In this paper, we establish the generalized Qi-type inequality involving conformable fractional integrals. The results presented here would provide extensions of those given in earlier works.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

Sensory descriptive analysis was used to evaluate the aged Feng-flavored baijiu. The results indicated that there are notable differences in the samples of different ages. The samples with shorter storage times and fresh distilled Baijiu present bran flavor, and fresh green flavor. with the increase of storage time, the fragrance of honey, sweetness, flowers, and aging gradually increases. The samples of Feng-flavored baijiu were dected by Headspace solid-phase microextraction (HS-SPME) combined with comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC–TOFMS) , in total, 496 sustances were identified in all samples, mainly containing 14 types of substances, such as esters, aldehydes etc., of which 42 substances were found in Feng-flavored baijiu for the first time. Chemometrics was used to analyze the key differential compounds. 143 differential compounds closely related to aging were preliminarily screened, and principal component analysis revealed that these samples were separated by year. 65 differential compounds were selected out by partial least squares discriminant analysis(PLS-DA). Furthermore, 43 key differential compounds were selected from the aged Feng-flavored baijiu combined with variable importance in projection and Pearson correlation coefficients. Partial least squares regression (PLSR) was used to research the correlation of sensory properties and key differential compounds, and the results indicated that most compounds were closely related to the aged Baijiu . This study afford theoretical basis and reference for flavor research of Feng-flavored baijiu.

A millimeter-wave microstrip leaky-wave antenna array based on the substrate-integrated waveguide (SIW) and the complementary split-ring resonator (CSRR) is proposed in this paper. The slow wave characteristics of the SIW are enhanced by etching two rows of symmetrical CSRR-type slots on the surface of the SIW layer. The magnetic coupling between the CSRR-SIW layer and equally spaced circular patches array on the upper layer realizes the radiation of electromagnetic energy. In the 23~30 GHz (relative bandwidth 26.4%) operating frequency band, the horizontal polarization radiation beam scanning from -62° to -2° is realized, with a peak gain of 9.6~11.7 dBi, and the cross-polarization ratio is more than 43.8 dB.

The azimuth wheel-rail of large aperture radio telescope is the key component, it not only sup-ports the whole weight of the antenna, but also directly affects the pointing performance of the antenna with its surface accuracy. The whole weight of the radio telescope is hundreds or even thousands of tons, its azimuth frame rollers have great contact stress with the wheel-rail surface, repeated rolling can cause rolling contact fatigue on the wheel-rail surface, resulting in wear, cracks and other damage to the wheel-rail, and even lead to failure or fracture of the wheel-rail in serious cases, so it is very important to monitor the damage of the antenna wheel-rail. In order to visually detect the use of antenna wheel-rail surface, this paper proposed the method using electromagnetic ultrasonic detection to detect the damage of antenna wheel-rail surface for the first time. Based on the electromagnetic ultrasonic nondestructive testing principle, the simplified wheel-rail model containing wear, corrosion and crack damage is simulated. The results show that this method can effectively detect the surface damage of the antenna wheel-rail surface, and it can provide an important reference for the research of wheel-rail damage detection of large radio telescope.

Developing new energy is critical to China's green and low-carbon development. And the New Energy Demonstration City Policy (NEDCP) is a vital innovation policy that inspires the development of new energy. Is the NEDCP facilitating green and low-carbon development, if so, how? Employing unbalanced panel data from 2003 to 2017, the impact of NEDCP on green and low-carbon development was studied by using the "difference in difference" (DID) model. We find that this policy can take significantly role. After various robustness tests, our results are still valid. According to the heterogeneity analysis, non-resource and non-old industrial base cities have a greater positive impact from this policy. The mechanism analysis denotes that the positive policy effect works through upgrading the industrial structure and stimulating urban innovation. The substantial empirical evidence presented in this article supports the continued promotion and implementation of new energy demonstration cities.

Satellite communication is expected to play a vital role in realizing Internet of Remote Things (IoRT) applications. This article considers an intelligent reflecting surface (IRS)-assisted downlink low Earth orbit (LEO) satellite communication network, where IRS provides additional reflective links to enhance the intended signal power. We aim to maximize the sum-rate of all the terrestrial users by jointly optimizing the satellite’s precoding matrix and IRS’s phase shifts. However, it is difficult to directly acquire the instantaneous channel state information (CSI) and optimal phase shifts of IRS due to the high mobility of LEO and the passive nature of reflective elements. Moreover, most conventional solution algorithms suffer from high computational complexity and are not applicable to these dynamic scenarios. A robust beamforming design based on graph attention networks (RBF-GAT) is proposed to establish a direct mapping from the received pilots and dynamic network topology to the satellite and IRS’s beamforming, which is trained offline using the unsupervised learning approach. The simulation results corroborate that the proposed RBF-GAT can achieve approximate performance compared to the upper bound with low complexity.

Objective: Identify factors associated with excessive day time sleepiness (EDS) in individuals with obstructive sleep apnea (OSA), and analyze the effects that obesity and gender have on excessive daytime sleepiness in such individuals. Methods: A total of 160 people were selected for this study. All the people have completed a clinical evaluation, and whose apnea-hypopnea index (AHI) > 10 events/hour of sleep on polysomnography were included in the study from the Department of otolaryngology. Results: The Mean age was 43.87±11.34 years, mean EDS score was 14.09± 4.91, and mean AHI was 43.88±20.66 events/hour of sleep. Male presented lower mean age, higher EDS scores, and more time in apnoea, whereas females presented with higher mean age, lower EDS scores, and less time in sleep apnea. The EDS score showed best correlation with duration of apnoea (r = 0.448; p < 0.01), peripheral oxygen saturation (SpO₂; r = -0.458; p < 0.01) and AHI (r = 0.484; p < 0.01). The mean body mass index (BMI) was 27.41±3.86 kg/m². Normal, Overweight, obese, and morbidly obese were observed in 20%, 61%, 18%, and 0.6% of cases, respectively. Severity of the disease best correlated with BMI (r = 0.421; p < 0.01). Conclusions: OSA is predominant in males (M/F 5:1), and obese population. Females diagnosed with OSA have higher mean age. However, EDS scores and time spent in sleep apnoea is lower in females. Higher BMI is associated with EDS, irrespective of gender.

Trimeresurus albolabris, also known as the white-lipped pit viper or white-lipped tree viper, is a highly venomous snake distributed across Southeast Asia and the cause of many snakebite cases. In this study, we report the first whole genome assembly of T. albolabris obtained with next-generation sequencing from a specimen collected in Mengzi, Yunnan, China. After genome sequencing and assembly, the genome of this male T. albolabris individual was 1.51 Gb in length and included 38.42% repeat-element content. Using this genome, 21,695 genes were identified, and 99.17% of genes could be annotated using gene functional databases. Our genome assembly and annotation process was validated using a phylogenetic tree, which included six species and focused on single-copy genes of nuclear genomes. This research will contribute to future studies on Trimeresurus biology and the genetic basis of snake venom.

