Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The problems of operating range and costs are the two most critical bottlenecks restricting the extensive application of electric vehicles at home and abroad. There are also some prominent problems in China's electric vehicles, such as slow improvement of electric vehicle's operating range, difficulty in charging, slow charging, low utilization efficiency of charging resources, and high battery cost for electric vehicles, which lead to poor competitiveness of electric vehicles compared with traditional internal combustion engine (I.C.E.) vehicles. This paper analyzes the key factors restricting the development and popularization of electric vehicles in China from the aspects of strategic policy, sales situation and self problems. Through summarizing the experience and lessons of French standardization development strategy and electric vehicle development mode, this paper puts forward the hypothesis leading the development of electric vehicles through standardization to enhance their competitiveness, gives the specific suggestions, and briefly analyzes the feasibility from the aspects of product situation. The research content of this paper provides a certain basis and ideas for the future research work.

The changing of land use and land cover (LULC) are both affected by climate and human activity and affect climate, biological diversity, and human well-being. Accurate and timely information about the LULC pattern and change is crucial for land management decision-making, ecosystem monitoring, and urban planning, especially in developing economies undergoing industrialization, urbanization, and globalization. Biodiversity degradation and urban expansion in eastern China are research hot-spots. However, the influence of LULC changes on the region remains largely unexplored. Here, an object-based and multi-temporal image analysis approach was developed to detect how LULC changes during 1985-2015 in the Tiaoxi watershed (Zhejiang province, eastern China) using Landsat TM and OLI data. The main objective of this study is to improve the accuracy of unsupervised change detection from object-based and multi-temporal images. To this end, a total of seven LULC maps are generated with multi-temporal images. A random stratified sample design was used for assessing change detection accuracy. The proposed method achieved an overall accuracy of 91.86%, 92.14%, 92.00%, and 93.86% for 2000, 2005, 2010, and 2015, respectively. Nevertheless, the proposed method, in conjunction with object-oriented and multi-temporal satellite images, offers a robust and flexible approach to LULC changes mapping that helps with emergency response and government management. Urbanization and agriculture efficiency are the main reasons for LULC changes in the region. We anticipate that this freely available data will improve the modeling for surface forcing, provide evidence of changes in LULC, and inform water-management decision-making.

This paper presents a new broadband ocean bottom seismograph (OBS) developed by the SUSTech OBS lab for passive-source seafloor seismic observations. This instrument, called Pankun, has several key features that set it apart from traditional OBS instruments. Besides the seismometer-separated scheme, these features include a unique shielding structure to minimize current-induced noise, a compact gimbal for accurate leveling, and low power consumption for extended operation on the seafloor. The design and testing of Pankun's primary components are thoroughly described in the paper. The instrument has been successfully tested in the South China Sea, demonstrating its ability to record high-quality seismic data. The anti-current shielding structure of Pankun OBS has the potential to improve low-frequency signals, particularly on the horizontal components, in seafloor seismic data.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Both lactic acid and short chain fatty acid (SCFA) play important roles in maintenance of intestinal epithelial structure and function. Trilactic glyceride (TLG) obtains both excellences of lactic acid and SCFA. This study was to investigate the effects of trilactic glyceride on growth performance, blood parameters, liver function, intestinal morphology and intestine function of piglets. Twelve weaned piglets (21±2 d) were randomly allocated to two treatment groups: 1) control group, piglets fed the basal diet; 2) TLG group, piglets fed the basal diet supplemented with 0.5 % TLG. On day 21 of the trial, D-xylose (0.1 g/kg·BW) was orally administrated to all piglets and blood samples were collected 1 h thereafter. Then, all the piglets were sacrificed to examine intestinal mucosal morphology and collect fatty tissue, liver and intestinal mucosa for further analysis. The results showed that: compared with the control group, TLG group decreased blood ALB and GGT on day 10 and 20, TLG group decreased blood TP and increased blood TG on day 20 of the trail (p < 0.05); TLG group decreased blood D-xylose and LDL, increased blood HDL (p < 0.05). These data suggested that supplementing trilactic glyceride had beneficial impacts on promoting nutrients’ metabolism, maintaining intestinal integrity, and alleviating oxidative stress and diarrhoea. Further research of molecular mechanisms showed changing expression levels of related proteins and genes, suggesting that these could be involved in the regulation of the impact. The community composition of the gut microbiota was also found to be altered in several operational taxonomic units within the genus, Prevotella (order Bacteroidales), and the order, Clostridiales.

We study the influence of high-order twisting phases on polarization states and optical angular momentum of a vector light field with locally linear polarization and a hybrid state of polarization (SoP). The initial SoP of a twisted vector optical field (TVOF) modulated by the high-order twisting phase possesses various symmetric distributions. The propagating properties of a high-order TVOF with locally linear polarization and hybrid SoP are explored, including the intensity compression, expansion, and conversion between the linear and circular polarization components. In particular, orbital angular momentum (OAM) appears in a high-order TVOF during propagation where no OAM exists in the initial field. The variation of OAM distribution in cross-section becomes more frequent with the increase of the twisting phase order. In addition, a non-symmetric OAM distribution appears in an anisotropic TVOF, leading to the rotation of the beam around the propagation axis during propagation. These results provide a new approach for optical field manipulation in a high-order TVOF.

To verify the reliability of the proposed stitching linear scan method for roundness measurement of small cylindrical workpieces, measurement uncertainties of the workpieces with various dimension are conducted. The cross-sectional circle of a cylindrical workpiece is divided into several equal arcs to be measured. Thus, the arc profile can be characterized according to the measured arcs. The roundness profile of the cylindrical part can be obtained by stitching these arc profiles together. Firstly, the measurement uncertainty of the workpiece with a diameter 1.5 mm and length 5.8 mm is evaluated to be 0.095 μm which can meet the uncertainty target of 0.1 μm. Considering the uncertainty of θx and θz which are the alignment around X-axis and Z-axis respectively changing with workpiece dimension changing, relevant uncertainties are carried out. As a result, there is no limitation with respect to workpiece diameter theoretically If the alignment can reach θz = θx = ±0.1° without considering the measurable range of the machine.

Excitotoxicity related to the dysfunction of the N-methyl-d-aspartate receptor (NMDAR) has been indicated to play an integral role in the pathophysiology of multiple disease states, including neurodegenerative disorders such as Parkinson’s disease. There is a notable gap in the market for novel NMDAR antagonists, however current methods to analyze potential antagonists rely on indirect measurements of calcium flux and hazardous radioligand binding assays. Recently, a fluorescent NMDAR ligand, N-adamantan-1-yl-dimethylamino-1-naphthalenesulfonic acid, known as AM-DAN was developed by our group. Additional studies on this ligand is necessary to evaluate its potential as a biological tool in NMDAR research. Therefore, this study was aimed at conducting structural analyses, fluorescence experiments, high-accuracy NMDAR molecular modelling and NMDAR phencyclidine (PCP) site competition binding studies using AM-DAN. Results revealed that AM-DAN has appropriate structural properties, significant fluorescent ability in various solvents and is able to bind selectively and compete for the PCP-binding site of the NMDAR. Therefore, AM-DAN holds promise as a novel fluorescent ligand to measure the affinity of prospective drugs binding at the NMDAR PCP-site and may circumvent the use of radioligands.

Fruit softening is an important characteristic of peach fruit ripening. The auxin receptor TIR1 (Transport Inhibitor Response 1) plays an important role in plant growth and fruit maturation, but little research has been conducted on the relation of TIR1 to the softening of peach fruits. In this study, the hardness of isolated peach fruits was reduced under exogenous NAA treatment of low concentration, at the same time, the low concentration of NAA treatment reduced the transcription level of PpPG and Ppβ-GAL genes related to cell wall softening, and PpACS1 genes related to ethylene synthesis. The transient over-expression of the PpTIR1 gene in peach fruit blocks caused significant down-regulation of the expression of early auxin-responsive genes, ethylene synthesis and cell wall metabolic genes related to fruit firmness. Through yeast two-hybrid technology, bimolecular fluorescence complementary technology, and firefly luciferase complementation imaging assay, an interaction between PpTIR1 and PpIAA1/3/5/9/27 proteins was revealed, and the interaction depended on auxin and its type and concentration. These results show that PpTIR1-Aux/IAA module has a possible regulatory effect on fruit ripening and softening.

