Background Telomere shortening is related to aging and unfavourable health outcomes. Obesity and metabolic diseases are important factors for accelerating aging. This study aimed to find out the association between obesity, metabolic disease, and telomere length in metabolically healthy adults. Methods 237 adults were enrolled with written consents at a health promotion centre of a tertiary hospital from February 2014 to March 2015. After excluding 99 subjects who met the exclusion criterion, a total of 130 metabolically healthy subjects were selected for final analysis. The subjects were divided into quartile groups according to the telomere lengths of their oral mucosal cells. Results The subjects consisted of 66 (50.8%) males with a mean age of 58.59 years. The body mass index (BMI, kg/m2) increased significantly along with the quartile groups (Q1, 23.00; Q2, 23.96; Q3, 23.70; Q4, 25.20; P-for trend=0.008). Waist circumference (WC, P-for trend=0.022), waist-to-hip ratio (WHR, P-for trend=0.005), and waist-to-height ratio (WHtR, P=0.001) also increased along with the quartile groups. Obesity prevalence (BMI ≥25 kg/m2), abdominal obesity (WC ≥90 cm for men, ≥85 cm for women), WHR 〉1.0 for men or 〉0.85 for women, and WHtR ≥0.5 increased significantly as the telomere length increased (P-for trend <0.05). After adjusting for covariates, the ORs for each obesity markers increased as the telomere length increased (P-for trend <0.05); and the ORs of WHtR were especially meaningful (Q1, 1.00; Q2, 2.53; Q3, 2.97; Q4, 7.81; P-for trend = 0.001). There were no significant trends for metabolic syndrome and its components along with the prevalence of fatty liver disease. Conclusion Obesity markers and telomere length had significant positive correlation despite the established theory. The obesity paradox may exist in metabolically healthy adults with regard to telomere length, However, further studies with larger sample sizes for the association between obesity and telomere length are needed.

Background: Animal-assisted therapy has positive effects on cognitive function, depression, performance ability, and social functioning in elderly patients. The aim of this study was to evaluate the effects of rearing pet insects on the cognitive function of healthy elderly participants, with fMRI (functional magnetic resonance imaging) being used for this purpose. Methods: Community-dwelling elderly women (≥60 years) with normal cognitive function were enrolled during April 2015. They were randomized at a 1:1 ratio into two groups: insect-rearing and control (n=16) groups, with the insect-rearing group being further classified into two groups for analysis according to the subjects’ scores in the Wisconsin Card Sorting Test, WCST) at the first fMRI: insect-rearing group I with a relatively high score (n=13), and insect-rearing group II with a relatively low score (n=6). All subjects were educated on a healthy lifestyle for better cognitive function at every visit, and the insect-rearing groups received and reared crickets as pet insects. The fMRI was performed at baseline and after 8 weeks using the WCST as a stimulus. The WCST consisted of two variations, a high level baseline (HLB) and semi-WCST version. Results: There were no significant differences in the baseline characteristics among the three groups. There was a significant difference accuracy of the HLB–semi-WCST (p<0.05) in insect-rearing group II after 8 weeks from the baseline test. In the fMRI analysis involving the WCST reaction test, increased activation was observed in the right dorsal lateral prefrontal cortex and parietal cortex in insect-rearing group II when the semi-WCST, rather than the HLB, was performed. There were no significant differences in the other groups. Conclusion: The rearing of pet insects as an animal-assisted therapy is cost-effective, easy, and occupies little space. In this study, it showed positive effects on executive functions and performance improvement in elderly women. Further larger studies on the effects of pet insects on cognitive function are warranted.

Glioblastoma (GBM) is a representative malignant brain tumor characterized by a dismal prognosis, with survival rates of less than 2 years and high recurrence rates. Despite surgical resection and several alternative treatments, GBM remains a refractory disease due to its aggressive invasiveness and resistance to anticancer therapy. In this report, we explore the role of fibronectin type III domain containing 3B (FNDC3B) and its potential as a prognostic and therapeutic biomarker in GBM. GBM exhibited a significantly higher cancer-to-normal ratio compared to other organs, and patients with high FNDC3B expression had a poor prognosis (p < 0.01). In vitro studies revealed that silencing FNDC3B significantly reduced the expression of Survivin, an apoptosis inhibitor, and also reduced cell migration, invasion, extracellular matrix adhesion ability, and stem cell properties in GBM cells. Furthermore, we identified that FNDC3B regulates PTEN/PI3K/Akt signaling in GBM cells using MetaCore integrated pathway bioinformatics analysis and a proteome profiler phospho-kinase array with sequential western blot analysis. Collectively, our findings suggest FNDC3B as a potential biomarker for predicting GBM patient survival and for the development of treatment strategies for GBM.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Hybrid fiber reinforced composites can be controlled by price, weight and various mechanical properties depending on fiber ratio and lamination method. Despite these excellent hybrid properties, there is a disadvantage that inter-laminar fracture due to external impact, which is the biggest weakness of fiber reinforced composite materials, is weak. The test specimens were prepared by using a vacuum bag method, which is manufactured by using an autoclave device. The pre-preg is manufactured in the form of a B-stage. In the process of fabricating the nanoparticle pre-preg, the homogeneizer using an ultrasonic wave was used to disperse the epoxy subject without the curing agent into nanoparticles. The dispersion of the nanoparticles was dispersed by the weight of the epoxy resin. This is to take into account the cohesion of HNT and to understand the range of cohesion of HNT in a matrix with viscosity and its phenomenon. According to the Comparison of the interlayer interfacial properties and mechanical properties of Aramid / Basalt fiber hybrid composites by HNT addition, the fracture toughness, ILSS and bending strength of specimens with HNT content of more than a certain level were decreased because of the aggregation of HNT.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

