The cortical motor system can be reorganized following a stroke, with an increasing recruitment of the contralesional hemisphere. However, it is unknown whether a similar hemispheric shift occurs in the somatosensory system to adapt to this motor change, and whether this is related to movement impairments.  This proof-of-concept study assessed somatosensory evoked potentials (SEPs), P50 and N100, in hemiparetic stroke participants and age-matched controls using high-density electroencephalograph (EEG) recordings during tactile finger stimulation. The laterality index was calculated to determine hemispheric dominance of the SEP and re-confirmed with source localization.  The study found that latencies of P50 and N100 were significantly delayed in stroke brains when stimulating the paretic hand. The amplitude of P50 was negatively correlated with Fügl-Meyer Upper Extremity Motor Score in stroke. Bilateral cortical responses were detected in stroke, while only contralateral cortical responses were shown in controls, resulting in a significant difference in the laterality index.  These results suggested that somatosensory reorganization after stroke involves increased recruitment of ipsilateral cortical regions. This reorganization delays the latency of somatosensory processing after a stroke.  This research provided new insights related to the somatosensory reorganization after stroke, which could enrich future hypothesis-driven therapeutic rehabilitation strategies from a sensory or sensory-motor perspective.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Fungal infections impact the lives of at least 12 million people every year, killing over 1.5 million. Wide-spread use of fungicides and prophylactic antifungal therapy have driven resistance in many serious fungal pathogens, and there is an urgent need to expand the current antifungal ar-senal. Recent research has focused on improving azoles, our most successful class of antifungals, by looking for synergistic interactions with secondary compounds. Synergists can co-operate with azoles by targeting steps in related pathways, or they may act on mechanisms related to re-sistance like active efflux or on totally disparate pathways or processes. A variety of sources of potential synergists have been explored, including pre-existing antimicrobials, pharmaceuticals approved for other uses, bioactive natural compounds and phytochemicals, and novel synthetic compounds. Synergy can successfully widen the antifungal spectrum, decrease inhibitory dosag-es, reduce toxicity, and prevent the development of resistance. This review highlights the diversity of mechanisms that have been exploited for the purposes of azole synergy and demonstrates that synergy remains a promising approach for meeting the urgent need for novel antifungal strate-gies.

The outer membrane of Gram-negative bacteria contains a variety of pore-forming structures collectively referred to as porins. Some of these are voltage-dependent, but weakly so, closing at high voltages. Triplin, a novel bacterial pore-former, is a three-pore structure, highly voltage dependent, with a complex gating process. The three pores close sequentially: pore 1 at positive potentials, 2 at negative and 3 at positive. A positive domain containing 14 positive charges (the voltage sensor) translocates through the membrane during the closing process and the translocation is proposed to take place by the domain entering the pore and thus blocking it resulting in the closed conformation. This mechanism of pore closure is supported by kinetic measurements that show that in the closing process the voltage sensor travels through most of the transmembrane voltage before reaching the energy barrier. Voltage-dependent blockage of the pores by polyarginine but not by a 500 fold higher concentrations of polylysine, is consistent with the model of pore closure, with the sensor consisting mainly of arginine residues, and with the presence, in each pore, of a complementary surface that serves as a binding site for the sensor.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

This article introduces a novel payload structure, which has been experimentally proven to have smaller impact force while the carried internal electronics remains intact. The study describes in details how materials and geometric structures were chosen based on information analysis. It is clarified how possible geometric structures and materials can be chosen to yield optimal efficiency. Finite element method simulations were carried out to investigate the mechanical properties of several geometric structures, which has led to the dodecahedron form. For the frame, Polylactic Acid were chosen as an optimal material. A low air pressure test for parts of the structure, and also the whole structure were carried out with successful results. Drop tests, with force measuring sensors and high speed videos, were carried out for measuring and comparing the maximal impact force of classical payloads and the novel one. Laboratory and real life tests demonstrated that the developed new structure is safer and it is applicable.

In this paper, inspired by recent articles of G. Anatriello and G. Vincenzi (see \cite{Ana}), and G. Cerda-Morales (see \cite{Cer1,Cer2}), we will introduce the third-order $\overline{h}$-Jacobsthal and third-order $\overline{h}$-Jacobsthal--Lucas sequences and their associated quaternions. The new results that we have obtained extend most of those obtained in \cite{Cer2}.

(1) Background: ganoderic acids (GAs) are specific triterpenes of Ganoderma lucidum. The HPLC fingerprint profile of GAs of the fruiting body has been well-known, but the mycelial fingerprinting remains unclear. (2) Methods: the ethanol extract of the mycelium of G. lucidum (YK-01) was further purified by preparative HPLC. The HPLC spectra for four strains of G. lucidum and one strain of G. formosanum (purple lingzhi) were investigated. (3) Results: nineteen lanostane triterpenes, including five new triterpenes, GA-TP (1), ganodermic acid Jc (GmA-Jc) (2), GmA-Jd (3), GA-TQ1 (4), and ganoderal B1 (5), and fourteen known triterpenes 6-19 were isolated from the ethanol extract. A green chemical HPLC analytical method was developed by using ethanol and acetic acid as mobile phase. These triterpenes comprise of a unique HPLC triterpenoid spectral pattern of G. lucidum mycelium. All four G. lucidum strains showed the same HPLC spectral pattern, whereas G. formosanum displayed a different pattern. Quantitation methods for ganoderic acid T (10) and S (12) were also validated. (4) Conclusions: the triterpenoid HPLC analytical method can be used to identify G. lucidum species, and to determine the contents of GA-T and GA-S.

We have investigated the antiferromagnetic phase transition in the frustrated and multiferroic hexagonal manganites $h$-(Y$_{0.98}$ Eu$_{0.02}$)MnO$_3$ (YEMO) and $h$-YMnO$_3$ (YMO). Elastic neutron scattering has been used to study in detail the phase transition in YMO and YEMO in zero pressure and in YMO at a hydrostatic pressure of 1.5~GPa. In zero pressure, we find the critical temperature $T_{\rm N} = 72.11(5)$~K and 71.3(1)~K and the critical exponent $\beta = 0.206(3)$ and 0.22(2), for YEMO and YMO, respectively. This is in agreement with earlier work by Roessli {\em et al.}. In applied hydrostatic pressure of 1.5~GPa, the ordering temperature increases to $T_{\rm N} = 75.2(5)$~K, in agreement with earlier reports, while $\beta$ is unchanged. Inelastic neutron scattering was used to determine the anisotropy spin wave gap at the phase transition, expected from spin wave theory to close with a critical exponent $\beta'$ identical to the one of the order parameter, $\beta' = \beta$. Our results indicate that the gap in YEMO indeed closes at $T_{\rm N}=72.4(3)$~K with $\beta' = 0.24(2)$, while the in-pressure gap in YMO closes at 75.2(5)~K with an exponent of $\beta' =0.19(3)$. In addition, the low-temperature anisotropy gap was found to have a slightly higher absolute value under pressure. The consistent values obtained for $\beta$ in the two systems support the likelihood of a new universality class for triangular, frustrated antiferromagnets.