Inflammatory reaction after ischemia-reperfusion contributes significantly to prognosis, and microglia activation is the main resource of inflammation in nervous system. STAT5 is proving to be a highly effective anti-inflammatory therapy with great potential, and inhibition of STAT5 has demonstrated significant anti-inflammation and therapeutic effects, but rarely focus on mechanism of neuroinflammation and brain injury from ischemia-reperfusion. It is the first time to found that the anti-inflammation of dauricine is mainly through STAT5-NF-κB pathway, might act as a STAT5 inhibitor. Dauricine suppressed the inflammation cytokines Eotaxin, KC, TNF-α, IL-1α, IL-1β, IL-6, IL-12β, IL-17α, and also inhibited the microglia activation. STAT5b mutant at Tyr-699 reversed the protective effect of dauricine on oxygen-glucose deprivation-reperfusion injury of neurons, and reactivated the suppression of dauricine on P-NF-κB of microglia. These results suggest that dauricine might suppress the neuroinflammation and protect the neuron from the injury of post-ischemia-reperfusion via mediating the microglia activation through STAT5-NF-κB pathway, and ss a potential therapeutic target for neuroinflammation, STAT5 needs to be raised concern in ischemic stroke.

Sediment transport is highly sensitive to flow conditions, showing significant increase during flood events. Based on this principle, this study set out to rank flood events occurring along river Trotuș (Romania) based on the amount of transported sediment and event duration. The 77 flood events recorded from 2000 to 2017 were ranked into 4 classes: type A (4%); type B (16%), type C (14%) and type D (66%). The sediment transport specific for the 4 types of flood events was related to the flow discharge (sediment rating curve and hysteresis effect), the specific stream power and the energy expenditure of these events. More than 60% of the hysteresis loops typical for flood events were clockwise, thus singling out the channel as the main sediment source. Ca. 74% of the total sediment yield was transported at stream power values higher than the 300 Wm-2 threshold, which was exceeded in less than 1% of the investigated timeframe. The changes occurring in the sediment transport rates after major floods show that these events are significant thresholds in the hydrogeomorphic evolution of river channels.

In this study, an extracellular metalloprotease from Pseudoalteromonas sp. H2 was purified and identified. The EH2 maintained more than 80% activity over a wide pH range of 5-10 and the stability was also nearly independent of pH. More than 65% of activity was detected in a wide temperature of 20-70℃. The high stability of the protease in presence of different surfactants and oxidizing agent was also observed. Moreover, we also investigated the antioxidant activities of the hydrolysates generated from porcine and salmon skins collagen by EH2. The results show that salmon skins collagen hydrolysates demonstrated higher DPPH (42.88%±1.85) and hydroxyl radical (61.83%±3.05) scavenging activity compared to those produced with porcine skins collagen. For oxygen radical absorbance capacity, the hydrolysates from porcine skins collagen had higher efficiency (7.72±0.13 μmol·TE/μmol). Even 1 nM mixed peptides can effectively reduce the levels of intracellular ROS. And the two type of substrates exerted the best antioxidant activity when hydrolyzed for 3 hours. Hydrolysis time and type of substrate exerted important effect on the antioxidant property of hydrolysates. This study may have implications for the potential application of marine protease in biocatalysis industry. In addition, the hydrolyzed peptides from meat waste containing beneficial collagen by protease have good antioxidant activity indicating it may be a potential additive in the food processing industry and cosmetics industry.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

In South Sudan, three case-control studies found a positive association between Nodding Syn-drome (NS) and a Mansonella perstans infection. To investigate whether M. perstans could play the primary and sole causal role in the development of NS, we examined blood films of persons with and without epilepsy in rural villages affected by NS in Mahenge, Tanzania, to identify M. perstans infections. Study participants were also examined for onchocercal nodules and skin lesions and tested for the presence of anti-O. volvulus antibodies (Ov16 ELISA). One hundred and thirteen epilepsy cases and 132 controls were enrolled, with a mean age of 28.3 years (interquartile range 22 – 34 years); 125 (51%) were females. Of the persons with epilepsy, 43 (38.1%) met the probable NS criteria. M. perstans infection was absent in all participants, but Ov16 prevalence and oncho-cerciasis-associated skin manifestations were positively associated with epilepsy, including probable NS. Onchocercal nodules in the mothers of cases were also positively associated with epilepsy. In conclusion, in contrast with O. volvulus, M. perstans is likely not endemic in Mahenge and therefore cannot be a co-factor for NS in the area. Hence, this filaria cannot be the primary and sole causal factor in the development of NS.

This work (in two parts) will review the recently developed predictive modeling methodology called “4th-BERRU-PM” and its applicability to energy systems as exemplified by an illustrative application to the Polyethylene-Reflected Plutonium (acronym: PERP) OECD/NEA reactor physics benchmark. The acronym 4th-BERRU-PM designates the “Fourth-Order Best-Estimate Results with Reduced Uncertainties Predictive Modeling” methodology, which yields best-estimate results with reduced uncertainties for the first fourth-order moments (mean values, covariance, skewness, and kurtosis) of the optimally predicted posterior distribution of model results and calibrated model parameters. The 4th-BERRU-PM uses the Maximum Entropy (MaxEnt) principle to incorporate fourth-order experimental and computational information, including fourth (and higher) order sensitivities of computed model responses to model parameters, thus incorporating, as particular cases, the results previously predicted by the second-order predictive modeling methodology 2nd-BERRU-PM, and vastly generalizing the results produced by extant data assimilation and data adjustment procedures. The 4th-BERRU-PM methodology encompasses the scopes of high-order sensitivity analysis (SA), uncertainty quantification (UQ), data assimilation (DA) and model calibration (MC). The application of the 4th-BERRU-PM methodology to energy systems is illustrated by means of the above-mentioned OECD/NEA reactor physics benchmark, which is modeled using the neutron transport Boltzmann equation involving 21976 imprecisely known parameters, the solution of which is representative of “large-scale computations.” The model result (“response”) of interest is the leakage of neutrons through the outer surface of this spherical benchmark, which can be computed numerically and measured experimentally. Part 1 of this work illustrates the impact of high-order sensitivities, in conjunction with parameter standard deviations of various magnitudes, on the determination of the expected value and variance of the computed response in terms of the first four moments of the distribution of the uncertain model parameters. Part 2 of this work will illustrate the capabilities of the 4th-BERRU-PM methodology for combining computational and experimental information, up to and including forth-order sensitivities and distributional moments, for producing best-estimate values for the predicted responses and model parameters while reducing their accompanying uncertainties.

Thymidylate synthase (TYMS) is an essential enzyme for the de novo synthesis of dTMP and has been a primary target for cancer chemotherapy. Although the physical structure of TYMS and the molecular mechanisms of TYMS catalyzing the conversion of dUMP to dTMP have been conducted thorough studies, oligomeric structure remains unclear. Here, we show that human TYMS not only exists in dimer but also octamer by intermolecular Cys43-disulfide formation. We optimize the expression condition of recombinant human TYMS using Escherichia coli system. Using HPLC-MS/MS, we show that purified TYMS has catalytic activity for producing dTMP. In the absence of reductant β-mercaptoethanol, SDS-PAGE and size exclusion chromatography (SEC) showed size of TYMS protein is about 35 KDa, 70 KDa, and 280 KDa. While the Cys43 was mutated to Gly, the band of ~280 KDa and the peak of octamer disappeared. Therefore, TYMS was determined to form octamer, dependent on the presence of Cys43-disulfide. By measuring Steady-State Parameters for monomer, dimer and octamer, we found the k_cat of octamer is increased slightly than monomer. On the basis of these findings, we suggest that octamer in the active state might have a potential influence on the design of new drug targets.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The article discusses early diagnosis and intervention for developmental delays in children, emphasizing the role of specialized services and personnel in supporting recovery and development. It presents findings from a pilot project initiated in Bucharest, aiming to assess the incidence of developmental delays in children aged 1-3 years in selected kindergartens, including ASD. The study involved children, parents, and specialists, utilizing systematic behavior observation (SBO) and semi-structured interviews. Results indicate that out of 613 evaluated children, 81 received specialized control recommendations, with 4 cases showing potential risk of ASD. Additionally, 8 children were diagnosed with autism. The incidence of autism in children aged 1-3 years was 1 in 51. Although exploratory, these findings suggest a model of good practice for future early diagnosis campaigns nationally. Conclusively, the study underscores the importance of early diagnosis and intervention for developmental delays, advocating for a responsive community and emphasizing the significance of national-level efforts to address these issues effectively.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Incident rates of neurodegenerative diseases have steadily increased globally, but there is no therapeutic access available. We newly prescribed medicinal herbal remedy including five different herbal plants called, Chen-Ma-Dan-Sam-Ga-Mi-Bang (CMST), purposed to prove for pharmacological properties and corresponded actions on hippocampus neuronal cell injury by hypoxia-induced mice model. Mice were adapted to normoxia or hypoxia with or without CMST for 5 days. We gathered pharmacological effects of CMST on cell injury by enhancement of dihydroethidium and 4-hydroxynonenal signals which were correlated with abnormal redox status in the protein or gene expression levels (abnormal elevations of nitric oxide, reactive oxygen species, lipid peroxidation and deteriorations of total glutathione, total antioxidant capacity, and activities of superoxide dismutase and catalase) due to hypoxia. CMST also notably exerted to attenuates molecules for neuronal cell injury markers such as p-tau, cleaved caspase-3 due to DNA oxidations (53bp1and phosphor-histone H2AX), inflammatory cytokines, and hemeoxigenase-1. We further figured out the underlying actions of CMST by in vitro experiment through inactivation of microglial cell which can mediate neuronal cell injury. Collectively, CMST prevented from hippocampal neuronal cells via inactivation of microglial cell with normalization of redox status on hypoxia-induced hippocampus neuronal cell injury.