The spring-in phenomenon of the composite parts can affect the assembly process. This study aims to predict the spring-in phenomenon of carbon fiber reinforced plastic (CFRP) part. Here, we predict the spring-in of the CFRP part using a coupled analysis of the forming and cooling processes during the stamping process. First, a simulation of the entire forming process, such as the transfer of the composite laminate, gravity analysis, and forming was performed to obtain the temperature distribution of the CFRP part. Subsequently, a finite-element (FE) simulation of the cooling process was conducted to predict the spring-in phenomenon of the shaped CFRP part using the temperature data obtained in the forming simulation. Finally, a CFRP part was manufactured and compared with the results of the FE simulation.

Acoustic emission (AE) is caused by the sudden release of energy by a material as a result of material degradation related to deformation, crack, or fault within a solid. The same situation also occurs in leaks caused by turbulence in the fluid around the leak. In this study, analytical modeling for AE due to leakage through a circular pinhole in a gas storage cylinder was performed. The displacement fields responsible for AE, excited by the concentrated force (CF) associated with the turbulent flow though the pinhole, were derived by solving the Navier-Lamé equation. The CF as an excitation source was formulated in terms of a fluctuating Reynolds stress (FRS) and spatial Green’s function. In particular, a series of experiments were conducted under different operating conditions to explore the characteristics of the AE signals due to leak in a gas cylinder. Finally, the simulation and experimental results were compared to verify the accuracy of the simulation results.

This research was conducted to manufacture thermally expandable microspheres (TEMs) for vehicles’ underbody coating and to apply them on an industrial scale. TEMs heat resistance was studied depending on the ratios of a cross-linking agent and an initiator. This research focused on the content of a cross-linking agent and how it affected the results. The TEMs’ outer shell was thickened to solve the problem of the foam expansion ratio’s reduction that occurred due to the shrinkage after the maximum expansion (Tmax) was reached. After foaming, the cross-sectional thickness and surface of the sample with thickened outer shell were observed. The TEMs with the thickened shell showed the least shrinkage, which indicated excellent shrinkage stability, even after prolonged exposure to heat.

This research was conducted to manufacture thermally expandable microspheres (TEMs) for vehicles’ underbody coating and to apply them on an industrial scale. TEMs heat resistance was studied depending on the ratios of a cross-linking agent and an initiator. This research focused on the content of a cross-linking agent and how it affected the results. The TEMs’ outer shell was thickened to solve the problem of the foam expansion ratio’s reduction that occurred due to the shrinkage after the maximum expansion (Tmax) was reached. After foaming, the cross-sectional thickness and surface of the sample with thickened outer shell were observed. The TEMs with the thickened shell showed the least shrinkage, which indicated excellent shrinkage stability, even after prolonged exposure to heat.

Achievement of solid fusion of the lumbosacral junction (L5-S1 level) is an important factor in adult spinal deformity (ASD) surgery. The purpose of this study is to explore the effectiveness and feasibility of injectable rhBMP-2 (a combination of Eschericia coli-derived rhBMP-2 and hydrogel type β-TCP carrier; NOVOSIS Inject) as a bone substitute for the fusion of lumbosacral junction. 20 patients (average age 69.1 years) diagnosed with ASD with sagittal imbalance who underwent surgical treatment including anterior lumbar interbody fusion (ALIF) in the L5-S1 level were evaluated. Injectable rhBMP-2 was applied in L5-S1 ALIF and followed-up for 1-year. Solid fusion rates and changes of clinical outcomes (Oswestry Disability Index [ODI], Visual Analog Scale [VAS] of back and leg) were measured and analyzed at 6 and 12 months after surgery. All postoperative adverse events were evaluated about the association with injectable rhBMP-2. Fusion rates were 68.4% and 100% at 6 and 12 months after surgery. Compared to baseline, ODI were improved to 45.8% and 63.7%, VAS(back) were improved to 69.2% and 72.8%, and VAS(leg) were improved to 49.2% and 64.8% at 6 and 12 months after surgery (p&lt;0.001, respectively). There were no adverse events associated with injectable rhBMP-2. Thus, injectable rhBMP-2 may be a suitable choice of a bone graft substitute when achieving solid interbody fusion in the lumbosacral junction.

