infrared spectroscopy (FTIR) confirmed the presence of PEG in the core. Thermogravimetric Analysis (TGA) proved the ability of PCFs to tolerate high temperatures. Differential Scanning Calorimetry (DSC) attested to the presence of PEG2000 peaks, since their melting points were close to those of virgin PEG2000, with a slight change in the PCFs and PCFts caused by the protective sheath of CA and CAt.

The popular appreciation of dry white wines is most frequently directed to young wines. However, present consumption trends comprise the valorisation of aged dry white wines. Therefore, the present work was aimed at the sensory analysis of these wines with different ages to define their sensory space and to understand which factors drive their quality evaluation by experienced tasters (critics, oenologists and students). Individuals were asked to evaluate several synthetic and aesthetic attributes and to characterise the analytic sensory profile through a Check-All-That-Apply (CATA) methodology. The quality evaluations were differently correlated with wine synthetic parameters according to the taster group. For both critics and oenologists, overall quality scores were driven by persistence and complexity. Moreover, quality was also highly correlated with power for critics and with balance for oenologists. Quality scores were highly correlated with wine browning (absorbance at 420 nm) for critics. The tasting panel showed a homogeneous analytic description of aroma, taste and mouthfeel consistent with wine age. The different ages could be associated to a continuous sensory space characterised by a decreasing perception of freshness and increase in mature and mellowed descriptors. All wines shared an austere in-mouth perception elicited by their acidity, saltiness, bitterness, smoothness and dryness. The age prediction showed that most tasters failed to guess the age wines with more than roughly 13 years old, indicating that tasters were not familiar with the sensory features of white wines with 17 to 46 years old. In conclusion, experienced tasters consistently described the sensory space and recognised the high quality of aged dry white wines. Education programs may use the defined sensory spaces according to aging and to expand the range of quality perception by consumers.

The development of electric aircrafts is becoming an important technology for achieving the goals set by the European Commission for the reduction of gases emissions by 2050 in the aeronautical transportation system. However, there is a gap between the values of specific power in commercial electric machines and the ones required for aeronautical applications. Therefore, the search for alternative materials and non-conventional designs is mandatory. One emergent solution is using superconducting machines and systems to overcome the current limits of conventional electrical machines. This work reviews the new hybrid and all-electric aircraft tendencies, complementing it with recent research on the design and development of high specific power superconducting machines. This includes the main topologies for hybrid and all-electric aircraft, with an overview of the ongoing worldwide projects of these types of aircrafts, systematizing the main characteristics of their propulsion systems. It also includes the research on superconducting machines for the purpose of high specific power, considering the impact on the redesign of aircraft systems in the electrical, cooling, and fuel source sense.

In this work, the influence of catalyst reuse and reaction time on the yield and quality of organic liquid products (OLP) obtained in a cracking pilot plant at 450 °C and 1.0 atm has been systematically investigated. The distillation of OLP produced 04 (four) distilled fractions. The quality of the biofuels was certified by physical-chemical analysis, as well as FT-IR and GC-MS analysis. The experimental results showed the feasibility of applying the spent sodium carbonate twice in catalytic cracking of vegetable oils. The physical-chemical properties (density, viscosity, acid value, saponification value, and flash point) of OLP decrease as the reaction time increases. The distillation of OLP yields 62.35% (wt.), producing green-like gasoline, kerosene, and diesel fractions rich in hydrocarbons. Therefore, biofuels-like fractions produced by distillation of OLP have a great potential for replacing partially petroleum derived fuels.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Surimi consists in a technique for concentrating myofibrillar proteins with gelling ability, which aims to make use of by-products from fish slaughter, such as bullfrog back, which can be basis for the manufacture of emulsified products. Due to the strategic need to develop clean label foods, products such as collagen have been reported as potential natural additives with bioactive properties. The objective was to elaborate a surimi from the mechanically separated bullfrog back and to develop an emulsion, replacing the soy lecithin used by hydrolyzed collagen, evaluating its emulsifying and antioxidant potential during 120 days of storage under freezing. Three meat emulsions were prepared: EC0 (100% soy lecithin), EC50 (50% soy lecithin + 50% collagen), and EC100 (100% collagen), which were subjected to analysis of chemical composition, emulsion stability, water holding capacity, luminosity, whiteness, texture profile, TBARS and antioxidant activity. Insertion of collagen increased whiteness, lightness, hardness, and chewiness values compared to the EC0, but showed greater fluid loss. All treatments showed stable WHC values (88 – 91%) over time. Replacement with collagen was satisfactory as an emulsifier and as an antioxidant, and the EC50 and EC100 treatments were not negatively affected in the investigated parameters.