Wearable exoskeleton solutions for upper limb rehabilitation or assistance, particularly for the hand area, have become increasingly attractive to researchers, proving to be effective over time in treating hand movement impairments following various neurological diseases. In the present work, the development of a wearable exoskeleton-type device for active hand rehabilitation has been addressed, based on fluid actuators made of elastomeric material and on myoelectric control by capturing myoelectric signals from the forearm area. The flexion movement of the fingers (phalanges) is actively assisted by pneumatic actuation of the built-in actuators and the extension movement is assisted by a depressurization control of the actuator. The device has been designed to be as easy to use as possible, light in weight, and to provide a high degree of comfort when used by the patient for rehabilitation training or daily life activities (ADL), which can be performed in the comfort of one's own home.

Despite the partial disclosure of driving scenario knowledge graphs, they still fail to meet the comprehensive needs of intelligent connected vehicles for driving knowledge. Current issues include the high complexity of pattern layer construction, insufficient accuracy of information extraction and fusion, and limited performance of knowledge reasoning models. To address these challenges, a hybrid knowledge graph method was adopted in the construction of the Driving Scenario Knowledge Graph (DSKG). Firstly, core concepts in the field were systematically sorted and classified, laying the foundation for the construction of a multi-level classified knowledge graph top-level ontology. Subsequently, by deeply exploring and analyzing the Traffic Genome data, 34 entities and 51 relations were extracted and integrated with the ontology layer, achieving the expansion and updating of the knowledge graph. Then, in terms of knowledge reasoning models, an analysis of the training results of the TransE, Complex, Distmult, and Rotate models in the entity linking prediction task of DSKG revealed that the Distmult model performed the best in metrics such as hit rate, making it more suitable for inference in DSKG. Finally, a standardized and widely applicable Driving Scenario Knowledge Graph was proposed. The DSKG and related materials have been publicly released for use by industry and academia.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

This study aimed to overcome the difficulty of conducting the horizontal-well cavity leaching test in the field and to investigate the long-term stability of the horizontal-well salt-cavity natural gas storage. The simulation test design is combined with the similarity theory to study the cavity expansion characteristics and the influence law of cavity leaching parameters. Through the design of a rubber hose connection, an integrated closed test system for multi-stage horizontal-well cavity leaching and brine drainage was built. The test system also realises the repeatable backward movement of the injection well during the test. A similarity simulation of the test design was carried out, and the test platform was constructed to carry out multi-stage horizontal-well leaching tests with a nitrogen cushion. In the horizontal-well leaching tests with a nitrogen cushion, the influence laws of the well spacing, flow rate and liquid level position on cavity expansion were investigated. Based on the morphological characteristics of the horizontal-well cavity, a numerical model of the horizontal-well salt cavity was developed, which reflects the real cavity morphology leached in the test. The long-term stability of the horizontal-well salt-cavity natural gas storage under different internal pressures was investigated through numerical simulation.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

This work presents the mathematical framework of the Second-Order Comprehensive Adjoint Sensitivity Analysis Methodology for Response-Coupled Forward/Adjoint Linear Systems (abbreviated as “2nd-CASAM-L”), which enables the most efficient computation of exactly obtained mathematical expressions of first- and second-order sensitivities of a generic system response with respect to functions (“features”) of model parameters. Subsequently, the first- and second-order sensitivities with respect to the model’s uncertain parameters, boundaries, and internal interfaces are obtained analytically and exactly, without needing large-scale computations. Within the 2nd-FASAM-L methodology, the number of large-scale computations is proportional to the number of model features (defined as functions of model parameters), as opposed to being proportional to the number of model parameters, which are considerably more than the number of features, being incomparably more efficient and more accurate than any other methods (statistical, finite differences, etc.) for computing exact expressions of response sensitivities (of any order) with respect to the model’s features and/or primary uncertain parameters, boundaries, and internal interfaces. The application of the 2nd-CASAM-L methodology is illustrated using a simplified energy-dependent neutron transport model of fundamental significance in nuclear reactor physics.

EGFR tyrosine kinase inhibitors (TKIs) are the preferred initial treatment for non-small cell lung cancer (NSCLC) patients harboring EGFR mutations. However, remission is transient, and no further effective treatment options are available for EGFR-TKI-advanced EGFR-mutant NSCLCs. Immunotherapy with immune checkpoint inhibitors (ICIs) induces sustained cancer remission in a subset of NSCLCs. However, ICI therapy exhibits limited activity in most EGFR-mutant NSCLCs. Mechanistically, the strong oncogenic EGFR signaling in EGFR-mutant NSCLCs contributes to the non-inflamed tumor immune microenvironment (TIME), characterized by a limited number of CD8+ T cell infiltration, a high number of regulatory CD4+ T cells and a high number of inactivated infiltrated T cells. Besides, EGFR-mutant NSCLC patients are generally non-smokers with low levels of PD-L1 expression and tumor mutation burden. However, current understanding only partially explains why a small population of EGFR-mutant NSCLCs durably respond to ICI therapy, resulting in many researchers actively working in this field. This review reviews the hope seen from pre-clinical studies and clinical trials which may be adopted to improve the outcome of ICI therapy in EGFR-mutant NSCLCs. Besides, the underlying mechanisms leading to the inferior clinical outcome of ICI therapy in EGFR-mutant NSCLCs are discussed.

In intermediary metabolism, enzymes are mainly for the specific provision of one small molecule from another, B from A, for its further use. But there are also decades of work relating to another evolved purpose, which is to prevent untoward effects of odd compounds of various origins, and of ordinary intermediates, whose improper concentrations may be avoided by hydrolases and other activities of metabolic correction.

Effective discharge, which represents the flow, or range of flows, that transport the most sediment over long term, was determined based on the mean daily flow discharge and mean daily suspended sediment discharge recorded between 1994 and 2014 at four gauging stations along the Trotuș River. This study proposes an efficient method for the estimation of effective discharge based on observed values of the suspended sediment load. By employing this method the suspended sediment load is no longer either under- or overestimated as in the cases when the assessment is based on sediment rating curves. The assessment on effective discharge was performed at two distinct levels: for the entire data series during the investigated time spans and, subsequently, for flows less than the bankfull discharge. The effectiveness curves of the suspended sediment transport characteristics revealed highly multimodal characteristics with many peaks, indicating ample ranges for the effective discharges. The main effective discharge corresponded to large flood events, which are typical for the upper end of the discharge range, whereas the secondary effective discharges corresponded to sub-bankfull flows, which are more frequent. The changes that occurred in the channel bed are reflected by the temporal variations in the effective discharge.