A typical solid-state quantum sensor can be developed based on negatively charged nitrogen-vacancy (NV-) centers in diamond. The electron spin state of NV- can be controlled and read at room temperature. Through optical detection magnetic resonance (ODMR) technology, temperature measurement inside living cells can be achieved at the nanoscale. The key to ODMR technology is to apply microwave resonance to manipulate the electron spin state of NV-. Therefore, the microwave field characteristics formed near the NV- have a crucial impact on the sensitivity of ODMR measurement. This article mainly focuses on the temperature situation in cellular applications, and simulates the influence of structural parameters of double open loop resonant (DOLR) microwave antennas and broadband large-area (BLA) microwave antennas on the microwave field’s resonance frequency, quality factor Q, magnetic field strength, uniformity, etc. The parameters are optimized to have sufficient bandwidth, high signal-to-noise ratio, low power loss, and high magnetic field strength in the temperature range of 36 ℃ to 42.5 ℃. Finally, the ODMR spectra are used for effect comparison, and the signal-to-noise ratio and Q values of the ODMR spectra are compared when using different antennas. We have provided an optimization method for the design of microwave antennas and it is concluded that the DOLR microwave antenna is more suitable for living cell temperature measurement in our study.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

We introduce a full binary directed tree structure to represent the set of natural numbers, further categorizing them into three distinct subsets: pure odd numbers, pure even numbers, and mixed numbers. We adopt a binary string representation for natural numbers and elaborate on the composite methodology encompassing odd- and even-number functions. Our analysis focuses on examining the iteration sequence (or composition) of the Collatz function and its reduced variant, which serves as an analog to the inverse function, to scrutinize the validity of the Collatz conjecture. To substantiate this conjecture, we incorporate binary strings into an algebraic formula that captures the essence of the Collatz sequence. By this means, we transform discrete powers of 2 into continuous counterparts, ultimately culminating in the smallest natural number, 1. Consequently, the sequence generated through infinite iterations of the Collatz function emerges as an eventually periodic sequence, thereby validating an enduring 87-year-old conjecture.

We use binary string to represent a natural number and show the composite procedure of odd-number and even-number functions, thus we propose full binary directed tree to represent the set of natural numbers and give another partition the natural number set to three sets: pure odd, pure even and mixed number. For the Collatz conjecture we make use of the parity of a natural number to analyse the sequence of iteration (or composite) of Collatz function and reduced Collatz function analog to the inverse function. We give tabular and binary strings to the algebra expression to state the sequence of Collatz, this is the key topic to proof the conjecture: the discrete powers of 2 can be changed to ultimately continuous powers of 2, finally get to pure even number and to the smallest number 1. The sequence created by the infinite iterations of the Collatz function becomes the ultimately periodic sequence if any natural number is the beginning value, proving the conjecture that has been held for 87 years.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

To investigate the effects of plant polysaccharides combined with boric acid on digestive function, immune function, and harmful gas and heavy metal contents in faeces of finishing pigs, for this study, 90 healthy three-way cross-bred pigs were selected and randomly divided into five groups: Con) A control, fed basic feed; BA) fed basic feed supplemented with 40 mg/kg of boric acid; BA+APS) fed basic feed supplemented with 40 mg/kg of boric acid and 400 mg/kg of Astragalus polysaccharides; BA+GLP) fed basic feed supplemented with 40 mg/kg of boric acid with 200 mg/kg of Ganoderma lucidum polysaccharides; and BA+EPS) fed basic feed supplemented with 40 mg/kg of boric acid and 500 mg/kg of Echinacea polysaccharides. Compared with the Con, the average daily gain (ADG) and trypsin activity were higher in BA, along with there being increased glutathione peroxidase (p < 0.05); furthermore, lower malondialdehyde content and harmful substance emissions from manure were observed (p < 0.05). Compared with BA, increases in ADG, gain-to-feed ratio (G/F), trypsin, and maltase activities were observed in BA+EPS (p < 0.05), as well as a lower NH3 emissions (p < 0.05). Compared with BA, BA+APS exhibited higher ADG, average daily feed intake (ADFI), G/F, trypsin, and maltase activities (p < 0.05), while H2S emissions were lower (p < 0.05). And Taken together, our findings reveal that supplementation with boric acid and plant polysaccharides in the diet of finishing pigs synergistically improved their growth performance, trypsin and maltase activities, and immune function, while also discovered the intestinal digestive enzymes, serum inflammatory factors, oxidative stress responseand emissions of harmful gases and heavy metals from feces and urine were tightly related, further reducing the impact of fecal pollution generated by modern animal husbandry on the environment.

The development of a method to produce coumarins unsubstituted on the pyranic nucleus catalyzed from Wells–Dawson heteropolyacid (H₆P₂W₁₈O₆₂), phenol derivatives and ethyl 3,3-diethoxypropionate using Pechmann condensation under solvent-free conditions is described. This catalytic method was also applied successfully to synthesize various substituted coumarins, including the corresponding phenols and ethyl 3,3-diethoxypropionate. This work provides a novel, cheaper and safer way to syhthesize coumarins unsubstituted on the pyranic nucleus.

Developing clinically meaningful nanomedicines for cancer therapy requires the drugs to be effective, safe, simple, cheap, and easy to store. In the present work, we report that a simple cationic Fe(III)-rich salt of [FeIIICl(TMPPH2)][FeIIICl4]2 (Fe-TMPP) exhibits a superior anticancer performance toward a broad spectrum of cancer cell lines, including breast, colorectal cancer, liver, pancreatic, prostate, and gastric cancers, with half maximal inhibitory concentration (IC50) values in the range of 0.098−3.97 μM (0.066−2.68 μg mL−1), and comparable to the best-reported medicines. Fe-TMPP can forms stand-alone nanoparticles in water without the need for extra surface modification or organic-solvent-assisted antisolvent precipitation. Critically, Fe-TMPP is TME-responsive (TME = tumor microenvironment), and can only elicit its function in the TME with overexpressed H2O2, converting H2O2 to the cytotoxic •OH to oxidize the phospholipid of the cancer cell membrane, causing ferroptosis, a programmed cell death process of cancer cells.

Aiming at the removal of radioactive cobalt ions from water by graphene oxide (GO), the adsorption mechanism of Co2+ on graphene oxide was analyzed using the quantum chemical calculation software Gaussian 16 based on the density functional theory. The influence of material structure factors such as carboxyl group, hydroxyl group, epoxy group and graphene sheet as well as external environmental factors such as pH, temperature and interfering ions on the adsorption effect was determined, and the influence of external environment was verified through experiments. Through calculation and experiment, it was found that the existence of oxygen-containing functional groups on graphene oxide can improve the adsorption efficiency of the materialappropriately,and increasing pH under acidic conditions was also helpful to improve the adsorption effect, and the material had certain selectivity for Co2+, the adsorption capacity and selectivity could be further improved when it was modified by increasing hydroxyl group.

Extracorporeal membrane oxygenation (ECMO), in conjunction with its life-saving benefits, carries a significant risk of acute brain injury (ABI). Hypoxic-ischemic brain injury (HIBI) is one of the most common types of ABI in ECMO patients. Various risk factors such as history of hypertension, high day 1 lactate level, low pH, cannulation technique, large peri-cannulation PaCO2 drop (∆PaCO2), and early low pulse pressure, have been associated with the development of HIBI in ECMO patients. The pathogenic mechanisms of HIBI in ECMO are complex and multifactorial, attributing to the underlying pathology requiring initiation of ECMO and the risk of HIBI associated with ECMO itself. HIBI is likely to occur in the peri-cannulation or peri-decannulation time secondary to underlying refractory cardiopulmonary failure before or after ECMO. Current therapeutics target pathological mechanisms, cerebral hypoxia and is-chemia, by employing targeted temperature management in the case of extracorporeal cardiopulmonary resuscitation (eCPR), and optimizing cerebral O2 saturations and cerebral perfusion. This review describes the pathophysiology, neuromonitoring, and therapeutic techniques to improve neurological outcomes in ECMO patients so as to prevent and minimize the morbidity of HIBI. Further studies aimed at stand-ardizing the most relevant neuromonitoring techniques, optimizing cerebral perfusion, and minimizing the severity of HIBI once it occurs will improve long-term neurological outcomes in ECMO patients.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

With the advances in industry and commerce, passengers have become more accepting of environmental sustainability issues; thus, more people now choose to travel by bus. Government administration constitutes an important part of bus transportation services as the government gives the right-of-way to transportation companies allowing them to provide services. When these services are of poor quality, passengers may lodge complaints. The increase in consumer awareness and developments in wireless communication technologies have made it possible for passengers to easily and immediately submit complaints about transportation companies to government institutions, which has brought drastic changes to the supply-demand chain comprised of the public sector, transportation companies, and passengers. This study proposed the use of big data analysis technology including systematized case assignment and data visualization to improve management processes in the public sector and optimize customer complaint services. Taichung City, Taiwan was selected as the research area. There, the customer complaint management process in public sector was improved, effectively solving such issues as station-skipping, allowing the public sector to fully grasp the service level of transportation companies, improving the sustainability of bus operations, and supporting the sustainable development of the public sector-transportation company-passenger supply chain.