The introduction of electrical vehicle charging infrastructure including EV charger, renewable energy resource at secondary feeder in distribution system has been increased as one of countermeasure for global environmental issues. However, the Electric Vehicle Charging (EVC) infrastructure may act as the peak load in distribution system, which can adversely impact on the voltage stability when the electric vehicle is quickly charged. Therefore, to keep within the limit capacity of secondary feeder and allowable limit for feeder voltage, this paper proposes a stabilization method by the Energy Storage System (ESS) control strategy at secondary feeder in order to be not violated over than lower and upper limit. Also, this paper presents the estimation method to keep the proper standard value of State of Charge (SOC). From the simulation results, the voltage stabilization operation by ESS should make the feeder voltages of the distribution system(secondary feeder) introduced EVC Infra keep better voltage conditions, also estimation method to keep the proper standard value is confirmed that the SOC of ESS when is the standby condition could be exactly kept within the proper reference range.

Quantitative analysis of human gait is critical for early discovery, progressive tracking, and rehabilitation of neurological and musculoskeletal disorders, such as Parkinson’s Disease, stroke, and Cerebral Palsy. Gait analysis typically involves estimating gait characteristics, such as spatio-temporal gait parameters and gait health indicators (e.g., step time, length, symmetry, and balance). Traditional methods of gait analysis involve the use of cameras, wearables, and force plates, but are limited in operational requirements when applied in daily life - such as direct line-of-sight, carrying devices, and dense deployment. This paper introduces a novel approach for gait analysis by passively sensing footstep-induced floor vibrations during walking using vibration sensors mounted on the floor surface. Our approach is non-intrusive, scalable, and perceived as more privacy-friendly, making it suitable for continuous gait health monitoring in daily life. We developed a floor vibration-based gait analysis framework to estimate various gait parameters that are used as standard metrics in medical practices, including temporal parameters (step, stride, stance, swing, double-support, single-support time) and spatial parameters (step length, width, angle, stride length), and extracts gait health indicators (cadence/walking speed, left-right symmetry, gait balance, initial contact types). The main challenge is that floor vibrations are distinct across different floor types. To address this challenge, our approach develops floor-adaptive algorithms to extract floor-specific features and is designed to be generalizable to various settings, including homes, hospitals, and eldercare facilities. We evaluate our approach through real-world walking experiments with 20 adults with 12,231 labeled gait cycles across concrete and wooden floors. Our results show 90.5% (RMSE 0.08s), 71.3% (RMSE 0.38m), and 92.3% (RMSPE 7.7%) accuracy in estimating temporal, spatial parameters, and gait health indicators, respectively.

A programmable DC power supply with Real-time Digital Simulator (RTDS)-based photovoltaic (PV) Power Hardware-In-the-Loop (PHIL) simulators have been used to improve the control algorithm and reliability of PV Inverter. This paper proposes a supervisory control algorithm for PV PHIL simulator with non-RTDS device that is an alternative solution of high cost PHIL simulator. However, when such a simulator with conventional algorithm which is used in RTDS is connected to a PV inverter, the output is in the transient state and it makes it impossible to evaluate the performance of the PV Inverter. Therefore proposed algorithm controls the voltage and current target values according to the constant voltage (CV) and constant current (CC) modes to overcome the limitation of the Computing Unit, DC power supply and also uses a multi-rate system to account for the characteristics of each component of simulator. A mathematical models of a PV system, programmable DC power supply, isolated DC measurement device and Computing Unit are integrated to form a real-time processing simulator. Performance tests using a PV PHIL simulator which is applied proposed algorithm connected a PV inverter are carried out and proved superiority and utility of this method against conventional methods.