The treatment of the bulky Rind-based dibromosilanes, (Rind)2SiBr2 (2) [Rind = 1,1,7,7-tetra-R1-3,3,5,5-tetra-R2-s-hydrindacen-4-yl: EMind (a: R1 = Et, R2 = Me) and Eind (b: R1 = R2 = Et)], with two equivalents of tBuLi in Et2O at low temperatures resulted in the formation of blue solutions derived from the diarylsilylenes, (Rind)2Si: (3). Upon warming the solutions above −20 °C, the blue color gradually faded, accompanying the decomposition of 3 and yielding the cyclic hydrosilanes (4) via intramolecular C−H bond insertion at the Si(II) center. The molecular structures of the bulky Eind-based 3b and 4b were confirmed by X-ray crystallography. Thus, at −20 °C, blue crystals were formed (Crystal-A), which were identified as mixed crystals of 3b and 4b. Additionally, colorless crystals of 4b as a singular component were isolated (Crystal-B), whose structure was also determined by an X-ray diffraction analysis. Although the isolation of 3 was difficult due to their thermally-labile nature, their structural characteristics and electronic properties were discussed based on the experimental findings complemented by computational results. We also examined the hydrolysis of 3b to afford the silanol, (Eind)2SiH(OH) (5b).

The human landscape transforming activity contributes to the global change of vegetation in different forms. Hunting is one of the most ancient human landscape-shaping activities. Feeders for hunting are particularly disruptive to vegetation. In the present study, we conducted a vegetation survey in these highly disturbed places. We are investigating the vegetation dynamics over several years in in the turkey oak–sessile oak zone, in two areas with different moisture and shade conditions (forest and clearing). One important background factor is changes in precipitation and temperature. The novelty of our present study lies in the fact that the observation takes place with continuous disturbance, where the human influence is very large. Our results confirm that the weed infestation be detectable at bait sites over a long period, and the interannual changes were typical in every year, according to the fact that in August, more weed species are usually present with a greater cover at the bait sites. The main meteorological factors played a role in the degree of weed infestation in each year. There was a higher proportion of vegetation regeneration in wetter years, while dry periods do not favor successional processes. With the drying of the climate, the disturbed areas are constantly losing their natural value, but wetter weather is not an automatic solution either. A more precise understanding of vulnerable systems and careful planning of treatment interventions is necessary.

We report on the occurrence of natural Magnesium Alumina Silicate Hydrate (M-(A)-S-H) cement at Feragen and Leka in eastern and western Trøndelag Norway, respectively. Both occurrences are located in the sub-arctic climate zone and form in glacial till and moraine material deposited on ultramafic rock during the Weichselian glaciation. Weathering of serpentinized peridotite dissolve brucite and result in a relative high pH alkaline fluid that subsequently reacts with the felsic minerals of the till (quartz, plagioclase, K-feldspar) to form a cement consisting of an amorphous material or a mixture of nanocrystalline Mg-rich phyllosilicates, including illite. The presence of plagioclase in the till results in the enrichment of alumina in the cement, i.e., forms M-A-S-H instead of the M-S-H cement. Dissolution of quartz results in numerous etch-pits and negative quartz crystals filled with M-A-S-H cement. Where the quartz dissolution is faster that the cement precipitation, a honeycomb-like texture is formed. Compositionally the cemented till (tillite) contains more MgO and has a higher loss of ignition than the till, suggesting that the cement is formed by a MgO fluid that previously reacted with the peridotite. The M-(A)-S-H cemented till represent a new type of duricrust, coined magsilcrete. The study of natural Mg-cement provides information on peridotites as a Mg-source for Mg-cement and as a feedstock for CO2 sequestration.

In this paper a full state feedback control of a double inverted pendulum on a cart (DIPC) are designed and compared. Modeling is based on Euler-Lagrange equations derived by specifying a Lagrangian, difference between kinetic and potential energy of the DIPC system. A full state feedback control with H infinity and H 2 is addressed. Two approaches are tested: open loop impulse response and a double inverted pendulum on a cart with full state feedback H infinity and H 2 controllers. Simulations reveal superior performance of the double inverted pendulum on a cart with full state feedback H infinity controller.

Using the h-index to assess individual researchers is not only unethical and unfair but also inaccurate and misleading. This index fails to offer a reliable measure of a researcher's impact based on their citation scores. Beyond statistical and conceptual considerations, authorship practices, especially in the case of multi-authored publications, give rise to significant problems that often go unnoticed. While some modifications of the h-index have been proposed to mitigate these weaknesses, the fundamental deficiencies persist. Most of these flaws have been effectively addressed by the c-score, a composite citation index. The c-score excludes self-citations, normalizes the number of citations by considering the number of authors in each paper, and takes into account first, single, and last authorship. This approach provides a more realistic measure of the impact of each individual researcher based on raw citations.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In this data deposit, I describe a dataset that is the result of content mining 167,318 published articles for statistical test results. As a result of this content mining, 688,112 results from 50,845 articles were extracted. In order to provide a comprehensive set of data, the statistical results are supplemented with metadata from the article they originate from. The dataset is provided in a comma separated file (CSV) in long-format. For each of the 688,112 results, 20 variables are included, of which seven are article metadata and 13 pertain to the individual statistical results (e.g., reported and recalculated p-value). A five-pronged approach was taken to generate the dataset: (i) collect journal lists, (ii) spider journal pages for articles, (iii) download articles, (iv) add article metadata, and (v) mine articles for statistical results.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

In this paper, we propose an imagined speech-based brain wave pattern recognition using deep learning. Multiple features were extracted concurrently from eight-channel Electroencephalography (EEG) signals. To obtain classifiable EEG data with fewer number of sensors, we placed the EEG sensors on carefully selected spots on the scalp. To decrease the dimensions and complexity of the EEG dataset and to avoid overfitting during the deep learning algorithm, we utilized the wavelet scattering transformation. A low-cost 8-channel EEG headset was used with MATLAB 2023a to acquire the EEG data. The Long-Short Term Memory Recurrent Neural Network (LSTM-RNN) was used to decode the identified EEG signals into four audio commands: Up, Down, Left, and Right. Wavelet scattering transformation was applied to extract the most stable features by passing the EEG dataset through a series of filtration processes. Filtration has been implemented for each individual command in the EEG datasets. The proposed imagined speech-based brain wave pattern recognition approach achieved a 92.50% overall classification accuracy. This accuracy is promising for designing a trustworthy imagined speech-based Brain-Computer Interface (BCI) future real-time systems. For better evaluation of the classification performance, other metrics were considered, and we obtained 92.74%, 92.50% and 92.62% for precision, recall, and F1-score, respectively.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

A modular approach to the construction of electric machines, drive systems, power supply systems is a new direction of modern technology development. Especially, the modular approach is promising for electric vehicles due to such positive aspects as increased efficiency, fault tolerance, overall reliability, safety, enhanced control capabilities, etc. In this work, the modular approach is comprehensively applied to an EV powertrain system, which includes a dual three-phase (DTP) BLDC motor with two machine modules of an asymmetric configuration, two battery modules and a supercapacitor module (SCM). The proposed H–H configuration of modular EV powertrain system includes four voltage source inverters that combine the power modules with the open ends of the windings (OEW) of the module machine armature, and provide control of their operation. Based on the developed mode system of the OEW machine module operation for EV traction and braking, a general control algorithm for the proposed configuration of the modular EV powertrain system has been developed. It combines the control of the operating modes with the functions of maintaining the required SOC level of the SCM and equalizing the SOCs of the two battery modules. The conducted simulation and experimental studies confirmed the workability and effectiveness of the proposed solutions.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

In this paper, the design and analysis of coupled tank water level control system is done using robust control theory. The main aim of this work is to improve level controlling mechanisms in industries and household areas. In this paper, H ∞ and μ –synthesis controllers are designed to improve the level control system. The coupled tank water level control system is designed using the proposed controller’s comparison and tested for tracking a reference level signals (step, sine wave and random) and simulation results have been analyzed successfully. Finally the comparative simulation results prove the effectiveness of the proposed coupled tank water level control system with H ∞ controller for improving the tracking mechanism performance of the system.