Fully mechanized mining face production involves complex geological conditions; mining pressure; gas, water, fire and other mining environments. The working face needs a shearer, hydraulic support, a scraper conveyor and other equipment for coordination. The deep integration of intelligent technology with factors such as "humans, machines, the environment, and management" in the workplace is the core content of intelligent coal mines. This paper puts forward an advanced framework for coal mining robot technology systems, including single robots, robotized equipment, robot clusters and unmanned systems. The framework clarifies the common key technologies of coal mining robot research and development and cross-integration with new technologies such as 5G, the industrial internet, big data, artificial intelligence, and digital twins to improve the autonomous and intelligent application of coal mining robots. By establishing a scientific and complete standard system for coal mining robots, we aim to achieve customized research and development and standardized production of various types of robots. A specific analysis was conducted on the research progress of common key technologies such as explosion-proof design, mechanical system innovation, power drive, intelligent sensing, positioning and navigation, and underground communication of coal mining robots. The current research and application status of various types of coal mining robots in China are summarized. A new direction for future coal mine robot research and development is proposed. Moreover, robotic mining systems should be promoted to enhance the overall intelligence level and mining efficiency of mining equipment. To develop human‒machine environment-integrated robots to improve the autonomy and collaboration level of coal mining robots. The digital twinning of the entire mine robot system should be accelerated, the normalized operation level of coal mine robots should be improved, research on coal mining robots, support robots, and transportation robots should be carried out, intelligence should be achieved in fully mechanized mining faces, and equipment support for fewer and unmanned fully mechanized mining faces should be provided. The practical process of implementing coal mining robotization has been summarized, and the technical and engineering feasibility of the coal mining machine population has been verified.

Work on callings has burgeoned in the past 20 years, yet recent reviews exposed a lack of conceptual clarity and disagreements around its definition, components and measures. One lingering point of contention revolves around the element of prosociality: Is a calling orientation primarily motivated by self-interest, prosocially orientated, or a mix of both? This conceptual paper reviews and examines the pro-self and prosocial component of a calling outlook, by examining and comparing the ways in which they feature in different calling subtypes: Classic, neoclassic, and modern callings. Our analysis suggests that these subtypes vary in where they are located on a pro-self – prosocial continuum: Classic callings are located on the prosocial side of the axis, modern callings are located on pro-self side of the axis, and neoclassic callings can be situated in the middle of the con-tinuum, integrating self-orientated and other-orientated motivations. Our analysis further suggests that these calling subtypes draw on divergent value systems: Classic callings are propelled by self-transcendent values, modern callings are driven by self-actualization motivations, and neoclassic callings integrate both value systems. We therefore argue that the subjective experiences of pursuing a calling within each subtype pathway differ, alt-hough they may culminate in similar outcomes. The paper offers a novel framework for analyzing people’s calling that draws on their values.

This paper utilizes dynamic panel threshold technology to conduct a nonlinear test on the direct effect between environmental regulation and economic fluctuations and the effect of industrial structure upgrading by taking 35 industrial sectors in China from 2003 to 2016 . The research has found that there is an inverted "U" relationship between environmental regulation and economic fluctuations, with the enhancement of environmental regulations, the economic fluctuation increases first and then decreases. The cross-terms of environmental regulation and industrial structure rationalization or industrial structure upgrading are significantly negative, which indicates that the enhancement of environmental regulation is conducive to promoting industrial structure upgrading and reducing the economic fluctuations. While the rationalization factors of industrial structure and advanced industrial structure are significantly negative, indicating that both forms of industrial structure upgrading are conducive to reducing the economic fluctuations. Environmental regulation has technical innovation thresholds for industrial structure upgrading and economic fluctuations, but there are no human capital or FDI thresholds. In the rationalization model of industrial structure, there is a nonlinear "U" relationship between environmental regulation and economic fluctuations when the proportion of scientific research expenditure is more than 1.35%. With the enhancement of environmental regulation, the economic fluctuation reduces first and then increases, and the corresponding inflection point value is 2.398% of the environmental regulation level. At the same time, the environmental regulation can indirectly reduce economic fluctuations by pushing down the industrial structure upgrades. In the advanced model of industrial structure, there is a “U” relationship between environmental regulation and economic fluctuation when the proportion of scientific research expenditure is greater than 1.26%. With continuous enhancement of environmental regulation, the economic fluctuation reduces first and then increases. The corresponding inflection point value is 1.78% of the environmental regulation level, and environmental regulation can indirectly reduce economic fluctuations by promoting the industrial structure at the same time.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

This study presents the development of a number of finite element (FE) models of the pelvis using different continuum and structural modelling approaches. Four FE models were developed using different modelling approaches: continuum isotropic, continuum orthotropic, hybrid isotropic and hybrid orthotropic. The models were subjected to an iterative adaptation process based on the Mechanostat principle. Each model was adapted to a number of common daily living activities (walking, stair ascent, stair descent, sit-to-stand and stand-to-sit) by applying onto it joint and muscle loads derived using a musculoskeletal modelling framework. The resulting models, along with a structural model previously developed by the authors, were compared visually in terms of bone architecture, and their response to a single load case was compared to a continuum FE model derived from CT imaging data. The main findings of this study were that the continuum orthotropic model was the closest to the CT derived model in terms of load response albeit having less total bone volume, suggesting that the role of material directionality in influencing the maximum orthotropic Young's modulus should be included in continuum bone adaptation models. In addition, the hybrid models, where trabecular and cortical bone were distinguished, had similar outcomes, suggesting that the approach to modelling trabecular bone is less influential when the cortex is modelled separately.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Strategic intelligence covers the examination of what impacts and influences the business and the related SWOT analysis, (strengths, weaknesses, opportunities, and threats mapping). Through this research, leaders will be able to properly allocate and re-route resources, identify areas of improvement, and ensure that strategic initiatives are aligned with the organization's mission. Strategic intelligence is, therefore, effective through the use of critical thought and data-driven decisions and seeing the outcomes of different positioned alternatives. It must also form and support a culture of cooperation and open communication within the organizations, stimulating employees' inputs and learning curves. The article's subject is the necessity for strategic intelligence, a crucial competence for leaders, managers, and companies striving to remain competitive, to be utilized and best leveraged in today's volatile and dynamic business contexts. It helps the leadership turn proactive, foresee trends, and make correct, agile decisions that enforce companies' long-term growth and success. This study follows a research design that includes a thorough literature review and bibliometric research, executed via VoSViewer, illustrating the concept of strategic intelligence from a leadership point of view as a driver of competitive advantage. Further, the article points out that the limitations are acknowledged because the literature on the matter is limited, as strategic intelligence is relatively new to the business sector; moreover, more research is required to fully understand and use the potential of strategic intelligence in business growth. By overcoming these limitations and continuing to study this concept, businesses can gain a competitive edge and make informed decisions that fuel their success in an ever-evolving market. As a result, this study contributes to developing strategic intelligence in leadership and business and paves the road for further research and applications of strategic intelligence theories in organizational contexts.

To solve the benefit allocation problem between the subjects of the supply chain of general contracting projects. The Cobb-Douglas function is applied to establish the benefit distribution model when the two cooperate in the supply chain system, analyze the optimal benefit situation of one-time cooperation between the two parties under two modes of egoistic decision and collectivistic decision as well as the benefit distribution problem of multiple cooperation, and conduct numerical simulation to calculate the functional relationship between each decision variable and the contribution degree of the general contractor under different effort cost coefficients. The results show that：In the case of one-time cooperation between general contractors and subcontractors, regardless of the decision mode, the degree of effort of both parties is positively related to their own contributions and negatively related to each other's contributions; the overall benefit of the supply chain system is positively proportional to the degree of contribution of the general contractor and inversely proportional to the share of benefit distribution of the subcontractor; in multiple cooperation, the equilibrium result of both parties achieving Pareto optimality at each stage is that both parties choose to cooperate.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Artificial intelligence (AI) systems are poised to become deeply integrated into society. If developed responsibly, AI has potential to benefit humanity immensely. However, it also poses a range of risks, including risks of catastrophic accidents. It is crucial that we develop oversight mechanisms that prevent harm. This article outlines a framework for evaluating and auditing AI to provide assurance of responsible development and deployment, focusing on catastrophic risks. We argue that responsible AI development requires comprehensive auditing that is proportional to AI systems’ capabilities and available affordances. This framework offers recommendations toward that goal and may be useful in the design of AI auditing and governance regimes.

