In the paper, a fully discrete compact difference scheme with $O(\tau^{2}+h^{4})$ precision is established by considering the numerical approximation of the one-dimensional Allen-Cahn equation. The numerical solutions satisfy discrete maximum principle under reasonable step ratio and time step constraint is proved. And the energy stability for the fully discrete scheme is investigated. An example is finally presented to show the effectiveness of scheme.

The changing of land use and land cover (LULC) are both affected by climate and human activity and affect climate, biological diversity, and human well-being. Accurate and timely information about the LULC pattern and change is crucial for land management decision-making, ecosystem monitoring, and urban planning, especially in developing economies undergoing industrialization, urbanization, and globalization. Biodiversity degradation and urban expansion in eastern China are research hot-spots. However, the influence of LULC changes on the region remains largely unexplored. Here, an object-based and multi-temporal image analysis approach was developed to detect how LULC changes during 1985-2015 in the Tiaoxi watershed (Zhejiang province, eastern China) using Landsat TM and OLI data. The main objective of this study is to improve the accuracy of unsupervised change detection from object-based and multi-temporal images. To this end, a total of seven LULC maps are generated with multi-temporal images. A random stratified sample design was used for assessing change detection accuracy. The proposed method achieved an overall accuracy of 91.86%, 92.14%, 92.00%, and 93.86% for 2000, 2005, 2010, and 2015, respectively. Nevertheless, the proposed method, in conjunction with object-oriented and multi-temporal satellite images, offers a robust and flexible approach to LULC changes mapping that helps with emergency response and government management. Urbanization and agriculture efficiency are the main reasons for LULC changes in the region. We anticipate that this freely available data will improve the modeling for surface forcing, provide evidence of changes in LULC, and inform water-management decision-making.

Natural products are an important source of antibacterial agents. Canthin-6-one alkaloids have displayed potential antibacterial activity based on our previous work. In order to improve the activity, twenty-two new 3-N-benzylated 10-methoxy canthin-6-ones were designed and synthesized through quaternization reaction. The in vitro antibacterial activity against three bacteria was evaluated by double dilution method. Four compounds (6f, 6i, 6p and 6t) displayed 2-fold superiority (minimum inhibitory concentration (MIC) = 3.91 µg/mL) against agricultural pathogenic bacteria R. solanacearum and P. syringae than agrochemical propineb. Moreover, the structure–activity relationships (SARs) were also carefully summarized in order to guide the development of antibacterial canthin-6-one agents.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Excitotoxicity related to the dysfunction of the N-methyl-d-aspartate receptor (NMDAR) has been indicated to play an integral role in the pathophysiology of multiple disease states, including neurodegenerative disorders such as Parkinson’s disease. There is a notable gap in the market for novel NMDAR antagonists, however current methods to analyze potential antagonists rely on indirect measurements of calcium flux and hazardous radioligand binding assays. Recently, a fluorescent NMDAR ligand, N-adamantan-1-yl-dimethylamino-1-naphthalenesulfonic acid, known as AM-DAN was developed by our group. Additional studies on this ligand is necessary to evaluate its potential as a biological tool in NMDAR research. Therefore, this study was aimed at conducting structural analyses, fluorescence experiments, high-accuracy NMDAR molecular modelling and NMDAR phencyclidine (PCP) site competition binding studies using AM-DAN. Results revealed that AM-DAN has appropriate structural properties, significant fluorescent ability in various solvents and is able to bind selectively and compete for the PCP-binding site of the NMDAR. Therefore, AM-DAN holds promise as a novel fluorescent ligand to measure the affinity of prospective drugs binding at the NMDAR PCP-site and may circumvent the use of radioligands.

Sediment transport is highly sensitive to flow conditions, showing significant increase during flood events. Based on this principle, this study set out to rank flood events occurring along river Trotuș (Romania) based on the amount of transported sediment and event duration. The 77 flood events recorded from 2000 to 2017 were ranked into 4 classes: type A (4%); type B (16%), type C (14%) and type D (66%). The sediment transport specific for the 4 types of flood events was related to the flow discharge (sediment rating curve and hysteresis effect), the specific stream power and the energy expenditure of these events. More than 60% of the hysteresis loops typical for flood events were clockwise, thus singling out the channel as the main sediment source. Ca. 74% of the total sediment yield was transported at stream power values higher than the 300 Wm-2 threshold, which was exceeded in less than 1% of the investigated timeframe. The changes occurring in the sediment transport rates after major floods show that these events are significant thresholds in the hydrogeomorphic evolution of river channels.

In South Sudan, three case-control studies found a positive association between Nodding Syn-drome (NS) and a Mansonella perstans infection. To investigate whether M. perstans could play the primary and sole causal role in the development of NS, we examined blood films of persons with and without epilepsy in rural villages affected by NS in Mahenge, Tanzania, to identify M. perstans infections. Study participants were also examined for onchocercal nodules and skin lesions and tested for the presence of anti-O. volvulus antibodies (Ov16 ELISA). One hundred and thirteen epilepsy cases and 132 controls were enrolled, with a mean age of 28.3 years (interquartile range 22 – 34 years); 125 (51%) were females. Of the persons with epilepsy, 43 (38.1%) met the probable NS criteria. M. perstans infection was absent in all participants, but Ov16 prevalence and oncho-cerciasis-associated skin manifestations were positively associated with epilepsy, including probable NS. Onchocercal nodules in the mothers of cases were also positively associated with epilepsy. In conclusion, in contrast with O. volvulus, M. perstans is likely not endemic in Mahenge and therefore cannot be a co-factor for NS in the area. Hence, this filaria cannot be the primary and sole causal factor in the development of NS.

This work (in two parts) will review the recently developed predictive modeling methodology called “4th-BERRU-PM” and its applicability to energy systems as exemplified by an illustrative application to the Polyethylene-Reflected Plutonium (acronym: PERP) OECD/NEA reactor physics benchmark. The acronym 4th-BERRU-PM designates the “Fourth-Order Best-Estimate Results with Reduced Uncertainties Predictive Modeling” methodology, which yields best-estimate results with reduced uncertainties for the first fourth-order moments (mean values, covariance, skewness, and kurtosis) of the optimally predicted posterior distribution of model results and calibrated model parameters. The 4th-BERRU-PM uses the Maximum Entropy (MaxEnt) principle to incorporate fourth-order experimental and computational information, including fourth (and higher) order sensitivities of computed model responses to model parameters, thus incorporating, as particular cases, the results previously predicted by the second-order predictive modeling methodology 2nd-BERRU-PM, and vastly generalizing the results produced by extant data assimilation and data adjustment procedures. The 4th-BERRU-PM methodology encompasses the scopes of high-order sensitivity analysis (SA), uncertainty quantification (UQ), data assimilation (DA) and model calibration (MC). The application of the 4th-BERRU-PM methodology to energy systems is illustrated by means of the above-mentioned OECD/NEA reactor physics benchmark, which is modeled using the neutron transport Boltzmann equation involving 21976 imprecisely known parameters, the solution of which is representative of “large-scale computations.” The model result (“response”) of interest is the leakage of neutrons through the outer surface of this spherical benchmark, which can be computed numerically and measured experimentally. Part 1 of this work illustrates the impact of high-order sensitivities, in conjunction with parameter standard deviations of various magnitudes, on the determination of the expected value and variance of the computed response in terms of the first four moments of the distribution of the uncertain model parameters. Part 2 of this work will illustrate the capabilities of the 4th-BERRU-PM methodology for combining computational and experimental information, up to and including forth-order sensitivities and distributional moments, for producing best-estimate values for the predicted responses and model parameters while reducing their accompanying uncertainties.