Flavonoids are major secondary metabolites in plants, which play important roles in maintaining the cellular redox balance in cells. Chalcone synthase (CHS) is the key enzyme in the flavonoids biosynthesis pathway, and has been proved to monitor the changes to drought stress tolerance. In this work, we overexpressed a CHS gene in tobacco (Nicotiana tabacum). The transgenic tobacco plants were more tolerant than the control plants to drought stress. The transcription levels of the key genes involved in the flavonoids pathway and the contents of seven flavonoids were also significantly raised in the transgenic tobacco plants. In addition, overexpression of the CHS gene lead to a lower concentration of the oxidative stress product malondialdehyde. Overall, the NtCHS gene studied in this work was considered as a candidate gene for genetic engineering to enhance drought tolerance of plants and improve response to oxidative stress.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

Abstract: Plant types and soil bacterial communities had a close relationship, understanding the profound association between them contributes to better learn bacterial ecological function for plant growth. In this study, rhizosphere soil of six different chemotype Cinnamomum camphora trees were collected, including C. bodinieri var. citralifera, [C. camphora (Linn.) Presl], camphora-type, cineole-type, linalool-type and isoborneol-type. Soil properties content and bacterial communities were analyzed. Two chemotype C. camphora, including [C. camphora (Linn.) Presl] and linalool-type, shaped similar bacterial community structure, decreased Firmcutes relative abundance. richness estimators (Chao1 index and Ace index) of [C. camphora (Linn.) Presl] were decreased compared with the others. Furthermore, soil bacterial community structure was also similar among bodinieri var. citralifera, camphora-type, cineole-type and isoborneol-type. Hence, different chemotype C. camphora altered soil nutrient and shaped rhizosphere bacterial communities.

Analyzing horse behavior is crucial for assessing training quality, particularly in accurately identifying actions like standing, walking, and running. Research has been conducted both domestically and internationally in this regard; however, challenges persist, including reliance on single sensors, poor real-time performance, and low identification accuracy. In view of these challenges, this study investigated real-time identification of horse behavior based on wearable devices. The system, centered around a microcontroller and utilizing a 4G network as a carrier, employs multi-axis IMU sensors as input sources to perceive horse posture. The study proposed a behavior classification method based on analysis of acceleration thresholds. The method consists primarily of two sequential stages: first, the resultant acceleration interval counting method, which employs a nonlinear segmentation approach for initial behavior classification; and second, the statistical analysis of variance parameters between segments, which when coupled with multi-level threshold processing, achieves a refined classification. Experimental results indicated that the interval counting method alone achieved an accuracy of 87.55%, while for the variance analysis method alone the accuracy was 90.87%. The proposed method, comprising the two stages, reached a classification accuracy of 91.57%, underpinning its usefulness in supporting future equine research.

To enhance the safety of power grid operations, this study proposes a high-precision short-term photovoltaic power prediction method that integrates information from surrounding pho-tovoltaic stations and the Conv-LSTM-ATT model. In the deep learning prediction model, not only is numerical weather prediction (NWP) data from the target photovoltaic station used as input features, but also highly correlated features from nearby photovoltaic stations are incor-porated. The research begins by analyzing the correlation between irradiance and power se-quences, along with distance factors, to calculate a composite similarity index between the target and other regional photovoltaic stations. Stations with high similarity indices are then selected as data sources. Subsequently, Bayesian optimization techniques are employed to find the optimal data fusion ratios. Ultimately, using the selected data, power prediction mod-eling is conducted via the Conv-LSTM-ATT deep neural network. Experimental results con-firm the superiority of the proposed model, which demonstrates higher predictive accuracy compared to three other classical models. The data fusion strategy determined by Bayesian optimization significantly enhances prediction accuracy, reducing the root mean square error (RMSE) of the test set by 20.04%, 28.24%, and 30.94% for three weather types, respectively.

Zinc cobalt oxide-zinc hydroxide (ZnCo2O4-Zn(OH)2) microspheres were successfully fabricated on carbon cloth via a sample hydrothermal method. The surface morphology of these microspheres and their efficacy in degrading methyl violet were further modulated by varying the thermal annealing temperatures. The manipulation of thermal annealing temperatures was pivotal in adjusting the porosity of ZnCo2O4-Zn(OH)2 microspheres to amplify their photocatalytic performance. Various analytical techniques were utilized to evaluate the physical and chemical properties of the ZnCo2O4-Zn(OH)2 microspheres, including field-emission scanning electron microscopy, energy-dispersive spectroscopy, X-ray diffraction, field-emission transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-vis spectroscopy. Compared to untreated ZnCo2O4-Zn(OH)2 microspheres, those subjected to thermal annealing exhibited increased specific surface area and light absorption capacity, rendering them highly effective photocatalysts under UVC light exposure. Subsequent studies have confirmed the superior performance of ZnCo2O4-Zn(OH)2 microspheres as a reusable photocatalyst for degrading methyl violet and tetracycline. Additionally, trapping experiments during the photodegradation process involving ZnCo2O4-Zn(OH)2 microspheres have identified hydroxyl radicals (·OH) and superoxide radicals (·O2–) as the primary reactive species.

The threat of fine particulate matter concentration (PM2.5) is increasing globally, Tackling this issue requires an accurate understanding of its trends and drivers. The article investigates the PM2.5 characteristics of 285 prefecture-level cities in China from 2000-2018 based on multiscale geographically weighted regression(MGWR), and the results show that（1）previous studies based on classical MGWR models may be somewhat unstable, while MGWR can reflect the scale of influence of different variables on the dependent variable, and its regression results are more reliable.（2）PM2.5 is very sensitive to carbon emission(CE) factors, and there is a high degree of spatial heterogeneity, and the influence scale of location is the smallest among all variables, close to the municipal scale.（3）In 2000, the constant term all, IS, OFT, CE, and LT positively affect PM2.5, while GDP (jurisdiction) and UR negatively affect PM2.5; in 2010, the constant term all, GDP (jurisdiction), IS, OFT and LT positively affect PM2.5, while UR and CE negatively affect PM2.5; in 2018 the constant term all, IS, OFT and CE factors positively affect PM2.5, and GDP (jurisdiction), UR and LT negatively affect PM2.5.

Background: Coronavirus Disease 2019 (COVID-19) has been demonstrated to be the cause of pneumonia. Nevertheless, it has not been reported as the cause of acute myocarditis or fulminant myocarditis. Case presentation: A 63-year-old male was admitted with pneumonia and cardiac symptoms. He was genetically confirmed as having COVID-19 according to sputum testing on the day of admission. He also had elevated troponin I (Trop I) level (up to 11.37 g/L) and diffuse myocardial dyskinesia along with a decreased left ventricular ejection fraction (LVEF) on echocardiography. The highest level of interleukin-6 was 272.40 pg/ml. Bedside chest radiographs showed typical ground-glass changes indicative of viral pneumonia. Laboratory test results for viruses that cause myocarditis were all negative. The patient conformed to the diagnostic criteria of the Chinese expert consensus statement for fulminant myocarditis. After receiving antiviral therapy and mechanical life support, Trop I was reduced to 0.10 g/L, and interleukin-6 was reduced to 7.63 pg/ml. Moreover, the LVEF of the patient gradually recovered to 68%. The patient died of aggravation of secondary infection on the 33^rd day of hospitalization. Conclusion: COVID-19 patients may develop severe cardiac complications such as myocarditis and heart failure. This is the first report of COVID-19 complicated with fulminant myocarditis. The mechanism of cardiac pathology caused by COVID-19 needs further study.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

In the paper, the author introduces the notions "multi-order logarithmic numbers" and "multi-order logarithmic polynomials", establishes an explicit formula, an identity, and two recurrence relations by virtue of the Faa di Bruno formula and two identities of the Bell polynomials of the second kind in terms of the Stirling numbers of the fi rst and second kinds, and constructs some determinantal inequalities, product inequalities, logarithmic convexity for multi-order logarithmic numbers and polynomials by virtue of some properties of completely monotonic functions.