The mechanism underlying microbiologically induced carbonate precipitation have not been thoroughly characterized, although numerous scholars and experts have specifically investigated questions regarding minerals induced by bacteria. The study of the precipitation of carbonate minerals induced by halophilic bacteria has aroused wide concern. The present study aimed to investigate the characterization and process of biomineralization in high salt systems by a halophilic bacterium, Chromohalobacter israelensis strain LD532 (GenBank: KX766026), which was isolated from the Yinjiashan Saltern in China. Carbonate minerals induced by LD532 were investigated in several sets of comparative experiments that employed magnesium sulfate and magnesium chloride as Mg resources. Magnesium calcite and aragonite were induced by LD532 bacteria, whereas these minerals did not appear in the control group. The mineral phases, micromorphologies, and crystal structures were analysed using X-ray powder diffraction, scanning electron microscopy, and energy dispersive X-ray detection. The carbonic anhydrase and urease secreted by strain LD532 through metabolism increased the pH value of the liquid medium and promoted the process of carbonate precipitation. Further study using high resolution transmission electron microscopy, energy dispersive X-ray detection and analysis of ultrathin slices showed that the nucleation sites of carbonate minerals were located on extracellular polymeric substances and the membranes of intracellular vesicles of LD532 bacteria, which provided favourable conditions for the growth of carbonate mineral crystals. The morphologies and compositions of minerals formed in solutions of MgSO₄ and MgCl₂ display significant differences, indicating that different sources of Mg²⁺ may also affect the physiological and biochemical activities of microorganisms and thus mineral deposition. This study will be of some interest for the interpretation of carbonate biomineralization in natural salt environments and has some value as a reference in understanding sedimentary carbonates in ancient marine environments, such as tidal flats.

Silver ion (Ag+) are recognized for their potent antibacterial properties; however, their utilization in food preservation is restricted by factors such as inadequate stability, a transient antibacterial impact, and the potential for human absorption. Hydrogel-based antibacterial agents are capable of exerting their antibacterial effects by establishing appropriate microenvironments, which facilitate the efficient delivery of antimicrobial molecules to the contaminated regions of food. In previous studies, we observed that chitosan (CS) and silver nitrate (AgNO3) were able to reduce Ag+ to silver nanoparticles (AgNPs) with enhanced antibacterial properties. This not only significantly extended the stability of the antibacterial agent but also demonstrated exceptional inhibitory capabilities against pathogenic bacteria, including common grape contaminants such as P. expansum, A. niger, and B. cinerea. Utilizing ultrasound-induced complexation technology, this study has successfully synthesized a chitosan-silver (CS-AgNPs) hydrogel. The efficacy of this hydrogel against the pathogenic fungus responsible for jujube black spot disease has been thoroughly investigated. The morphology structures of CS-AgNPs hydrogels were characterized by TEM, FTIR and UV-vis. The results indicated that AgNPs ranging from 80 to 110 nm were uniformly dispersed within the gel matrix and remained stable for extended periods at room temperature. In vitro antibacterial assays and fractional inhibitory concentration index (FICI) studies revealed that the pronounced antibacterial efficacy of the CS-AgNPs hydrogel was primarily attributed to the additive antibacterial effect of CS and AgNPs. These insights underscore the significant potential of CS-AgNPs hydrogels in combating fungal diseases of jujube, offering innovative strategies and materials for the management of agricultural pathogens.

This work presents a new scheme for autonomous control and obstacle detection of a catamaran unmanned surface vessel. Based on the Newtonian mechanics, hydrodynamics, and maneuvering modelling group modelling principles in the attached coordinate system, a three-degree-of-freedom motion model of the catamaran unmanned surface vessel is constructed. The fuzzy inference method is used to overcome the drawback that the traditional PID control cannot tune the PID parameters online, and the trajectory controller is designed. Meanwhile, 3D LIDAR is used to achieve obstacle detection. The results of the trajectory tracking simulations and experiments verify the accuracy of the model design and the effectiveness of the autonomous control design.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

This paper examines the use of business maturity models as a tool for achieving business maturity and improving organizational performance in a rapidly changing business environment. Specifi-cally, the paper evaluates existing maturity models and methodologies, analyzes their effective-ness, and develops a novel and enhanced model tailored to the oil and gas sector. The authors highlight the importance of considering fundamental factors that underlie the implementation of maturity models and the need to evaluate their fit with organizational goals and values. The pa-per concludes by emphasizing the ongoing nature of business maturity and the effectiveness of theproposed Business Maturity Framework (BMF) model in enhancing operational excellence, competitiveness, and sustainable growth in the oil and gas industry. The paper makes a notable contribution to the specialized literature precisely through the differ-ent approaches to the business maturity process and through the proposed business maturity model itself as a base of strategy formulation, which includes a new dimension. This dimension analyzes whether the market and customers are ready for the level of digitization that the com-pany wants to achieve in a future state.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

B lymphocyte development has two DNA recombination processes: V(D)J recombination of the immunoglobulin (Igh) gene variable region and class switching of the Igh constant regions from IgM to IgG, IgA, or IgE. V(D)J recombination is required for successful maturation of B cells from pro-B to pre-B to immature-B and then to mature B cells in the bone marrow. CSR occurs outside of the bone marrow when mature B cells migrate to peripheral lymphoid organs, such as spleen and lymph nodes. Both V(D)J recombination and CSR depend on an “open chromatin” state that makes DNA accessible to specific enzymes, recombination activating gene (RAG), and activation-induced cytidine deaminase (AID). Acetyltransferases GCN5 and PCAF possess redundant functions acetylating histone H3 lysine 9 (H3K9). Here, we generated a mouse model that lacks both GCN5 and PCAF in B cells. We found that double-deficient mice possess low levels of mature B cells in the bone marrow and peripheral organs, an accumulation of pro-B cells in bone marrow, and reduced CSR levels. We conclude that both GCN5 and PCAF are required for B cell development in vivo.

Improving plant nitrogen use efficiency (NUE) is important for many crops, especially in hybrid breeding. Reducing nitrogen inputs is key for achieving sustainable rice production and decreasing environmental problems. Here, we analyzed the transcriptomic and physiological changes in two indica restorer lines (Nanhui511 and Minghui23) under high (HN) and low nitrogen (LN) conditions. Nanhui511 (NH511) was more sensitive to different nitrogen supplies and exhibited higher nitrogen uptake and NUE under HN conditions by increasing lateral root and tiller numbers in the seedling and maturation stages, respectively. It also exhibited a lower survival rate than that of MH23 when planted in chlorate-containing hydroponic solution, indicating its high nitrogen uptake ability under different nitrogen supply conditions. When transferred from LN to HN conditions, NH511 had 2456 differentially expressed genes, whereas MH23 had only 266. Furthermore, genes related to nitrogen utilization showed differential expression in NH511 under HN conditions, while the opposite was observed in MH23. These results will help decrease certain limitations of hybrid rice breeding and provide novel data for high-NUE hybrid rice cultivation.

In the paper, a fully discrete compact difference scheme with $O(\tau^{2}+h^{4})$ precision is established by considering the numerical approximation of the one-dimensional Allen-Cahn equation. The numerical solutions satisfy discrete maximum principle under reasonable step ratio and time step constraint is proved. And the energy stability for the fully discrete scheme is investigated. An example is finally presented to show the effectiveness of scheme.

Background: Ultraviolet (UV) radiation from the sunlight can harm skin cells, causing short-term effects, such as sunburns and long-term effects, such as pigmentation changes, changes in the skin's immune responses, and increased risk of skin cancer. These conditions can be largely prevented with proper sun protection measures and behavioural changes. This study aims to assess the knowledge on sun protection behaviour and baseline knowledge of medical students from the “Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania. Methods: Data in this cross-sectional study were collected through a Google Forms questionnaire, which was distributed from November 2023 to December 2023 via digital communication channels to students across all academic years. STROBE guidelines were consulted for data synthesis; Results: A total of 668 stu-dents responded. The student cohort demonstrated a commendable level of awareness of the risks associated with sun exposure and the advantages of employing sun protection factor (SPF); how-ever, the incidence of sunburns remained notably elevated (72.3%). Further analysis revealed cor-relations among gender, academic year, presence of photosensitizing conditions, and adherence to SPF application. Additionally, there is a need to improve understanding of the appropriate appli-cation techniques for SPF, as only 11.5% of the students exhibited proficiency in this regard; Con-clusions: As future healthcare providers, medical students hold significance in promoting healthy behaviours in the broader community. This study indicates that while their knowledge about sun protection is satisfactory, there is scope for enhancement.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

China is in the climbing phase of the "Inverted U" environmental Kuznets curve, from excessive environmental consumption to the development stage of governance and protection, and green innovation. It is the most complex period of environmental quality. Environmental and policy regulation are very important. Select panel data of 29 provinces of China (excluding Hong Kong, Macau, Taiwan, Hainan and Tibet) from 2008 to 2017, construct a nonlinear two-threshold regression model, empirically analyse the impact of environmental tax and government innovation subsidies to green processes innovation, and attempt to explore whether the implementation of these two policies at the same time can make enterprises more inclined to green process innovation and whether there is an optimal space for policy implementation. It is proposed that the synergy effect of environmental tax and government innovation subsidy policies on enterprise green process innovation should be fully utilized, and the enterprise green process innovation environment and incentive mechanism should be improved to promote the green transformation and sustainable development of enterprises.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