Climate data are important in building a hydrological risk assessment model. The ClimInonda web application enables interactive and dynamic visualizations of different data collected from different weather stations in the study area on a single platform, allowing users to explore and analyze data in an easy way. This can assist decision-makers and stakeholders in understanding the current state of the environment and in identifying areas of flooding risk. Visualizations can include different types of data, such as satellite imagery, weather data, and terrain data, and can be displayed using various techniques, such as heat maps, contour maps, and 3D models by providing easy-to-understand visualizations. The different stations of the Gafsa and Kasserine governorates in the study area are included and other stations of the Algerian territory (Tebessa governorate) are incorporated. This web application also provides the capability to include each user's stations.

In the frame of a broader project, we were interested at comparing the amino acid profile in a specific variety of onion, Rossa da inverno sel. Rojo Duro, produced in two different Italian sites: Cannara (Umbria region) and Imola (Emilia Romagna region). In both places, onions were cultivated and harvested in the same way, and irrigated by water sprinkler method. A further group of Cannara onions, growth by microirrigation, was also evaluated. After the extraction of free amino acid mixture from onion samples, an ion-pairing RP-HPLC method allowed the separation and the evaporative light scattering detection of almost all underivatized proteinogenic amino acids. However, only the peaks corresponding to Leu, Phe, Trp, were present in all the investigated samples and unaffected from matrix interfering peaks. The application of the beeswarm/box plots with the ANOVA/TukeyHSD statistical approach revealed a content of Leu and Phe markedly influenced by the geographical origin of the onions, while not by the irrigation procedure. The developed HPLC method was validated in terms of specificity, linearity, LOD and LOQ, accuracy and precision, before the quantitative assay of Leu, Phe and Trp in the onion samples. Although further studies are necessary, these preliminary findings can represent a good starting point for considering the quantity of specific amino acids in the Rossa da inverno sel. Rojo Duro variety as a fingerprint of its geographical origin. In principle, the developed approach might be applied to other onion varieties, thus contributing to their characterization and traceability, also contributing to limit commercial frauds.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Subnational governments play a key role responding to climate change risks in terms of policy strategies and instruments. This article analyzes how Brazilian municipal and state governments have developed and implemented public policies to mitigate and to adapt to climate change risks. We surveyed all cities’ and states’ climate policies within the country. The methodological approach includes five main points of analysis: 1. mitigation targets and intentions; 2. adaptation actions; 3. stakeholders’ participation; 4. policy implementation; 5. participation in networks related to climate change. Our results suggest that even though subnational climate policies in Brazil are isolated initiatives within the national context, they play an important role responding to climate change risks in different scales and levels. The strongest Brazilian policies with both mitigation and adaptation actions counted on previous mobilization for the climate issue involving different stakeholders from several segments of the society. These governments have also participated in transnational cooperation networks related to climate change.

Academic publishing is undergoing a highly transformative process, and many rules and value systems that were in place for years are being challenged in unprecedented forms leading to the evolution of novel ways of dealing with new pressures. One of the most important aspects of an integrated and valid academic literature is the ability to screen publications for errors during peer review to weed out mistakes, fraud and inconsistencies, such that the final published product represents a product that has value, intellectually, and otherwise. It is difficult to claim the existence of perfect manuscripts. The level of errors that exist in a manuscript will depend on the rigor of the research group and of the peer review process that was used to screen that paper. When errors slip into a final published paper, either through honest error or misconduct, and are not detected during peer review and editorial screening, but are spotted during post-publication peer review, an opportunity is created to set the record straight, and to correct it. To date, the most common forms of correcting the literature have been errata, corrigenda, expressions of concern, and retractions. Despite this range of corrective measures, which represent artificially created corrals around pockets of imperfect literature, certain cases do not quite fit this mold, and new suggested measures for correcting the literature have been proposed, including manuscript versioning, amendments, partial retractions and retract and replace. In this commentary, a discussion of the evolving correction of the literature is provided, as are perspectives of the risks and benefits of such new measures to improve it.