This study describes a novel method for grading pathological sections of gliomas. Our own integrated hyperspectral imaging system was employed to characterize 270 bands of cancerous tissue samples from microarray slides of gliomas. These samples were then classified according to the guidelines developed by the World Health Organization, which define the subtypes and grades of diffuse gliomas. We explored a hyperspectral feature extraction model called SMLME-Resnet using microscopic hyperspectral images of brain gliomas of different malignancy grades. The model combines the channel attention mechanism and multi-scale image features to automatically learn the pathological organization of gliomas and obtain hierarchical feature representations, effectively removing the interference of redundant information. It also completes multi-modal, multi-scale spatial and spectral feature extraction to improve the automatic classification of glioma subtypes. The proposed classification method demonstrated high average classification accuracy (>97.3\%) and Kappa coefficient (0.954), indicating its effectiveness in improving the automatic classification of hyperspectral gliomas. The method is readily applicable in a wide range of clinical settings, offering valuable assistance in alleviating the workload of clinical pathologists. Furthermore, the study contributes to the development of more personalized and refined treatment plans, as well as subsequent follow-up and adjustment of treatment, by providing physicians with insights into the underlying pathological organization of gliomas.

A new quinazolinone alkaloid, named peniquinazolinone A (1), as well as eleven known com-pounds, 2-(2-hydroxy-3-phenylpropionamido)-N-methylbenzamide (2), viridicatin (3), viridicatol (4), (±)-cyclopeptin (5a/5b), dehydrocyclopeptin (6), cyclopenin (7), cyclopenol (8), methyl-indole-3-carboxylate (9), 2,5-dihydroxyphenyl acetate (10), methyl m-hydroxyphenylacetate (11), conidiogenone B (12), was isolated from the endophytic Penicillium sp. HJT-A-6. The chemical structures of all compounds were elucidated by comprehensive spectroscopic analysis, including 1D, 2D NMR, and HRESIMS. The absolute configuration at C-13 of peniquinazolinone A (1) was established by applying the modified Mosher’s method. Compounds 2, 3, and 7 exhibited an op-timal promoting effect on the seed germination of Rhodiola tibetica at a concentration of 0.01 mg/mL, while the optimal concentration for compounds 4 and 9 to promote Rhodiola tibetica seed germination was 0.001 mg/mL. Compound 12 showed optimal seed-germination-promoting activity at a concentration of 0.1 mg/mL. Compared with the positive drug 6-benzyladenine (6-BA), compounds 2, 3, 4, 7, 9, and 12 could extend the seed-germination period of Rhodiola tibetica up to the 11th day.

Coal is an important resource that is closely related to people’s lives and has an irreplaceable role. However, coal mine safety accidents occur from time to time in the process of working underground. To this end, this paper proposes a coal mine environmental safety early warning model to detect abnormalities and ensure worker safety in a timely manner by assessing the underground climate environment. In this paper, the support vector machine (SVM) parameters are optimized using an improved artificial hummingbird algorithm (IAHA), and its safety level is classified by combining various environmental parameters. To address the problems of insufficient global exploration capability and slow convergence of the artificial hummingbird algorithm during iterations, a strategy incorporating Tent chaos mapping and backward learning is used to initialize the population, a Levy flight strategy is introduced to improve the search capability during the guided foraging phase, and then the simplex method is introduced to replace the worst value before the end of each iteration of the algorithm. The IAHA-SVM safety warning model was established using the improved algorithm to classify and predict the safety of the coal mine environment into four classes. Finally, the performance of the IAHA algorithm and the IAHA-SVM model are simulated separately. The simulation results show that the convergence speed and the search accuracy of the IAHA algorithm are improved, and the performance of the IAHA-SVM model has a significant improvement.

Buckling defect will appear on the outer surface of the deformed ring during constrained ring rolling (CRR) of aluminum alloy thin wall conical ring with inner high ribs (AATWCRIHR), if the geometrical dimension of the ribs doesn't match the wall thickness. To avoid the buckling defect, a quantitative method for characterizing the degree of the buckling defect is proposed using the area of buckling profile. Then an orthogonal experimental scheme was designed taking the width of the middle rib, thickness of wall, and height of the middle rib as design variables and defining the area of buckling profile as optimization objective. Subsequently, a quadratic polynomial response surface model was established by combining the optimization algorithm with the finite element method (FEM), and the geometrical dimension of the middle ribs of the deformed AATWCRIHR is optimized. Also the optimal parameter combination to minimize the area of buckling profile is obtained and verified using FE simulation. Results show that the AATWCRIHR after optimization doesn’t generate the buckling defect during constrained ring rolling, and it is proved that the quantitative buckling defect representation method and the optimization design method based on the response surface model and the finite element simulation results are feasible for the constrained ring rolling process of the AATWCRIHR.

The massive use of electronic equipment has raised concerns about electromagnetic (EM) pollution, leading to increased attention to EM shielding in both civil and military applications. EM absorption materials play a crucial role in reducing the energy of microwaves projected onto their surface. In this work, we propose a novel OTA (over-the-air) antenna test method to evaluate and analyze the functionality of EM absorption materials. This method offers a new and practical way to assess the effectiveness of these materials. Measured results indicate that the presence of the EM absorption material led to a decrease in antenna gain of approximately 2-3 dB, a reduction in efficiency of more than 10-15%, and a smaller radiation pattern during the actual testing process. These findings highlight the impact of EM absorption materials on antenna performance. Compared to the traditional S-parameter testing method, the gain comparison testing method exhibits the advantages of higher accuracy and simpler operation in the lower frequency experiment.

In the paper, the author finds bounds of the sine and cosine along a circle on the complex plane in terms of two double inequalities for the norms of the sine and cosine along a circle on the complex plane.

In the paper, the author discusses and computes bounds of the sine and cosine along straight lines on the complex plane.

Construction using earth materials demonstrates ecological sustainability using locally sourced natural materials and environmentally friendly demolition methods. In this study, the environmental impact of adding cement to soil materials for rammed-earth farmhouse construction in rural China was investigated and comparatively simulated using the One Click LCA database, focusing on the conflict between sustainability objectives and the practical aspects of cement addition. By analyzing how the addition of cement aligns with local construction practices and by addressing the debate surrounding the inclusion of cement in rammed earth construction, our objective is to provide insights into achieving a balance between the environmental impact and the pragmatic considerations of using cement in earthen building practices. Three local structure scenarios are evaluated via simulations: a cement-stabilized rammed earth wall, a fired brick wall, and a localized reinforced concrete frame structure. The quantitative environmental impacts are assessed, and the qualitative differences in adaptation, economic sustainability, and other factors are examined in the context of present-day development in rural China. The results show that the use of cement-stabilized rammed earth wall-supported structures is associated with higher embodied carbon emissions compared to structures supported by reinforced concrete frames and enclosed by brick walls; however, these emissions are lower than those for brick wall-supported structures, while effectively meeting the structural requirements. In addition, the use of cement-stabilized earth for perimeter walls simplifies material management and disposal throughout the building's life cycle, and the cost-effectiveness of cement has been found to be substantially greater than that of reinforced concrete frames and brick structures, improving economic viability and social acceptability, especially among low-income communities in rural areas.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

In the paper, by convolution theorem for the Laplace transforms and analytic techniques, the author finds necessary and sufficient conditions for complete monotonicity, monotonicity, and inequalities of several functions involving polygamma functions. By these results, the author derives a lower bound of a function related to the sectional curvature of the manifold of the beta distributions. Finally, the author poses several guesses and open problems related to monotonicity, complete monotonicity, and inequalities of several functions involving polygamma functions.