In this work, we introduce the class of h-MN-convex functions by generalizing the concept of MN-convexity and combining it with h-convexity. Namely, let M : [0, 1] → [a, b] be a Mean function given by M (t) = M (t; a, b); where by M (t; a, b) we mean one of the following functions: A_t (a, b) := (1 − t) a + tb, G_t (a, b) = a^1−tb^t and H_t (a, b) := $\frac{ab}{ta+\left(1-t\right)b}=\frac{1}{A_t\left(\frac{1}{a},\frac{1}{b}\right)}$ with the property that M (0; a, b) = a and M (1; a, b) = b. Let I, J be two intervals subset of (0, ∞) such that (0, 1) ⊆ J and [a, b] ⊆ I. Consider a non-negative function h : J → (0, ∞), a function f : I → (0, ∞) is said to be h-MN-convex (concave) if the inequality f (M (t; x, y)) ≤ (≥) N (h(t); f (x), f (y)), holds for all x, y ∈ I and t ∈ [0, 1]. In this way, nine classes of h-MN-convex functions are established, and therefore some analytic properties for each class of functions are explored and investigated. Characterizations of each type are given. Various Jensen’s type inequalities and their converses are proved.

One of the main challenges of cultured meat is reducing the costs of production, often described as scaling. The main components of the cultivation process include: cells, media, scaffolds and bioreactors. This work presents an alternative to current stainless steel or glass bioreactors and uses food-grade plant-based scaffolds. Bioreactors must be sterile and leak-free to maintain a proper environment for cell growth. Thermoplastic films are a popular material for constructing these fluidic systems, but traditional methods of welding these film are expensive and do not allow rapid prototyping resulting in high research and development costs for companies. In this study, a laser welding method was developed to join thermoplastic films in a way that prevents contamination and leaks, affording effective macro-fluidics fabrication. This technique was tested using polyethylene (PET) films and a laser cutter operating with settings calibrated for the material to be welded or cut. The laser welding method was found to produce strong, leak-free seals in PET films with minimal heat-induced damage to the films. The ability to design fluidics, chambers and ports of various size. Using this method afforded the incorporation of plant-based scaffolds from food-grade plants (Rice). The laser welding method developed in this study provides a reliable, contamination-free method for the rapid fabrication of fluidic systems for cell cultivation. This technique has the potential to be compatible with a vast range of cell types and scaffolds and to be widely adopted in tissue engineering for regenerative medicine and food applications such as cultured meat.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Detecting and monitoring changes in soil salinity through remote sensing provides an opportunity for field assessment in regions where on-site measurements are limited. This investigation, carried out in Siwa Oasis, Egypt, aimed to assess the efficacy of several soil salinity indices derived from Landsat 5 and 7 satellite images. To achieve this, 56 on-site ground measurements were utilized for evaluation purposes. The study aimed to improve the correlation between EC and index values and explore the relationship between salinity and changes in land cover. Eleven spectral indices were calculated for nine scenes captured in different months from August to December. The first approach involved stacking the data to identify the index with the strongest correlation with ground EC values, without the need for complex analysis or EC value ranging. In the second approach, the ground EC measurements were classified into seven different salinity categories, and the correlation coefficient was calculated between each index and each salinity category. The third approach analyzed the data temporally, considering different salinity levels. Lastly, a spatial correlation analysis was conducted between EC and index values in the fourth scenario. The initial approach revealed a weak correlation due to substantial variation in EC values. However, the SI index demonstrated the highest correlation coefficient of 0.38. In the second scenario, the S2 index exhibited the highest correlation of 0.96 for moderate salinity samples. The third scenario showed that the S1 index achieved the highest correlation value of 0.99 for moderately saline areas. In the fourth scenario, the SI index exhibited the strongest correlation among all four ponds with correlation coefficients of 0.23, 0.23, 0.18, and 0.61. Notably, the correlations observed in the second and third scenarios demonstrated higher correlation coefficients compared to both the first and fourth scenarios. The study highlighted significant variations in EC levels related to land cover types and pond elevation. Additionally, remote sensing methods detected a 48% increase in total vegetated area over 17 years, showing the potential of remote sensing techniques in salinity monitoring for expanding agriculture and improving land management.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Coral reefs are declining worldwide due to global changes in the marine environment. The increasing frequency of massive bleaching events in the tropics is highlighting the need to better understand the stages of coral physiological responses to extreme conditions. Moreover, like many other coastal regions, coral reef ecosystems are facing additional localized anthropogenic issues such as nutrient loading, increased turbidity, and coastal development. Different strategies have been developed to measure the health status of a damaged reef, ranging from the resolution of individual polyps to an entire coral community, but techniques for measuring coral physiology in situ are not yet widely implemented. For instance, while there are many studies of the coral holobiont response in single or limited-number multiple stressor experiments, they provide only partial insights to metabolic performance under more complex temporally and spatially variable natural conditions. Here, we discuss the current status of coral reefs and their global and local stressors in the context of experimental techniques that measure core processes in coral metabolism (respiration, photosynthesis, and biocalcification) in situ, and their role in indicating the health status of colonies and communities. We highlight the need to improve the capability of in situ studies in order to better understand the resilience and stress response of corals under multiple global and local scale stressors.

This paper aims to unify q-derivative/q-integral and h-derivative/h-integral in a single definition, this will be called q−h-derivative/q−h-integral. These notions are further extended on finite interval [a,b] in the form of left and right q−h-derivatives and q−h-integrals. Some inequalities are studied for q−h-integrals which are directly connected with well known results. In diverse fields of science and engineering the theory based on q-derivatives/q-integrals and h-derivatives/h-integrals can be unified by using the concept of q−h-derivative/q−h-integral.

In this study, we define new classes of convexity called of h-Godunova-Levin and h-Godunova-Levin preinvexity, through which some new inequalities of Hermite-Hadamard type were established. These new classes are the generalisation of several known convexity including the s-convex, P-function, Godunova-Levin. Further, the properties of h-Godunova-Levin function were also discussed. Meanwhile, the applications of h-Godunova-Levin Preinvex function are given

In this work, several inequalities of Popoviciu type for h-MN-convex functions are proved, where M and N are denote to Arithmetic, Geometric and Harmonic means and h is a non-negative superadditive or subadditive function.

Renewable resources gain increasing interest as source for environmentally benign biomaterials, such as drug encapsulation/release compounds, and scaffolds for tissue engineering in regenerative medicine. Being the second largest naturally abundant polymer, the interest in lignin valorization for biomedical utilization is rapidly growing. Depending on resource and isolation procedure, lignin shows specific antioxidant and antimicrobial activity. Today, efforts in research and industry are directed toward lignin utilization as renewable macromolecular building block for the preparation of polymeric drug encapsulation and scaffold materials. Within the last five years, remarkable progress has been made in isolation, functionalization and modification of lignin and lignin-derived compounds. However, literature so far mainly focuses lignin-derived fuels, lubricants and resins. The purpose of this review is to summarize the current state of the art and to highlight the most important results in the field of lignin-based materials for potential use in biomedicine (reported in 2014–2018). Special focus is drawn on lignin-derived nanomaterials for drug encapsulation and release as well as lignin hybrid materials used as scaffolds for guided bone regeneration in stem cell-based therapies.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

