In the present era, infertility is one of the major issues which restricts many couples to have their own kids. Infertility is the inability to achieve a clinical pregnancy after regular unprotected sexual intercourse for the period of one year or more. Various factors including defective male or female germ cell development, unhealthy and improper lifestyles, diseases like cancer and associated chemo-or-radiation therapies, congenital disorders etc. may be responsible for infertility. Therefore, it is highly important to understand the basic concepts of germ cell development including primordial germ cell (PGC) formation, specification, migration, entry to genital ridges and their molecular mechanisms, activated pathways, paracrine and autocrine signaling, along with possible alteration which can hamper germ cell development and can cause adversities like cancer progression and infertility. Knowing all these aspects in a proper way can be very much helpful in improving our understanding about gametogenesis and finding possible ways to cure related disorders. Here in this review, various aspects of gametogenesis especially female gametes and relevant factors causing functional impairment have been thoroughly discussed.

How to disentangle the possible genuine quenching of gA caused by scale anomaly of QCD parameterized by the scale-symmetry-breaking quenching factor qssb from nuclear correlation effects is described. This is done by matching the Fermi-liquid xed (FLFP) point theory to the "Extreme Single Particle (shell) Model" (acronym ESPM) in superallowed Gamow-Teller transitions in heavy doubly-magic shell nuclei. The recently experimentally observed indication for (1-qssb) ≠0 - that one might identify as "fundamental quenching (FQ)" - in certain experiments seems to be alarmingly signi cant. I present arguments how symmetries hidden in the matter-free vacuum can emerge and suppress such FQ in strong nuclear correlations. How to con rm or refute this observation is discussed in terms of the superallowed Gamow-Teller transition in the doubly-magic nucleus 100Sn and in the spectral shape in the multifold forbidden β decay of 115In.

Intradermal injection of botulinum neurotoxin is a frequently performed procedure in aesthetic dermatology to improve facial skin tone, texture, fine wrinkles, and enlarged pores. In practice, botulinum neurotoxin type A is also used to reduce skin oiliness of the face. There is increasing evidence that acetylcholine plays specific roles in sebum production, suggesting that botulinum neurotoxin type A may reduce sebum production by interfering with cholinergic transmission between sebaceous glands and autonomic nerve terminals. Botulinum neurotoxins can also inhibit several pathogenetic components of acne development, suggesting that botulinum neurotoxins can be used as a safe and effective treatment modality for acne and other skin disorders related to the overactivity of sebaceous glands. This review aims to explore the current evidence behind the treatment of oily skin and acne with botulinum neurotoxin type A.

In Korea, rice is a major staple grain and is mainly cultivated using various agricultural machinery. Air pollutants emitted from agricultural machinery have their origins mainly from the exhaustion of internal combustion engines. In this study, emission characteristics of five main air pollutants by European Environment Agency's Tier 1 method for rice cultivation was analyzed. Diesel is a main fuel for agricultural machinery and gasoline is generally used only for rice transplanters as a fuel in Korea. Tractors consume 46% of total fuel consumption and 56% of diesel fuel consumption. Gasoline used for rice transplanters accounts for 17% of total fuel consumption each year. Tractors and rice transplanters are emitting 82% of all total pollutants. From 2011 to 2019, the total amount of air pollutant emissions was decrease by 15%. That accounted for the reduction of rice cultivation fields in those periods. Rice transplanting operation was in charge of 42% of total emissions. Then, harrowing, harvesting, tilling, leveling, and pest control operations generated 10%, 10%, 8%, 8% and 7% of total emissions, respectively. The contribution of each air pollutant held 54% of CO, 39% of NOx, 5% of NMVOC, and 2% of TSP from the total emission inventory. The three major regions emitting air pollutants from mechanized agricultural practices were Jeollanam-do, Chungcheongnam-do, and Jeollabuk-do, which consume 55% of total fuel usage in rice farming. The total amount of air pollutant emissions from rice cultivation practices in 2019 was calculated as 8,448 Mg in Korea.

A comprehensive heuristic analysis of the Pollard's Rho Method (PRM) is given. The analysis is based on ultimate periods and tails distribution of sequences. If $n$ is the composite number to be factored, then an improved version of PRM is developed which has an expected run time of $O(\sqrt[8]{n}\ln n)$ on a multi-core architecture which utilized a clever way of evaluating polynomials.

Hydrogels incorporated with hydrophobic motifs have received considerable attention to recapitulate the cellular microenvironments, specifically for the bio-mineralization of a 3D matrix. Introduction of hydrophobic motifs into a hydrogel often results in irregular arrangement of the motifs, and further phase separation of hydrophobic domains, but limited efforts have been made to resolve this challenge in the hydrophobically-modified hydrogel. Therefore, this study presents an advanced integrative strategy to incorporate hydrophobic domains regularly in a hydrogel by self-assembling of polymer cross-linkers, building blocks of a hydrogel. Self-assemblies between polymer cross-linkers were examined as micro-domains to incorporate hydrophobic motifs in a hydrogel. The self-assembled structures in a pre-gelled solution were confirmed with the fluorescence analysis and the hydrophobicity of a hydrogel could be tuned by incorporating the motifs in a controlled manner. Overall, the results of this study would greatly serve to tuning performance of a wide array of hydrophobically-modified hydrogels in drug delivery, cell therapies and tissue engineering.

Rho guanosine triphosphatases (GTPases) are key regulators in a number of cellular functions, including actin cytoskeleton remodeling and vesicle traffic. Traditionally, Rho GTPases are studied because of their function in cell migration and cancer, while their roles in metabolism are less documented. However, emerging evidence implicates Rho GTPases as regulators of processes of crucial importance for maintaining metabolic homeostasis. Thus, the time is now ripe for reviewing Rho GTPases in the context of metabolic health. Rho GTPase-mediated key processes include the release of insulin from pancreatic β-cells, glucose uptake into skeletal muscle and adipose tissue, and muscle mass regulation. Through the current review, we cast light on the important role of Rho GTPases in skeletal muscle, adipose tissue, and the pancreas and mechanisms by which Rho GTPases act to regulate glucose metabolism in health and disease. We also describe challenges and goals for future research.

Convolutional Neural Networks (CNNs) are largely hand-crafted, which leads to inefficiency in the constructed network. Various other algorithms have been proposed to address this issue, but the inefficiencies resulting from human intervention have not been addressed. Our proposed EvolveNet algorithm is a task-agnostic evolutionary search algorithm that can find optimal depth and width scales automatically in an efficient way. The optimal configurations are not found using grid search, instead evolved from an existing network. This eliminates inefficiencies that emanate from hand-crafting, thus reducing the drop in accuracy. The proposed algorithm is a framework to search through a large search space of subnetworks until a suitable configuration is found. Extensive experiments on the ImageNet dataset demonstrate the superiority of the proposed method by outperforming the state-of-the-art methods.