Bone drilling is a common procedure used to create pilot holes for inserting screws to secure implants for fracture fixation. However, dis process can increase bone temperature, teh excessive heat can lead to cell death and thermal osteonecrosis, potentially causing early fixation failure or complications. We conducted a three-dimensional dynamic elastoplastic finite element model to evaluate teh propagation and distribution of heat during bone drilling and assess teh thermally TEMPeffected zone (TAZ) dat may lead to thermal necrosis. dis model investigates teh parameters influencing bone temperature during bone drilling, including drill diameter, rotational speed, feed force, and predrilled hole. Teh results indicate dat our FE model is sufficiently accurate in predicting teh temperature rise TEMPeffect during bone drilling. Teh maximum temperature decreases exponentially wif radial distance. When teh feed forces are 40 and 60 N, teh maximum temperature does not exceed 45 °C. However, wif feed forces of 10 and 20 N, both teh maximum temperature exceeds 45 °C wifin a radial distance of 0.2 mm, indicating a high-risk zone for potential thermal osteonecrosis. Wif teh two-stage drilling procedure, where a 2.5 mm pilot hole is pre-drilled, teh maximum temperature can be reduced by 14 °C. dis suggests dat higher feed force and rotational speed and/or using a two-stage drilling process could mitigate bone temperature elevation and reduce teh risk of thermal osteonecrosis during bone drilling.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

In this study, a new type of temperature sensor device was developed. The circular electrode of the thermal sensitive sensor was modified with TMT and O₂ plasma to enhance the conductivity by forming a thin SnOxCy layer on the electrode surface. The Nano-Au particles were subjected to O₂ plasma pretreatment to form peroxide groups on the surface. The thermally sensitive sensor was made by mixing the above-treated Nano-Au particles with N-isopropylacrylamide (NIPAAm) to form solution and then UV-induced grafting polymerization of the NIPAAm-containing solution onto the electrode substrate. The composite hydrogels on the electrode introduce thermo-sensitive polymeric surface films for temperature sensing. Using ambient environment resistance test to measure the resistance, the LCST (lower critical solution temperature) of Nano-Au (MUA) mixed with NIPAAm hydrogel was found to be 32 °C. At ambient temperatures higher than LCST, the electrode resistance decreases linearly.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Climate change in the coming decades could intensify extreme events such as severe droughts. Combined with the possible increase of water demands, these changes exert a large pressure on the water systems. In order to confirm this assumption, a set of scenarios was proposed in this study to consider the combined impact of climate changes and the increase in water demand on the main multiple-use reservoirs of São Francisco River, Brazil. For this purpose, five CMIP6 climate models were used considering two greenhouse gas emissions scenarios: the SSP2-4.5 and SSP5-8.5. The naturalized and withdraw streamflows were estimated to the adopted reser-voirs considering all existing, new and projected demands. The conjunction of scenarios indicat-ed an increase in Potential Evapotranspiration, a possible significant reduction in water availa-bility, a growth in water demand mainly for irrigation and a substantial reduction in the perfor-mance of the evaluated reservoirs.

Our aim was to determine the secondary antibody deficiency profiles of patients in a mesoregion of São Paulo state, Brazil, focusing on infectious diseases. Demographic characteristics, clinical and laboratory data were obtained from electronic files; infections were classified as organ-specific and graded as mild, moderate, life-threatening, and fatal. Non-Hodgkin lymphoma (NHL) accounted for 30% of patients, nephrotic syndrome (NS) 25%; chronic lymphocyte leukemia 20%, and multiple myeloma 15%. Patients with NS were younger than those in other groups, and hypo-γ-globulinemia was detected in 94.1%, IgG <400 mg/dL in 60.0%, IgA <40 mg/dL in 55.0%, and CD19 <20 cells/mm³ in 30.0%. One hundred and one infections were found; 82.1% were classified as mild or moderate, 7.9% as life-threatening, and 1.9% as fatal. Respiratory tract infections were more prevalent (41.5%), and pneumonia accounted for 19.8%. Lower levels of infections were found in patients with NS compared with NHL (P=0.0001). Most patients progressed to hypo-γ-globulinemia and secondary antibody deficiency after treatment with immunosuppressants, and mild and moderate infections were predominant. These therapies are increasing in patients with different diseases, therefore monitoring hypo-γ-globulinemia and infections may help to identify patients at high risk for severe complications, antibiotic prophylaxis or treatment, and immunoglobulin replacement