The 3x+1 problem asks the following: Suppose we start with a positive integer, and if it is odd then multiply it by 3 and add 1, and if it is even, divide it by 2. Then repeat this process as long as you can. Do you eventually reach the integer 1, no matter what you started with? Collatz conjecture (or 3n+1 problem) has been explored for about 85 years. In this paper, we convert an integer number from decimal to binary number, and convert the Collatz function to binary function, which is multiplication and division of two binary numbers. Finally the iternation of the Collatz function, eventually reach the integer 1, thus we solve the 3x+1 problem completely.

In recent years, with the development of the Internet of Things and distributed computing, the "server-edge device" architecture has been widely deployed. This study focuses on leveraging autoencoder technology to address the binary classification problem in network intrusion detection, aiming to develop a lightweight model suitable for edge devices. Traditional intrusion detection models face two main challenges when directly ported to edge devices: inadequate computational resources to support large-scale models and the need to improve the accuracy of simpler models. To tackle these issues, this research utilizes Extreme Learning Machine for its efficient training speed and compact model size to implement autoencoders. Two improvements over the latest related work are proposed: First, to improve data purity and ultimately enhance detection performance, this study partitions the data into multiple regions based on the prediction results of these autoencoders. Second, leveraging autoencoder characteristics to investigate further the data within each region. We used the public dataset NSL-KDD to test the behavior of the proposed mechanism. The experimental results show that when dealing with multi-class attacks, the model's performance was significantly improved, the accuracy and the F1-score are improved by 3.5% and 2.9%, respectively maintaining its lightweight nature.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Precision and accuracy estimation is an important index used to reflect the measurement performance and quality of a measurement system. To reveal the significance and connotations of the precision and accuracy estimation index of a close-range photogrammetry system, several common precision and accuracy estimation methods used in close-range photogrammetry are explained from a theoretical perspective, and the mechanism of the internal coincidence precision estimation and the external coincidence accuracy estimation are deduced, respectively. Through detailed experimental design and testing, the validity and reliability of the proposed precision and accuracy estimation methods are verified, which provides strong evidence for the quality control, optimisation, and evaluation of the measurement results from a close-range photogrammetry system. At the same time, it has significance for the further development of precision and accuracy estimation analysis of close-range photogrammetry systems.

Infrared dim and small target detection is a key technology of various detection tasks. However, due to the lack of shape, texture, and other information, it is a challenging task to detect dim and small targets. Recently, since many traditional algorithms ingore global information of infrared images, they generate some false alarms in complicated environments. To address this problem, in this paper, a coarse-to-fine deep learning-based method is proposed to detect dim and small targets. Firstly, a coarse-to-fine detection framework integrating deep learning and background prediction is applied for detecting targets. The framework contains of coarse detection module and fine detection module. In coarse detection stage, Region Proposal Network (RPN) is employed to generate masks in target candidate regions. Then, for further optimize the result, inpainting is utilized to predict the background by the global semnantic of images. In this paper, inpainting algorithm with a mask aware dynamic filtering module is incorporated into the fine detection stage to estimate background in candidate target areas. Finally, compared with existing algorithms, the experimental results indicate that the proposed framework have effective detection capability and robustness for complex surroundings.

Marine mortar was the goal material and its multi-scale physical-chemical-mechanical characteristics were the principal interest in this study. The on-line multi-scale damage detection experiments art was designed to quantify the characteristics mathematically and graphically. The normal cylinder specimen with 70-day age was produced and investigated by dynamically global MSHCT scan and local detection of EDS, SEM and XRD. The experiments results indicated that the marine mortar offered the appreciable strength at the early age at least, although some saline minerals were generated during the preparation. The micro-interfacial behavior and the parental foci controlled the damage development of the marine mortar the performance of which was still the adjustable one by the composition optimization.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Multi-cameras system is widely applied in 3D computer vision especially when multiple cameras are distributed on both sides of the measured object. The calibration methods of multi-cameras system are critical to the accuracy of vision measurement and the key is to find an appropriate calibration target. In this paper, a high-precision camera calibration method for multi-cameras system based on transparent glass checkerboard and ray tracing is described, which is used to calibrate multiple cameras distributed on both sides of the glass checkerboard. Firstly, the intrinsic parameters of each camera is obtained by Zhang’s calibration method. Then, multiple cameras capture several images from the front and back of the glass checkerboard with different orientations, and all images contain distinct grid corners. As the cameras on one side are not affected by the refraction of glass checkerboard, extrinsic parameters can be directly calculated. However, the cameras on another side are influenced by the refraction of glass checkerboard, and the direct use of projection model will produce calibration error. A multi-cameras calibration method using refractive projection model and ray tracing is developed to eliminate this error. Furthermore, both synthetic and real data are employed to validate the proposed approach. The experimental results of refractive calibration show that the error of the 3D reconstruction is smaller than 0.2 mm, the relative errors of both rotation and translation are less than 0.014%, and the mean and standard deviation of reprojection error of 4-cameras system are 0.00007 and 0.4543 pixel. The proposed method is flexible, high accurate, and simple to carry out.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Europium (Eu)-doped fluorapatite (FA) nanorods has a similar biocompatibility with hydroxyapatite (HA) in terms, attracted much attention as cell imaging biomaterials due to their luminescent property. Here, we will discuss the new feature of europium doped fluorapatite (Eu-FA) nanorods as anticancer drug carrier. Eu-FA nanorods was prepared using a hydrothermal method. The morphology, crystal structure, fluorescence and composition are investigated. The specific crystal structure, enabling an effective loading of drug molecules. Doxorubicin (DOX), used as an anticancer model drug, was shown to be effectively loaded onto the surface of the nanorods. The DOX release was fairly pH-dependent, occurring more rapidly at pH 5.5 than pH 7.4 was observed. The intracellular penetration of the DOX-loaded Eu-FA nanorods (Eu-FA/DOX) can be imaged in situ due to the self-fluorescence property. Treatment of melanoma A375 cells with Eu-FA/DOX elicited a more effective apoptosis rate than direct DOX treatment. Overall, Eu-FA show great promise for tracking and treating tumor, may potentially useful as a multifunctional carrier system to effectively load and sustainably deliver drugs.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The characteristics of gap plasmon formed by nanoparticle-on-mirror (NPOM) structure composed of metal nanoparticles (MNP) and metal thin films have aroused the interest of various optoelectronic devices. The resonant spectrum obtained by the internal coupling effect of gap can be flexibly controlled by the polarization of incident light and the thickness of the dielectric layer between MNP and metal thin films. We have theoretically studied the resonance spectra of polarization-dependent gold ellipsoidal nanoparticles (GENP) and gold thin films in the gap region of NPOM structures. GENP and gold thin films are separated by a dielectric layer with a refractive index of 1.36. We observe that the intensity of the local electric field resonance peak in the gap region is inversely proportional to the polarization angle. Similarly, the intensity of the local electric field resonance peak in the gap region is inversely proportional to the thickness of the dielectric layer. We have obtained more than 2200 V/m local electric field intensity (dielectric layer thickness 0.3nm). Finally, the resonant peak wavelength of the electric field in the gap region of the NPOM structure is also controlled by the polarization angle of the incident light and the thickness of the dielectric layer.