Commuting is a vital travel channel for college students throughout their higher education career; nevertheless, excessive commute time negatively impacts students’ school satisfaction, academic achievement, health, and quality of life. Meanwhile, few studies have explored students’ commute time, covering a large population and scope. Therefore, this study analyzes the dwelling type that influences college and graduate students’ school commute times in the Seoul Metropolitan Area, using data from the 2016 Household Travel Diary Survey. This study uses spatial data on housing development to classify five dwelling types (i.e., new town, housing site development, Seoul, Incheon, and Gyeonggi-do). A multiple linear regression model empirically analyses students’ household and personal characteristics. The results reveal that dwelling type significantly affects students’ commute time. Specifically, Students living in Seoul have a shorter commute to school than those living in new towns. Socioeconomic characteristics have less effect on college and graduate students' school commute time. This study discusses the problem of excessive commuting of college and graduate students in new towns.

Aging is associated with muscle atrophy and fatty infiltration of skeletal muscle. The multifidus muscle stabilizes the lumbar spine and undergoes adipose accumulation with age, leading to functional decline in the elderly. Therefore, quantitative assessment of the multifidus muscle can be beneficial for the elderly when formulating treatment strategies and reducing future complications. Fifty-seven patients (mean age, 73.89 ± 6.09; 23 male patients) who underwent lumbar Magnetic resonance imaging (MRI) were prospectively recruited. The cross-sectional area (CSA) of the multifidus from the L2-S1 level and the CSA of the L4-5 level psoas muscle were measured. The functional CSA (fCSA) of the multifidus muscle was measured by excluding the fat infiltration area from the multifidus CSA. The CSA to fCSA ratio was obtained by multiplying 100 by the value obtained by dividing CSA by the fCSA. Pfrrmann classification was used to evaluate the degree of disc degeneration. The functional disability measurements were the Short Physical Performance Battery (SPPB), Berg Balance Scale (BBS), grip strength, and functional reach test (FRT). Pearson's correlation analysis was used to examine the relationship between the functional disability measurements and the multifidus muscle. The CSA to fCSA ratio value was relatively constant at each spine level and showed a significant correlation with the SPPB, grip strength, FRT, and psoas index (p<0.05). However, degree of disc and multifidus muscle degeneration were not statistically significant. So, age-related changes play a significant role in developing back muscle fatty infiltration than disc dgeneration. Moreover, Grip strength showed a stronger relationship with the quality of the multifidus muscle than other functional disability measurements.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Background: Two types of medicinal systems are available in Korea: Western and oriental. These exist as separate services that independently provide medical care to patients. We determined the utility and benefits of compressive and integrated medical services (CIMS) comprising 12 sessions of acupuncture and healing programs over 6 weeks. Methods: In this two-group parallel single-center randomized controlled assessor-blinded trial, 24 participants were assigned to either the experimental (conventional medical treatment plus CIMS, n = 12) or control (conventional medical treatment, n = 13) group. Spinal nerve root block was performed on the compressed spinal nerve root (identified using magnetic resonance imaging) when no improvement was observed after the initial treatment. The experimental group received 12 cycles of acupuncture and manual therapy for 6 weeks; the control group received conventional medical treatment alone. Results: The average age of participants in the experimental and control groups was 70.73 ± 5.95 and 67.33 ± 8.89 years, respectively. There were no significant differences between the groups in terms of age, body mass index, Leeds Assessment of Neuropathic Symptoms and Signs, sex, and current medical history. We found high compliance for both programs (acupuncture and healing). On exclusion of between-group effects, the visual analog scale (VAS) score improved significantly over time (p = 0.045). Further, comparison of the groups after excluding the effects of visits revealed significantly lower VAS scores in the experimental group than in the control group (p = 0.000). Conclusions: Patients with degenerative lumbar spinal stenosis who mainly complain of radiating pain in the lower leg may benefit from CIMS after spinal nerve root block for ≤3 months after treatment. Our study findings suggest that this treatment improves spinal function and Oswestry Disability Index score. However, CIMS did not improve QoL.

In this paper we establish several Hermite-Hadamard type integral inequalities for trigonometrically rho-convex functions. Applications for special means are provided as well.

The differentiation between Neuromyelitis optica spectrum disorder (NMOSD) and cervical spondylotic myelopathy (CSM) is necessary, because both diseases have similar symptoms, such as motor weakness and sensory disturbances. The challenge arises when NMOSD presents with short-segment spinal cord lesions, which can mimic the clinical presentation of CSM. This case report presents an NMOSD misdiagnosed as CSM. A 66-year-old woman presented with neck pain, left arm pain, and motor weakness. She was initially diagnosed with CSM based on MRI findings that revealed the increased signal intensity of the spinal cord at the C3 to 4 levels and underwent surgery. Three years later, she had sudden left upper extremity motor weakness and mild gait disturbance. Physical exam showed left-side weakness and altered reflexes, with longitudinally extensive transverse myelitis (LETM) findings on cervical MRI. The CSF study revealed a 2+ AQP4-Ab finding. Finally, NMO was diagnosed. Steroid pulsed therapy and immunosuppression therapy led to improved motor function and gait after 20 days. We present a case report of a NMO patient who initially exhibited clinical and radiological features CSM but was later diagnosed with NMO. This case underscores the diagnostic challenge in distinguishing NMO from CSM, especially in elderly patients who commonly experience spinal degeneration leading to cord compression and associated cord signal changes on MRI. The misinterpretation or confusion with transverse myelitis can occur as a result. This case highlights the importance of considering NMO as a potential differential diagnosis in elderly patients with spinal degeneration, emphasizing the significance of precise and timely diagnosis for guiding optimal treatment decisions.

Cisplatin is a widely used anticancer drug for treating solid tumors, but it is associated with severe side effects, including nephrotoxicity. Various studies have suggested that the nephrotoxicity of cisplatin could be overcome; nonetheless, an effective adjuvant drug has not yet been established. Oleanolic acid acetate (OAA), a triterpenoid isolated from Vigna angularis, is commonly used to treat inflammatory and allergic diseases. This study aimed to investigate the protective effects of OAA against cisplatin-induced apoptosis and necroptosis using TCMK-1 cells and a mouse model. In cisplatin-treated TCMK-1 cells, OAA treatment significantly reduced Bax and cleaved-caspase3 expression, whereas increased Bcl-2 expression. Moreover, in cisplatin-induced kidney injury mouse model, OAA treatment alleviated weight loss in the body and major organs and also relieved cisplatin-induced nephrotoxicity symptoms. RNA sequencing analysis of kidney tissues identified lipocalin-2 as the most upregulated gene by cisplatin. Additionally, necroptosis-related genes such as receptor interacting protein kinase (RIPK) and mixed lineage kinase domain like (MLKL) were identified. In vitro study, the phosphorylation of RIPKs and MLKL was reduced by OAA pretreatment in both cisplatin-treated cells and cells boosted by co-treatment with z-VAD-FMK. In conclusion, OAA could protect the kidney from cisplatin-induced nephrotoxicity and may serve as an anticancer adjuvant.