In airborne sensor networks (ASNs), the media access control (MAC) protocol is facing with serious unfairness problem due to the traditional protection mechanism of air-to-air communications among aircrafts. Actually by using the binary exponential back-off algorithm at high traffic loads to minimize collisions among users, the latest successful node can always benefit from this kind of MAC to obtain channel resources. Moreover, when taking the existence of the hidden nodes in ASNs into account, the inaccurate traffic load information will further aggravate the system’s unfairness. In this paper, a neighbor-channel-aware (NCA) protocol is proposed to improve the fairness of MAC protocol in ASNs. In the proposal, the NCA frame is firstly added and exchanged between neighbor nodes periodically, which helps to resolve the inaccurate traffic load information, so as to avoid reducing the probability of successful message transmission. Then a traffic-loading based back-off algorithm is involved to make the neighbor nodes cooperatively adjust the inter-frame space (IFS) interval to further reduce the unfairness. The simulation results show that, the proposed MAC protocol can guarantee the satisfied fairness, simultaneously avoiding heavy network overloads to protect key messages’ successful transmissions in ASNs.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

On the H-type group G⊂Rm×Rn, we study the existence of solutions for the Brezis-Nirenberg problem

Most Acinetobacter baumannii strains are naturally competent. Although some information is available about factors that enhance or reduce the frequency of transformation of this bacterium, the regulatory elements and mechanisms are barely understood. In this article, we describe studies on the role of H-NS in the regulation of expression of genes related to natural competency and the ability to uptake foreign DNA. The expression levels of the natural transformation-related genes pilA, pilT, pilQ, comEA, comEC, comF, and drpA were significantly increased in a Δhns derivative of Acinetobacter baumannii A118. Complementation of the mutant with a recombinant plasmid harboring hns restored expression levels of six of these genes (pilT remained expressed at high levels) to those of the wild-type strain. The transformation frequency of the A. baumannii A118 Δhns strain was significantly higher than that of the wild-type. Similar, albeit not identical, effects occurred when hns was deleted from the hypervirulent A. baumannii AB5075 strain. Reduction of gene expression in a few cases was not as pronounced as to reach wild-type levels, and expression of comEA was enhanced further. In conclusion, the expression of all seven transformation-related genes was enhanced after deleting hns in A. baumannii A118 and AB5075, and these modifications are accompanied by an increase in the cells’ transformability. The results demonstrate a role of H-NS in A. baumannii’s natural competence.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Introduction: The trophoblast derived angiogenic factors are considered to play an important role in the pathophysiology of various complications of pregnancy. The aim of this study was to establish relationship between concentrations of soluble Human Leukocyte Antigen-G (sHLA-G) in maternal serum and amniotic fluid at 16-22 weeks of gestation and the sonographic measurements of the fetal and placental growth. Materials and methods: sHLA-G in serum and amniotic fluid, as well as fetal biometric data and placental volume and perfusion indices were determined in 41 uncomplicated singleton pregnancies. Results: The sHLA-G levels were unchanged both in amniotic fluid and in serum during mid-pregnancy. The sHLA-G level in serum correlated positively with amniotic sHLA-G level (β=0.63, p<0.01). Significant correlation was found between serum sHLA-G level and abdominal measurement (β=0.41, p<0.05) and estimated fetal weight (β=0.41, p<0.05). The amniotic sHLA-G level and placental perfusion (VI: β = -0.34, p<0.01 and VFI: β = -0.44, p<0.01, respectively) were negatively interrelated. A low amniotic sHLA-G level was significantly associated with nuchal translucency (r = -0.102, p<0.05). Conclusions: sHLA-G assayed in amniotic fluid might be a potential indicator for placental function, whereas the sHLA-G level in serum can be a prognostic modality for feto-placental insufficiency.

Authentic learning opportunities that simulate full scale design and construction experiences using real materials offer ideal experiential learning environments for construction and civil engineering students by challenging students to apply building concepts in practical settings. However, the excessive cost of real building materials required for this mode of education limits access to the vast majority of students. As a result, educational researchers have explored potential alternatives to provide cost-effective experiential learning through activities using mock-up materials (e.g., plastic straws, popsicle sticks) and simulation of experiences using immersive technologies (e.g., virtual reality or augmented reality). While some of these alternatives approximate the environment and others provide physical interaction with mock-up materials, the lack of authenticity in the building materials used introduces some apparent differences between the “authentic” learning environments and their cost-effective approximations. Therefore, this research aims to identify the learning processes reported by students and faculty who participated in authentic learning experiences to understand the ways in which this mode of education offers unique value to construction education. Their interview responses illustrated characteristics of authentic learning experiences that were believed to be critical to the learning process, some of which included: working in groups; interdisciplinary participants; and use of real construction materials. Although some of these characteristics are intrinsically linked to the use of real materials, others do not explicitly refer to interaction with real materials. This may indicate to aspects of the authentic learning processes that educational researchers can strategically target through more cost-effective learning environments like virtual and augmented reality. The contribution of this paper is in identifying the characteristics of authentic learning experiences that may guide educational investment and research innovations that aim to replicate some of these learning experiences through more accessible learning environments.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Reactions in water between the Cu2(µ-EGTA) chelate (EGTA = ethylene-bis(oxyethyleneimino)tetraacetate(4-) ion) and 2,6-diaminopurine (Hdap) in molar ratios 1:1 and 1:2 yield only blue crystals of the ternary compound [Cu4(μ-EGTA)2(μ-H(N3)dap)2(H2O)2]·7H2O (1) that has been studied by single crystal X-ray diffractometry, various physical methods (thermal stability, spectral and magnetic properties), as well as DFT theoretical calculations. In the crystal, uncoordinated water is disordered. The tetranuclear complex molecule also has some irrelevant disorder in an EGTA-ethylene moiety. In the complex molecule, both bridging organic molecules act as binucleating ligands. There are two distorted five- (type 4+1) and two six- (type 4+1+1) Cu(II) centres. Each half EGTA acts as a tripodal tetradentate Cu(II) chelator, with mer-NO2+O(ether, distal) conformation. Hdap exhibits the tautomer H(N3)dap, with the dissociable H-atom on its less basic N-heterocyclic atom. These features favour the efficient cooperation between Cu-N7 or Cu-N9 bonds with appropriate O-EGTA atoms, as N6-H···O or N3-H···O interligand interactions respectively. Bridging role of both organics determines the tetranuclear dimensionality of the complex in 1. In this crystal, such molecules associate in zig-zag chains, built by alternating ,-interactions between the five- or six-atom rings of Hdap ligands of adjacent molecules. DFT theoretical calculations (using two different theoretical models and characterized by the quantum theory of “atoms in molecules”) reveal the importance of these ,-interactions between Hdap ligands, as well as that corresponding to the referred hydrogen bonds in the contributed tetranuclear molecule.

Today, more than 70 million tons of lignin are produced by the pulp and paper industry every year. However, the utilization of lignin as a source for chemical synthesis is still limited due to the complex and heterogeneous lignin structure. The purpose of this study was a selective photodegradation of industrially available kraft lignin in order to obtain appropriate fragments and building block chemicals for further utilization, e.g. polymerization. Thus, kraft lignin obtained from soft wood black liquor by acidification was dissolved in sodium hydroxide and irradiated at a wavelength of 254 nm with and without the presence of titanium dioxide in various concentrations. Analyses of the irradiated products via SEC showed decreasing molar masses and decreasing polydispersity indices over time. At the end of the irradiation period the lignin was depolymerised to form fragments as small as the lignin monomers. TOC analyses showed minimal mineralisation due to the depolymerisation process.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Infections contribute to carcinogenesis through inflammation-related mechanisms. It is well established that H. pylori infection is an etiological factor in gastric carcinogenesis. However, the mechanism through which H. pylori infection contributes to the development of gastric cancer has not been fully elucidated. H. pylori-associated chronic inflammation is linked to genomic instability via reactive oxygen and nitrogen species (RONS). In this article, we summarize the current knowledge of H. pylori-induced double strand breaks (DSBs). Further, we will provide mechanistic insight into how processing of oxidative DNA damage via base excision repair (BER) leads to double strand breaks (DSBs). We review the recent progress how H. pylori infection triggers NF-kB /iNOS versus NF-kB/nucleotide excision repair (NER) axis mediated DSBs to drive genomic instability. Taken together, this review discusses current findings related to DSBs and their implications for the mechanisms of DSB repair.