The CuCrSn alloy is promising as high-strength and high-conductivity Cu alloy due to its relative low smelting requirement, while thus far reports on the CuCrSn alloy is still quite lacked. In this study, the microstructure and properties of Cu-0.20Cr-0.25Sn (wt%) specimens prepared under different rolling and aging combinations were comprehensively characterized, in order to reveal the effects of cold rolling and aging on the CuCrSn alloy. The results show that increasing the aging temperature from 400 ºC to 450 ºC can obviously accelerates the precipitation, and the cold rolling before aging significantly increases the initial microhardness and promotes the precipitation. Whereas, the deformation hardening will be eliminated during the aging process, making the microhardness even decrease monotonically when the aging temperature and the rolling ratio before aging are high. Performing the cold rolling after the aging can maximize the effects of precipitation strengthening and deformation strengthening, and its adverse impact on the conductivity is not serious. A tensile strength of 506.5 MPa and a conductivity of 70.33% IACS were obtained with such a treatment, only the elongation decreases. Different strength-conductivity combinations of the CuCrSn alloy can be achieved through appropriate combinations of the aging and post aging cold rolling conditions.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Nowadays, brain signal processing is performed rapidly in various brain-computer interface (BCI) applications. Most researchers focus on developing new methods for the future or improving the basic implemented models to identify the optimum standalone feature set. Our research focuses on four ideas. One of them introduces future communication models, and the others are for improving old models or methods. These are: 1) new communication imagery model instead of speech imager using the mental task: Due to speech imagery is very difficult, and it is impossible to imagine sound for all of the characters in all of the languages. Our research introduces a new mental task model for all languages that call Lip-sync imagery. This model can use for all characters in all languages. This paper implemented two lip-sync for two sounds, characters or letters. 2) New combination Signals: Selecting an inopportune frequency domain can lead to inefficient feature extraction. Therefore, domain selection is so important for processing. This combination of limited frequency ranges proposes a preliminary for creating Fragmentary Continuous frequency. For the first model, two s intervals of 4 Hz as filter banks were examined and tested. The primary purpose is to identify the combination of filter banks with 4Hz (scale of each filter bank) from the 4Hz to 40Hz frequency domain as new combination signals (8Hz) to obtain well and efficient features using increasing distinctive patterns and decreasing similar patterns of brain activities.3) new supplement bond graph classifier for SVM classifier: When SVM linear uses in very noisy, the performance is decreased. But we introduce a new bond graph linear classifier to supplement SVM linear in noisy data. 4) a deep formula recognition model: it converts the data of the first layer into a formula model (formula extraction model). The main goal is to reduce the noise in the subsequent layers for the coefficients of the formulas. The output of the last layer is the coefficients selected by different functions in different layers. Finally, the classifier extracts the root interval of the formulas, and the diagnosis does based on the root interval. For all of the ideas achieved the results of implementing methods. The results are between 55% to 98%. Less result is 55% for the deep detection formula, and the highest result is 98% for new combination signals.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

The first case of Corona Virus Disease 2019 (COVID-19) was reported in Wuhan, China in December 2019. Since then, COVID-19 has quickly spread out to all provinces in China and over 150 countries or territories in the world. With the first level response to public health emergencies (FLRPHE) launched over the country, the outbreak of COVID-19 in China is achieving under control in China. We develop a mathematical model based on epidemiology of COVID-19, incorporating the isolation of healthy people, confirmed cases and close contacts. We calculate the basic reproduction numbers 2.5 in China (excluding Hubei province) and 2.9 in Hubei province with the initial time on January 30 which show the severe infectivity of COVID-19, and verify that the current isolation method effectively contains the transmission of COVID-19. Under the isolation of healthy people, confirmed cases and close contacts, we find a noteworthy phenomenon that is the potential second epidemic of COVID-19, and estimate the peak time and value and the cumulative number of cases. Simulations show that the isolation of close contacts tracked measure can efficiently contain the transmission of the potential second epidemic of COVID-19. With isolation of all susceptible people or all infected people or both, there is no potential second epidemic of COVID-19. Furthermore, resumption of work and study can increase the transmission risk of the potential second epidemic of COVID-19.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Ferrocenium (Fc+) inherits a number of molecular/electronic properties from the neutral counterparts’ ferrocene (Fc) including the high symmetry. Both Fc+ and Fc prefer the eclipsed structure (D5h) over the staggered structure (D5d) by an energy of 0.36 kcal·mol-1. The present study using the recently developed excess orbital energy spectrum (EOES) shows that the open shell Fc+ cation exhibits similar conformer dependent configurational changes to the neutral Fc conformer pair. A further energy decomposition analysis (EDA) discloses that the reasons for the preferred structures are different between Fc+ and Fc. The dominant differentiating energy between the Fc+ conformers is the electrostatic energy (EEstat), whereas in neutral Fc, it is the quantum mechanical Pauli repulsive energy (EPauli). Within the D5h conformer of Fc+, the EOES reveals that the -electrons of Fc+ experience more substantial conformer dependent energy changes than the -electrons (assumed the hole is in a β orbital).

In the paper, the authors survey integral representations (including the Lévy--Khintchine representations) and applications of some bivariate means (including the logarithmic mean, the identric mean, Stolarsky's mean, the harmonic mean, the (weighted) geometric means and their reciprocals, and the Toader--Qi mean) and the multivariate (weighted) geometric means and their reciprocals, derive integral representations of bivariate complex geometric mean and its reciprocal, and apply these newly-derived integral representations to establish integral representations of Heronian mean of power 2 and its reciprocal.

In this perspective article, we ponder topographical enhancements of artificial neural networks. In our recent paper in JMLR, we proved a quasi-equivalence between the network width and depth and also discussed the power of intra-links, which can be viewed as network height. In 1982, Hopfield published a network to model human associative memory, which contains many loops for dynamic evolution toward fixed points. Based on noising-denoising loops, diffusion models are recently developed to enable Bayesian modeling and inference with big data. Furthermore, we envision development of multi-AI-agent systems through “netware” engineering as a quantum leap of software engineering for emergent behaviors and autonomous AI at individual and population levels. We believe that the novel use of links and loops in space and time via multi-scale coupling would catalyze the next-generation neural networks.

This paper presents a study to accurately evaluate defects in reinforced concrete decks using ultrasonic pulse-echo signals. Two validation specimens were designed and tested where reinforced concrete deck slab specimens included planned voids and defects. A commercial Ultrasonic Pulse-Echo (UPE) device obtains 2-D images of the void/defect locations of the reinforced concrete deck. The UPE is based on the ultrasonic shear-wave test method using dry-point-contact transmitting and receiving transducers and employing a synthetic aperture focusing technique. The authors analyzed the recorded UPE A-scan data to enhance the accuracy of estimating the defects' locations using the synthetic aperture focusing technique imaging method. The analysis benefitted from an advanced denoising approach and defect echo peak extraction based on empirical modal decomposition, Hurst exponent characterization, and Hilbert envelope estimation. While output from conventional UPC devices can only provide qualitative results, the new method provides quantitative information on the anomalies inside the reinforced concrete deck. The developed approach accurately assists with assessing the location and depth of the voids/defects in the reinforced concrete deck slabs.

In the paper, the authors survey integral representations of the Catalan numbers and the Catalan–Qi function, discuss equivalent relations between these integral representations, supply alternative and new proofs of several integral representations, collect applications of some integral representations, and present sums of several power series whose coefficients involve the Catalan numbers.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

The undoped and tungsten (W)-doped vanadium dioxide (VO₂) thin films were prepared by electron beam evaporation associated with ion-beam assisted deposition (IAD). The influence of different W-doped contents (3%-5%) on the optical, electrical, structural, and thermos-mechanical properties of VO₂ thin films was investigated experimentally. Spectral transmittance results showed that with the increase of W-doped contents, the transmittance in the visible light range (400-750 nm) decreases from 60.2% to 53.9%, and the transmittance in the infrared wavelength range (2.5 μm to 5.5 μm) drops from 55.8% to 15.4%. As the W-doped content increases, the residual stress in the VO₂ thin film decreases from -0.276 GPa to -0.238 GPa, but the surface roughness increases. For temperature-dependent spectroscopic measurements, heating the VO2 thin films from 30°C to 100°C showed the most significant change in transmittance for the 5% W-doped VO₂ thin film. When the heating temperature exceeds 55°C, the optical transmittance drops significantly, and the visible light transmittance drops by about 11%. Finally, X-ray Diffraction (XRD) and scanning electron microscope (SEM) were used to evaluate the microstructure characteristics of VO₂ thin films.