Mitochondrial Ca2+ ([Ca2+]M) uptake through Ca2+ uniporter (MCU) is central to many cell functions such as bioenergetics, spatiotemporal organization of Ca2+ signals, and apoptosis. MCU activity is regulated by several intrinsic proteins including MICU1, MICU2, and EMRE. While significant details about the role of MICU1, MICU2, and EMRE in MCU function have emerged recently, a key challenge for the future experiments is to investigate how these regulatory proteins modulate mitochondrial Ca2+ influx through MCU in intact cells under pathophysiological conditions. This is further complicated by the fact that several variables affecting MCU function change dynamically as cell functions. To overcome this void, we develop a data-driven model that closely replicates the behavior of MCU under a wide range of cytosolic Ca2+ ([Ca2+]C), [Ca2+]M, and mitochondrial membrane potential values in WT, MICU1 knockout (KO), and MICU2 KO cells at the single mitochondrion and whole-cell levels. The model is extended to investigate how MICU1 or MICU2 KO affect mitochondrial function. Moreover, we show how Ca2+ buffering proteins, the separation between mitochondrion and Ca2+-releasing stores, and the duration of Ca2+-releasing channels affect mitochondrial function under different conditions. Finally, we demonstrate an easy extension of the model to single channel function of MCU.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Hizikia fusiformis is a common, edible marine alga found in Asia. Although the anticancer activity of its extracts has previously been investigated, its active compounds have not been identified. In this study, saringosterol acetate (SA) was isolated from H. fusiformis extracts by centrifugal partition chromatography (CPC) system (two phase solvents condition: n-hexane:ethyl acetate/methanol:water = 5:3:7:1, v/v), exhibited anticancer effects in the human lung adenocarcinoma epithelial cell line, A549, by inducing apoptosis and sub-G1 phase cell cycle arrest. In addition, SA increased the expression of the pro-apoptotic proteins, Bax and cleaved caspase 3, and decreased that of the anti-apoptotic protein Bcl-xL. Although, SA did not affect the expression of p53, induces expression of Bid and caspase 8. In conclusion, we suggested that SA induces apoptosis against A549 cells via Bid and caspase 8 dependent pathway.

Although the number of unwed mothers have mental health problems and intellectual disability, little research have focused on their mental and cognitive status. Since there has been public stigma of unwed mother in South Korea, they tend to conceal their status and less likely to seek psychiatric and psychological help. In this context, this study aims to assess current status of their mental health and intellectual characteristics. A total 48 unwed mothers from two shelter homes in South Korea were agreed to participate in the study. To compare mental health and intellectual abilities of unwed mothers with the general women population, reference data from national studies was used. Unwed mothers were more likely to have mood disorder, post traumatic stress disorder(PTSD), alcohol and nicotine use disorder, attention-deficit hyperactivity disorder (ADHD) than the general women population. Among 48 participants, 20 (41.7%) were lower than 70 Intelligence Quotient (IQ) and the mean of IQ (78.31) was significantly lower than normalized IQ mean of general women population. In logistic regression analysis, psychiatric disorders were associated intellectual disability. This study confirmed that unwed mothers dwelling in Korean shelter homes have more experience of mental disorders and lower intellectual ability than general women population.

Aging is associated with muscle atrophy and fatty infiltration of skeletal muscle. The multifidus muscle stabilizes the lumbar spine and undergoes adipose accumulation with age, leading to functional decline in the elderly. Therefore, quantitative assessment of the multifidus muscle can be beneficial for the elderly when formulating treatment strategies and reducing future complications. Fifty-seven patients (mean age, 73.89 ± 6.09; 23 male patients) who underwent lumbar Magnetic resonance imaging (MRI) were prospectively recruited. The cross-sectional area (CSA) of the multifidus from the L2-S1 level and the CSA of the L4-5 level psoas muscle were measured. The functional CSA (fCSA) of the multifidus muscle was measured by excluding the fat infiltration area from the multifidus CSA. The CSA to fCSA ratio was obtained by multiplying 100 by the value obtained by dividing CSA by the fCSA. Pfrrmann classification was used to evaluate the degree of disc degeneration. The functional disability measurements were the Short Physical Performance Battery (SPPB), Berg Balance Scale (BBS), grip strength, and functional reach test (FRT). Pearson's correlation analysis was used to examine the relationship between the functional disability measurements and the multifidus muscle. The CSA to fCSA ratio value was relatively constant at each spine level and showed a significant correlation with the SPPB, grip strength, FRT, and psoas index (p&lt;0.05). However, degree of disc and multifidus muscle degeneration were not statistically significant. So, age-related changes play a significant role in developing back muscle fatty infiltration than disc dgeneration. Moreover, Grip strength showed a stronger relationship with the quality of the multifidus muscle than other functional disability measurements.

Diabetes mellitus is associated with cardiovascular, ophthalmic, and renal comorbidities. Among these, diabetic cardiomyopathy (DCM) causes the most severe symptoms and is considered to be a major health problem worldwide. Exercise is widely known as an effective strategy for the prevention and treatment of many chronic diseases. Importantly, the onset of complications arising from diabetes can be delayed or even prevented by exercise. Regular exercise is reported to have positive effects on diabetes mellitus and the development of DCM. The protective effects of exercise include the prevention of cardiac apoptosis, fibrosis, oxidative stress, and microvascular diseases, as well as improvement in cardiac mitochondrial function, and calcium regulation. The present review summarizes the recent findings to describe the potential mechanisms by which exercise may prevent DCM and heart failure.