In this paper we obtain some inequalities of Hermite-Hadamard type for composite convex functions. Applications for AG, AH-h-convex functions, GA, GG, GH-h-convex functions and HA, HG, HH-h-convex function are given.

Voltage-gated potassium (Kv) channels and hyperpolarization-activated cyclic nucleotide-gated (HCN) channels share similar structures but have opposite gating polarity. Kv channels have a strong coupling ( &gt;109) between the voltage sensor (S4) and the activation gate: when S4s are activated the gate is open to &gt;80%, but when S4s are deactivated, the gate is open &lt; 10-9 of the time. Using noise analysis, we show that the coupling between S4 and the gate is &lt; 200 in HCN channels. In addition, using voltage clamp fluorometry, locking the gate open in a Kv channel drastically altered the energetics of S4 movement. In contrast, locking the gate open or decreasing the coupling between S4 and the gate in HCN channels had only minor effects on the energetics of S4 movement, consistent with a weak coupling between S4 and the gate. We propose that this loose coupling is a prerequisite for the reversed voltage gating in HCN channels.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

In this study, the degradable superhydrophobic Mg/P/Z/F/H (magnesi-um/poly(-caprolactone)/zinc oxide/1H,1H,2H,2H-perfluorodecyltriethoxysilane (PFDTES)/ heating process) composite materials were prepared through one-step method for enhancing the corrosion resistance of AZ91D magnesium alloys. Electrochemical measurements showed that Mg/P/Z/F/H materials significantly improved the corrosion resistance of magnesium alloys in 3.5 wt.% NaCl. The self-cleaning, adhesion and stability tests suggested that Mg/P/Z/F/H composite materials had well self-cleaning properties, good adhesion strength and stability in wet atmosphere.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

The antiradical and antimicrobial activity of lignin and lignin-based films are both of great interest for applications such as food packaging additives. The polyphenol structure of lignin in addition to the presence of O-containing functional groups is potentially responsible for these activities. This study used DPPH assays to discuss the antiradical activity of HPMC/lignin and HPMC/lignin/chitosan films. The scavenging activity (SA) of both binary (HPMC/lignin) and ternary (HPMC/lignin/chitosan) systems was affected by the percentage of the added lignin: the 5% addition showed the highest activity and the 30% addition had the lowest. Both, scavenging activity and antimicrobial activity are depending on the biomass source showing the following trend: organosolv of softwood > Kraft of softwood > organosolv of grass. Testing the antimicrobial activities of lignins and lignin-containing films showed high antimicrobial activities against gram-positive and gram-negative bacteria at 35 °C and at low temperatures (0-7 °C). Purification of kraft lignin has a negative effect on the antimicrobial activity while storage has positive effect. The lignin release in the produced films affected the activity positively and the chitosan addition enhances the activity even more for both gram-positive and gram-negative bacteria. Testing the films against spoilage bacteria that grow at low temperatures revealed the activity of the 30% addition on HPMC/L1 film against both B. thermosphacta and P. fluorescens while L5 was active only against B. thermosphacta. In HPMC/lignin/chitosan films the 5% addition exhibited activity against both B. thermosphacta and P. fluorescens.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Modern Monte-Carlo-based rendering systems still suffer from the computational complexity involved in the generation of noise-free images, making it challenging to synthesize interactive previews. We present a framework suited for rendering such previews of static scenes using a caching technique that builds upon a linkless octree. Our approach allows for memory-efficient storage and constant-time lookup to cache diffuse illumination at multiple hitpoints along the traced paths. Non-diffuse surfaces are dealt with in a hybrid way in order to reconstruct view-dependent illumination while maintaining interactive frame rates. By evaluating the visual fidelity against ground truth sequences and by benchmarking, we show that our approach compares well to low-noise path traced results, but with a greatly reduced computational complexity allowing for interactive frame rates. This way, our caching technique provides a useful tool for global illumination previews and multi-view rendering.

The focus of our study was the changes in the composition of semi-natural dry grasslands in Hungary. Since these valuable habitats were created with the help of humans, their preservation also requires regular treatment. Our mowing experiment aimed to investigate the suppression of the native Calamagrostis epigejos L. Roth. In Hungary, in the Cserhát Mountains, eight permanent plots were mowed twice a year. The vegetation was sampled annually between 2001 and 2011. The effects of mowing were investigated with repeated measures analysis of variance (ANOVA). After 10 years, the C. epigejos cover of the mowed plots decreased significantly, from the initial average of 62.38 to 7.50%. Surprisingly, we also experienced a similar decrease in the control plots. Regular treatment also had a positive effect on the number of species and diversity. Species richness increased continuously in both treatment types, which indicates the combined effect of vegetation succession and treatment. The biomass growth of other Poaceae and Fabaceae species, which are important from a grassland management perspective, was also facilitated by mowing. Our results suggest that long-term in situ experiments and continuous botanical studies are needed to establish a reliable utilization of grasslands.

This paper addresses a mode-dependent state-feedback H∞ control for descriptor hybrid systems, considering both the absence and presence of actuator saturation. Firstly, the necessary and sufficient conditions for the stochastic admissibility criterion with H∞ performance ? of the closed-loop system is proposed. Given the proposed non-convex condition, the author reformulates it into linear matrix inequalities (LMIs). Then, to extend the result to the systems with actuator saturation, the actuator saturated control input is expressed as a linear combination of given state-feedback control input and a virtual control input that remains under the saturation level. To verify this expression, the set invariant condition is also suggested by using the singular mode-dependent Lyapunov function candidate. Therefore, the LMI conditions for the existence of the mode-dependent state-feedback H∞ control and the ellipsoidal shape of invariant set are successfully derived. Two numerical examples demonstrate the effectiveness of the proposed approach in optimizing H∞ performance $\gamma$ and identifying the largest invariant set.

The purpose of this study is to estimate the mean transitioning probabilities from a Healthy state to malaria positive uncomplicated state or to malaria positive severe state. It also classifies the various transitioning probabilities of moving through the various states based on some baseline characteristics. Malaria test results for 2019 over a 12-month period were collected from the University of Ghana school clinic. An H-U model for the study was developed and the transition rates from the cross-sectional data are indicated. With two states Healthy (H) and Uncomplicated (U) forming a state space, there were four possible transitions. The results show that the probability of transitioning from a Healthy state to a malaria positive state is 0.03% while the probability that an individual will remain at Healthy state (H) after the test is 99.73%. It was found that if an individual is already positive and has taken medication the probability that its second test came out negative is 6.45% while the chances that it will remain positive but uncomplicated is 93.55%. The study also showed that in the long run, about 95.98% of persons who visited the student clinic with malaria symptoms recorded negative tests for malaria parasite while about 4% recorded positive for malaria. In terms of disaggregation by gender, it was realized that the number of reported negative test results were higher for females (97.08%) than for males (96.13%). However, the infection rate is higher for males (3.87%) than females (2.92%). It is recommended that in as much as the University of Ghana has two health centers (a clinic and hospital), there should be a centralized system to track students’ health so research done would not be biased.

In this paper, modelling designing and simulation of a Ward Leonard layout system is done using robust control theory. In order to increase the performance of the Ward Leonard layout system with H infinity optimal control synthesis and H infinity optimal control synthesis via gamma-iteration controllers are used. The open loop response of the Ward Leonard layout system shows that the system needs to be improved. Comparison of the Ward Leonard layout system with H∞ optimal control synthesis and H infinity optimal control synthesis via gamma-iteration controllers to track a desired step speed input have been done. Finally, the comparative simulation results prove the effectiveness of the proposed Ward Leonard layout system with H infinity optimal control synthesis controller in improving the percentage overshoot and the settling time.