This work continues the review and illustrative application to energy systems of the “Fourth-Order Best-Estimate Results with Reduced Uncertainties Predictive Modeling” (4th-BERRU-PM) methodology. The 4th-BERRU-PM methodology uses the Maximum Entropy (MaxEnt) principle to incorporate fourth-order experimental and computational information, in-cluding fourth (and higher) order sensitivities of computed model responses with respect to model parameters. The 4th-BERRU-PM methodology yields the fourth-order MaxEnt posterior distribution of experimentally measured and computed model responses and parameters, in the combined phase-space of model responses and parameters. The 4th-BERRU-PM methodology encompasses fourth-order sensitivity analysis (SA) and uncertainty quantification (UQ), which were reviewed in the accompanying work (Part 1), as well as fourth-order data assimilation (DA) and model calibration (MC) capabilities, which will be reviewed and illustrated in this work (Part 2). The applicability of the 4th-BERRU-PM methodology to energy systems is illustrated by using the Polyethylene-Reflected Plutonium (acronym: PERP) OECD/NEA reactor physics benchmark, which is modeled using the linear neutron transport Boltzmann equation, involving 21976 im-precisely known parameters. This benchmark is representative of “large-scale computations” such as those involved in the modeling of energy systems. The result (“response”) of interest for the PERP benchmark is the leakage of neutrons through the outer surface of this spherical benchmark, which can be computed numerically and measured experimentally. The impact of the high-order sensitivities of the response with respect to the PERP model parameters is quantified for “high-precision” parameters (2% standard deviations) and “medium-precision” parameters (5% standard deviations). Analyzing the best-estimate results with reduced uncertainties for the 1st- through 4th-order moments (mean values, covariance, skewness, and kurtosis) produced by the 4th-BERRU-PM methodology for the PERP benchmark indicates that, even for systems mod-eled by linear equations (e.g., the PERP benchmark), retaining only first-order sensitivities is insufficient for reliable predictive modeling (including SA, UQ, DA, MC). At least second-order sensitivities should be retained in order to obtain reliable predictions.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Hydrogen sulfide (H₂S) is a novel gasotransmitter, sucrose (SUC) is both cellular energy and signaling molecule. However, their signaling interaction in maize thermotolerance is poorly known. In this study, using maize seedlings as materials, metabolic and functional interaction of H₂S and SUC in maize thermotolerance was investigated. Data show that under heat stress survival rate and tissue viability were increased by exogenous SUC, while malondialdehyde content and electrolyte leakage were decreased by SUC, indicating SUC could upraise maize thermotolerance. Also, SUC-upraised thermotolerance was enhanced by H₂S, while weakened by inhibitor (propargylglycine) and scavenger (hypotaurine) of H₂S and SUC-transport inhibitor (N-ethylmaleimide). To figure out underlying mechanism of H₂S-SUC interaction-upraised thermotolerance, redox parameters in mesocotyls of maize seedlings were measured before and after heat stress. The data display that activity and gene expression of H₂S-metabolizing enzymes were up-regulated by SUC, whereas H₂S had no significant effect on activity and gene expression of SUC-metabolizing enzymes. Besides, activity and gene expression of catalase, glutathione reductase, ascorbate peroxidase, peroxidase, dehydroascorbate reductase, monodehydroascorbate reductase, and superoxide dismutase were reinforced by H₂S, SUC, and their combination under non-heat and heat conditions in varying degrees. Similarly, content of ascorbic acid, flavone, carotenoid, and polyphenol was increased by H₂S, SUC, and their combination, whereas production of superoxide radical and hydrogen peroxide level were impaired by these treatments to different extent. These results imply that the metabolic and functional interaction of H₂S and sucrose exists in the formation of maize thermotolerance through redox homeodynamics.

Lipid nanoparticles (LNPs) are promising carriers for constructing drug delivery systems (DDSs) in disease treatments. Previous studies have suggested that lipid composition and biophysical properties of LNPs can significantly impact their interaction with cells and tissues, allowing for the development of suitable LNPs for precise drug delivery. Our previous study proposed the concept and facile preparation of reconstituted lipid nanoparticles (rLNPs), which not only have the advantages of traditional LNPs but also contain the lipids of mother cell/tissue. In this study, we have found that brain-derived rLNPs (B-rLNPs) can have much better accumulation to the ischemic area of the ischemic stroke (IS) model than liver-derived rLNPs (L-rLNPs). This homing effect hopefully makes rLNPs a useful tool for developing highly accessible devices with homologous targeting ability for precise drug delivery.

The best business relationships are built as relationships between people and organizations that work together to achieve common goals. In the current digital era, B2B collaboration relationships are essential for business success. The response time to customer requests can be a key factor in maintaining these relationships and obtaining a competitive advantage. The use of VBA automation for repetitive tasks can help speed up this process, but it is important that computer operators have medium knowledge about using VBA macros. This work deals with issues related to improving response times to requests received by email, using a macro program for repetitive tasks. The empirical study was conducted on an average of 50 daily emails for order confirmation, with an average writing time of 68 s per email, resulting in a potential reduction in working time for the operator of approximately 1 h/day, only for order confirmation. The results show a significant improvement in working time for computer operators, using VBA buttons for repetitive tasks.

Supervised machine learning (SML) is a powerful method for predicting a small number of well-defined output groups (e.g., potential buyers of a certain product) by taking as input a large number of known well-defined measurements (e.g., past purchases, income, ethnicity, gender, credit record, age, favorite color, favorite chewing gum). SML is predicated upon the existence of a training dataset in which the correspondence between the input and output is known to be true. SML has had enormous success in the world of commerce, and this success may have prompted a few scientists to employ it in the study of molecular and genome evolution. Here, we list the properties of SML that make it an unsuitable tool in certain evolutionary studies. In particular, we argue that SML cannot be used in an evolutionary exploratory context for the simple reason that training datasets that are known to be a priori true do not exist. As a case study, we use an SML study in which it was concluded that most human genomes evolve by positive selection through soft selective sweeps (Schrider and Kern 2017). We show that in the absence of legitimate training datasets, Schrider and Kern (2017) used (1) simulations that employ many manipulatable variables and (2) a system of cherry-picking data that would put to shame most modern evangelical exegeses of the Bible. These two factors, in addition to the lack of methodological detail and negative controls, lead us to conclude that all evolutionary inferences derived from so-called SML algorithms (e.g., S-HIC) should be taken with a huge shovel of salt.

In training a deep learning system to perform audio transcription, two practical problems may arise. Firstly, most datasets are weakly labelled, having only a list of events present in each recording without any temporal information for training. Secondly, deep neural networks need a very large amount of labelled training data to achieve good quality performance, yet in practice it is difficult to collect enough samples for most classes of interest. In this paper, we propose factorising the final task of audio transcription into multiple intermediate tasks in order to improve the training performance when dealing with this kind of low-resource datasets. We evaluate three data-efficient approaches of training a stacked convolutional and recurrent neural network for the intermediate tasks. Our results show that different methods of training have different advantages and disadvantages.

MIGAL – Galilee Research Institute is a regional R&amp;D center in the northeast peripheral region of Israel. An internationally recognized applied research institute, MIGAL specializes in biotechnology and computational sciences, plant sciences, precision agriculture and environmental sciences, as well as food, nutrition and health. Most of MIGAL’s researchers serve as the core faculty at Tel Hai Academic College (TH). Despite the country’s small surface area, socioeconomic inequality in Israel is high by OECD standards, with wage differences between rich and poor regions reaching up to 400%. The aims of this study are to identify possible socioeconomic impacts of MIGAL–TH on the peripheral northeast’s development. We discuss the effects of academic research and institutions of higher education on mitigating differences between the center and periphery of the country. Data for MIGAL, TH and the northeastern peripheral region were collected from the yearly reports of the two institutions and the Israel Central Bureau of Statistics. MIGAL was found to serve as a link between research, academic teaching and socioeconomic development in the northeast periphery. Several variables related to this link and describing MIGAL–TH and northeastern periphery development were analyzed over time: MIGAL’s budget, total number of employees and number of employees with PhDs; number of TH graduate students; socioeconomic index (SEI) of the northeastern periphery and its position on the Israeli list of regional SEIs. The signs and significance levels of their trends indicate a potential socioeconomic impact of academic research and higher education on peripheral development in the northeast of the country. Research budgets and the creation of jobs for academics living in the region are just a few examples of this impact.