The article discusses early diagnosis and intervention for developmental delays in children, emphasizing the role of specialized services and personnel in supporting recovery and development. It presents findings from a pilot project initiated in Bucharest, aiming to assess the incidence of developmental delays in children aged 1-3 years in selected kindergartens, including ASD. The study involved children, parents, and specialists, utilizing systematic behavior observation (SBO) and semi-structured interviews. Results indicate that out of 613 evaluated children, 81 received specialized control recommendations, with 4 cases showing potential risk of ASD. Additionally, 8 children were diagnosed with autism. The incidence of autism in children aged 1-3 years was 1 in 51. Although exploratory, these findings suggest a model of good practice for future early diagnosis campaigns nationally. Conclusively, the study underscores the importance of early diagnosis and intervention for developmental delays, advocating for a responsive community and emphasizing the significance of national-level efforts to address these issues effectively.

In the past decade, targeted therapies for solid tumors, including non-small cell lung cancer (NSCLC), have advanced significantly, offering tailored treatment options for patients. However, individuals without targetable mutations pose a clinical challenge, as they may not respond to standard treatments like immune-checkpoint inhibitors (ICIs) and novel targeted therapies. While the mechanism of action of ICIs seems promising, the lack of a robust response limits their widespread use. Although the expression levels of programmed death ligand 1 (PD-L1) on tumor cells are used to predict ICI response, identifying new biomarkers, particularly those associated with the tumor microenvironment (TME), is crucial to address this unmet need. Recently, inflammatory cytokines such as interleukin-1 beta (IL-1β) have emerged as a key area of focus and hold significant potential implications for future clinical practice. Combinatorial approaches of IL-1β inhibitors and ICIs may provide a potential therapeutic modality for NSCLC patients without targetable mutations. In this review, we discuss the role of IL-1β in NSCLC, its involvement in inflammatory pathways, and explore its potential role in the treatment of NSCLC.

Incident rates of neurodegenerative diseases have steadily increased globally, but there is no therapeutic access available. We newly prescribed medicinal herbal remedy including five different herbal plants called, Chen-Ma-Dan-Sam-Ga-Mi-Bang (CMST), purposed to prove for pharmacological properties and corresponded actions on hippocampus neuronal cell injury by hypoxia-induced mice model. Mice were adapted to normoxia or hypoxia with or without CMST for 5 days. We gathered pharmacological effects of CMST on cell injury by enhancement of dihydroethidium and 4-hydroxynonenal signals which were correlated with abnormal redox status in the protein or gene expression levels (abnormal elevations of nitric oxide, reactive oxygen species, lipid peroxidation and deteriorations of total glutathione, total antioxidant capacity, and activities of superoxide dismutase and catalase) due to hypoxia. CMST also notably exerted to attenuates molecules for neuronal cell injury markers such as p-tau, cleaved caspase-3 due to DNA oxidations (53bp1and phosphor-histone H2AX), inflammatory cytokines, and hemeoxigenase-1. We further figured out the underlying actions of CMST by in vitro experiment through inactivation of microglial cell which can mediate neuronal cell injury. Collectively, CMST prevented from hippocampal neuronal cells via inactivation of microglial cell with normalization of redox status on hypoxia-induced hippocampus neuronal cell injury.

Wearable exoskeleton solutions for upper limb rehabilitation or assistance, particularly for the hand area, have become increasingly attractive to researchers, proving to be effective over time in treating hand movement impairments following various neurological diseases. In the present work, the development of a wearable exoskeleton-type device for active hand rehabilitation has been addressed, based on fluid actuators made of elastomeric material and on myoelectric control by capturing myoelectric signals from the forearm area. The flexion movement of the fingers (phalanges) is actively assisted by pneumatic actuation of the built-in actuators and the extension movement is assisted by a depressurization control of the actuator. The device has been designed to be as easy to use as possible, light in weight, and to provide a high degree of comfort when used by the patient for rehabilitation training or daily life activities (ADL), which can be performed in the comfort of one's own home.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Despite the partial disclosure of driving scenario knowledge graphs, they still fail to meet the comprehensive needs of intelligent connected vehicles for driving knowledge. Current issues include the high complexity of pattern layer construction, insufficient accuracy of information extraction and fusion, and limited performance of knowledge reasoning models. To address these challenges, a hybrid knowledge graph method was adopted in the construction of the Driving Scenario Knowledge Graph (DSKG). Firstly, core concepts in the field were systematically sorted and classified, laying the foundation for the construction of a multi-level classified knowledge graph top-level ontology. Subsequently, by deeply exploring and analyzing the Traffic Genome data, 34 entities and 51 relations were extracted and integrated with the ontology layer, achieving the expansion and updating of the knowledge graph. Then, in terms of knowledge reasoning models, an analysis of the training results of the TransE, Complex, Distmult, and Rotate models in the entity linking prediction task of DSKG revealed that the Distmult model performed the best in metrics such as hit rate, making it more suitable for inference in DSKG. Finally, a standardized and widely applicable Driving Scenario Knowledge Graph was proposed. The DSKG and related materials have been publicly released for use by industry and academia.

This work presents the mathematical framework of the Second-Order Comprehensive Adjoint Sensitivity Analysis Methodology for Response-Coupled Forward/Adjoint Linear Systems (abbreviated as “2nd-CASAM-L”), which enables the most efficient computation of exactly obtained mathematical expressions of first- and second-order sensitivities of a generic system response with respect to functions (“features”) of model parameters. Subsequently, the first- and second-order sensitivities with respect to the model’s uncertain parameters, boundaries, and internal interfaces are obtained analytically and exactly, without needing large-scale computations. Within the 2nd-FASAM-L methodology, the number of large-scale computations is proportional to the number of model features (defined as functions of model parameters), as opposed to being proportional to the number of model parameters, which are considerably more than the number of features, being incomparably more efficient and more accurate than any other methods (statistical, finite differences, etc.) for computing exact expressions of response sensitivities (of any order) with respect to the model’s features and/or primary uncertain parameters, boundaries, and internal interfaces. The application of the 2nd-CASAM-L methodology is illustrated using a simplified energy-dependent neutron transport model of fundamental significance in nuclear reactor physics.