This paper is concerned with developing an efficient numerical algorithm for fast implementation of the sparse grid method for computing the $d$-dimensional integral of a given function. The new algorithm, called the MDI-SG ({\em multilevel dimension iteration sparse grid}) method, implements the sparse grid method based on a dimension iteration/reduction procedure, it does not need to store the integration points, nor does it compute the function values independently at each integration point, instead, it reuses the computation for function evaluations as much as possible by performing the function evaluations at all integration points in a cluster and iteratively along coordinate directions. It is shown numerically that the computational complexity (in terms of CPU time) of the proposed MDI-SG method is of polynomial order $O(Nd^3 )$ or better, compared to the exponential order $O(N(\log N)^{d-1})$ for the standard sparse grid method, where $N$ denotes the maximum number of integration points in each coordinate direction. As a result, the proposed MDI-SG method effectively circumvents the curse of dimensionality suffered by the standard sparse grid method for high-dimensional numerical integration.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

In the paper, the authors find two explicit formulas and recover a recursive formula for the generalized Motzkin numbers. Consequently, the authors deduce two explicit formulas and a recursive formula for the Motzkin numbers, the Catalan numbers, and the restricted hexagonal numbers respectively.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to study the effect of explosion load on the flexural performance of RC beams, two RC beams of the same size were carried out explosion test and bearing capacity test successively. Piezoelectric intelligent aggregate was embedded in the beams in advance to monitor the damage state of the beams, which realized the whole process of damage monitoring of the concrete inside the structure from explosion damage to compression damage.Based on wavelet packet analysis and residual bearing capacity damage evaluation criteria, the beam damage was quantitatively evaluated, and the bending bearing capacity of RC beam after explosion damage was compared and analyzed.The results show that the change of concrete strain gauge signal, the phenomenon of crack development and the increase of internal crack development index indicate that the RC beam is damaged by explosion load.After explosion damage, the damage index of the beam increases and the residual bending capacity decreases, which proves that the piezoelectric intelligent aggregate sensor can effectively monitor the bending capacity change of the component after explosion damage.

Recent years have witnessed a boom of fashion bloggings sharing information about clothing and cosmetics on diverse social media platforms. Constant exposure to fashion-related digital information heavily impacts the cognition and behaviour of Chinese youth. Compared to the substantial studies on the impact of social media, scarce research has been conducted on how youth’s cognitive processing of fashion-related digital information interacts with motivational factors to determine the subsequent behaviour. This study made an initial attempt to address this issue by exploring the successive associations between clothing motivation (amotivation, controlled, and autonomous motivation), online critical thinking (for information credibility, objectivity, and relevance), and the subsequent behavioural intentions. A total of 1997 Chinese youths with diverse educational backgrounds voluntarily participated in the study. Results confirmed the direct links between clothing motivation and behavioural intentions, but these links were mediated by different online critical thinking skills. This study provides new insights for both practitioners and scholars in the fields of education, psychology, social media, and marketing.

Sparse reward long horizon task is a major challenge for deep reinforcement learning algorithm. One of the key barriers is data-inefficiency. Even in the simulation environment, it usually takes weeks to training the agent. In this study, a data-efficiency training framework is proposed, where a curriculum learning is design for the agent in the simulation scenario. Different distributions of the initial state are set for the agent to get more informative reward during the whole training process. A fine-tuning of the parameters in the output layer of the neural network for value function is conduct to bridge the gap between sim-to-real. An experiment of UAV maneuver control is conducted in the proposed training framework to verify the method more efficient. We demonstrate that data-efficiency is different for the same data in different training stages.

Sympatric distribution and temporal overlap of cryptic zooplankton species pose a challenge to the framework of the niche differentiation theory and the mechanisms allowing competitor coexistence. We applied the methods of phylogenetic analysis, DNA taxonomy and statistical analysis to study the temporal distribution patterns of cryptic B. calyciflorus species, an excellent model, in three lakes, and to explore the putative mechanisms for their seasonal succession and temporal overlap. The results showed that in the warm-temperate Lake Yunlong, B. fernandoi and B. calyciflorus s.s. underwent a seasonal succession, which was largely attributed to their differential adaptation to water temperature. In the subtropical Lake Jinghu, B. fernandoi, B. calyciflorus s.s. and B. dorcas exhibited both seasonal succession and temporal overlap. Seasonal successions were largely attributed to their differential adaptation to temperature, and temporal overlap resulted from their differential responses to algal food concentration. In the tropical Lake Jinniu, B. calyciflorus s.s. persisted throughout the year, and overlapped with B. dorcas for 5 months. Temporal overlap resulted from their differential responses to copepod predation. These results indicated that the temporal distribution pattern of cryptic B. calyciforus species and the mechanism allowing competitor coexistence vary with different climate zones.

The ongoing outbreak of the novel coronavirus pneumonia (also known as COVID-19) has triggered a series of stringent control measures in China, such as city closure, traffic restrictions, contact tracing and household quarantine. These containment efforts often lead to changes in the contact pattern among individuals of the population. Many existing compartmental epidemic models fail to account for the effects of contact structure. In this paper, we devised a pairwise epidemic model to analyze the COVID-19 outbreak in China based on confirmed cases reported during the period February 3rd--17th, 2020. By explicitly incorporating the effects of family clusters and contact tracing followed by household quarantine and isolation, our model provides a good fit to the trajectory of COVID-19 infections and is useful to predict the epidemic trend. We obtained the average of the reproduction number $R=1.494$ ($95\%$ CI: $1.483-1.507$) for Hubei province and $R=1.178$ ($95\%$ CI: $1.145-1.158$) for China (except Hubei), suggesting that some existing studies may have overestimated the reproduction number by neglecting the dynamical correlations and clustering effects. We forecasted that the COVID-19 epidemic would peak on February 13th ($95\%$ CI: February $9-17$th) in Hubei and 6 days eariler in the regions outside Hubei. Moreover the epidemic was expected to last until the middle of March in China (except Hubei) and late April in Hubei. The sensitivity analysis shows that ongoing exposure for the susceptible and population clustering play an important role in the disease propagation. With the enforcement of household quarantine measures, the reproduction number $R$ effectively reduces and epidemic quantities decrease accordingly. Furthermore, we gave an answer to the public concern on how long the stringent containment strategies should maintain. Through numerical analysis, we suggested that the time for the resumption of work and production in China (except Hubei) and Hubei would be the middle of March and the end of April, 2020, respectively. These constructive suggestions may bring some immeasurable social-economic benefits in the long run.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

The Mara River basin (MRB) has a world-famous ecosystem, but the vegetation has been damaged due to economic development in recent years, and there is little known about the area that will experience severe vegetation damage in the future. Based on the vegetation vulnerability system, principal component analysis, and three CMIP6 scenarios (SSP1-2.6, SSP2-4.5, SSP5-8.5), vegetation vulnerability was calculated in the base period (2010-2019), near-term period (2020-2059) and long-term period (2060-2099) in the MRB. The spatial cluster of vegetation vulnerability was revealed by spatial correlation analysis, and the transition of vegetation vulnerability of different periods was analyzed by stochastic matrix. The results showed that in all periods, the vulnerability showed a high-high cluster in the east, and a low-low cluster midstream and downstream. From the stochastic matrix, the area of high vulnerability increased the least under the SSP1-2.6, while it increased the most under the SSP5-8.5. The vegetation vulnerability upstream increased the most from the base period to the near-term period and long-term period in the MRB. By comparing the vegetation vulnerability under different scenarios, and pointing out the areas with the highest vulnerability increase, this study can better provide comprehensive decision-making for vegetation protection in the MRB.