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

: Rasmussen’s encephalitis (RE) stands as a rare neurological disorder marked by progressive cerebral hemiatrophy and epilepsy resistant to medical treatment. Despite extensive study, the primary cause of RE remains elusive, while its histopathological features encompass cortical inflammation, neuronal degeneration, and gliosis. The underlying molecular mechanisms driving disease progression remain largely unexplored. In this case study, we present a patient with RE who underwent hemispherectomy and has remained seizure-free for over six months, experiencing gradual motor improvement. Further-more, we conducted molecular analysis on the excised brain tissue, unveiling a decrease in the expres-sion of cell cycle-associated genes coupled with elevated levels of BDNF and TNF-α proteins. These findings suggest potential involvement of cell cycle regulators in the progression of RE.

Climate change related increases in frequency and intensity of heatwaves affect viticulture, leading to losses in yield and grape quality. We assessed whether canopy architecture manipulation mitigates the effects of summer stress in a Mediterranean vineyard. Muscat of Alexandria grapevines were monitored during 2019-2020. Two canopy shoot positioning treatments were applied: Vertical shoot positioning (VSP); and Modulated shoot positioning (MSP), the west side upper foliage released to promote partial shoot leaning, shading the clusters. Clusters were sampled at pea size (PS), veraison (VER) and full maturation (FM). Measurements included rachis anatomy and hydraulic conductance, and aquaporins (AQP) and stress-related genes expression in cluster tissues. Results show significant seasonal and interannual differences in Kh and vascular anatomy. At VER, Krachis , Krachis+pedicels, and xylem diameter decreased but were unaffected by treatments. The Phloem/Xylem ratio was either increased (2019) or reduced (2020) in MSP, compared to VSP. Most AQP were down-regulated at FM in pedicels, and up-regulated at VER in pulp. A potential maturation shift in MSP was observed, confirmed by the up-regulation of several stress-related genes in all tissues. The study pinpoints the role of canopy architecture in berry water relations and stress response during ripening.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

The four-way reversing valve is a key component determining whether a heat pump air conditioning system can work. Studying the four-way reversing valve is of great significance for improving the performance of the heat pump air conditioning system. In this paper, the control equation of the sliding block movement process is constructed to simulate the reversing process of the four-way reversing valve in fluid mechanics, and a detailed study is carried out from the sliding block speed, sliding block acceleration, sliding block force, refrigerant leakage, and other aspects. Research has shown that optimizing the structure of the slider can greatly improve the working performance of the four-way reversing valve. Increasing the height of the slider not only improves the pressure relief ability of the four-way reversing valve and prevents the slider from being damaged by high-pressure gas impact, but also reduces the leakage of refrigerant during the directional process; When reducing the length of the slider, although it will improve the pressure relief capacity of the four-way reversing valve, it also increases the amount of refrigerant leakage. The research results provide a theoretical basis and improvement direction for designers to improve the performance of four-way reversing valves.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This study investigated the inhibitory effect of Siegesbeckia orientalis ethanolic extract (SOE) on growth and metastasis of hepatic tumors in C57BL/6JNarl mice, which is the model of tumor-igenesis induced by subcutaneous injection of Hepa1-6 murine hepatoma cells on the back of mice. Feeding 25 mg SOE/kg BW daily for 14 days effectively reduced the hepatoma weight in tu-mor-bearing mice by 59.7%. SOE intervention reduced the expression of anti-apoptotic Bcl-2 gene in tumor tissue by 48.5% and down-regulated the antioxidant system, by reducing the gene ex-pression of catalase (48.0%), glutathione peroxidase (46.3%), and superoxide dismutase (32.0%). In addition, SOE intervention increased the production of ROS by 21.4%, and the gene expression of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 by 135.3%, 179.3% and 91.7%, respectively, indicating that SOE intervention promoted the acute inflammatory response. Results of H&E staining analysis showed that SOE had the ability to inhibit angiogenesis in tumor tissue. Fur-thermore, SOE treatment inhibited the expression of migration-related genes, such as MMP-2, MMP-7, MMP-9 and β-catenin, and the inhibition rates were 24.8%, 27.4%, 10.4% and 21.9%, respectively. These results imply that SOE had the ability to suppress tumor metastasis. On the other hand, SOE intervention decreased the serum contents of inflammatory cytokines, such as TNF-α, IL-1β and IL-6 by 27.4%, 30.4%, and 30.7%, respectively, indicating that SOE intervention has an anti-inflammatory effect on normal tissues of mice. Since SOE intervention had no signif-icant effect on liver and kidney weights, and no mice died throughout the experiment, it shows that it is safe to feed SOE under this experimental condition. Based on the above results, SOE has a great potential to be used in the treatment of hepatoma.