Perilla frutense var. acuta (Lamiaceae) has been used to treat indigestion, asthma, and allergies in traditional medicine. In this study, luteolin 7-O-diglucuronide (1), apigenin 7-O-diglucuronide (2), and rosmarinic acid (3) were isolated from the leaves of P. frutescens var. acuta. Various approaches were performed to investigate the anti-inflammatory activity of the isolated compounds (1-3) and their working mechanisms. In silico docking simulation demonstrated that 1-3 would work as a PPAR-α/δ/γ agonist, and in vitro PPAR-α/δ/γ transcriptional assay showed that the Perilla extract and 3 increased PPAR-α luciferase activity [1.71 and 1.61 times of the control (PPAR-α + PPRE, p < 0.001)]. In the NF-κB luciferase assay, 1 suppressed NF-κB activity the most (56.83 % at 5 µM; 74.96 % at 10 µM; 79.86 % at 50 µM). In addition, 1 and 2 inhibited the mRNA expression of NF-κB target genes, including Il6, Mcp1, and Tnfa, at 50 µM, and 3 suppressed the genes at the mRNA level in a dose-dependent manner. We report that 1 and 2 exert anti-inflammatory effects through NF-κB inhibition, and PPAR-α/NF-κB signaling pathway is related to the anti-inflammatory activity of 3.

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

Hepatic fibrosis is the wound-healing process of chronic hepatic disease that leads to end-stage of hepatocellular carcinoma and demolition of hepatic structures. EMT has been identified to phenotypic conversion of the epithelium to mesenchymal phenotype that occurred during fibrosis. Smad decoy oligodeoxynucleotide (ODN) is a synthetic DNA fragment containing complementary sequence of Smad transcription factor. Thus, this study evaluated the anti-fibrotic effects of Smad decoy ODN on carbon tetrachloride (CCl₄)-induced hepatic fibrosis in mice. As shown in histological results, CCl₄ treatment triggered hepatic fibrosis and increased Smad expression. On the contrary, Smad decoy ODN administration suppressed fibrogenesis and EMT process. The expression of Smad signaling and EMT-associated protein was markedly decreased in Smad decoy ODN treatment mice compared with CCl₄-injuried mice. In conclusion, these data indicate the practicability of Smad decoy ODN administration for preventing hepatic fibrosis and EMT processes.

One of the most promising advancements in healthcare is the application of digital twin technology. Digital twins are virtual replicas of real-world human patients and can be used for monitoring, and diagnosis, and as a tool to design treatment strategies tailored to individual patients. Furthermore, digital twins could also be helpful in finding novel treatment targets and predicting the effects of drugs and other chemical substances in development. This review article delves into the various data sources and methodologies that contribute to the construction of digital twins. Each data source, including blood glucose levels, heart MRI and CT scans, cardiac electrophysiology, written reports, and multi-omics data, comes with different challenges regarding standardization, integration, and interpretation. We showcase how various datasets and methods are used to overcome these obstacles and generate a digital twin. While digital twin technology has seen significant progress, there are still hurdles in the way to achieving a fully comprehensive patient digital twin. Developments in non-invasive and high-throughput data collection, as well as advancements in modeling and computational power will be crucial to improve digital twin systems. We discuss a few critical developments in light of the current state of digital twin technology. Despite challenges, digital twin research holds great promise for personalized patient care and has the potential to shape the future of healthcare innovation.

Background: Two types of medicinal systems are available in Korea: Western and oriental. These exist as separate services that independently provide medical care to patients. We determined the utility and benefits of compressive and integrated medical services (CIMS) comprising 12 sessions of acupuncture and healing programs over 6 weeks. Methods: In this two-group parallel single-center randomized controlled assessor-blinded trial, 24 participants were assigned to either the experimental (conventional medical treatment plus CIMS, n = 12) or control (conventional medical treatment, n = 13) group. Spinal nerve root block was performed on the compressed spinal nerve root (identified using magnetic resonance imaging) when no improvement was observed after the initial treatment. The experimental group received 12 cycles of acupuncture and manual therapy for 6 weeks; the control group received conventional medical treatment alone. Results: The average age of participants in the experimental and control groups was 70.73 ± 5.95 and 67.33 ± 8.89 years, respectively. There were no significant differences between the groups in terms of age, body mass index, Leeds Assessment of Neuropathic Symptoms and Signs, sex, and current medical history. We found high compliance for both programs (acupuncture and healing). On exclusion of between-group effects, the visual analog scale (VAS) score improved significantly over time (p = 0.045). Further, comparison of the groups after excluding the effects of visits revealed significantly lower VAS scores in the experimental group than in the control group (p = 0.000). Conclusions: Patients with degenerative lumbar spinal stenosis who mainly complain of radiating pain in the lower leg may benefit from CIMS after spinal nerve root block for ≤3 months after treatment. Our study findings suggest that this treatment improves spinal function and Oswestry Disability Index score. However, CIMS did not improve QoL.