Rhotekin is an effector protein for small GTPase Rho. This protein consists of a Rho binding domain (RBD), a pleckstrin homology (PH) domain, proline-rich regions and a C-terminal PDZ-binding motif. We and other groups have identified various binding partners for Rhotekin and proposed their possible physiological roles. However, functions of Rhotekin per se are largely unknown and information about its physiological roles are fragmentary. In this review, we summarize known features of Rhotekin in neuronal tissues and cancer cells. We also describe characteristics of binding partners for Rhotekin and predicted roles of their interaction.

Methotrexate (MTX) is commonly used in intrathecal chemotherapy for patients with acute lymphocytic leukemia (ALL) to prevent central nervous system (CNS) involvement. However, the use of MTX-based chemotherapy can lead to rare yet severe complications, such as MTX-induced myelopathy. Here we report the case of MTX-induced myelopathy initially misdiagnosed as Guillain-Barre syndrome, leading to a delay in diagnosis and treatment. We present a case of a 39-year-old male with a history of B-cell acute lymphoblastic leukemia (B-ALL) who experienced bilateral foot paresthesia and progressive lower extremity weakness after intrathecal methotrexate (MTX) treatment. Initially suspected as Guillain-Barre syndrome (GBS) due to similar clinical features and nerve conduction studies. The patient received intravenous immunoglobulin (IVIG) treatment, but his condition worsened. A subsequent spine MRI revealed MTX-induced myelopathy. This case highlights the diagnostic challenge posed by the similarity in clinical presentation between MTX-induced myelopathy and GBS. Differentiating between these conditions is critical for appropriate management. Prompt recognition and treatment with folate metabolism compounds may mitigate neurological sequelae.

Purpose: This study investigated the hypotensive effect of RKI-1447, a Rho kinase inhibitor, in a porcine ex vivo pigmentary glaucoma model. Methods: Twenty-eight porcine anterior chambers were perfused with medium supplemented with 1.67 × 10⁷ pigment particles/mL for 48 hours before treatment with RKI-1447 (n = 16) or vehicle control (n = 12). Intraocular pressure (IOP) was recorded and outflow facility was calculated. Primary trabecular meshwork cells were exposed to RKI-1447 or vehicle control; effects on the cytoskeleton, motility, and phagocytosis were evaluated. Result: Compared to baseline, the perfusion of pigment caused a significant increase in IOP in the RKI-1447 group (P = 0.003) at 48 hours. Subsequent treatment with RKI-1447 significantly reduced IOP from 20.14 ± 2.59 mmHg to 13.38 ± 0.91 mmHg (P = 0.02). Pigment perfusion reduced the outflow facility from 0.27 ± 0.03 at baseline to 0.18 ± 0.02 at 48 hours (P < 0.001). This was partially reversed with RKI-1447. RKI-1447 caused no apparent histological changes in the micro- or macroscopic TM appearance. RKI-1447-treated primary TM cells showed significant disruption of the actin cytoskeleton both in the presence and absence of pigment (P < 0.001) but no effect on TM migration was observed. Pigment-treated TM cells exhibited a reduction in TM phagocytosis, which RKI-1447 reversed. Conclusion: RKI-1447 significantly reduces IOP by disrupting TM stress fibers and increasing TM phagocytosis. These features may make it useful for the treatment of secondary glaucomas with an increased phagocytic load.

Objective: The Rho GTPase/Rho kinase pathway is an important target in glaucoma treatment. This study investigated the hypotensive effect of RKI-1447, a Rho kinase inhibitor developed for cancer treatment, in a porcine ex vivo pigmentary glaucoma model. Materials and Methods: Twenty-eight fresh porcine anterior chambers were perfused with pigment medium (1.67 × 10⁷ pigment particles/mL) for 48 hours before being subjected to the RKI-1447 (n = 16) or the vehicle control (n = 12). Another twelve eyes with normal medium perfusion served as the control. The intraocular pressure (IOP) was recorded at two-minute intervals and the outflow facility was calculated. To investigate the intracellular mechanism of the IOP reduction, primary trabecular meshwork cells were exposed to RKI-1447 or the vehicle control and then analyzed for changes in cytoskeleton, motility, and phagocytosis. Results: Compared to the baseline, the perfusion of pigment caused a significant increase in IOP in the RKI-1447 group (P = 0.003) at 48 hours. Subsequent treatment with RKI-1447 significantly reduced IOP from 20.14 ± 2.59 mmHg to 13.38 ± 0.91 mmHg (P = 0.02). Pigment perfusion reduced the outflow facility from 0.27 ± 0.03 at baseline to 0.18 ± 0.02 at 48 hours (P < 0.001). This was partially reversed with RKI-1447. RKI-1447 exhibited no apparent changes in the micro- or macroscopic appearance, including histology. Primary TM cells exposed to RKI-1447 showed a significant disruption of the actin cytoskeleton both in the presence and absence of pigment exposure (P < 0.001) but no effect on TM migration was observed. Pigment-treated TM cells exhibited a reduction in TM phagocytosis, which RKI reversed. Conclusions: RKI-1447 is a novel ROCK inhibitor that significantly reduces IOP by disrupting TM stress fibers and increasing TM phagocytosis. These features may make it especially useful for the treatment of secondary glaucomas with an increased phagocytosis load but also for other open angle glaucomas.

The human chromosome 11q13 (HSA 11q13) genomic locus is a major cancer hotspot and has been established as the most frequently altered by amplification in a variety of human cancers. The fatty acid desaturase genes (FADS1, FADS2 and FADS3) localize to the 11q12- 13.1 region. FADS2 activity is promiscuous, catalyzing biosynthesis of polyunsaturated and monounsaturated fatty acids, including unsaturated branched chain fatty acids (BCFA) by Δ6, Δ8, and Δ4 desaturation toward at least 16 substrates. Our main aim here is to review known and putative consequences of FADS2 dysregulation due to effects on the 11q13 locus in various cancer types. We searched PubMed and Google Scholar databases for articles that showed 11q13 amplification and studies reporting FADS2 function in various cancer types. FADS2 silencing causes synthesis of sciadonic acid (ScA, 5Z,11Z,14Z-20:3) in MCF7 cells and breast cancer in vivo. 5Z,11Z,14Z-20:3 is structurally identical to the eicosanoid precursor arachidonic acid (5Z,8Z,11Z,14Z–20:4) except it lacks the internal Δ8 double bond required for prostaglandin and leukotriene synthesis, among other eicosanoids. Melanoma, prostate, liver and lung cancer cells insensitive to SCD inhibition show increased FADS2 activity leading to sapienic acid (16:1n10) biosynthesis from 16:0. Elevated serum mead acid (20:3n-9) levels were found in more than a third of hepatocellular carcinoma patients, indicative of an unsatisfied demand for arachidonic acid, likely as a substrate for eicosanoids. A highly expressed circular RNA (hsa_circ_022382) within an exonic region of FADS2 is associated with shorter overall survival in colorectal cancer patients. Similarly, in lung cancer tissues circFADS2 RNA is highly expressed. Palmitic acid (16:0) is a common substrate for SCD and FADS2. FADS2 circular RNAs are at high levels in colorectal and lung cancer tissues. The evidence thusfar supports an effort for future research on the role of FADS2 as a tumor suppressor in a range of neoplastic disorders.