The processed tomato is one of the major food products of Italy and characterized today many Italian Regions, in northern and southern Italy, even though the firms in the industry have had difficulties, in recent years, due to an increase in the cost of raw materials. Furthermore, tomato processing firms are often characterized by significant investment in fixed assets and working capital, with an consequent increase in equity and/or debt financing, with consequent increasing of the risk of bankruptcy, as happens to many firms in the sector in recent years. The aim of the research is than to analyze the risk of bankruptcy of tomato processing companies applying financial ratios. To achieve this goal, the research consider the annual data of a sample of 17 tomato processing firms operating in the Inter Regional Interprofessional Organization “OI Pomodoro da Industria Nord Italia”; firms’ data are divided into still-active (not-distressed) and failed (distressed) firms, with the aim of analyzing the differences between financial data and management practices of the two groups of firms to evaluate the sustainability of the business cycle. The company data suggest that larger firms, with adequate financial structure, have been able to withstand the tomato market crisis in recent years, where distressed firms are on average smaller and suffer from a higher recourse to debt capital with lower profit margins than not-distressed firms. The research could then be applied by entrepreneurs, managers, bankers and public operator to define good practices of management to be achieved and measured with financial ratios even in order reduce the risk of distress for firms operating in tomato sector.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

The World Health Organization has defined the outbreak of the new coronavirus as a public health emergency of international concern. The average age of patients affected by the disease caused by the virus ranges from 49 to 59 years. The symptoms of coronavirus disease 2019 (COVID-19) infection include fever, cough, acute respiratory disease, and, in severe cases, the disease may progress to pneumonia and renal failure that may lead to death. Many oral and maxillofacial hospital procedures produce aerosol and droplets contaminated by blood, bacteria, and viruses. The purpose of this study is to gather recommendations from health authorities and scientific articles in order to educate surgeons regarding the procedures to assist and treat in oral and maxillofacial surgeries. The objective is to prevent the transmission of COVID-19 during the treatment of patients in urgent and emergency situations. The study’s methodology used the guidelines provided by the Brazilian College of Oral and Maxillofacial Surgery, in addition to the recommendations and epidemiologic data from national and international health authorities. The implementation of special precautions in oral and maxillofacial surgeries may elucidate questions related to the transmission of the disease by asymptomatic carriers and help control the spread of the virus.