Papain-like lysosomal cysteine proteases include 11 human cysteine cathepsins which act as endopeptidases and/or exopeptidases. They are involved in numerous physiological and pathological processes. Among them, only cathepsins B, H, C, and X/Z exhibit exopeptidase activity. Their activities are tightly regulated in various ways to prevent potentially hazardous effects on the cell. In this review, we focus on the structural and functional aspects of these four cysteine cathepsins and their role in neurodegeneration and cancer. Neurodegenerative disorders of aging share an endolysosomal dysfunction and accumulation and spread of oligomeric forms of neurotoxic proteins. The accumulation of various protein aggregates activates the microglia, thus inducing the activation and release of cysteine cathepsins and proinflammatory cytokines, leading to neurodegeneration. In cancer, cysteine cathepsins participate in tumor progression and metastasis. Tumor–stromal crosstalk leads to activation of the stroma and overexpression and secretion of proteolytic enzymes, triggering extracellular matrix degradation and the release of soluble factors. Activated stromal cells (i.e., macrophages, fibroblasts, mast cells) secrete additional growth factors, cytokines, and chemokines that are responsible for the regulation of processes leading to tumor progression and metastasis. Therefore, a better understanding of the role of cysteine cathepsins in neurodegeneration and cancer could lead to novel targeted therapeutic approaches.

In this paper, the design and control of a hydraulic system based tire changer machine have been analyzed and simulated using Matlab/Simulink Toolbox successfully. The machine have a displacement input which is a leg pedal displacement in order to push the piston of the pump to fed the motor with a pressured hydraulic fluid to rotate the tire with an angular speed to mount and dismount it. Augmentation based H_∞ and H₂ optimal synthesis controllers have been used to improve the performance of the machine. Comparison of the proposed controllers for tracking a reference input speed have been done using two reference inputs (step and random) signals. Finally the comparative simulation results proved the effectiveness of the proposed tire changer with H synthesis controller in improving the settling time and percentage overshoot.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

Many corporations have now revised their value statements to showcase their commitment to sustainable development and green business due to the pressing issues of climate and environmental damage. Despite the importance of value statements that can direct companies to achieve sustainable goals, what kind of values can be perceived as organizational orientations to sustainability remains unknown. This study explores how the general public views the inclusion of sustainable components in value statements from the listed companies in Hong Kong by using Q-sort methodology (n = 30). Analyzing the final sample of 40 value statements extracted from 27 listed companies, we identified three factors related to sustainability, namely, Empowering business process management, Empowering customer-centric excellence, and Empowering sustainable progress. This study provides an additional component to the traditional triple bottom line by suggesting that internal operation of a company is an emerging idea to understand corporate sustainability.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

The reaction of mercaptoacetic acid esters with pentachloro-2-nitro-1,3-butadiene provides appropriate precursors for the synthesis of 2,3,4-trisubstituted benzo[h]quinolines. These heterocycles are easily accessible via a single-step reaction with 1-naphthyl- or 1-anthracenylamine, respectively. Due to steric bulk and high electron density ring closure to benzo[h]quinolines takes place, exclusively. Such highly substituted annelated pyridine systems can be modified in subsequent, selective reactions to build up new N-heterocycles with promising microbiological properties. Antibacterial and antiproliferative assays against four cell mammalian cell lines demonstrate that some of the sulfur-substituted benzo[h]quinolines analogs display potent phenotypic bioactivities in the single-digit micromolar range.

Hypotrochoidal profile contours have been produced in industrial applications in recent years using twin-spindle processes, and they are considered effective high-quality solutions for positive shaft–hub connections. This study mainly concerns analytical approaches to determine the bending stresses in hypotrochoidal profile shafts. The formulation was developed according to bending principles using the mathematical theory of elasticity and conformal mappings. The loading was further used to investigate the rotating bending behaviour. The stress factors for the classical calculation of maximum bending stresses were also determined for all those profiles presented and compiled in the German standard DIN3689-1 for practical applications. The results were also compared with the corresponding numerical and experimental results, and very good agreement was observed. Additionally, based on previous work, the stress factor was determined for the case of torsional loading to calculate the maximum torsional stresses in the standardised profiles, and the results are listed in a table. This study contributes to the further refinement of the current DIN3689 standard.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Cervical cancer is one of the ailments that endangers the health of women all over the world and causes infertility. Fortunately, this disease can be avoided. Both the results and participation rates of the current preventative strategy remain poor. Hence, preventative or early detection methods remain challenging and open. In gynecology and computer science fields, few studies on identifying cervical cancer are based on behavior risk factor and machine learning. Moreover, various social and behavioral aspects might often make it more difficult to detect cervical cancer especially in low‑ and middle‑income countries (LMICs). Accordingly, focus on predicting the presence of cervical cancer through behavioral risk factors is the basic structure of this research. We proposed an approach to classify cervical cancer from a social-behavioral perspective using logistic regression to predict cervical cancer. We got significantly improved outcomes than the existing methods. Moreover, we used feature engineering to formulate less dimensionality as a pre-processing step and optimized parameters to be prepared for classification phase. The results proved that using the logistic regression with regularization type L1 had a promising performance. The accuracy of Logistic Regression (LR) L1 was 97.2%. Such results support the proposed work as a reliable classification predictive tool.

Due to the digitization and Internet of Things revolutions, the present electronic world has a wealth of cybersecurity data. Efficiently resolving cyber anomalies and attacks is becoming a growing concern in today's cyber security industry all over the world. Traditional security solutions are insufficient to address contemporary security issues due to the rapid proliferation of many sorts of cyber-attacks and threats. Utilizing artificial intelligence knowledge, especially machine learning technology, is essential to providing a dynamically enhanced, automated, and up-to-date security system through analyzing security data. In this paper, we provide an extensive view of machine learning algorithms, emphasizing how they can be employed for intelligent data analysis and automation in cybersecurity through their potential to extract valuable insights from cyber data. We also explore a number of potential real-world use cases where data-driven intelligence, automation, and decision-making enable next-generation cyber protection that is more proactive than traditional approaches. The future prospects of machine learning in cybersecurity are eventually emphasized based on our study, along with relevant research directions. Overall, our goal is to explore not only the current state of machine learning and relevant methodologies but also their applicability for future cybersecurity breakthroughs.

Artificial Intelligence (AI) is a leading technology of the current age of the Fourth Industrial Revolution (Industry 4.0 or 4IR), with the capability of incorporating human behavior and intelligence into machines or systems. Thus AI-based modeling is the key to building automated, intelligent, and smart systems according to today's needs. To solve real-world issues various types of AI such as analytical, functional, interactive, textual, and visual AI can be applied to enhance the intelligence and capabilities of an application. However, developing an effective AI model is a challenging task due to the dynamic nature and variation in real-world problems and data. In this paper, we present a comprehensive view on "AI-based Modeling" with the principles and capabilities of potential AI techniques that can play an important role in developing intelligent and smart systems in various real-world application areas including business, finance, healthcare, agriculture, smart cities, cybersecurity and many more. We also emphasize and highlight the research issues within the scope of our study. Overall, the goal of this paper is to provide a broad overview of AI-based modeling that can be used as a reference guide by academics and industry people as well as decision-makers in various real-world scenarios and application domains.