Flavonoids are important natural compounds characterized by their extensive biological activities. Citrus flavonoids form a significant segment within the broader flavonoid category. Naringenin, an integral part of this series, is recognized for its powerful anti-inflammatory and antioxidant properties. In addition, considering the lack of existing research on naringenin's potential effectiveness and intracellular mechanisms of action in skin-related applications, especially as a cosmetic ingredient, this study aimed to explore naringenin's role in reducing the fundamental generation of reactive oxygen species. This was achieved by examining its inhibitory effects on the expression levels of NADPH oxidase and iNOS, ultimately leading to a reduction in NO production. This research examined the anti-inflammatory and antioxidant capacities of naringenin by employing a cellular senescence model of LPS-induced HDFs. The evaluation of naringenin's efficacy was validated through several investigative procedures, including the NF-κB luciferase assay, ELISA assay, and qRT-PCR. To verify the anti-inflammatory effectiveness of naringenin, the study measured the responsive elements of NF-κB using a luciferase reporter assay. This assessment revealed that naringenin could decrease the concentration of genes activated by NF-κB. Moreover, the study found that naringenin inhibited the transcriptional expression of known NF-κB regulated inflammatory cytokines, including IL-1β, IL-6, and IL-8. In addition, results from the qRT-PCR analysis indicated a reduction in iNOS expression facilitated by naringenin. Based on the data gathered and analyzed in this study, it can be conclusively inferred that naringenin possesses promising potential as a cosmetic ingredient, offering both anti-inflammatory and antioxidant benefits.

Retinopathy is a human eye disease that causes changes in retinal blood vessels that leads to bleed, leak fluid and vision impairment. Symptoms of retinopathy are blurred vision, changes in color perception, red spots, and eye pain. In this paper, a new methodology based on Convolutional Neural Networks (CNN) is developed and proposed to diagnose and give a decision about the presence of retinopathy. The CNN model is trained by different images of eyes that have retinopathy and those which do not have retinopathy. The performance of the proposed model is compared with the related methods of DREAM, KNN, GD-CNN and SVM. Experimental results show that the proposed CNN performs better.

This single-blind and cross-sectional study evaluated the role of Rho-kinase (ROCK) as a biomarker of the cardiovascular remodelling process assessed by echocardiography in competitive long-distance runners (LDR) during the training period before a marathon race. Thirty-six healthy male LDR (37.0±5.3 years; 174.0±7.0 height; BMI: 23.8±2.8; VO2-peak: 56.5±7.3 mL·kg-1·min-1) were separated into two groups according to previous training level: high-training (HT, n=16) ≥100 km·week-1 and low-training (LT, n=20) ≥70 and &lt;100 km·week-1. Also, twenty-one healthy nonactive subjects were included as a control group (CTR). A transthoracic echocardiography was performed and ROCK activity levels in circulating leukocytes were measured at rest (48-hr without exercising) the week before the race. HT group showed higher left ventricular mass index (LVMi) and left atrial volume index (LAVi) than other groups (p&lt;0.05, for both), also higher levels of ROCK activity were found in LDR (HT=6.17±1.41 vs CTR=1.64±0.66 (p&lt;0.01); vs LT=2.74±0.84; (p&lt;0.05)). In LDR a direct correlation between ROCK activity levels and LVMi (r=0.83; p&lt;0.001), and LAVi (r=0.70; p&lt;0.001) were found. In conclusion, in male competitive long-distance runners, the load of exercise implicated in marathon training is associated with ROCK activity levels and the left cardiac remodelling process assessed by echocardiography.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

. Various elements such as evolutions in IoT services resulting from sensoring by vehicle parts and advances in small communication technology devices have significantly impacted the mass spread of mobility services that are provided to users in need of limited resources. In particular, business models are progressing away from one-off cost towards longer term cost as represented by shared services utilizing kick-boards or bicycles and subscription services for vehicle software. Advances in shared mobility services as described are calling for solutions that can enhance reliability of data aggregate by users leveraging mobility services in the next-generation mobility areas. However, mining process to renew status, ensures continued network communication and block creation demands high performance in public block chain. This thesis proposes random certificate node selection mechanism in block network that creates blocks via node that has tokens issued for block creation and lets only specific nodes selected by encrypting token information acquires token.

Network slicing is a promising technology for 5G networks in which operators can sell customized services to different tenants at various prices and Quality of Services (QoS) demands. Thus, the latest 4th Generation (4G) and upcoming 5th Generation (5G) mobile technologies are expected to offer massive connectivity and management of high volume of data traffic in the presence of immense interferences from mobile networks of IoT devices. Further, it will face challenges of congestion and overload of data traffic due to the humongous number of IoT devices. Nevertheless, these devices are likely to demand high throughput, low latency, and high level of reliability especially for critical real-time applications such as in Vehicular Communication System (VCS). To address these issues in 5G mobile networks, this paper proposes a Slice Allocation Management (SAM) Model based on the critical services of smart systems such as VCS to satisfy QoS demands. The proposed model aims at providing dedicated slices on the basis of service requirements such as expected throughput and latency for VCS. To ensure such performance and provide data traffic priorities of IoT devices in the uplink of Relay Nodes (RNs) cells in the 5G mobile networks, we have sliced the Radio Access Networks (RAN), along with the assignment of the nearest Mobile Edge Computing (MEC) with isolated slices based on the priorities for each IoT nodes to reduce latency level. The proposed model was simulated and validated using the OPNET simulator. The results obtained demonstrate that SAM Model is able to achieve improvement of end to end delays and uplink throughputs of the networks in high-density networks of IoT devices.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Poor survival of human pluripotent stem cells (hPSCs) following freezing, thawing, or passaging hinders maintenance and differentiation in stem cell research. Rho-associated kinases (ROCKs) play a crucial role in hPSC survival. To date, a typical ROCK inhibitor, Y-27632, has been the primary agent used in hPSC research. Here, we report that another ROCK inhibitor, fasudil, can be used as an alternative. Fasudil increased hPSC growth due to survival rather than proliferation following thawing and passaging, similar to Y-27632. It did not affect pluripotency and genetic integrity including mitochondrial genome (mtDNA). Notably, the genes related to metabolism, mTORC1, and TP53 have mainly displayed a faster recovery pattern with ROCK inhibitors than control. Furthermore, fasudil was confirmed as useful for the single dissociation of hPSCs and for aggregation. It also increased retinal pigment epithelium (RPE) differentiation and the survival of neural crest cells during differentiation. These findings suggest that fasudil can replace Y-27632 for use in stem cell research.