EGFR tyrosine kinase inhibitors (TKIs) are the preferred initial treatment for non-small cell lung cancer (NSCLC) patients harboring EGFR mutations. However, remission is transient, and no further effective treatment options are available for EGFR-TKI-advanced EGFR-mutant NSCLCs. Immunotherapy with immune checkpoint inhibitors (ICIs) induces sustained cancer remission in a subset of NSCLCs. However, ICI therapy exhibits limited activity in most EGFR-mutant NSCLCs. Mechanistically, the strong oncogenic EGFR signaling in EGFR-mutant NSCLCs contributes to the non-inflamed tumor immune microenvironment (TIME), characterized by a limited number of CD8+ T cell infiltration, a high number of regulatory CD4+ T cells and a high number of inactivated infiltrated T cells. Besides, EGFR-mutant NSCLC patients are generally non-smokers with low levels of PD-L1 expression and tumor mutation burden. However, current understanding only partially explains why a small population of EGFR-mutant NSCLCs durably respond to ICI therapy, resulting in many researchers actively working in this field. This review reviews the hope seen from pre-clinical studies and clinical trials which may be adopted to improve the outcome of ICI therapy in EGFR-mutant NSCLCs. Besides, the underlying mechanisms leading to the inferior clinical outcome of ICI therapy in EGFR-mutant NSCLCs are discussed.

In intermediary metabolism, enzymes are mainly for the specific provision of one small molecule from another, B from A, for its further use. But there are also decades of work relating to another evolved purpose, which is to prevent untoward effects of odd compounds of various origins, and of ordinary intermediates, whose improper concentrations may be avoided by hydrolases and other activities of metabolic correction.

Effective discharge, which represents the flow, or range of flows, that transport the most sediment over long term, was determined based on the mean daily flow discharge and mean daily suspended sediment discharge recorded between 1994 and 2014 at four gauging stations along the Trotuș River. This study proposes an efficient method for the estimation of effective discharge based on observed values of the suspended sediment load. By employing this method the suspended sediment load is no longer either under- or overestimated as in the cases when the assessment is based on sediment rating curves. The assessment on effective discharge was performed at two distinct levels: for the entire data series during the investigated time spans and, subsequently, for flows less than the bankfull discharge. The effectiveness curves of the suspended sediment transport characteristics revealed highly multimodal characteristics with many peaks, indicating ample ranges for the effective discharges. The main effective discharge corresponded to large flood events, which are typical for the upper end of the discharge range, whereas the secondary effective discharges corresponded to sub-bankfull flows, which are more frequent. The changes that occurred in the channel bed are reflected by the temporal variations in the effective discharge.

Fully mechanized mining face production involves complex geological conditions; mining pressure; gas, water, fire and other mining environments. The working face needs a shearer, hydraulic support, a scraper conveyor and other equipment for coordination. The deep integration of intelligent technology with factors such as "humans, machines, the environment, and management" in the workplace is the core content of intelligent coal mines. This paper puts forward an advanced framework for coal mining robot technology systems, including single robots, robotized equipment, robot clusters and unmanned systems. The framework clarifies the common key technologies of coal mining robot research and development and cross-integration with new technologies such as 5G, the industrial internet, big data, artificial intelligence, and digital twins to improve the autonomous and intelligent application of coal mining robots. By establishing a scientific and complete standard system for coal mining robots, we aim to achieve customized research and development and standardized production of various types of robots. A specific analysis was conducted on the research progress of common key technologies such as explosion-proof design, mechanical system innovation, power drive, intelligent sensing, positioning and navigation, and underground communication of coal mining robots. The current research and application status of various types of coal mining robots in China are summarized. A new direction for future coal mine robot research and development is proposed. Moreover, robotic mining systems should be promoted to enhance the overall intelligence level and mining efficiency of mining equipment. To develop human‒machine environment-integrated robots to improve the autonomy and collaboration level of coal mining robots. The digital twinning of the entire mine robot system should be accelerated, the normalized operation level of coal mine robots should be improved, research on coal mining robots, support robots, and transportation robots should be carried out, intelligence should be achieved in fully mechanized mining faces, and equipment support for fewer and unmanned fully mechanized mining faces should be provided. The practical process of implementing coal mining robotization has been summarized, and the technical and engineering feasibility of the coal mining machine population has been verified.

Work on callings has burgeoned in the past 20 years, yet recent reviews exposed a lack of conceptual clarity and disagreements around its definition, components and measures. One lingering point of contention revolves around the element of prosociality: Is a calling orientation primarily motivated by self-interest, prosocially orientated, or a mix of both? This conceptual paper reviews and examines the pro-self and prosocial component of a calling outlook, by examining and comparing the ways in which they feature in different calling subtypes: Classic, neoclassic, and modern callings. Our analysis suggests that these subtypes vary in where they are located on a pro-self – prosocial continuum: Classic callings are located on the prosocial side of the axis, modern callings are located on pro-self side of the axis, and neoclassic callings can be situated in the middle of the con-tinuum, integrating self-orientated and other-orientated motivations. Our analysis further suggests that these calling subtypes draw on divergent value systems: Classic callings are propelled by self-transcendent values, modern callings are driven by self-actualization motivations, and neoclassic callings integrate both value systems. We therefore argue that the subjective experiences of pursuing a calling within each subtype pathway differ, alt-hough they may culminate in similar outcomes. The paper offers a novel framework for analyzing people’s calling that draws on their values.

This paper utilizes dynamic panel threshold technology to conduct a nonlinear test on the direct effect between environmental regulation and economic fluctuations and the effect of industrial structure upgrading by taking 35 industrial sectors in China from 2003 to 2016 . The research has found that there is an inverted "U" relationship between environmental regulation and economic fluctuations, with the enhancement of environmental regulations, the economic fluctuation increases first and then decreases. The cross-terms of environmental regulation and industrial structure rationalization or industrial structure upgrading are significantly negative, which indicates that the enhancement of environmental regulation is conducive to promoting industrial structure upgrading and reducing the economic fluctuations. While the rationalization factors of industrial structure and advanced industrial structure are significantly negative, indicating that both forms of industrial structure upgrading are conducive to reducing the economic fluctuations. Environmental regulation has technical innovation thresholds for industrial structure upgrading and economic fluctuations, but there are no human capital or FDI thresholds. In the rationalization model of industrial structure, there is a nonlinear "U" relationship between environmental regulation and economic fluctuations when the proportion of scientific research expenditure is more than 1.35%. With the enhancement of environmental regulation, the economic fluctuation reduces first and then increases, and the corresponding inflection point value is 2.398% of the environmental regulation level. At the same time, the environmental regulation can indirectly reduce economic fluctuations by pushing down the industrial structure upgrades. In the advanced model of industrial structure, there is a “U” relationship between environmental regulation and economic fluctuation when the proportion of scientific research expenditure is greater than 1.26%. With continuous enhancement of environmental regulation, the economic fluctuation reduces first and then increases. The corresponding inflection point value is 1.78% of the environmental regulation level, and environmental regulation can indirectly reduce economic fluctuations by promoting the industrial structure at the same time.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