The harmful nature of high concentrations of antibiotics to humans and animals requires urgent development of novel materials and techniques for their absorption. In this work, CTAB (Cetyltrimethyl Ammonium Bromide)-assisted synthesis of ZIF-8 (zeolitic imidazolate framework) derived hollow carbon (ZHC) was designed, prepared and used as a high-performance adsorbent, further evaluated by Langmuir and Freundlich isothermal adsorption experiments, dynamic analysis as well as theoretical calculation. The maximum capacities of ZHC on adsorbing tetracycline (TC), norfloxacin (NFO) and levofloxacin (OFO) are 267.3, 125.6 and 227.8 mg g^-1, respectively, which delivers superior adsorptive performance when compared to widely studied inorganic adsorbates. The design concept of ZIFs-derived hollow carbon material provides guidance and insights for the efficient adsorbent of environmental antibiotics.

Tulou dwellings in Southeast China have captivated global interest due to their distinctive appearance, sustainable construction materials and technologies, and their defensive and collective housing functions. Despite several recognized as World Cultural Heritage sites, the vast majority of tulou buildings are undergoing irreversible decline and destruction, necessitating a comprehensive and systematic study. Taking 83 Tulou buildings in Raoping County, Chaozhou City, Guangdong Province as the research object, this study reconstructs the historical scenes and systematically reveals the emergence, popularity, and consolidation process of tulou dwellings as integrated defensive and residential buildings for ordinary people by conducting a comprehensive analysis of historical documents and local chronicles. Based on an extensive field investigation, the study systematically analyzes the geospatial distribution and the spatial characteristics of Raoping tulou and its residential unit. The results demonstrate the adaptability and flexibility of tulou dwellings, showcasing their developmental process and revealing the inclusive nature of these traditional residences, as well as the initiative of those who reside within them. The research findings contribute to a more dynamic, comprehensive, and authentic understanding of tulou and Chinese traditional residences, providing valuable references for the preservation and sustainable development of tulou architectural heritage.

Aspartame is the methyl-ester of the aspartate-phenylalanine dipeptide. Over time it became a very popular artificial sweetener. However, since its approval by the main food safety agencies, several concerns have been raised related to neuropsychiatric effects and neurotoxicity, due to its ability to activate glutamate receptors, as well as carcinogenic risks by increased production of reactive oxygen species. Within this review we critically evaluated reports concerning the safety of aspartame. Some studies evidenced subtle mood and behavioral changes upon daily high-dose intake below the admitted limit. Epidemiology studies also evidenced associations between daily aspartame intake and higher predisposition for malignant diseases like non-Hodgkin lymphomas and multiple myelomas, particularly in males, but association by chance still could not be excluded. While the debate over the carcinogenic risk of aspartame is ongoing, it is clear that its use may pose some dangers in peculiar cases, such as patients with seizures or other neurological diseases; it should be totally forbidden for patients with phenylketonuria, and reduced doses or complete avoidance are advisable during pregnancy. It would be also highly desirable for every product containing aspartame to clearly indicate on the label the exact amount of the substance and some risk warnings.

The present paper proposes a fractal analysis of the Covid-19 dynamics in 45 European countries. We introduce a new idea of using the box-counting dimension of the epidemiologic curves as a means of classifying the Covid-19 pandemic in the countries taken into consideration. The classification can be a useful tool in deciding upon the quality and accuracy of the data available. We also investigated the reproduction rate, which proves to have significant fractal features, thus enabling another perspective on this epidemic characteristic. Moreover, we studied the correlation between two meteorological parameters: global radiation and daily mean temperature and two Covid-19 indicators: daily new cases and reproduction rate. The fractal dimension differences between the analysed time series graphs could represent a preliminary analysis criterion, increasing research efficiency. Daily global radiation was found to be stronger linked with Covid-19 new cases than air temperature (with a greater correlation coefficient -0.386, as compared with -0.318), and consequently it is recommended as the first-choice meteorological variable for prediction models.

Dirofilariosis is an infectious disease caused by species of the Dirofilaria genus. It is manifested by the appearance of a subcutaneous swelling, especially in the eye region. We present the case of a 29-year-old patient that accused facial asymmetry in the right genian region. Following clinical and paraclinical evaluations, the diagnosis of parasitic cyst was established in the context of dirofilariosis with Dirofilaria repens (D. repens). Treatment consisted of surgical excision of the formation associated with prophylactic antibiotic medication. Macroscopic analysis of the excision piece revealed a structure that contains a cystic cavity and a filamentous form with a length of approximately 10 mM and a diameter of 1 mM. This is the first case of dirofilariosis located in the genian region reported in Romania. The overview of this pathology is important to raise awareness among physicians about its presence and its clinical variations.

Background and Objectives Neurofibromatosis 1 (NF1 MIM # 162200), also known as von Recklinghausen disease, is among the most common autosomal dominantly transmitted disorders characterized mainly by neurocutaneous manifestations such as café au lait spots, intertriginous freckling, various types of neurofibromas (cutaneous neurofibromas or plexiform tumors), neurological manifestations, and bone abnormalities. It occurs with an incidence of 1:3000–1:4000 cases. Cone-rod dystrophies belong to the large group of retinal dystrophies, a highly heterogeneous group of disorders clinically manifested mainly by damage to cone and rod cells and have a broad spectrum of clinical manifestations. Many genes are involved in their etiology, with more than 100 currently identified, including the CRX gene responsible for the autosomal dominant form of cone-rod dystrophy (ad CORD). Materials and Methods: The authors present an intriguing case of a patient diagnosed with Neurofibromatosis type 1 (NF1) as an infant and ocular involvement (myopia and astigmatism onset at age 15), which yielded a surprising molecular testing result. Results: Molecular DNA analysis identified a rare occurrence of two mutational variants, including a pathogenic variant in the NF1 gene, c.3871-2A, and a likely pathogenic variant in the CRX gene c.119G>A. Conclusions: The authors present this case to highlight the surprises offered by molecular testing in a condition where the diagnosis is usually based on clinical criteria, thus providing patients with competent genetic advice.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

In this essay, I revisit Neural Networks (NNs) through the lens of evolutionary dynamics. From the two most important features of NNs, I recover the two most general equations of evolutionary dynamics. These two equations may thus serve as a connection between NNs and a body of knowledge that has been built over multiple centuries and has found application across a vast range of disciplines. This connection may therefore also help explain why NNs with the two features in question are applicable across a much broader range of domains than initially envisioned.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

In response to the fire protection design challenges faced by the integrated station-city engineering under the new model of station-city fusion, such as large building volume, diverse traffic types, functional integration, spatial complexity, and inapplicable standards, this paper selects Chongqing East Station as a typical engineering case. The fire safety engineering methods and performance-based fire protection design ideas were used. The paper summarized the fire protection difficulties, such as multifunctional combination construction, large fire protection distance, large fire protection zoning area, long evacuation distance, and design of evacuation (quasi) safety zones. Combining with the actual situation of the engineering, this paper analyzed the basic technical measures taken to address these design challenges. By adopting the method of fire safety engineering, the safety of the design scheme is verified, which can provide a solution approach for the current fire protection design challenges in the integrated station-city engineering.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

This paper presents an original method of additive manufacturing of cylindrical parts with variable circumference thickness, which allows the control of the deposition of molten material using an algorithm for decomposing the part geometry into volumetric elements with known dimensional configuration. In the absence of a post-processor capable of controlling additive manufacturing on a 5-axis numerical control machine, control of the deposition of molten material is done using parameterized programs, which can control both the feed speeds of the machine tool axes and the specific functions of the printing equipment. Additive manufacturing can make a positive contribution to sustainable development compared to traditional manufacturing technologies, thus making a positive contribution for a sustainable future. The aim of the work is to make it possible to 3D print parts with variable wall thickness using a CNC machining centre. To obtain the variable thickness layer we have implemented an original method of deposition with molten material (FDM), the coordination of the system composed of physical elements respectively programmable elements, is realized through control functions materialized in parameterized part programs, the generated outputs being the variable speed of the machine axes on a circular trajectory, the angular positioning, the filament advance.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Leucine-rich repeat receptor-like kinases (LRR-RLKs) have been reported to play important roles in plant growth, development and stress responses. However, no comprehensive analysis of this family has been performed in Gossypium, which are important economic crop and suffer various stresses in growth and development. Here we conducted a comprehensive analysis of LRR-RLK family in four Gossypium species (G. arboreum, G. barbadense, G. hirsutum and G. raimondii). A total of 1641 LRR-RLK genes were identified in the four Gossypium species involved in our study. Maximum-likelihood phylogenetic tree revealed that all the LRR-RLK genes were divided into 21 subgroups. Exon-intron organization structure of LRR-RLK genes kept relative conserved in subfamilies and between Arabidopsis and Gossypium. Subfamilies XI and XII were found dramatically expanded in Gossypium. Tandem duplication acted as an important mechanism in expansion of Gossypium LRR-RLK gene family. Function analysis suggested that plant hormone signaling and plant-pathogen interaction pathway were enriched in Gossypium LRR-RLK genes. Promoters analysis and expression profiles analysis revealed that Gossypium LRR-RLK genes were extensively regulated by TFs, phytohormone and various environmental stimuli, and play key roles in stress defense and diverse development processes. Our study provided valuable information for further function study of Gossypium LRR-RLK genes.