In this study, the focus is on the drop test simulation of an MR (Magnetorheological) damper-based main landing gear (MRMLG), aiming to explore multi-degree-of-freedom (DOF) dynamic models during aircraft landing. Three different 6-DOF dynamic models are proposed in this work and their drop performances are compared with results achieved one of commercial softwares. The proposed models include a nonlinear aircraft model (NLAM), a linearized approximated aircraft model (LAAM) linearizing from the nonlinear equations of motion in NLAM, and a fully approximated aircraft model (FAAM) which linearizes the MRMLG's strut force model. In order to evaluate drop performance of the aircraft landing gear system with MR dampers, a 7-DOF aircraft model incorporating the nonlinear MRMLG is formulated using RecurDyn. The principal comparative param-eters are the coefficient of determination (R2) for system response of each model with Re-curDyn model and root mean square error (RMSE) which is the ensembles of CG dis-placement data for each model. In addition, the ensemble of time series data is created for diverse drop scenarios, providing valuable insights into the performance of the proposed drop test models of the aircraft landing gear system featuring MR dampers.

We investigated the efficacy of a Rumex crispus and Cordyceps sinensis mixture made using the Beopje (Korea traditional processing method to remove anti-nutrients and enhance phytochemicals) method to regulate immune cell responses toward nitric oxide (NO) production, pro-inflammatory cytokines, and inflammation related genes in mice splenocytes. The six experimental groups were as follows: control (control), Rc-Cs (Rumex crispus (Rc) and Cordyceps sinensis (Cs) mixture, 6:4), TMC (Taemyeongcheong, commercial healthy drink containing Rc-Cs), LPS (lipopolysaccharide), LPS+Rc-Cs, and LPS+TMC. The Rc-Cs mixture reduced nitric oxide (NO) production in LPS-induced splenocytes. Moreover, Rc-Cs enhanced production of the pro-inflammatory cytokines TNF-α, IFN-γ, IL-1β, and IL-6 compared to the control (no treatment). However, Rc-Cs inhibited production of pro-inflammatory cytokines in LPS-induced splenocytes. In addition, LPS+Rc-Cs also significantly suppressed mRNA expression of IL-1β and IL-6 compared to LPS treatment. Interestingly, Rc-Cs did not increase mRNA levels of iNOS and COX-2, which are inflammation related genes compared to the control, while LPS+Rc-Cs reduced mRNA levels of iNOS and COX-2 compared LPS alone (p < 0.05). TMC showed a similar pattern compared to Rc-Cs. Therefore, Rc-Cs treatment in splenocytes enhanced NO production and pro-inflammatory cytokines compared to the control, whereas Rc-Cs treatment in LPS-induced splenocytes reduced NO production, pro-inflammatory cytokines, and inflammation related genes. Thus, Rc-Cs regulated immune cells responses by increasing pro-inflammatory cytokines in splenocytes and reducing toxin (LPS)-induced inflammation. These results indicate that a Rumex crispus and Cordyceps sinensis mixture (Rc-Cs) and TMC containing Rc-Cs promote immune cells responses and anti-inflammatory activities.

Controversy exists on whether animal and plant proteins influence obesity differently. The purpose of this study was to evaluate the association between total, animal, and plant protein intake with the obesity index and renal function in Korean adults. Study participants included Korean adults aged 60 years or older from the Korean National Health and Nutrition Examination Survey in 2013-2014. Height, weight, and waist circumference (WC) were measured and the body mass index (BMI) was calculated. One-day 24-hour recall data were used to estimate the daily total, animal, and plant protein intake. Glomerular filtration rate (GFR) was calculated by using the Modification of Diet in Renal Disease (MDRD) equation. General linear modellings were used to assess the relationships between protein intake, BMI and WC. The mean age was 69.2 ± 0.2 years, 44.2% were male. The total daily protein intake was 1.1 ± 0.02 g/kg/d and 0.9 ± 0.02 g/kg/d for males and females, respectively. Only one third of protein intake was from animal sources. In males, BMI (p < 0.001, p = 0.016, p < 0.001 respectively) and WC (p < 0.001, p = 0.010, p < 0.001, respectively) decreased as daily intake of plant protein (g/kg/d), animal protein (g/kg/d) and total protein (g/kg/d) increased. Similar associations were shown in Korean female. GFR was not associated with protein intake regardless of protein source in both sexes. In Korean adults aged 60 years or older, the protein intake was associated with a favorable obesity index without decrease in renal function. The effect was similar in both male and females, with both animal and plant proteins.

: Chemical accidents can occur anywhere. The need for chemical management in Korea was realized following the 2012 Gumi hydrofluoric acid accident in 2012. The Chemicals Control Act was enacted in 2015. This system evaluates the risks (high, medium, low) and consequent safety management at all plants that handle hazardous chemical substances. However, the system was criticized as excessive when most plants were designated high-risk without considering their size. Thus, laboratories and hospitals handling very small quantities were subject to regulation. Accordingly, in 2021 Korea revised the system to include off-site consequence analyses and a Korean-style risk analysis. Plants handling very small quantities, such as laboratories and hospitals, were exempt from regulation. In this study, plating and paint manufacturing companies, which were classified as high-risk in the previous system, even though they were medium-size business plants, were re-evaluated as low-risk plants. In the Korean-style risk analysis, it is possible to see at a glance what is lacking in the plants, such as cooperation between local residents and local governments and the construction of safety facilities according to the type of accident scenario. The revised system is a reasonable regulation for medium business plants.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

While fibrinolytic enzymes and thrombolytic agents offer assistance in treating cardiovascular diseases, the existing options are associated with a range of adverse effects. In our previous research, we successfully identified ficin, a naturally occurring cysteine protease that possesses unique fibrin and fibrinogenolytic enzymes, making it suitable for both preventing and treating cardiovascular disorders linked to thrombosis. Papain is a prominent natural cysteine protease derived from the latex of Carica papaya. The potential role of papain in preventing fibrin(ogen)lytic, anticoagulant, and antithrombotic activities has not yet been investigated. Therefore, we examine how papain influences fibrinogen and the process of blood coagulation. Papain is highly stable at pH 4-11 and 37-60°C by azocasein assay. In addition, SDS gel separation electrophoresis, zymography, and fibrin plate assays were used to determine fibrinogen and fibrinolysis activity. Papain appears to have a molecular weight of around 37 kDa, and is highly effective in degrading fibrin, with a molecular weight of over 75 kDa. Furthermore, papain-based hemostatic performance was confirmed in blood coagulation tests, a blood clot lysis assay, and a κ-carrageenan rat tail thrombosis model, highlighting its strong efficacy in blood coagulation. Papain shows dose-dependent blood clot lysis activity, cleaves fibrinogen chains of Aα, Bβ, and γ-bands and significantly extends prothrombin time (PT) and activated partial thromboplastin time (aPTT). Moreover, the mean length of the infarcted regions in the tails of Sprague-Dawley rats with κ-carrageenan was shorter in rats administered 10 U/kg of papain than in streptokinase-treated rats. Thus, papain, a natural cysteine protease, has distinct fibrin and fibrinogenolytic properties, suggesting its potential for preventing or treating cardiovascular issues and thrombosis-related diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Prompt removal of misfolded membrane proteins and misassembled membrane protein complexes is essential for membrane homeostasis. However, the elimination of these toxic proteins from the hydrophobic membrane environment has high energetic barriers. Transmembrane FtsH is the only known ATP-dependent protease responsible for this task, unlike other well-studied soluble ATP-dependent proteases. The mechanisms by which FtsH recognizes, unfolds, translocates, and proteolyzes its substrates remain unclear. Here, we report the crystal structures of the Thermotoga maritima FtsH periplasmic domain (PD) in an associative trimeric state at a 1.5-1.95 Å resolution. We also describe the pH-dependent oligomerization states of the isolated PD using dynamic light scattering. These observations help us understand how FtsH recognizes membrane-anchored misfolded proteins.