Dengue virus serotype 2 (DENV-2) is responsible for dengue epidemics on a global scale and is recognized for being associated with severe cases of the disease. This study conducted the phylogenetic investigation of DENV-2 in the Northern region of Brazil. DENV-2 isolates from 2017 to 2021, originating from Northern Brazilian states, were selected. Only one lineage (I) of the Asian-American genotype and one lineage (5) of the cosmopolitan genotype were observed. All sequences of the Asian-American genotype used in this study were segregated into a paraphyletic subgroup aligned with sequences from an American clade. These results indicate a probable geographic link starting from Puerto Rico. Additionally, sequences from Acre were identified and grouped into a monophyletic clade of the cosmopolitan genotype. These results indicate the cocirculation of two DENV-2 distinct lineages: Lineage 1, Asian-American genotype (probable origin from Puerto Rico); Lineage 5, cosmopolitan genotype (probable origin from Peru). Our results provide important data regarding the study of DENV genotypes and lineages distribution, as well as opening up possibilities for probable introduction and dissemination routes.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The viewpoint and reaction of a country towards climate change are shaped by its political, cultural, and scientific backgrounds, in addition to the distinct characteristics of its evolving climate and the anticipated and actual consequences of the phenomenon in the times ahead. A region's climate has a significant impact on how water is managed and used, mostly in the primary sector (agroforestry systems, livestock, and agriculture), and both the distribution of ecosystem types and the amount and spreading of species on Earth. As a result, the environment and agricultural practices are affected by climate, so evaluating both distribution and evolution is extremely pertinent. Towards this aim, the climate distribution and evolution in the S. Francisco River basin (SFRB) is assessed in three periods (1970−2000, 1981−2022) in the past and 20412060 in the future from an ensemble of GCMs under two SSPs (Shared Socioeconomic Pathways), SSP2-4.5 and SSP5-8.5. The Köppen-Geiger (KG) climate classification system is analyzed, and climate change impacts are inferred for this watershed located in central-eastern Brazil, covering an area equivalent to 8% of the country. Results predict the disappearance of the hot-summer (Csa) and warm-summer (Csb) Mediterranean climates, and a reduction/increase in the tropical savanna with dry winter (Aw)/dry summer (As). A striking increase in the semi-arid hot (BSh-steppe) climate is predicted with a higher percentage (10%) under SSP5-8.5. The Source and the mouth of SFRB are projected to endure the major impacts of climate change that is followed by a predicted increase/decrease in temperature/precipitation. Future freshwater resource availability, and quality for human use will all be impacted. Consequences on ecosystems, agricultural and for the socioeconomic sectors within the SFRB might deepen the current contrasts between regions, urban and rural areas, and even between population groups, thus translating to a larger extent, the inequality that still characterizes Brazilian society. Maps depicting land use and cover changes in the São Francisco River basin from 1985 to 2022 highlight tendencies such as urbanization, agricultural expansion, deforestation, and changes in shrubland and water bodies. Urban areas fluctuated slightly, while cropland significantly increased from 33.57% to 45.45%, and forest areas decreased from 3.88% to 3.50%. Socioeconomic data reveals disparities among municipalities: 74.46% with medium Human Development Index (HDI), 0.59% with very high HDI, and 9.11% with low HDI. Most municipalities have a Gross Domestic Product (GDP) per capita below US$ 6,000. Population distribution maps show a predominance of small to medium-sized urban and rural communities, reflecting the basin's dispersed demographic and economic profile. To build routes towards a shared sustainable goal—namely, to adapt and reduce the expected climate change impacts in SFRB—it is imperative that integrated measures be conducted with the cooperation of stakeholders, local population, and decision-makers.

As part of a project ordered by the Ministry of Science, Technology and Innovation of Brazil, an assessment of Brazilian biological collections was conducted by the Brazilian Societies of Botany, Microbiology, Virology and Zoology to obtain data on the current state of these collections. The goal was to provide subsidies for future public policies, including financial support and prioritization policies. Herein, we present the results of the microbiological collections, which play a fundamental role in the ex situ conservation of biodiversity and support research, development and innovation. A survey was sent to public and private institutions in Brazil and answered by 168 microbiological collections from 79 different institutions. Among these, 73 comprise public research institutions and universities, demonstrating the State's importance in preserving and safeguarding Brazilian microbial diversity. The main taxonomic groups are bacteria (present in 70.24% of the collections) and fungi (52.98% of the collections) from different Brazilian ecosystems and biomes, including several type strains. Furthermore, the collections preserve microorganisms with biotechnological potential for application in environmental protection, public health, industry, and agribusiness. However, despite all these economic and biotechnological potentials, the data analysis showed serious limitations and fragilities, especially regarding physical infrastructure and human resources, and raises alerts about the risk that Brazilian collections are subjected to.