Bearings are widely used in various types of electrical machinery and equipment. As their core components, failures will often cause serious consequences . At present, most methods of parameter adjustment are still manual adjustment of parameters. This adjustment method is susceptible to prior knowledge and easy to fall into the local optimal solution, failing to obtain the global optimal solution and requires a lot of resources.Therefore, this paper proposes a new method of bearing fault diagnosis based on wavelet packet transform and convolutional neural network optimized by simulated annealing algorithm.The experimental results show that the method proposed in this paper has a more accurate effect in feature extraction and fault classification compared with traditional bearing fault diagnosis methods. At the same time, compared with the traditional artificial neural network parameter adjustment, this paper introduces the simulated annealing algorithm to automatically adjust the parameters of the neural network, thereby obtaining an adaptive bearing fault diagnosis method. To verify the effectiveness of the method, the Case Western Reserve University bearing database was used for testing, and the traditional intelligent bearing fault diagnosis method was compared. The results show that the method proposed in this paper has good results in bearing fault diagnosis. Provides a new way of thinking in the field of bearing fault diagnosis in parameter adjustment and fault classification algorithms

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

With the intensification of population aging in rural areas, it becomes increasingly important to analyze the post-retirement migration intention of rural residents and the variables influencing these intentions. In this study, we focus on rural residents aged 45 to 60 and investigate the main variables that influence the post-retirement migration intention of rural residents, using survey data collected from 164 households in three different rural areas and the logistic regression model. From the result of this study, we found that gender, part-time employment, savings level, children's residence and occupation stability, and interest in urban living positively affect migration intention. In contrast, the number of rural companions, relationships with others in rural areas, and evaluation of rural living have a negative effect. In addition, we employ age and the proportion of mobile income as control variables to examine the variables that influence the post-retirement migration intention in different age groups and mobile income groups. The analysis reveals that, the variables influencing post-retirement migration intention varied across age groups and mobile income groups, and this variation can be attributed to the differences between groups' characteristics.

This study empirically examines the spatial spillover effect of various environmental regulations on green technology innovation using panel data from 284 county-level cities in China between 2007 and 2019. A geographical-economic spatial weight matrix is constructed, and the spatial Durbin model is employed to identify the specific characteristics of this spillover effect. The findings indicate that the spatial spillover effect of green technology innovation primarily occurs through geographical transmission. However, there is no significant spatial autocorrelation when using the economic distance weight matrix. Various types of environmental regulations influence the spatial spillover effect of green technology innovation in distinct ways. Specifically, Market-motivated environmental regulation exhibits a U-shaped relationship with the spatial spillover effect, while Command-controlled environmental regulation demonstrates an inverted U-shaped relationship, suggesting a complementary effect. Additional research shows that the upgrading of industrial structure acts as a mediator between command environmental regulation and the spatial spillover effect of green technology innovation. Government departments should comprehensively coordinate Market-motivated environmental regulation and Command-controlled environmental regulation, accurately assess the intensity of Command-controlled measures, and prevent the migration of green technology innovation elements caused by excessive regulatory measures within enterprises.

The transportation of feed pellets via pneumatic conveying plays an improtant role in feed industry. In recent years, many efforts are made both exprimentally and numerically to gain a better understanding of the underlying mechanism for pneumatic conveying. Though few of those research is directly related to feed pellets, it can be beneficial to draw a full picture of rencent development in pneumatic conveying, with emphasis on aspects extendable to feed transportation. This paper reviews first the major factors concerning feed pellets pneumatic conveying, such as particle breakage, pipe wear and electrostatic. Building on that, new advancement including emerging new technologies in experiments and simulations are discussed, with a focus on the experimental measurements and mathematical models, repectively. The needs for future research and the analogy to feed pellets tranportation is given lastly.

In the paper, by virtue of convolution theorem for the Laplace transforms, Bernstein's theorem for completely monotonic functions, and other techniques, the author finds necessary and sufficient conditions for a difference constituted by four derivatives of a function involving trigamma function to be completely monotonic.

The most cited evidence for (nonbaryonic) dark matter has been an apparent lack of visible mass to gravitationally support the observed orbital velocity of matters in rotating disk galaxies. Yet measurement of the mass of celestial objects cannot be straightforward, requiring theories derived from the known physical laws along with some empirically established semi-quantitative relationship. The most reliable means for determining the mass distribution in rotating disk galaxies is to solve a force balance equation according to Newton’s laws from measured rotation curves, similar to calculating the Sun’s mass from the Earth’s orbital velocity. Another common method to estimate galactic mass distribution is to convert measured brightness from surface photometry based on empirically established mass-to-light ratio. For convenience, most astronomers commonly assumed a constant mass-to-light ratio for estimation of the so-called “luminous” or “visible” mass, which should not be expected accurate. The mass determined from rotation curve typically exhibit an exponential-like decline with galactrocentric distance, qualitatively consistent with observed surface brightness. This fact scientifically suggests variable mass-to-light ratio of baryonic matter in galaxies without the need for dark matter.

Pneumatic nebulizers (as variations based on the Collison nebulizer) have been widely used for producing fine aerosol droplets from a liquid material. The basic working principle of those nebulizers has been qualitatively described as utilization of the negative pressure associated with an expanding gas jet to syphon liquid into the jet stream, then to blow and shear into liquid sheets, filaments, and eventually droplets. Detailed quantitative analysis based on fluid mechanics theory is desirable, to gain in-depth understanding of the liquid aspiration mechanism among other aspects of the Collison nebulizer behaviour. The purpose of present work is to investigate the nature of negative pressure distribution associated with compressible gas jet flow in the Collison nebulizer by a computational fluid dynamics (CFD) analysis, using an OpenFOAM® compressible flow solver. The value of the negative pressure associated with a gas jet flow is examined by varying geometric parameters of the jet expansion channel adjacent to the outlet of jet orifice. Such an analysis can provide valuable insights into fundamental mechanisms for liquid aspiration, helpful for designing improved pneumatic atomizer in the Aerosol Jet® direct-write system for micro-feature, high-aspect-ratio material deposition

In the paper, by induction and recursively, the author proves that the generating function of multivariate logarithmic polynomials and its reciprocal are a Bernstein function and a completely monotonic function respectively, establishes a Lévy-Khintchine representation for the generating function of multivariate logarithmic polynomials, deduces an integral representation for multivariate logarithmic polynomials, presents an integral representation for the reciprocal of the generating function of multivariate logarithmic polynomials, computes real and imaginary parts for the generating function of multivariate logarithmic polynomials, derives two integral formulas, and denies the uniform convergence of a known integral representation for Bernstein functions.

In the paper, by virtue of some properties for the Riemann zeta function, the author finds a double inequality for the ratio of two consecutive Bernoulli numbers with even indexes and analyzes the approximating accuracy of the double inequality.

In the paper, the author (1) presents an explicit formula and its inversion formula for higher order derivatives of generating functions of the Bell polynomials, with the help of the Faà di Bruno formula, properties of the Bell polynomials of the second kind, and the inversion theorem for the Stirling numbers of the first and second kinds; (2) recovers an explicit formula and its inversion formula for the Bell polynomials in terms of the Stirling numbers of the first and second kinds, with the aid of the above explicit formula and its inversion formula for higher order derivatives of generating functions of the Bell polynomials; (3) constructs some determinantal and product inequalities and deduces the logarithmic convexity of the Bell polynomials, with the assistance of the complete monotonicity of generating functions of the Bell polynomials. These inequalities are main results of the paper.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

In the paper, the authors establish two identities to express the generating function of the Chebyshev polynomials of the second kind and its higher order derivatives in terms of the generating function and its derivatives each other, deduce an explicit formula and an identities for the Chebyshev polynomials of the second kind, derive the inverse of an integer, unit, and lower triangular matrix, present several identities of the Catalan numbers, and give some remarks on the closely related results including connections of the Catalan numbers respectively with the Chebyshev polynomials, the central Delannoy numbers, and the Fibonacci polynomials.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.