A biocatalytic system that could produce bioactive resveratrol poly-glucosides using sucrose as a low-cost source of UDP-glucose donors and amylosucrase DgAS from Deinococcus geothermalis was developed in this study. This system boasts several advantages, including fast and direct conversion of substrates to products, thermostable, and regio-stereospecific, and effectiveness in vitro and in vivo at 40°C. With a success rate of around 97.0% in a short period in vitro and 95.0% in vivo, resveratrol-O-glucosides showed exciting outcomes in cosmetic activities, such as antioxidant, anti-inflammatory, anti-aging, and whitening effects when tested with Raw 264.7, B16, and HS68 cell lines. DgAS is recognized as an important biocatalyst due to its higher thermostability, effectiveness, and specificity among all known amylosucrases (ASases) in the production of poly-glucosides in a chain of polyphenols, like resveratrol, making it an ideal candidate for industrial use to cost-effective production of cosmetic items.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Downregulated microRNA-142-3p signaling contributes to the pathogenesis of endometriosis [1] [2], an invasive disease where the lining of the uterus grows at ectopic locations, by yet incompletely understood mechanisms. Using bioinformatics and in vitro assays, this study identifies cytoskeletal regulation and integrin signaling as two relevant categories of miR-142-3p targets. qPCR revealed that miR-142-3p upregulation in St-T1b cells downregulates ROCK2, CFL2, RAC1, WASL and ITGAV. qPCR and Western-blotting showed miR-142-3p effect on WASL and ITGAV was significant also in primary endometriotic stroma cells. Luciferase reporter assays in ST-T1b cells then confirmed direct regulation of ITGAV and WASL. On the functional side, miR-142-3p upregulation significantly reduced ST-T1b cell size, the size of vinculin plaques, migration through fibronectin-coated transwell filters and the ability of ST-T1b and primary endometriotic stroma cells to contract collagen I gels. These results suggest that miR-142-3p has a strong mechanoregulatory effect on endometrial stroma cells and its external administration reduces the invasive endometrial phenotype. Within the limits of an in vitro investigation, our study provides new mechanistic insights into the pathogenesis of endometriosis and provides a perspective for the development of miR-142-3p based drugs for inhibiting invasive growth of endometriotic cells.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

The effects of chemical composition and solidification rate on the solidification behavior of high-Cr white irons were investigated through directional solidification. Increasing the solidi-fication rate in hypoeutectic alloys caused the finer dendrite arm spacing as expected. The eutec-tic structure which formed in the interdendritic region comprised of M7C3 and austenite, how-ever, secondary dendrite arms of hypoeutectic alloys contained a few M7C3 particles that solidi-fied prior to the eutectic structure. The transition from cellular to dendritic solidification oc-curred at a solidification rate between 50 µm/s and 100 µm/s in a near eutectic alloy. In the near eutectic alloy with cellular solidification, a directionally arrayed in-situ composite of M7C3/austenite formed within the cell. Speckle-like feature appeared in the intercellular region due to M23C6 carbide precipitation during subsequent cooling after freezing. Like dendrite arm spacing in hypoeutectic alloys, the inter-speckle spacing and the inter-fibre spacing became finer with increasing solidification rate in the cellular solidification range.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

In South Korea, in line with the increasing need for a reliable water supply following the continuous increase in water demand, the Smart Water Grid Research Group (SWGRG) was officially launched in 2012. With the vision of providing water welfare at a national level, SWGRG incorporated information and communications technology in its water resource management, aiming at the development of core technologies for a Smart Water Grid consisting of intelligent microgrids and a demonstration and tests of the developed technologies through a field operation in a living lab. The living lab was built in Block 112 of YeongJong Island, Incheon, South Korea (area of 17.4 km2, population of 8,000), where Incheon International Airport, a hub of Northeast Asia, is located. In this location, water is supplied through a single submarine pipeline, making the place optimal for responses to water crises and the construction of a water supply system during emergencies. From 2017 to 2019, ultrasonic wave type smart water meters and IEEE 802.15.4g advanced metering infrastructure (AMI) networks were installed at 527 sites of 958 consumer areas in the living lab, and core element technologies (intelligent water source management and distribution system, smart water distribution network planning/control/operation strategy establishment, AMI network and device development, integrated management of bi-directional smart water information), and operation solutions (smart water statistics information, real-time demand-supply analysis, decision support system, real-time hydraulic pipeline network analysis, smart DB management, and water information mobile application) were developed through a field operation and testing.

Microbial production is a promising method that can overcome major limitations in conventional methods of lycopene production, such as low yields and variations in product quality. Significant efforts have been made to improve lycopene production by engineering either the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway or mevalonate (MVA) pathway in microorganisms. To further improve lycopene production, it is critical to utilize metabolic enzymes with high specific activities. Two enzymes, 1-deoxy-D-xylulose-5-phosphate synthase (Dxs) and farnesyl diphosphate synthase (IspA), are required in lycopene production using MEP pathway. Here, we evaluated the activities of Dxs and IspA of Vibrio sp. dhg, a newly isolated and fast-growing microorganism. Considering that the MEP pathway is closely related to the cell membrane and electron transport chain, the activities of the two enzymes of Vibrio sp. dhg were expected to be higher than the enzymes of E. coli. We found that Dxs and IspA in Vibrio sp. dhg exhibited 1.08-fold and 1.38-fold higher catalytic efficiencies, respectively. Consequently, the heterologous overexpression improved the specific lycopene production by 1.88-fold. Our findings could be widely utilized to enhance production of lycopene and other carotenoids.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

This study explores the near-surface dispersion mechanisms of contaminants in coastal waters, leveraging a comprehensive method that includes using dye and drifters as tracers, coupled with diverse observational platforms like drones, satellites, in-situ sampling, and HF radar. The aim is to deepen our understanding of surface currents' impact on contaminant dispersion, thereby improving predictive models for environmental incident management, including pollutant releases. Rhodamine WT dye, chosen for its significant fluorescent properties and detectability, along with drifter data, allowed us to investigate the dynamics of near-surface physical phenomena such as the Ekman current, Stokes drift, and wind-driven currents. Our research emphasizes the importance of integrating scalar tracers and Lagrangian markers in experimental designs, revealing differential dispersion behaviors due to near-surface vertical shear caused by the Ekman current and Stokes drift. The elongation direction of the dye patch aligns with the Ekman current direction during slow current conditions. Analytical calculations of vertical shear, based on the Ekman current and Stokes drift, closely matched those derived from tracer observations. Over a 7-hour experiment, the vertical diffusivity of near-surface water was observed at 2×10-4 m2/s, and the horizontal eddy diffusivity of the dye patch and drifters reached the order of 1 m2/s and at a 1000m length scale. Particle tracking models demonstrate that while HF radar currents can effectively predict the trajectories of tracers near the surface, incorporating near-surface currents, including Ekman current, Stokes drift, and windage, is essential for a more accurate prediction of the fate of surface floats.