This study presents the development of a number of finite element (FE) models of the pelvis using different continuum and structural modelling approaches. Four FE models were developed using different modelling approaches: continuum isotropic, continuum orthotropic, hybrid isotropic and hybrid orthotropic. The models were subjected to an iterative adaptation process based on the Mechanostat principle. Each model was adapted to a number of common daily living activities (walking, stair ascent, stair descent, sit-to-stand and stand-to-sit) by applying onto it joint and muscle loads derived using a musculoskeletal modelling framework. The resulting models, along with a structural model previously developed by the authors, were compared visually in terms of bone architecture, and their response to a single load case was compared to a continuum FE model derived from CT imaging data. The main findings of this study were that the continuum orthotropic model was the closest to the CT derived model in terms of load response albeit having less total bone volume, suggesting that the role of material directionality in influencing the maximum orthotropic Young's modulus should be included in continuum bone adaptation models. In addition, the hybrid models, where trabecular and cortical bone were distinguished, had similar outcomes, suggesting that the approach to modelling trabecular bone is less influential when the cortex is modelled separately.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Strategic intelligence covers the examination of what impacts and influences the business and the related SWOT analysis, (strengths, weaknesses, opportunities, and threats mapping). Through this research, leaders will be able to properly allocate and re-route resources, identify areas of improvement, and ensure that strategic initiatives are aligned with the organization's mission. Strategic intelligence is, therefore, effective through the use of critical thought and data-driven decisions and seeing the outcomes of different positioned alternatives. It must also form and support a culture of cooperation and open communication within the organizations, stimulating employees' inputs and learning curves. The article's subject is the necessity for strategic intelligence, a crucial competence for leaders, managers, and companies striving to remain competitive, to be utilized and best leveraged in today's volatile and dynamic business contexts. It helps the leadership turn proactive, foresee trends, and make correct, agile decisions that enforce companies' long-term growth and success. This study follows a research design that includes a thorough literature review and bibliometric research, executed via VoSViewer, illustrating the concept of strategic intelligence from a leadership point of view as a driver of competitive advantage. Further, the article points out that the limitations are acknowledged because the literature on the matter is limited, as strategic intelligence is relatively new to the business sector; moreover, more research is required to fully understand and use the potential of strategic intelligence in business growth. By overcoming these limitations and continuing to study this concept, businesses can gain a competitive edge and make informed decisions that fuel their success in an ever-evolving market. As a result, this study contributes to developing strategic intelligence in leadership and business and paves the road for further research and applications of strategic intelligence theories in organizational contexts.

To solve the benefit allocation problem between the subjects of the supply chain of general contracting projects. The Cobb-Douglas function is applied to establish the benefit distribution model when the two cooperate in the supply chain system, analyze the optimal benefit situation of one-time cooperation between the two parties under two modes of egoistic decision and collectivistic decision as well as the benefit distribution problem of multiple cooperation, and conduct numerical simulation to calculate the functional relationship between each decision variable and the contribution degree of the general contractor under different effort cost coefficients. The results show that：In the case of one-time cooperation between general contractors and subcontractors, regardless of the decision mode, the degree of effort of both parties is positively related to their own contributions and negatively related to each other's contributions; the overall benefit of the supply chain system is positively proportional to the degree of contribution of the general contractor and inversely proportional to the share of benefit distribution of the subcontractor; in multiple cooperation, the equilibrium result of both parties achieving Pareto optimality at each stage is that both parties choose to cooperate.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Artificial intelligence (AI) systems are poised to become deeply integrated into society. If developed responsibly, AI has potential to benefit humanity immensely. However, it also poses a range of risks, including risks of catastrophic accidents. It is crucial that we develop oversight mechanisms that prevent harm. This article outlines a framework for evaluating and auditing AI to provide assurance of responsible development and deployment, focusing on catastrophic risks. We argue that responsible AI development requires comprehensive auditing that is proportional to AI systems’ capabilities and available affordances. This framework offers recommendations toward that goal and may be useful in the design of AI auditing and governance regimes.

The mechanism underlying microbiologically induced carbonate precipitation have not been thoroughly characterized, although numerous scholars and experts have specifically investigated questions regarding minerals induced by bacteria. The study of the precipitation of carbonate minerals induced by halophilic bacteria has aroused wide concern. The present study aimed to investigate the characterization and process of biomineralization in high salt systems by a halophilic bacterium, Chromohalobacter israelensis strain LD532 (GenBank: KX766026), which was isolated from the Yinjiashan Saltern in China. Carbonate minerals induced by LD532 were investigated in several sets of comparative experiments that employed magnesium sulfate and magnesium chloride as Mg resources. Magnesium calcite and aragonite were induced by LD532 bacteria, whereas these minerals did not appear in the control group. The mineral phases, micromorphologies, and crystal structures were analysed using X-ray powder diffraction, scanning electron microscopy, and energy dispersive X-ray detection. The carbonic anhydrase and urease secreted by strain LD532 through metabolism increased the pH value of the liquid medium and promoted the process of carbonate precipitation. Further study using high resolution transmission electron microscopy, energy dispersive X-ray detection and analysis of ultrathin slices showed that the nucleation sites of carbonate minerals were located on extracellular polymeric substances and the membranes of intracellular vesicles of LD532 bacteria, which provided favourable conditions for the growth of carbonate mineral crystals. The morphologies and compositions of minerals formed in solutions of MgSO₄ and MgCl₂ display significant differences, indicating that different sources of Mg²⁺ may also affect the physiological and biochemical activities of microorganisms and thus mineral deposition. This study will be of some interest for the interpretation of carbonate biomineralization in natural salt environments and has some value as a reference in understanding sedimentary carbonates in ancient marine environments, such as tidal flats.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

This work presents a new scheme for autonomous control and obstacle detection of a catamaran unmanned surface vessel. Based on the Newtonian mechanics, hydrodynamics, and maneuvering modelling group modelling principles in the attached coordinate system, a three-degree-of-freedom motion model of the catamaran unmanned surface vessel is constructed. The fuzzy inference method is used to overcome the drawback that the traditional PID control cannot tune the PID parameters online, and the trajectory controller is designed. Meanwhile, 3D LIDAR is used to achieve obstacle detection. The results of the trajectory tracking simulations and experiments verify the accuracy of the model design and the effectiveness of the autonomous control design.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

This paper examines the use of business maturity models as a tool for achieving business maturity and improving organizational performance in a rapidly changing business environment. Specifi-cally, the paper evaluates existing maturity models and methodologies, analyzes their effective-ness, and develops a novel and enhanced model tailored to the oil and gas sector. The authors highlight the importance of considering fundamental factors that underlie the implementation of maturity models and the need to evaluate their fit with organizational goals and values. The pa-per concludes by emphasizing the ongoing nature of business maturity and the effectiveness of theproposed Business Maturity Framework (BMF) model in enhancing operational excellence, competitiveness, and sustainable growth in the oil and gas industry. The paper makes a notable contribution to the specialized literature precisely through the differ-ent approaches to the business maturity process and through the proposed business maturity model itself as a base of strategy formulation, which includes a new dimension. This dimension analyzes whether the market and customers are ready for the level of digitization that the com-pany wants to achieve in a future state.