Educational institutions must identify students who are academically struggling to provide them with necessary support to improve their performance. In this context, recommendation systems powered by deep learning techniques are vital for detecting and categorizing such students. These systems help students plan their future by uncovering patterns in their historical academic data. This study introduces a new deep learning model designed to classify academically underperforming students in educational settings. The model incorporates a Gated Recurrent Neural Network (GRU) and includes specific neural network features like a dense layer, max-pooling layer, and the ADAM optimization algorithm. The model's training and evaluation were conducted using a dataset comprising 15,165 student assessment records from various academic institutions. The performance of the developed GRU model was benchmarked against other educational recommendation systems, including Recurrent Neural Network models, AdaBoost, and the Artificial Immune Recognition System v2. The proposed GRU model demonstrated remarkable accuracy, achieving an overall rate of 99.70%.

: Extra- and intra-cellular activity occurs under the direction of numerous inter-molecular interactions, and in any tissue or cell, molecules are densely packed, thus promoting those molecular interactions. Galectins and chemokines, the focus of this review, are small, protein effector molecules that mediate various cellular functions, in particular cell adhesion and migration, as well as cell signaling/activation. In the past, researchers have reported that combinations of these (and other) effector molecules act separately, yet sometimes in concert, but nevertheless physically apart and via their individual cell receptors. This view that each effector molecule functions independently of the other limits our thinking about functional versatility and cooperation, and, in turn, ignores the prospect of physiologically important inter-molecular interactions, especially when both molecules are present or co-expressed in the same cellular environment. This review is focused on such protein-protein interactions with chemokines and galectins, their homo- and hetero-oligomeric structures that they can form, and the functional consequences of those paired interactions.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Due to the rising dependency on digital technology, cybersecurity has emerged as a more prominent field of research and application that typically focuses on securing devices, networks, systems, data and other resources from various cyber-attacks, threats, risks, damages, or unauthorized access. Artificial Intelligence (AI), also referred to as a crucial technology of the current Fourth Industrial Revolution (Industry 4.0 or 4IR), could be the key to intelligently dealing with these cyber issues. Various forms of AI methodologies, such as analytical, functional, interactive, textual as well as visual AI can be employed to get the desired cyber solutions according to their computational capabilities. However, the dynamic nature and complexity of real-world situations and data gathered from various cyber sources make it challenging nowadays to build an effective AI-based security model. Moreover, defending robustly against adversarial attacks is still an open question in the area. In this paper, we provide a comprehensive view on "Cybersecurity Intelligence and Robustness", emphasizing multi-aspects AI-based modeling and adversarial learning that could lead to addressing diverse issues in various cyber applications areas such as detecting malware or intrusions, zero-day attacks, phishing, data breach, cyberbullying and other cybercrimes. Thus the eventual security modeling process could be automated, intelligent, and robust compared to traditional security systems. We also emphasize and draw attention to the future aspects of cybersecurity intelligence and robustness along with the research direction within the context of our study. Overall, our goal is not only to explore AI-based modeling and pertinent methodologies but also to focus on the resulting model's applicability for securing our digital systems and society.

The digital world has a wealth of data, such as Internet of Things (IoT) data, business data, health data, mobile data, urban data, security data, and many more, in the current age of the Fourth Industrial Revolution (Industry 4.0 or 4IR). Extracting knowledge or useful insights from these data can be used for smart decision-making in various applications domains. In the area of data science, advanced analytics methods including machine learning modeling can provide actionable insights or deeper knowledge about data, which makes the computing process automatic and smart. In this paper, we present a comprehensive view on "Data Science'' including various types of advanced analytics methods that can be applied to enhance the intelligence and capabilities of an application through smart decision-making in different scenarios. We also discuss and summarize ten potential real-world application domains including business, healthcare, cybersecurity, urban and rural data science, and so on by taking into account data-driven smart computing and decision making. Based on this, we finally highlight the challenges and potential research directions within the scope of our study. Overall, this paper aims to serve as a reference point on data science and advanced analytics to the researchers and decision-makers as well as application developers, particularly from the data-driven solution point of view for real-world problems.

Vehicle windshield wiper system increases the driving safety by contributing a clear shot viewing to the driver. In this paper, modelling, designing and simulation of a vehicle windshield wiper system with robust control theory is done successfully. H∞ loop shaping and robust pole placement controllers are used to improve the wiping speed by tracking a reference speed signals. The reference speed signals used in this paper are step and sine wave signals. Comparison of the H∞ loop shaping and robust pole placement controllers based on the two reference signals is done and convincing results have been obtained. Finally the comparative results prove the effectiveness of the proposed H∞ Loop Shaping controller to improve the wiping mechanism for the given two reference signals.

Nanoindentation load-depth (P-h) plots is the basis for determination of mechanical properties of the samples and is especially vital for thin coatings deposited on substrates of various mechanical makeup from amorphous-brittle (borosilicate glass) to Silicon (having different crystallographic texture) to ductile substrates like stainless steel as well other aspects like indenter tip shape. The elastic-plastic response by simulated P-h plots as per modified empirical relations have been presented. The outcomes of this computational studies enlighten the database on the P-h plots for various coating/substrate systems and shall aid in the analysis of experimental P-h plots obtained,

Na⁺/H⁺ exchangers (NHEs) are known to be important regulators of pH in multiple intracellular compartments of eukaryotic cells. Sperm function is especially dependent on changes in pH and thus it has been postulated that NHEs play important roles in regulating the intracellular pH of these cells. For example, in order to achieve fertilization, mature sperm must maintain a basal pH in the male reproductive tract and then alkalize in response to specific signals in the female reproductive tract during the capacitation process. Eight NHE isoforms are expressed in mammalian testis/sperm: NHE1, NHE3, NHE5, NHE8, NHA1, NHA2, NHE10, and NHE11. These NHE isoforms are expressed at varying times during spermatogenesis and localize to different subcellular structures in developing and mature sperm where they contribute to multiple aspects of sperm physiology and male fertility including proper sperm development/morphogenesis, motility, capacitation, and the acrosome reaction. Previous work has provided evidence for NHE3, NHE8, NHA1, NHA2, and NHE10 being critical for male fertility in mice and NHE10 has recently been shown to be essential for male fertility in humans. In this article we review what is known about each NHE isoform expressed in mammalian sperm and discuss the physiological significance of each NHE isoform with respect to male fertility.

A simple undirected graph $\Gamma=(V_\Gamma,E_\Gamma)$ admits an $H$-covering if every edge in $E_\Gamma$ belongs to at least one subgraph of $\Gamma$ that isomorphic to a graph $H$. For any graph $\Gamma$ admitting $H$-covering, a total Labelling $\beta: V_\Gamma \cup E_\Gamma \longrightarrow \{1,2,\dots,p\}$ is called an $H$-irregular total $p$-labelling of $\Gamma$ if every two different subgraphs $H_1$ and $H_2$ of $\Gamma$ isomorphic to $H$ have distinct weights where the weight $w_\beta(K)$ of subgraph $K$ of $\Gamma$ is defined as $w_f(K):=\displaystyle \sum_{v\in V_K} f(v) + \sum_{e\in E_K} f(e)$. The smallest number $p$ for which a graph $\Gamma$ admits an $H$-irregular total $p$-labelling is called the total $H$-irregularity strength of $\Gamma$ and is denoted by $ths(\Gamma)$. In this paper, we determine the total $H$-irregularity strength of edge comb product of two graphs.