Respiratory rate is an important biomarker that indicates changes in the clinical condition of critically ill patients, so a surveillance tool that can accurately monitor the changing respiratory rate in real time is needed. Through investigating various pairs of machine learning models, we proposed new machine learning model for real-time respiratory rate estimation using photoplethysmogram. New photoplethysmogram-driven respiratory rate dataset(StMary) was collected from surgical intensive care unit of a tertiary referral hospital, using photoplethysmogram signal collector. For 50patients and 50healthy volunteers, 2-minute photoplethysmogram was collected for each subject twice. To evaluate the respiratory rate of subject, it was inputted into the deep neural network model we built, and dataset was splitted into training, validation, testing dataset, then 4-fold cross validation was exploited. Our deep neural network model trained with StMary and two public datasets(BIDMC and CapnoBase) individually, or selectively merged dataset had shown a low error rate in respiration rate measurements. Our model trained with StMary showed low mean absolute error score(1.0273±0.8965), and trained with 3 datasets(CapnoBase, BIDMC and StMary) showed a lower error rate(1.7359±1.6724) than the model trained with CapnoBase and BIDMC(1.9480±1.6751). We could verify the performance of model evaluating respiratory rate from photoplethysmogram, and our dataset could contribute as the clinical research data that supports artificial intelligence models evaluating respiratory rate and surveillance tools to test whether their monitoring function works properly.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Due to the shortage of agricultural labor forces and rapid aging of farmers, the utilization of tractors is becoming popular and essential in Korea. Tractors can be classified into two types, a walking tractor called as a power tiller and a riding tractor. In this study, agricultural tractors including walking and riding types were categorized into 4 levels by rated output power. And diesel emission inventory of tractors was established and analyzed using 2011 and 2019 survey data in Korea. Emission inventory including CO, NOx, SOx, TSP(PM10), PM2.5, VOCs and NH3 were established using Tier 3 methodology. The total amount of emission using agricultural tractors was decreased about 13% from 2011 to 2019. The number of walking tractors were decreased by about 19% in 8 years, on the other hand that of riding tractors were increased by about 12%. However, the emission reduction is about 48% for walking tractors and the emission increment is about 5% for riding tractors. Thus, the total emission from agricultural tractors was decreased by about 16% in those periods. It is due to the decrease of 21% and 15% in the hours of use of walking and riding tractors, respectively, in 2019. Walking tractors mainly emit air pollutants from spraying and transporting. Riding tractors mainly 61% of total air pollutants emits from soil preparation and transporting operations. Geographic information system (GIS) was used to spatially assign air pollutants variables into 17 provinces and metropolitan cities in Korea. High emission generating regions and changes of emissions during 8 years were clearly seen in GIS analysis. High air pollutant emitting regions are mainly located in the western and southern regions of Korea, which have plenty of arable areas compared to other regions in Korea.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Prostaglandin E2 (PGE2) is an important biological mediator involved in the defense against Mycobacterium tuberculosis (Mtb) infection. Currently, there are no reports on the mycobacterial components that regulate PGE2 production. Previously, we have reported that RpfE-treated dendritic cells (DCs) effectively expanded the Th1 and Th17 cell responses simultaneously; however, the mechanism underlying Th1 and Th17 cell differentiation is unclear. Here, we show that PGE2 produced by RpfE-activated DCs via the MAPK and cyclooxygenase 2 signaling pathways induces Th1 and Th17 cell responses mainly via the EP4 receptor. Furthermore, mice administered intranasally with PGE2 displayed RpfE-induced antigen-specific Th1 and Th17 responses with a significant reduction in bacterial load in the lungs. Furthermore, the addition of optimal PGE2 amount to IL-2-IL-6-IL-23p19-IL-1β was essential for promoting differentiation into Th1/Th17 cells with strong bactericidal activity. These results suggest that RpfE-matured DCs produce PGE2 that induces Th1 and Th17 cell differentiation with potent anti-mycobacterial activity.

Purpose Immune responses for cancer cells can be altered according to genetic variation of human leukocyte antigen (HLA). Association of HLA polymorphism with risk of various cancer types is well known. However, the association between HLA and glioblastoma (GBM) remains uncertain. We sought to evaluate the association of HLA polymorphism with risk of GBM development in Koreans. Materials and Methods A case-control study was performed to identify the odds ratios (OR) of HLA class I and II genes for GBM. The control group consisted of 142 healthy Korean volunteers, and the GBM group was 80 patients with newly diagnosed GBM at our institution. HLA class I (-A, -B, and –C) and class II (-DR, -DQ, and –DP) genotyping was performed by high-resolution polymerase chain reaction (PCR)-sequence-based typing (PCR-SBT) methods. Results There were significantly decreased frequencies of HLA-A*26:02 (OR 0.22 CI 0.05-0.98), HLA-C*08:01 (OR 0.29 CI 0.10-0.87), and HLA-DRB1*08:03 (OR 0.32 CI 0.11-0.98), while there was significantly increased frequency of HLA-C*04:01 (OR 2.29 CI 1.05-4.97). In analysis of haplotypes, the frequency of DRB1*14:05-DQB1*05:03 was significantly decreased (OR 0.22 CI 0.05-0.98). Conclusion This study suggests that genetic variations of HLA may affect GBM development in Koreans. Further investigations with larger sample sizes are needed to delineate any potential role of the HLA polymorphisms in the pathogenesis of GBM development.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

The CCAAT/enhancer-binding protein β (C/EBPβ) is a transcription factor that regulates cellular proliferation, differentiation, apoptosis and tumorigenesis. Although the pro-oncogenic roles of C/EBPβ have been implicated in various human cancers, how it contributes to tumorigenesis or tumor progression has not been determined. Immunohistochemistry with human non-small cell lung cancer (NSCLC) tissues revealed that higher levels of C/EBPβ protein are expressed compared to normal lung tissues. Knockdown of C/EBPβ by siRNA reduced the proliferative capacity of NSCLC cells by delaying G₂/M transition of the cell cycle. In C/EBPβ-knockdown cells, a prolonged increase in phosphorylation of cyclin dependent kinase 1 at tyrosine 15 (Y15-pCDK1) was displayed with increased Wee1 and decreased Cdc25B expression, simultaneously. ChIP analysis showed that C/EBPβ bound to distal promoter regions of WEE1 and repressed WEE1 transcription through the interaction with histone deacetylase 2. Treatment of C/EBPβ-knockdown cells with a Wee1 inhibitor induced a decrease in Y15-pCDK1 and recovered cells from G₂/M arrest. In the xenograft tumors, the depletion of C/EBPβ significantly reduced tumor growth. Taken together, these results indicate that Wee1 is a novel transcription target of C/EBPβ that is required for the G₂/M phase of cell cycle progression, ultimately regulating proliferation of NSCLC cells.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