B lymphocyte development has two DNA recombination processes: V(D)J recombination of the immunoglobulin (Igh) gene variable region and class switching of the Igh constant regions from IgM to IgG, IgA, or IgE. V(D)J recombination is required for successful maturation of B cells from pro-B to pre-B to immature-B and then to mature B cells in the bone marrow. CSR occurs outside of the bone marrow when mature B cells migrate to peripheral lymphoid organs, such as spleen and lymph nodes. Both V(D)J recombination and CSR depend on an “open chromatin” state that makes DNA accessible to specific enzymes, recombination activating gene (RAG), and activation-induced cytidine deaminase (AID). Acetyltransferases GCN5 and PCAF possess redundant functions acetylating histone H3 lysine 9 (H3K9). Here, we generated a mouse model that lacks both GCN5 and PCAF in B cells. We found that double-deficient mice possess low levels of mature B cells in the bone marrow and peripheral organs, an accumulation of pro-B cells in bone marrow, and reduced CSR levels. We conclude that both GCN5 and PCAF are required for B cell development in vivo.

Background: Ultraviolet (UV) radiation from the sunlight can harm skin cells, causing short-term effects, such as sunburns and long-term effects, such as pigmentation changes, changes in the skin's immune responses, and increased risk of skin cancer. These conditions can be largely prevented with proper sun protection measures and behavioural changes. This study aims to assess the knowledge on sun protection behaviour and baseline knowledge of medical students from the “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania. Methods: Data in this cross-sectional study were collected through a Google Forms questionnaire, which was distributed from November 2023 to December 2023 via digital communication channels to students across all academic years. STROBE guidelines were consulted for data synthesis; Results: A total of 668 stu-dents responded. The student cohort demonstrated a commendable level of awareness of the risks associated with sun exposure and the advantages of employing sun protection factor (SPF); how-ever, the incidence of sunburns remained notably elevated (72.3%). Further analysis revealed cor-relations among gender, academic year, presence of photosensitizing conditions, and adherence to SPF application. Additionally, there is a need to improve understanding of the appropriate appli-cation techniques for SPF, as only 11.5% of the students exhibited proficiency in this regard; Con-clusions: As future healthcare providers, medical students hold significance in promoting healthy behaviours in the broader community. This study indicates that while their knowledge about sun protection is satisfactory, there is scope for enhancement.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

China is in the climbing phase of the "Inverted U" environmental Kuznets curve, from excessive environmental consumption to the development stage of governance and protection, and green innovation. It is the most complex period of environmental quality. Environmental and policy regulation are very important. Select panel data of 29 provinces of China (excluding Hong Kong, Macau, Taiwan, Hainan and Tibet) from 2008 to 2017, construct a nonlinear two-threshold regression model, empirically analyse the impact of environmental tax and government innovation subsidies to green processes innovation, and attempt to explore whether the implementation of these two policies at the same time can make enterprises more inclined to green process innovation and whether there is an optimal space for policy implementation. It is proposed that the synergy effect of environmental tax and government innovation subsidy policies on enterprise green process innovation should be fully utilized, and the enterprise green process innovation environment and incentive mechanism should be improved to promote the green transformation and sustainable development of enterprises.

This work continues the review and illustrative application to energy systems of the “Fourth-Order Best-Estimate Results with Reduced Uncertainties Predictive Modeling” (4th-BERRU-PM) methodology. The 4th-BERRU-PM methodology uses the Maximum Entropy (MaxEnt) principle to incorporate fourth-order experimental and computational information, in-cluding fourth (and higher) order sensitivities of computed model responses with respect to model parameters. The 4th-BERRU-PM methodology yields the fourth-order MaxEnt posterior distribution of experimentally measured and computed model responses and parameters, in the combined phase-space of model responses and parameters. The 4th-BERRU-PM methodology encompasses fourth-order sensitivity analysis (SA) and uncertainty quantification (UQ), which were reviewed in the accompanying work (Part 1), as well as fourth-order data assimilation (DA) and model calibration (MC) capabilities, which will be reviewed and illustrated in this work (Part 2). The applicability of the 4th-BERRU-PM methodology to energy systems is illustrated by using the Polyethylene-Reflected Plutonium (acronym: PERP) OECD/NEA reactor physics benchmark, which is modeled using the linear neutron transport Boltzmann equation, involving 21976 im-precisely known parameters. This benchmark is representative of “large-scale computations” such as those involved in the modeling of energy systems. The result (“response”) of interest for the PERP benchmark is the leakage of neutrons through the outer surface of this spherical benchmark, which can be computed numerically and measured experimentally. The impact of the high-order sensitivities of the response with respect to the PERP model parameters is quantified for “high-precision” parameters (2% standard deviations) and “medium-precision” parameters (5% standard deviations). Analyzing the best-estimate results with reduced uncertainties for the 1st- through 4th-order moments (mean values, covariance, skewness, and kurtosis) produced by the 4th-BERRU-PM methodology for the PERP benchmark indicates that, even for systems mod-eled by linear equations (e.g., the PERP benchmark), retaining only first-order sensitivities is insufficient for reliable predictive modeling (including SA, UQ, DA, MC). At least second-order sensitivities should be retained in order to obtain reliable predictions.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Hydrogen sulfide (H₂S) is a novel gasotransmitter, sucrose (SUC) is both cellular energy and signaling molecule. However, their signaling interaction in maize thermotolerance is poorly known. In this study, using maize seedlings as materials, metabolic and functional interaction of H₂S and SUC in maize thermotolerance was investigated. Data show that under heat stress survival rate and tissue viability were increased by exogenous SUC, while malondialdehyde content and electrolyte leakage were decreased by SUC, indicating SUC could upraise maize thermotolerance. Also, SUC-upraised thermotolerance was enhanced by H₂S, while weakened by inhibitor (propargylglycine) and scavenger (hypotaurine) of H₂S and SUC-transport inhibitor (N-ethylmaleimide). To figure out underlying mechanism of H₂S-SUC interaction-upraised thermotolerance, redox parameters in mesocotyls of maize seedlings were measured before and after heat stress. The data display that activity and gene expression of H₂S-metabolizing enzymes were up-regulated by SUC, whereas H₂S had no significant effect on activity and gene expression of SUC-metabolizing enzymes. Besides, activity and gene expression of catalase, glutathione reductase, ascorbate peroxidase, peroxidase, dehydroascorbate reductase, monodehydroascorbate reductase, and superoxide dismutase were reinforced by H₂S, SUC, and their combination under non-heat and heat conditions in varying degrees. Similarly, content of ascorbic acid, flavone, carotenoid, and polyphenol was increased by H₂S, SUC, and their combination, whereas production of superoxide radical and hydrogen peroxide level were impaired by these treatments to different extent. These results imply that the metabolic and functional interaction of H₂S and sucrose exists in the formation of maize thermotolerance through redox homeodynamics.