Groove pancreatitis represents a chronic focal form of pancreatitis affecting the zone between the pancreatic head and the duodenal „C” loop, known as the groove area. This is a rare condition that affects the pancreatic periampullary part, including the duodenum and the common bile duct, associated usually with long-term alcohol and tobacco misuse and being more frequent in men than in women. The most common clinical symptoms of groove pancreatitis include weight loss, acute abdominal pain, nausea, and jaundice. This report is about a 66 year old woman with a history of heavy smoking, presenting with weight loss, nausea, and upper abdominal pain. Contrast enhanced computed tomography revealed the existence of a chronic pancreatitis as well as the dilatation of the main pancreatic duct, a cyst of the pancreatic head and enlargement of the biliary tract. Conservatory treatment was initiated but with no improvement of symptoms. Since there was no indication for endoscopic retrograde cholangiopancreatography, we decided to perform a pancreatoduodenectomy, as surgery appears to be the single effective treatment.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Three new cembranoids (1–3) and a new casbanoid (4), along with three known analogues (5–7), have been isolated from the soft coral Sinularia nanolobata collected off Ximao Island. The structures including the absolute configurations of new compounds were established by extensive spectro-scopic data analysis, time-dependent density functional theory/electronic circular dichroism (TDDFT-ECD) calculations and the comparison with spectroscopic data of known compounds. In in vitro bioassay, compounds 1 and 5 exhibited moderate cytotoxic activities against human erythroleukemia (HEL) cells line with IC50 values of 37.1 and 42.4 uM, respectively.

Fifteen new diterpenoids, namely xishaklyanes A-O (1-15), along with three known related ones (16-18), were isolated from the soft coral Klyxum molle collected from Xisha Islands, South China Sea. The stereochemistry of the new compounds were elucidated by a combination of detailed spectroscopic analyses, chemical syntheses, quantum chemical calculations and comparison with the reported data. The absolute configuration of compound 18 was established by the modified Mosher's method for the first time. In bioassay, some of these compounds exhibited considerable antibacterial activities on fish pathogenic bacteria, and compound 4 showed the most effective activity with MIC of 0.225 g/mL against Lactococcus garvieae.

One important motivation for the implementation of the Water Framework Directive is the creation of non-market environmental benefits such as improved ecological quality, or greater opportunities for open-access river recreation via microbial pollution remediation. Pollution sources impacting on ecological or recreational water quality can be uncorrelated but non-market benefits arising from riverine improvements are typically conflated within benefit valuation studies. Using stated preference choice experiments, we seek to disaggregate these sources of value for different river users, thereby allowing decision makers to understand the consequences of adopting alternative investment strategies. Our results suggest anglers derive greater value from improvements to the ecological quality of river water, in contrast to swimmers and rowers for whom greater value is gained from improvements to recreational quality. We also find three distinct groups of respondents: a majority preferring ecological over recreational improvements, a substantial minority holding opposing preference orderings and a small proportion expressing relatively low values for either form of river quality enhancement. As such, this research demonstrates that the non-market benefits which may accrue from different types of water quality improvements are nuanced in terms of their potential beneficiaries and, by inference, their overall value and policy implications.

Many clinical trials end uninformatively. Informativeness, in the context of clinical trials, defines whether a study’s results definitively answer its research questions with meaningful next steps. One subset of these trials are those focused on global health set in low-resource settings. Global health clinical trials benefitting people in low-resource settings are funded primarily by a limited number of large foundations, pharmaceutical firms (“industry”), and national governments. While clinical trial protocols are required to go through reviews in regulatory and ethical domains, outside of industry-funded trials, funders rarely require focused scientific design reviews. There are no documented standards and processes, or even best practices, for funders to perform scientific reviews after the funding commitment. Considering the investment in and standardization of ethical and regulatory reviews, and the prevalence of studies ending without clarity or never finishing, it may be that scientific reviews of trial designs with a focus on informativeness offer the best chance for improved outcomes and return on investments in clinical trials. A maturity model is a helpful tool for knowledge transfer to help grow capabilities in a new area, or for those looking to perform a self-assessment in an existing area. Such a model is offered for scientific design reviews of clinical trial protocols: a valuable and often-neglected governance step for funders or sponsors, among others. This maturity model includes 11 process areas and 5 maturity levels. Each of the 55 process area levels is populated with descriptions on a continuum toward an optimal state to improve trial protocols in the area of risk of failure. This tool allows for prescriptive guidance on next investments to improve attributes of post-funding reviews of trials, with a focus on informativeness.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Silkworm ovary-derived BmN4 cells rely on chromatin-induced spindle assembly to form microtubule-based square mitotic spindles that ensure accurate segregation of holocentric chromosomes during cell division. The chromosome passenger protein Aurora B regulates chromosomal condensation and segregation, spindle assembly checkpoint, and cytokinesis; however, its role in holocentric organisms needs further clarification. This study examined the architecture and dynamics of spindle microtubules during prophase and metaphase in BmN4 cells and those with siRNA-mediated BmAurora B knockdown using immunofluorescence labelling. Anti-α-tubulin and anti-γ-tubulin antibodies revealed faint γ-tubulin signals co-localized with α-tubulin in early prophase during nuclear membrane rupture, which intensified as prophase progressed. At this stage, bright regions of α-tubulin around and on the nuclear membrane surrounding the chromatin suggested the start of microtubule assembling in the microtubule organizing centers (MTOCs). In metaphase, the number and size of γ-tubulin foci increased and were detected on both sides of the chromosomes. This resulted in a distinctive multipolar square spindle with holocentric chromosomes aligned at the metaphase plate. siRNA-mediated BmAurora B knockdown significantly reduced the γ-tubulin foci during prophase, impacting microtubule nucleation and spindle structure in metaphase. Spatiotemporal BmAurora B expression analysis provided new insights into the regulation of this mitotic kinase in silkworm larval gonads during gametogenesis. Our results suggest that BmAurora B is crucial for the formation of multipolar square spindles in holocentric insects, possibly through the activation of γ-tubulin ring complexes in multiple centrosome-like MTOCs.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

Plastics have become an indispensable part of modern life today. The global production of plastics has gone up to 299million tones in 2013, which is believed to be increasing in the near future. The utilization of plastics and its final disposal pose a tremendous negative significance impacts on the environment. The aim of this study was to investigate the thermal and catalytic pyrolysis for production of fuel oil from the polyethene plastic wastes. Catalysts used in the experiment were acid activated clay mineral and aluminum chlorides on activated carbon. The clay mineral was activated by refluxing it with 6M Sulphuric acid for 3hours. The experiment was conducted in three different phases: the first phase of the experiment was done without a catalyst where 88mL oil was obtained at a maximum temperature of 39 and heating rates of 12.5, reaction time of 4hours. The second phase involves the use of acid activated clay mineral where 100mL of oil was obtained and heating rates of 12.5 and reaction time of 3hours 30minutes. The third phase was done using aluminium chlorides on activated carbon and 105ml oil was obtained at a maximum temperature of 400 and heating rates of 15.5 reaction time of 3hours 10minutes. From the results, catalytic pyrolysis is more efficient than purely thermal pyrolysis and homogenous catalysis (aluminum chlorides) shows a better result than solid acid catalyst (activated clay minerals) hence saving the energy needed for pyrolysis and making the process more economically feasible.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.