Many quantum dot light-emitting diodes (QLEDs) utilize ZnO nanoparticles (NPs) as an electron injection layer (EIL). However, the use of ZnO NP ETL material often results in charge imbalance within the quantum dot (QD) emitting layer (EML) and exciton quenching at the interface of QD EML and ZnO NP EIL. To overcome these challenges, we introduced an Arginine (Arg) interlayer (IL) onto the ZnO NP EIL. The Arg IL elevated the work function of ZnO NPs, thereby suppressing electron injection into the QD, leading to improved charge balance within the QDs, Additionally, the inherent insulating nature of the Arg IL prevented direct contact between QDs and ZnO NPs, reducing exciton quenching and consequently improving device efficiency. The inverted QLED (IQLED) utilizing a 20-nm-thick Arg IL on ZnO NP EIL exhibited a 2.22-fold increase in current efficiency and a 2.28-fold increase in EQE and compared to an IQLED without an IL. Likewise, the IQLED with a 20-nm-thick Arg IL on ZnO NP EIL demonstrated a 1.34-fold improvement in current efficiency and a 1.36-fold increase in EQE compared to IQLED with a 5-nm-thick PEI IL on ZnO NPs.

In this study, the effect of hot stamping forming process on the properties change of compound layer in Al–Si coated high-strength steel sheet with different thickness was investigated. The coating layer in hot stamped high-strength steel sheet was composed of a diffusion layer and a compound layer. As the hot stamping temperature and holding time for forming increased, the thickness of the compound layer in the Al–Si coated high-strength steel sheet increased. The thickness of coating layer with the hot stamping for 500 sec at 890, 910 and 950 °C was obtained 8.9, 11.8, and 20.6 micrometer, respectively. The thickness of coating layer with hot stamping for 180, 500 and 550 sec at 910 ^oC was obtained 5.7, 11.8, and 17.8 micrometer, respectively. The compound layer in hot stamped high-strength steel sheet with Al–Si coating layer consists of Al_5.4Fe₂ and Fe₂Si phases. In the compound layer, Al and Si were irregularly distributed.

The aim of this study was to analyze whether the respiratory variation in ECG standard lead II R-wave amplitude (ΔRDII) could be used to assess intravascular volume status following inferior vena cava (IVC) clamping. This clamping causes an acute decrease in cardiac output during liver transplantation (LT). We retrospectively compared ΔRDII and related variables before and after IVC clamping in 34 recipients. Receiver operating characteristic (ROC) curve and area under the curve (AUC) analyses were used to derive a cutoff value of ΔRDII for predicting pulse pressure variation (PPV). After IVC clamping, cardiac output significantly decreased while ΔRDII significantly increased (P = 0.002). The cutoff value of ΔRDII for predicting a PPV >13% was 16.9% (AUC: 0.685) with a sensitivity of 57.9% and specificity of 77.6% (95% confidence interval 0.561 – 0.793, P = 0.015). Frequency analysis of ECG also significantly increased in the respiratory frequency band (P = 0.016). Although significant changes in ΔRDII during vena cava clamping were found at norepinephrine doses < 0.1 μg/kg/min (P = 0.014), such changes were not significant at norepinephrine doses > 0.1 μg/kg/minP = 0.093). ΔRDII could be a noninvasive dynamic parameter in LT recipients presenting with hemodynamic fluctuation. Based on our data, we recommended cautious interpretation of ΔRDII may be requisite according to vasopressor administration status.

In order to accurately identify the external economic situation in China and analyze the situation of economic development in Northeast China, based on the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis framework, this article analyses the economy in Northeast China from the four factors of SWOT. To solve the lack of quantitative analysis in SWOT analysis, this article applies Analytic Hierarchy Process (AHP) to the analysis, and finally forms a complete system framework with the combination of qualitative and quantitative factors, through the analysis of the important degree of various factors and the consistency test, the key factors influencing the economic development in Northeast China are analyzed, and constructive countermeasures are proposed.

A new design scheme is proposed for twisting the walls of a microchannel, and its performance is demonstrated numerically. The numerical study was carried out for a T-shaped microchannel with twist angles in the range of 0 to 34π. The Reynolds number range was 0.15 to 6. The T-shaped microchannel consists of two inlet branches and an outlet branch. The mixing performance was analyzed in terms of the degree of mixing and relative mixing cost. All numerical results show that the twisting scheme is an effective way to enhance the mixing in a T-shaped microchannel. The mixing enhancement is realized by the swirling of two fluids in the cross section and is more prominent as the Reynolds number decreases. The twist angle was optimized to maximize the DOM, which increases with the length of the outlet branch. The twist angle was also optimized in terms of the relative mixing. The two optimum twisting angles are generally not coincident. The optimum twist angle shows a dependence on the length of the outlet branch but it is not affected much by the Reynolds number.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

As the global demand for clean and sustainable energy sources intensifies, hydrogen emerges as a promising alternative fuel. The widespread adoption of hydrogen, however, is impeded by the lack of efficient systems for storage and transportation. This review aims to summarize the recent advancements and prevailing challenges within the realm of hydrogen storage and transportation, thereby providing guidance and impetus for future research and practical applications in this domain. Through a systematic selection and analysis of the latest literature, this study highlights the strengths, limitations, and technological progress of various hydrogen storage methods, including compressed gaseous hydrogen, cryogenic liquid hydrogen, organic liquids hydrogen, solid materials hydrogen storage, as well as the feasibility, efficiency, and infrastructure requirements of different transportation modes such as pipelines, road and seaborne transportation. The findings reveal that challenges such as low storage density, high costs, and inadequate infrastructure persist despite progress in high-pressure storage and cryogenic liquefaction. The review also underscores the potential of emerging technologies and innovative concepts, including metal-organic frameworks, nanomaterials, and underground storage, along with the potential synergies with renewable energy integration and hydrogen production facilities. In conclusion, interdisciplinary collaboration, policy support, and ongoing research are essential in harnessing hydrogen’s full potential as a clean energy carrier. This review concludes that research in hydrogen storage and transportation is vital to global energy transformation and climate change mitigation.

In Korea, the underground silo structure for low- and intermediate-level radioactive waste disposal facilities has been constructed and operated since 2014. Large-scale earthquakes occurred in 2016 and 2017, respectively, in Gyeongju and Pohang areas near the underground silo structures, and interest in the stability of the underground silo increased significantly. In this paper, one-dimensional free field analyses have been carried out before the three-dimensional silo dynamic analyses subjected to earthquake loadings. As an additional study, a new form of finite element equilibrium equation is derived in terms of relative motions, which is essentially the same equation as that expressed in terms of total motions where the base shear force is applied for earthquake load. The accuracy of conventional finite element solutions is evaluated by directly comparing them with closed-form solutions by frequency domain analysis such as SHAKE91.