Introduction: This study explored the structural relationship between peer relations, exercise participation satisfaction, exercise commitment, and adherence to intention to exercise among Korean sports club participants. The objective was to offer insights that can enhance intentions for continuous exercise participation. Methods: To fulfill this objective, data were gathered using snowball sampling from teenagers at middle schools in Seoul and Gyeonggi, South Korea, who either currently participate in school sports clubs or have participated in the past. A total of 261 responses were analyzed using frequency, technical statistics, and confirmatory factor, reliability, correlation, and structural equation model analyses. Results: Through these analyses, this study found that peer relationships, exercise participation satisfaction, and exercise commitment were significant as both direct and indirect influences on exercise adherence intentions. Discussion: Intervention strategies should focus on fostering the positive emotions that stem from peer relationships.

Yttrium oxide (Y2O3) resistive random-access memory (RRAM) devices were fabricated using the sol–gel process on indium tin oxide/glass substrates. These devices exhibited conventional bipolar RRAM characteristics, without requiring a high voltage forming process. The effect of current compliance on the Y2O3 RRAM devices was investigated and revealed that as the set current compliance values increased, the resistance values gradually decreased. Consequently, intermediate resistance values were obtained, which are suitable for multi-level cell (MLC) switching. The fabricated Y2O3 RRAM devices were capable of functioning as an MLC with a capacity of 2 bits in one cell, utilizing three low resistance states and one common high resistance state. The potential of the Y2O3 RRAM for neural networks was further explored through numerical simulations. Hardware neural networks based on the Y2O3 RRAM demonstrated effective digit image classification with a high accuracy rate of approximately 88%, comparable to the ideal software-based classification (~92%). This suggests that the proposed RRAM has the potential to be utilized as a memory component in practical neuromorphic systems.

Fanconi anemia (FA) develops due to a mutation in one of the FANC genes that are involved in repair of interstrand crosslinks (ICLs). FANCG, a member of the FA core complex, is essential for ICL repair. Previous FANCG-deficient mouse models were generated with drug-based selection cassettes in mixed mice backgrounds, leading to a disparity in interpretation of genotype-related phenotype. To exclude these confounders, we created a Fancg-KO (KO) mouse model using CRISPR/Cas9. The entire Fancg locus was targeted and maintained on the immunological well-characterized C57BL/6J background. Intercrossing of heterozygous mice resulted in sub-Mendelian numbers of homozygous mice, suggesting loss of FANCG can be embryonic lethal. KO mice displayed infertility, hypogonadism but no other developmental problems. Bone marrow analysis revealed a defect in various hematopoietic stem and progenitor subsets with a bias towards myelopoiesis. Cell lines derived from Fancg-KO mice were hypersensitive to crosslinking agents-cisplatin and Mitomycin C, and Fancg-KO mouse embryonic fibroblasts (MEFs) displayed increased γ-H2AX upon cisplatin treatment. Reconstitution of these MEFs with Fancg cDNA corrected for the ICL hypersensitivity. Collectively, this project provides a new, genetically and immunologically well-defined Fancg-KO mouse model for further in vivo and in vitro studies on FANCG and ICL repair.

Currently, most plastic waste stems from packaging materials, with a large proportion of this waste either discarded or used to derive fuel. Accordingly, there is growing interest in the use of pyrolysis in the context of chemically recycling non-recyclable (i.e., via mechanical means) plastic waste into petrochemical feedstock. The aim of this study is to use kinetic analyses to elucidate the pyrolytic properties of solid recovered fuel (SRF) produced using two types of reactors, namely, fixed bed and fluidized bed reactors. From the kinetic analysis, the activation energy corresponding to the rate of pyrolysis reaction conversion was obtained. In conclusion, we found that the pyrolysis occurs more vigorously in fluidized bed reactors compared to fixed bed reactors.

Research on image-inpainting tasks has mainly focused on enhancing performance by augmenting various stages and modules. However, this trend does not consider the increase in the number of model parameters and operational memory, which increases the burden on computational resources. To solve this problem, we propose a Parametric Efficient Image InPainting Network (PEIPNet) for efficient and effective image-inpainting. Unlike other state-of-the-art methods, the proposed model has a one-stage inpainting framework in which depthwise and pointwise convolutions are adopted to reduce the number of parameters and computational costs. To generate semantically appealing results, we selected three unique components: spatially-adaptive denormalization (SPADE), dense dilated convolution module (DDCM), and efficient self-attention (ESA). The SPADE was adopted to conditionally normalize activations according to the mask to distinguish between damaged and undamaged regions. The DDCM was employed at every scale to overcome the gradient-vanishing obstacle and gradually fill-in pixels by capturing global information along the feature maps. The ESA was utilized to obtain clues from unmasked areas by extracting long-range information. In terms of efficiency, our model has the lowest operational memory compared with other state-of-the-art methods. Both qualitative and quantitative experiments demonstrate the generalized inpainting of our method on three public datasets: Paris StreetView, CelebA, and Places2.