This article will briefly review the progress of h-BN based solid-state metal semiconductor metal (MSM) neutron detectors. In the last decade, several groups have been working on hexagonal boron nitride (h-BN) based solid-state neutron detectors. Recently, the detection efficiency of 59% has been reported. Efficient, low-cost neutron detectors made from readily available materials are essential for various applications. Neutron detectors are widely used to detect fissile materials and nuclear power plants for security applications. The most common and widely used neutron detectors are 3He based, which are sometimes bulky, difficult to transport, have high absorption length, need relatively high bias voltage (>1000 V), and have low Q-value (0.764 MeV). Also, 3He is not readily available material. Thus, there is a strong need to find an alternative detection material. 10B isotope has a high neutron absorption cross-section, and it has been tested as a coating on the semiconducting materials. Due to the two-step process, neutron capture through 10B, and then electron-hole pair generation in a typical semiconducting material, the efficiency of these devices is not up to the mark. The progress in h-BN based detectors requires a review to envision the further improvement in this technology.

A methodology based on the concepts that arise from Density Functional Theory named Conceptual Density Functional Theory (CDFT) was chosen for the calculation of some global and local reactivity descriptors of the Discodermins A-H family of marine peptides through the consideration of the KID (Koopmans in DFT) technique that was successfully used in previous studies of this kind of molecular systems. The determination of active sites of the studied molecules for different kind of reactivities was achieved by resorting to some CDFT-based descriptors like the Fukui functions as well as the Parr functions derived from Molecular Electron Density Theory (MEDT). A few properties identified with their ability to behave as a drug and the bioactivity of the peptides considered in this examination were acquired by depending on a homology model by studying the correlation with the known bioactivity of related molecules in their interaction with various biological receptors. With the further object of analyzing their bioactivity some parameters of usefulness for future QSAR studies, their predicted biological targets and the the ADME (Absorption, Distribution, Metabolism, and Excretion) parameters related to the Discodermins A-H pharmacokinetics are also reported.

Customs law and procedures are important part of the trade system in Jordan. They regulate the flow of goods across the borders. The purpose of this paper is to examine Jordan's import regime by analyzing customs law, rules of origin, free trade zones, and tariffs reform.

The Jordanian Law of Commercial Agents and Intermediaries No. 28 of 2001 and the Emirati Commercial Agency Law No. 2 of 2010 cover all forms of sale contracts through intermediaries. These Laws provide express restrictions and protective provisions on the conduct by local agents of internal commercial agency activities. However, these statutory protections are granted only to registered agencies conducted by national agents.The Jordanian legislator does not regulate the issue of agency exclusivity, which can constitute a restraint of trade and leads to a state of market monopolization. Courts in Jordan have exclusive jurisdiction in settling disputes arising out of agency agreements. However, this exclusive jurisdiction does not cover unregistered commercial agencies which are treated as enforceable commercial contracts under the general provisions prescribed in the Commercial Code.Under the Jordanian Law the principal cannot terminate the agency agreement at any time, but he can dismiss its renewal upon the expiry of its date without justified grounds. Certain statutory protections provided by the Jordanian laws raise barriers to entry to their national markets. This statutory policy violates the specific commitments made by Jordan with respect to market access and national treatment established by the GATS.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The central nervous system (CNS) is the final frontier in drug delivery because of the blood-brain barrier (BBB), which poses significant barriers to the access of most drugs to their targets. Kynurenic acid (KYNA), a tryptophan (Trp) metabolite, plays an important role in behavioral functions and abnormal KYNA levels have been observed in neuropsychiatric conditions. The current challenge lies in delivering KYNA to the CNS owing to its polar side chain. Recently, C-3 side chain modified KYNA analogs have been shown to cross the BBB; however, it is unclear whether they retain the biological functions of the parent molecule. This study examined the impact of KYNA analogs, specifically SZR-72, SZR-104, and the newly developed SZRG-21, on behavior. The analogs were administered intracerebroventricularly (i.c.v.), and their effects on the motor domain were compared with those of KYNA. Specifically, open field (OF) and rotarod (RR) tests were employed to assess motor activity and skills. SZR-104 increased horizontal exploratory activity in the OF test at a dose of 0.04 μmol/4 μL, while SZR-72 decreased vertical activity at doses of 0.04 and 0.1 μmol/4 μL. In the RR test, however, neither KYNA nor its analogs showed any significant differences in motor skills at either dose. Side chain modification affects affective motor performance and exploratory behavior, as the results show for the first time. In this study, we showed that KYNA analogs alter emotional components such as motor-associated curiosity and emotions. Consequently, drug design necessitates the development of precise strategies to traverse the BBB while paying close attention to modifications in their effects on behavior.

Past public health crises (e.g. tobacco, alcohol, opioids, cholera, HIV, lead, pollution, venereal disease, even COVID-19) have been met with interventions targeted both at the individual and all of society. While the healthcare community is very aware that the global pandemic of non-communicable diseases (NCD’s) has its origins in our Western ultraprocessed food diet, society has been slow to initiate any interventions other than public education, which has been ineffective, in part due to food industry interference. This article provides the rationale for such public health interventions, by compiling the evidence that added sugar, and by proxy the ultraprocessed food category, meets the four criteria set by the public health community as necessary and sufficient for regulation — addiction, toxicity, ubiquity, and externalities (how does your consumption affect me?). To its credit, some countries have recently heeded this science and have instituted sugar taxation policies to help ameliorate NCD’s within their borders. This article also supplies scientific counters to food industry talking points, in order to guide both scientists and policy makers in instituting further appropriate public health measures to quell this pandemic.

Rotavirus species H (RVH) has been detected in pigs, humans and bats. Moreover, porcine RVHs have been recently identified in several swine-producing countries. Despite their zoonotic impact, genome information of RVHs is still limited. This study aimed to establish a tentative complete genome-based genotyping system for RVHs, by appending genomic sequences from 12 porcine RVHs identified in Japan between 2013 and 2015 to those from human and other porcine RVHs reported in previous studies. Phylogenetic analysis of 11 RNA segments indicated that porcine RVHs could be classified into multiple genotypes. Consequently, the genotype classification for RVHs revealed the existence of genotypes 10G, 6P, 6I, 3R, 4C, 7M, 6A, 2N, 4T, 6E, 3H for the genes VP7, VP4, VP6, VP1, VP2, VP3, NSP1, NSP2, NSP3, NSP4 and NSP5, respectively. Surprisingly, two distinctive types in NSP1 and NSP3 genes were identified from among the twelve porcine RVHs. Our data suggest a potentially novel gene rearrangement event between porcine RVH and rotavirus species C in the NSP3 gene. These findings would provide a new insight in understanding for evolution of RV.

In the current age of the Fourth Industrial Revolution ($4IR$ or Industry $4.0$), the digital world has a wealth of data, such as Internet of Things (IoT) data, cybersecurity data, mobile data, business data, social media data, health data, etc. To intelligently analyze these data and develop the corresponding real-world applications, the knowledge of artificial intelligence (AI), particularly, machine learning (ML) is the key. Various types of machine learning algorithms such as supervised, unsupervised, semi-supervised, and reinforcement learning exist in the area. Besides, the deep learning, which is part of a broader family of machine learning methods, can intelligently analyze the data on a large scale. In this paper, we present a comprehensive view on these machine learning algorithms that can be applied to enhance the intelligence and the capabilities of an application. Thus, this study's key contribution is explaining the principles of different machine learning techniques and their applicability in various real-world applications areas, such as cybersecurity, smart cities, healthcare, business, agriculture, and many more. We also highlight the challenges and potential research directions based on our study. Overall, this paper aims to serve as a reference point for not only the application developers but also the decision-makers and researchers in various real-world application areas, particularly from the technical point of view.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

The WTO is here to stay. Institutions are never perfect. The way the WTO, as an institution, runs its business may not be perfect either. Arab countries are attempting to broaden their engagement in the multilateral trading system in a manner that has many implications. This engagement includes accession to the WTO, participation in WTO dispute resolution mechanism, and representations at the WTO.