A dioxomolybdenum catalyst [(MoO2Cl2-O-MoO2Cl2)(L)] (1) (with L (1S,2S)-N,N´-bis(2-pyridinecarboxamide)-1,2-cyclohexane) was prepared and used as catalyst for the desulfurization of a multicomponent model fuel containing the most refractory sulfur compounds in real fuels. This complex showed to have a high efficiency to oxidize the aromatic benzothiophene derivative compounds present in fuels, mainly using a biphasic 1:1 model fuel/MeOH system. This process conciliates catalytic oxidative and extractive desulfurization, occurring the oxidation of the sulfur compounds in the polar organic solvent. The oxidative catalytic performance of (1) showed to be influenced by the presence of water in the system. Using 50% aq. H2O2 it was possible to reuse the catalyst and the extraction solvent MeOH during ten consecutive cycles without loss of desulfurization efficiency.

Tellurium exhibits exceptional intrinsic electronic properties. However, investigations into the modulation of tellurium's electronic properties through physical modification are notably scarce. Here, we present a comprehensive study focused on the evolution of the electronic properties of tellurium crystal flakes under plasma irradiation treatment by employing conductive atomic force microscopy and Raman spectroscopy. The plasma-treated tellurium experienced a process of defect generation through lattice broken. Prior to the degradation of electronic transport performance due to plasma irradiation treatment, a remarkable observation emerged: in the low-energy region of hydrogen plasma-treated tellurium, a notable enhancement in conductivity was unexpectedly detected. The mechanism underlying this enhancement in electronic transport performance was thoroughly elucidated by comparing it with the electronic structure induced by argon plasma irradiation. This study not only fundamentally uncovers the effects of plasma irradiation on tellurium crystal flakes, but also unearths an unprecedented trend of enhanced electronic transport performance at low irradiation energies when utilizing hydrogen plasma. This abnormal trend bears significant implications for guiding the prospective application of tellurium-based 2D materials in the realm of electronic devices.

Objectives: Robotic bilateral axillary breast approach (BABA) thyroid surgery began in 2008 and is now one of the most widely used remote-access thyroid surgeries worldwide. This study aimed to analyze the results of 500 robotic BABA thyroid surgeries performed in a single institution in Korea compared with open thyroid surgery. Methods: From December 2018 to March 2020, 502 robotic BABA thyroidectomies (RTs) and 531 conventional open thyroidectomies (OTs) were performed in our institution by a single endocrine surgeon. We retrospectively reviewed patient medical records and performed a comparative analysis of OT and RT. Results: The RT group was younger (43.41±11.41 versus 54.28±13.41 years, p<0.001) and had a higher proportion of females (84.3% versus 69.3%, p<0.001), a lower BMI (24.66±3.97 versus 25.83±4.07 kg/m2), a higher proportion of lobectomies (52.6% versus 45.2%) and a lower proportion of lateral neck dissections (3.4% versus 10.0%, p<0.001). The RT group had a lnger operation time (145.33±40.80 versus 93.39±43.55 minutes, p<0.001) and higher surgical cost. Although the OT group had a larger tumor size and higher proportion of extrathyroidal extension, the numbers of retrieved lymph nodes were not significantly different between the two groups. Additionally, there was no difference in the stimulated thyroglobulin level before radioactive iodine therapy (7.01±35.73 versus 8.39±58.77, p=0.782). The rates of transient vocal cord palsy and transient hypoparathyroidism were significantly lower in the RT group, and those of scar-related complications were higher in the OT group. Conclusion: Robotic BABA thyroid surgery has advantages not only in better cosmetic outcomes but also in lower rates of vocal cord palsy and hypoparathyroidism, with comparable lymph node retrieval and serum thyroglobulin levels.

Organophosphate pesticides (OPs) are toxic substances that contaminate aquatic environments, interfere with the development of the nervous system, and induce Neurodevelopmental Toxicity (NDT) in animals and humans. The canonical mechanism of OP neurotoxicity involves the inhibi-tion of acetylcholinesterase (AChE), but other mechanisms non-AChE are also involved and not fully understood. We used network toxicology and molecular docking to identify molecular targets and toxicity mechanisms common to OPs. Targets related to diazinon-oxon, chlorpyrifos oxon, and paraoxon OPs were predicted using the Swiss Target Prediction and PharmMapper databases. Targets related to NDT were compiled from GeneCards and OMIM databases. In order to construct the protein-protein interaction (PPI) network, the common targets between OPs and NDT were imported into the STRING. Networks topological analyses identified EGFR, MET, HSP90AA1, and SRC as hub nodes common to the three OPs. Using Reactome pathway and gene ontology we found that signal transduction, axon guidance, cellular responses to stress, and glutamatergic signaling activation play key roles in OP-induced NDT.