Lipid nanoparticles (LNPs) are promising carriers for constructing drug delivery systems (DDSs) in disease treatments. Previous studies have suggested that lipid composition and biophysical properties of LNPs can significantly impact their interaction with cells and tissues, allowing for the development of suitable LNPs for precise drug delivery. Our previous study proposed the concept and facile preparation of reconstituted lipid nanoparticles (rLNPs), which not only have the advantages of traditional LNPs but also contain the lipids of mother cell/tissue. In this study, we have found that brain-derived rLNPs (B-rLNPs) can have much better accumulation to the ischemic area of the ischemic stroke (IS) model than liver-derived rLNPs (L-rLNPs). This homing effect hopefully makes rLNPs a useful tool for developing highly accessible devices with homologous targeting ability for precise drug delivery.

The best business relationships are built as relationships between people and organizations that work together to achieve common goals. In the current digital era, B2B collaboration relationships are essential for business success. The response time to customer requests can be a key factor in maintaining these relationships and obtaining a competitive advantage. The use of VBA automation for repetitive tasks can help speed up this process, but it is important that computer operators have medium knowledge about using VBA macros. This work deals with issues related to improving response times to requests received by email, using a macro program for repetitive tasks. The empirical study was conducted on an average of 50 daily emails for order confirmation, with an average writing time of 68 s per email, resulting in a potential reduction in working time for the operator of approximately 1 h/day, only for order confirmation. The results show a significant improvement in working time for computer operators, using VBA buttons for repetitive tasks.

Supervised machine learning (SML) is a powerful method for predicting a small number of well-defined output groups (e.g., potential buyers of a certain product) by taking as input a large number of known well-defined measurements (e.g., past purchases, income, ethnicity, gender, credit record, age, favorite color, favorite chewing gum). SML is predicated upon the existence of a training dataset in which the correspondence between the input and output is known to be true. SML has had enormous success in the world of commerce, and this success may have prompted a few scientists to employ it in the study of molecular and genome evolution. Here, we list the properties of SML that make it an unsuitable tool in certain evolutionary studies. In particular, we argue that SML cannot be used in an evolutionary exploratory context for the simple reason that training datasets that are known to be a priori true do not exist. As a case study, we use an SML study in which it was concluded that most human genomes evolve by positive selection through soft selective sweeps (Schrider and Kern 2017). We show that in the absence of legitimate training datasets, Schrider and Kern (2017) used (1) simulations that employ many manipulatable variables and (2) a system of cherry-picking data that would put to shame most modern evangelical exegeses of the Bible. These two factors, in addition to the lack of methodological detail and negative controls, lead us to conclude that all evolutionary inferences derived from so-called SML algorithms (e.g., S-HIC) should be taken with a huge shovel of salt.

In training a deep learning system to perform audio transcription, two practical problems may arise. Firstly, most datasets are weakly labelled, having only a list of events present in each recording without any temporal information for training. Secondly, deep neural networks need a very large amount of labelled training data to achieve good quality performance, yet in practice it is difficult to collect enough samples for most classes of interest. In this paper, we propose factorising the final task of audio transcription into multiple intermediate tasks in order to improve the training performance when dealing with this kind of low-resource datasets. We evaluate three data-efficient approaches of training a stacked convolutional and recurrent neural network for the intermediate tasks. Our results show that different methods of training have different advantages and disadvantages.

MIGAL – Galilee Research Institute is a regional R&D center in the northeast peripheral region of Israel. An internationally recognized applied research institute, MIGAL specializes in biotechnology and computational sciences, plant sciences, precision agriculture and environmental sciences, as well as food, nutrition and health. Most of MIGAL’s researchers serve as the core faculty at Tel Hai Academic College (TH). Despite the country’s small surface area, socioeconomic inequality in Israel is high by OECD standards, with wage differences between rich and poor regions reaching up to 400%. The aims of this study are to identify possible socioeconomic impacts of MIGAL–TH on the peripheral northeast’s development. We discuss the effects of academic research and institutions of higher education on mitigating differences between the center and periphery of the country. Data for MIGAL, TH and the northeastern peripheral region were collected from the yearly reports of the two institutions and the Israel Central Bureau of Statistics. MIGAL was found to serve as a link between research, academic teaching and socioeconomic development in the northeast periphery. Several variables related to this link and describing MIGAL–TH and northeastern periphery development were analyzed over time: MIGAL’s budget, total number of employees and number of employees with PhDs; number of TH graduate students; socioeconomic index (SEI) of the northeastern periphery and its position on the Israeli list of regional SEIs. The signs and significance levels of their trends indicate a potential socioeconomic impact of academic research and higher education on peripheral development in the northeast of the country. Research budgets and the creation of jobs for academics living in the region are just a few examples of this impact.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Tulou dwellings in Southeast China have captivated global interest due to their distinctive appearance, sustainable construction materials and technologies, and their defensive and collective housing functions. Despite several recognized as World Cultural Heritage sites, the vast majority of tulou buildings are undergoing irreversible decline and destruction, necessitating a comprehensive and systematic study. Taking 83 Tulou buildings in Raoping County, Chaozhou City, Guangdong Province as the research object, this study reconstructs the historical scenes and systematically reveals the emergence, popularity, and consolidation process of tulou dwellings as integrated defensive and residential buildings for ordinary people by conducting a comprehensive analysis of historical documents and local chronicles. Based on an extensive field investigation, the study systematically analyzes the geospatial distribution and the spatial characteristics of Raoping tulou and its residential unit. The results demonstrate the adaptability and flexibility of tulou dwellings, showcasing their developmental process and revealing the inclusive nature of these traditional residences, as well as the initiative of those who reside within them. The research findings contribute to a more dynamic, comprehensive, and authentic understanding of tulou and Chinese traditional residences, providing valuable references for the preservation and sustainable development of tulou architectural heritage.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Aspartame is the methyl-ester of the aspartate-phenylalanine dipeptide. Over time it became a very popular artificial sweetener. However, since its approval by the main food safety agencies, several concerns have been raised related to neuropsychiatric effects and neurotoxicity, due to its ability to activate glutamate receptors, as well as carcinogenic risks by increased production of reactive oxygen species. Within this review we critically evaluated reports concerning the safety of aspartame. Some studies evidenced subtle mood and behavioral changes upon daily high-dose intake below the admitted limit. Epidemiology studies also evidenced associations between daily aspartame intake and higher predisposition for malignant diseases like non-Hodgkin lymphomas and multiple myelomas, particularly in males, but association by chance still could not be excluded. While the debate over the carcinogenic risk of aspartame is ongoing, it is clear that its use may pose some dangers in peculiar cases, such as patients with seizures or other neurological diseases; it should be totally forbidden for patients with phenylketonuria, and reduced doses or complete avoidance are advisable during pregnancy. It would be also highly desirable for every product containing aspartame to clearly indicate on the label the exact amount of the substance and some risk warnings.