This research presents a novel approach to film analysis, leveraging word vectors to objectively evaluate movie critiques. Focusing on Director Chanwook Park’s award-winning film, ’Decision to Leave’, the study employs word vectors derived from the movie’s script of Korean text. Traditional critiques often emphasize contrasting elements and themes, but their subjective nature poses challenges in objective validation. To address this, we trained a language model using LSTM on the film’s script, obtaining word vectors that capture the essence of the narrative. These vectors were then used to perform various text analyses, including similarity and analogy operation for the keywords suggested by the critiques. By comparing the semantic relationships in the critiques with those derived from the word vectors, we could objectively validate the critiques’ assertions. Furthermore, we visualized the word vectors in a two-dimensional space, confirming the spatial relationships of key terms highlighted in critiques. The study underscores the potential of word vectors in providing a more objective lens for film analysis, bridging the gap between traditional film criticism and data-driven insights.

Carbon fiber insole (CFI), which is lightweight and stiff to reduce energy loss and help wearers perform better in sports, has recently been introduced. However, there are scarce reports on the effects of CFI on sports performance, muscle fatigue and wearing comfort. This study investigat-ed the short-term effects of CFI on sports performance, lower extremity muscle activity, and sub-jective comfort. Thirty young healthy males performed various sports tasks and treadmill runs with wearable sensors under two experimental insole conditions (benchmark insole as a baseline, CFI). The results showed that compared to the benchmark insole, CFI significantly improved sports performance in terms of power generation and agility. However, it activated more of the Tibialis Anterior and Gastrocnemius Medialis muscles and was perceived stiffer, and less com-fortable. These findings suggested that CFI can improve sports performance, but it could cause more lower extremity muscle fatigue and subjective discomfort.

We demonstrate, for the first time, a highly sensitive detection of 4-methylimidazole (4-MeI), a carcinogenic material, by applying an electric field enhancement technique using a terahertz (THz) metamaterial at the THz region. The THz metamaterials were fabricated with a metal array using an electric-field-coupled inductor-capacitor (ELC) resonator structure, and FDTD simulation showed good agreement with experimental results. We measured the THz spectra of the metamaterials to detect 4-MeI concentrations of 0, 1, 2, 5, 10, 15, and 20 mg/L. The resonance frequency of the metamaterial was shifted by approximately 8 GHz and transmittance at the resonance frequency increased to 2 x 10-3 as the concentration was increased, up to 20 mg/L. Our study provides new insight into application of metamaterials to detect carcinogen using a THz technique.

During prolonged standing, insufficient calf muscle pumping accompanies venous stasis and hypertension in the lower legs, resulting in valve dysfunction, venous wall problems, and subsequent inflammation. Compression therapy, which includes medical compression stockings (MCS) and mechanical intermittent pneumatic compression (IPC), is one of the most effective therapeutic interventions for treating chronic venous diseases. This study aimed to investigate the safety and efficacy of IPC and MCS, and the optimal protocol of compression therapy for chronic venous disease. This crossover trial was conducted for healthy, long standing workers (>8 h daily) with leg edema and pain. Four groups were established for each visit: group A (resting after work without MCS), group B (resting after work with MCS), group C (IPC after work without MCS), and group D (IPC after work with MCS). The primary outcome was the visual analogue scale (VAS) score for leg pain. The secondary outcomes were leg volume (mL), circumference (cm), extracellular fluid/total body fluid (ECF/TBF), and extracellular water/total body water (ECW/TBW) through bioimpedance analysis. Outcomes were assessed before work (T0), after work (T1), and 60 minutes after intervention (T2). We included 39 healthy volunteers, aged 30.03±7.56 years. All four groups had significantly increased leg pain after work (T0-1) but improved 60 minutes after intervention (T1-2), particularly group C (decreased VAS by 1.9). When leg swelling was compared at T0 and T1, groups A and C showed significant increases in leg volume and circumference, indicating significant work-induced edema, whereas groups B and D showed no change or even a decrease. After interventions, leg volume and circumference significantly decreased in groups A and C, although groups B and C did not show significant improvement. The ECF/TBF and ECW/TBW of all groups decreased after interventions. Leg pain and edema after prolonged standing in healthy adults were safely and effectively improved by IPC. Although MCS also reduced leg edema immediately after work, it did not show significant improvement in leg pain at T0-1–and T1-2, nor in swelling at T1-2.