Perovskite based solar cells have achieved tremendous progress reaching record efficiency in the past 5 years. Numerous new processes and chemistry have been reported and contribute to the perovskite rapid progress. Continuous efficiency improvements are still necessary for perovskite solar cells, and an exploratory data analysis on devices performance over multiple studies could boost the technology development. Such analysis could identify patterns or provide insights that are not obvious in a single study. Here we present a high quality dataset containing only independently certified Pb-based perovskite solar cells summarizing their efficiency, relevant I-V metrics, manufacturing processes and materials used. Analysis over the dataset provides insights on how aperture size, perovskite deposition methods and materials used in each functional layer affect the final solar cell efficiency and I-V metrics. Future directions are also suggested for efficiency improvements.

Public safety and intelligent surveillance systems critically depend on anomaly behavior detection for effective monitoring. In real-world pedestrian detection scenarios, prevalent challenges such as missed detections, complex background interference, and small target sizes hinder accurate anomaly identification. To address these issues, this study introduces YOLO-ABD, a lightweight method for anomaly behavior detection that integrates small target detection and channel shuffling. This method employs YOLOv8n as the baseline model, incorporating a small target detection mechanism in the Head part and utilizing GSConv convolution in the Backbone to enhance perceptual capability. Additionally, the SimAM attention mechanism is integrated to mitigate complex background interference, thereby improving target detection performance. Evaluation on the IITB-Corridor dataset demonstrated mAP50 and mAP50-95 scores of 89.3% and 60.6%, respectively. Generalization testing on the street-view-gdogo dataset further highlighted the superiority of YOLO-ABD over advanced detection algorithms, underscoring its effectiveness and generalizability. With a relatively small parameter count, YOLO-ABD presents an excellent lightweight solution for pedestrian anomaly behavior detection.

The spin-torsion theory is a gauge theory approach to gravity that expands upon Einstein's general relativity (GR) by incorporating the spin of microparticles. In this study, we further develop the spin-torsion theory to examine spherically symmetric and static gravitational systems that involve free-falling macroscopic particles. We posit that the quantum spin of macroscopic matter becomes noteworthy on cosmic scales. We further assume that the Dirac spinor and Dirac equation adequately capture all essential physical characteristics of the particles and their associated processes. A crucial aspect of our approach involves substituting the constant mass in the Dirac equation with a scale function, allowing us to establish a connection between quantum effects and the scale of gravitational systems. This mechanism ensures that the quantum effect of macroscopic matter is scale-dependent and diminishes locally, a phenomenon not observed in microparticles. For any given matter density distribution, our theory predicts an additional quantum term, the quantum potential energy (QPE), within the mass expression. QPE induces time dilation, distance contraction, and thus mimics a gravitational well. When applied to cosmology, our theory yields a static cosmological model. The QPE serves as a counterpart to the cosmological constant introduced by Einstein to balance gravity in his static cosmological model. The QPE also offers a plausible explanation for the origin of the Hubble redshift (traditionally attributed to the universe's expansion). The predicted luminosity distance-redshift relation aligns remarkably well with SNe Ia data from the cosmological sample of SNe Ia. In the context of galaxies, QPE functions as the equivalent of dark matter. The predicted circular velocities align well with the rotation curve data from the SPARC (Spitzer Photometry and Accurate Rotation Curves database) sample. Importantly, our conclusions in this paper are reached through a conventional approach, with the sole assumption of the quantum effects of macroscopic matter on large scales, without the need for additional modifications or assumptions.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Almost two decades ago, Ernesto P. Borges and Bruce M. Boghosian embarked on the intricate task of composing a manuscript to honor the profound contributions of Constantino Tsallis to the realm of statistical physics, coupled with a concise exploration of q-Statistics. Fast forward to Constantino Tsallis’ illustrious 80th birthday celebration in 2023, where Deniz Eroglu and Ugur Tirnakli delved into Constantino’s collaborative network, injecting renewed vitality into the project. With hearts brimming with appreciation for Tsallis’ enduring inspiration, Eroglu, Boghosian, Borges and Tirnakli proudly present this meticulously crafted manuscript as a token of their gratitude.