The present paper proposes a fractal analysis of the Covid-19 dynamics in 45 European countries. We introduce a new idea of using the box-counting dimension of the epidemiologic curves as a means of classifying the Covid-19 pandemic in the countries taken into consideration. The classification can be a useful tool in deciding upon the quality and accuracy of the data available. We also investigated the reproduction rate, which proves to have significant fractal features, thus enabling another perspective on this epidemic characteristic. Moreover, we studied the correlation between two meteorological parameters: global radiation and daily mean temperature and two Covid-19 indicators: daily new cases and reproduction rate. The fractal dimension differences between the analysed time series graphs could represent a preliminary analysis criterion, increasing research efficiency. Daily global radiation was found to be stronger linked with Covid-19 new cases than air temperature (with a greater correlation coefficient -0.386, as compared with -0.318), and consequently it is recommended as the first-choice meteorological variable for prediction models.

The collaboration of multimodal transport documents is the foundation for conducting multimodal transport operations. Blockchain technology can effectively address trust issues and information sharing difficulties in current multimodal transport document collaboration. However, in current blockchain-based electronic document research, the bottleneck problem lies in the collaboration of multiparty in multimodal transport under the "one-bill coverage system". We design a blockchain platform architecture for multimodal transport, reshaping collaboration processes for different modes of transport based on the blockchain platform. It proposes a collaboration model for multimodal transport under the "one-bill coverage system" and performs model solving and case analysis. The obtained collaboration strategies are embedded into the platform's application layer. Finally, using Solidity language, it writes smart contracts related to multimodal transport under the "one-bill coverage system " and deploys and executes them on the Remix platform.

Background and Objectives Neurofibromatosis 1 (NF1 MIM # 162200), also known as von Recklinghausen disease, is among the most common autosomal dominantly transmitted disorders characterized mainly by neurocutaneous manifestations such as café au lait spots, intertriginous freckling, various types of neurofibromas (cutaneous neurofibromas or plexiform tumors), neurological manifestations, and bone abnormalities. It occurs with an incidence of 1:3000–1:4000 cases. Cone-rod dystrophies belong to the large group of retinal dystrophies, a highly heterogeneous group of disorders clinically manifested mainly by damage to cone and rod cells and have a broad spectrum of clinical manifestations. Many genes are involved in their etiology, with more than 100 currently identified, including the CRX gene responsible for the autosomal dominant form of cone-rod dystrophy (ad CORD). Materials and Methods: The authors present an intriguing case of a patient diagnosed with Neurofibromatosis type 1 (NF1) as an infant and ocular involvement (myopia and astigmatism onset at age 15), which yielded a surprising molecular testing result. Results: Molecular DNA analysis identified a rare occurrence of two mutational variants, including a pathogenic variant in the NF1 gene, c.3871-2A, and a likely pathogenic variant in the CRX gene c.119G>A. Conclusions: The authors present this case to highlight the surprises offered by molecular testing in a condition where the diagnosis is usually based on clinical criteria, thus providing patients with competent genetic advice.

In this essay, I revisit Neural Networks (NNs) through the lens of evolutionary dynamics. From the two most important features of NNs, I recover the two most general equations of evolutionary dynamics. These two equations may thus serve as a connection between NNs and a body of knowledge that has been built over multiple centuries and has found application across a vast range of disciplines. This connection may therefore also help explain why NNs with the two features in question are applicable across a much broader range of domains than initially envisioned.

Dirofilariosis is an infectious disease caused by species of the Dirofilaria genus. It is manifested by the appearance of a subcutaneous swelling, especially in the eye region. We present the case of a 29-year-old patient that accused facial asymmetry in the right genian region. Following clinical and paraclinical evaluations, the diagnosis of parasitic cyst was established in the context of dirofilariosis with Dirofilaria repens (D. repens). Treatment consisted of surgical excision of the formation associated with prophylactic antibiotic medication. Macroscopic analysis of the excision piece revealed a structure that contains a cystic cavity and a filamentous form with a length of approximately 10 mM and a diameter of 1 mM. This is the first case of dirofilariosis located in the genian region reported in Romania. The overview of this pathology is important to raise awareness among physicians about its presence and its clinical variations.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

In response to the fire protection design challenges faced by the integrated station-city engineering under the new model of station-city fusion, such as large building volume, diverse traffic types, functional integration, spatial complexity, and inapplicable standards, this paper selects Chongqing East Station as a typical engineering case. The fire safety engineering methods and performance-based fire protection design ideas were used. The paper summarized the fire protection difficulties, such as multifunctional combination construction, large fire protection distance, large fire protection zoning area, long evacuation distance, and design of evacuation (quasi) safety zones. Combining with the actual situation of the engineering, this paper analyzed the basic technical measures taken to address these design challenges. By adopting the method of fire safety engineering, the safety of the design scheme is verified, which can provide a solution approach for the current fire protection design challenges in the integrated station-city engineering.

This paper presents an original method of additive manufacturing of cylindrical parts with variable circumference thickness, which allows the control of the deposition of molten material using an algorithm for decomposing the part geometry into volumetric elements with known dimensional configuration. In the absence of a post-processor capable of controlling additive manufacturing on a 5-axis numerical control machine, control of the deposition of molten material is done using parameterized programs, which can control both the feed speeds of the machine tool axes and the specific functions of the printing equipment. Additive manufacturing can make a positive contribution to sustainable development compared to traditional manufacturing technologies, thus making a positive contribution for a sustainable future. The aim of the work is to make it possible to 3D print parts with variable wall thickness using a CNC machining centre. To obtain the variable thickness layer we have implemented an original method of deposition with molten material (FDM), the coordination of the system composed of physical elements respectively programmable elements, is realized through control functions materialized in parameterized part programs, the generated outputs being the variable speed of the machine axes on a circular trajectory, the angular positioning, the filament advance.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Leucine-rich repeat receptor-like kinases (LRR-RLKs) have been reported to play important roles in plant growth, development and stress responses. However, no comprehensive analysis of this family has been performed in Gossypium, which are important economic crop and suffer various stresses in growth and development. Here we conducted a comprehensive analysis of LRR-RLK family in four Gossypium species (G. arboreum, G. barbadense, G. hirsutum and G. raimondii). A total of 1641 LRR-RLK genes were identified in the four Gossypium species involved in our study. Maximum-likelihood phylogenetic tree revealed that all the LRR-RLK genes were divided into 21 subgroups. Exon-intron organization structure of LRR-RLK genes kept relative conserved in subfamilies and between Arabidopsis and Gossypium. Subfamilies XI and XII were found dramatically expanded in Gossypium. Tandem duplication acted as an important mechanism in expansion of Gossypium LRR-RLK gene family. Function analysis suggested that plant hormone signaling and plant-pathogen interaction pathway were enriched in Gossypium LRR-RLK genes. Promoters analysis and expression profiles analysis revealed that Gossypium LRR-RLK genes were extensively regulated by TFs, phytohormone and various environmental stimuli, and play key roles in stress defense and diverse development processes. Our study provided valuable information for further function study of Gossypium LRR-RLK genes.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Groove pancreatitis represents a chronic focal form of pancreatitis affecting the zone between the pancreatic head and the duodenal „C” loop, known as the groove area. This is a rare condition that affects the pancreatic periampullary part, including the duodenum and the common bile duct, associated usually with long-term alcohol and tobacco misuse and being more frequent in men than in women. The most common clinical symptoms of groove pancreatitis include weight loss, acute abdominal pain, nausea, and jaundice. This report is about a 66 year old woman with a history of heavy smoking, presenting with weight loss, nausea, and upper abdominal pain. Contrast enhanced computed tomography revealed the existence of a chronic pancreatitis as well as the dilatation of the main pancreatic duct, a cyst of the pancreatic head and enlargement of the biliary tract. Conservatory treatment was initiated but with no improvement of symptoms. Since there was no indication for endoscopic retrograde cholangiopancreatography, we decided to perform a pancreatoduodenectomy, as surgery appears to be the single effective treatment.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Three new cembranoids (1–3) and a new casbanoid (4), along with three known analogues (5–7), have been isolated from the soft coral Sinularia nanolobata collected off Ximao Island. The structures including the absolute configurations of new compounds were established by extensive spectro-scopic data analysis, time-dependent density functional theory/electronic circular dichroism (TDDFT-ECD) calculations and the comparison with spectroscopic data of known compounds. In in vitro bioassay, compounds 1 and 5 exhibited moderate cytotoxic activities against human erythroleukemia (HEL) cells line with IC50 values of 37.1 and 42.4 uM, respectively.

Fifteen new diterpenoids, namely xishaklyanes A-O (1-15), along with three known related ones (16-18), were isolated from the soft coral Klyxum molle collected from Xisha Islands, South China Sea. The stereochemistry of the new compounds were elucidated by a combination of detailed spectroscopic analyses, chemical syntheses, quantum chemical calculations and comparison with the reported data. The absolute configuration of compound 18 was established by the modified Mosher's method for the first time. In bioassay, some of these compounds exhibited considerable antibacterial activities on fish pathogenic bacteria, and compound 4 showed the most effective activity with MIC of 0.225 g/mL against Lactococcus garvieae.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

One important motivation for the implementation of the Water Framework Directive is the creation of non-market environmental benefits such as improved ecological quality, or greater opportunities for open-access river recreation via microbial pollution remediation. Pollution sources impacting on ecological or recreational water quality can be uncorrelated but non-market benefits arising from riverine improvements are typically conflated within benefit valuation studies. Using stated preference choice experiments, we seek to disaggregate these sources of value for different river users, thereby allowing decision makers to understand the consequences of adopting alternative investment strategies. Our results suggest anglers derive greater value from improvements to the ecological quality of river water, in contrast to swimmers and rowers for whom greater value is gained from improvements to recreational quality. We also find three distinct groups of respondents: a majority preferring ecological over recreational improvements, a substantial minority holding opposing preference orderings and a small proportion expressing relatively low values for either form of river quality enhancement. As such, this research demonstrates that the non-market benefits which may accrue from different types of water quality improvements are nuanced in terms of their potential beneficiaries and, by inference, their overall value and policy implications.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Many clinical trials end uninformatively. Informativeness, in the context of clinical trials, defines whether a study’s results definitively answer its research questions with meaningful next steps. One subset of these trials are those focused on global health set in low-resource settings. Global health clinical trials benefitting people in low-resource settings are funded primarily by a limited number of large foundations, pharmaceutical firms (“industry”), and national governments. While clinical trial protocols are required to go through reviews in regulatory and ethical domains, outside of industry-funded trials, funders rarely require focused scientific design reviews. There are no documented standards and processes, or even best practices, for funders to perform scientific reviews after the funding commitment. Considering the investment in and standardization of ethical and regulatory reviews, and the prevalence of studies ending without clarity or never finishing, it may be that scientific reviews of trial designs with a focus on informativeness offer the best chance for improved outcomes and return on investments in clinical trials. A maturity model is a helpful tool for knowledge transfer to help grow capabilities in a new area, or for those looking to perform a self-assessment in an existing area. Such a model is offered for scientific design reviews of clinical trial protocols: a valuable and often-neglected governance step for funders or sponsors, among others. This maturity model includes 11 process areas and 5 maturity levels. Each of the 55 process area levels is populated with descriptions on a continuum toward an optimal state to improve trial protocols in the area of risk of failure. This tool allows for prescriptive guidance on next investments to improve attributes of post-funding reviews of trials, with a focus on informativeness.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Silkworm ovary-derived BmN4 cells rely on chromatin-induced spindle assembly to form microtubule-based square mitotic spindles that ensure accurate segregation of holocentric chromosomes during cell division. The chromosome passenger protein Aurora B regulates chromosomal condensation and segregation, spindle assembly checkpoint, and cytokinesis; however, its role in holocentric organisms needs further clarification. This study examined the architecture and dynamics of spindle microtubules during prophase and metaphase in BmN4 cells and those with siRNA-mediated BmAurora B knockdown using immunofluorescence labelling. Anti-α-tubulin and anti-γ-tubulin antibodies revealed faint γ-tubulin signals co-localized with α-tubulin in early prophase during nuclear membrane rupture, which intensified as prophase progressed. At this stage, bright regions of α-tubulin around and on the nuclear membrane surrounding the chromatin suggested the start of microtubule assembling in the microtubule organizing centers (MTOCs). In metaphase, the number and size of γ-tubulin foci increased and were detected on both sides of the chromosomes. This resulted in a distinctive multipolar square spindle with holocentric chromosomes aligned at the metaphase plate. siRNA-mediated BmAurora B knockdown significantly reduced the γ-tubulin foci during prophase, impacting microtubule nucleation and spindle structure in metaphase. Spatiotemporal BmAurora B expression analysis provided new insights into the regulation of this mitotic kinase in silkworm larval gonads during gametogenesis. Our results suggest that BmAurora B is crucial for the formation of multipolar square spindles in holocentric insects, possibly through the activation of γ-tubulin ring complexes in multiple centrosome-like MTOCs.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Plastics have become an indispensable part of modern life today. The global production of plastics has gone up to 299million tones in 2013, which is believed to be increasing in the near future. The utilization of plastics and its final disposal pose a tremendous negative significance impacts on the environment. The aim of this study was to investigate the thermal and catalytic pyrolysis for production of fuel oil from the polyethene plastic wastes. Catalysts used in the experiment were acid activated clay mineral and aluminum chlorides on activated carbon. The clay mineral was activated by refluxing it with 6M Sulphuric acid for 3hours. The experiment was conducted in three different phases: the first phase of the experiment was done without a catalyst where 88mL oil was obtained at a maximum temperature of 39 and heating rates of 12.5, reaction time of 4hours. The second phase involves the use of acid activated clay mineral where 100mL of oil was obtained and heating rates of 12.5 and reaction time of 3hours 30minutes. The third phase was done using aluminium chlorides on activated carbon and 105ml oil was obtained at a maximum temperature of 400 and heating rates of 15.5 reaction time of 3hours 10minutes. From the results, catalytic pyrolysis is more efficient than purely thermal pyrolysis and homogenous catalysis (aluminum chlorides) shows a better result than solid acid catalyst (activated clay minerals) hence saving the energy needed for pyrolysis and making the process more economically feasible.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.