Substantial studies have focused on early detection of Alzheimer's disease (AD). Cerebral amyloid beta (Aβ), is hallmark of AD, can be observed in vivo via positron emission tomography imaging using amyloid tracer or cerebrospinal fluid assessment, but costly expensive. The current study aims to identify and compared predictability in magnetic resonance imaging (MRI) markers and neuropsychological markers to predict cerebral Aβ status in AD cohort using machine learning (ML) approaches. The predictability in candidate markers for cerebral Aβ status was examined by analyzing 724 participants from the ADNI-2 cohort. Demographic variables, structural MRI markers, and neuropsychological test scores were used as input in several ML algorithms to predict cerebral Aβ positivity. Out of five combination of candidate markers, neuropsychological markers with demographics showed the most cost-efficient result. A feature selection model could distinguish abnormal levels of Aβ with the predictability of 0.85, indicating the same performance with MRI-based models. The result has first to identified the predictability in MRI markers using ML approaches, and secondary to demonstrate the neuropsychological model with demographics could predict Aβ positivity, suggesting a more cost-efficient method for detecting cerebral Aβ status compared to MRI markers.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

With the increase of intelligent voice phishing and the increasing reliance on open banking systems, there has been a rise in cases where individuals' personal information has been exposed, resulting in significant financial losses for the victims. Non-face-to-face transactions in the financial sector face challenges such as customer identification, ensuring transaction integrity, and preventing transaction rejection. Blockchain-based distributed ledgers have been proposed as a solution, but their adoption is limited due to the difficulty of managing private keys and the burden of gas fees management. This paper proposes a non-face-to-face P2P real-time token payment system that minimizes the risk of key loss by storing private keys in a keystore file and database through a server-based key management module. The proposed system simplifies token creation and management through a server-based token management module and implements an automatic gas charging function for smooth token transactions. Transaction integrity and non-repudiation are ensured through a transaction confirmation module that uses transaction IDs without exposing personal information. Furthermore, advanced security measures such as blocking foreign IP access and DDoS defense are implemented to securely protect user data. The proposed system aims to provide a convenient, secure, and accessible online payment solution to the public by implementing a self-authentication function using a web application that is not limited to smart phones or application platforms.

Due to advances in power electronics technology and the evolution of automation devices, the number of electrical devices that are sensitive to power quality is rapidly increasing, and for this reason, users are increasing their demand for high quality. To meet power quality demands, many power conversion devices are used, including dynamic voltage restorers (DVRs). DVRs are rec-ognized as devices that can effectively manage problems such as voltage segment, swells, and harmonics. DVR control requires many samples for harmonic compensation, which has the dis-advantage of being complicated to implement due to fast digital signal processing computation and the application of the cyclic discrete Fourier transform. In this paper, a high-precision DVR system configuration is proposed that compensates for harmonics using a periodically equivalent time-interval sampling technique and a novel circular structured memory filter. The proposed circular structured multi-pointer memory filter is an effective filter algorithm for high-precision input voltage measurement because it can remove noise and compensate for the delay of the phase angle of the filter in voltage measurement. A simulation and DVR prototype system was built, and the feasibility and effectiveness of the phase angle multi-filter voltage detection method and the compensation method were verified by experiments.

The grain size of CVD (Chemical Vapor Deposition) graphene was controlled by changing the precursor gas flow rates, operation temperature, and chamber pressure. Graphene of average grain sizes of 4.1 µm, 2.2 µm, and 0.5 µm were synthesized in high quality and full coverage. The possibility to tailor the thermoelectric conversion characteristics of graphene has been exhibited by examining the grain size effect on the three elementary thermal and electrical properties of σ, S, and k. Electrical conductivity (σ) and Seebeck coefficients (S) were measured in a vacuum for supported graphene on SiO₂/Si FET (Field Effect Transistor) substrates so that the charge carrier density could be changed by applying a gate voltage (V_G). Mobility (µ) values of 529~1042, 459~745, and 314~490 cm²/V·s for the three grain sizes of 4.1 µm, 2.2 µm, and 0.5 µm, respectively, were obtained from the slopes of the measured σ vs. V_G graphs. The power factor (PF), the electrical portion of the thermoelectric figure of merit (ZT), decreased by about one half as the grain size was decreased, while the thermal conductivity (k) decreased by one quarter for the same grain decrease. Finally, the resulting ZT increased more than two times when the grain size was reduced from 4.1 µm to 0.5 µm.

Objective: The purpose of this study is to compare the effects of stretching methods for flexibility, muscle activation, and pressure pain threshold in ballet dancers, and to suggest an effective stretching method. Methods: Thirty-three ballet dancers were randomized to a static stretching group (n=11), muscle energy technique stretching group (n=11), and vibration-assisted stretching group (n=11). The angle of hip joint extension in arabesque, the activation of rectus femoris in Devéloppé, and the pressure pain threshold on rectus femoris in sitting position were measured to compare the effects of different stretching methods. Results: Hip joint extension angles increased in all stretching methods (p<0.05), however, vibration-assisted stretching and muscle energy technique stretching were more effective than static stretching (p<0.05). The activation of the rectus femoris decreased in all groups (p<0.05), but the muscle energy technique stretching group and the vibration-assisted stretching group showed a significant decrease compared to the static stretching group (p<0.05). The pressure pain threshold showed significant improvement only in the static stretching group (p<0.05), and the vibration-assisted stretching group (p<0.05). Conclusion: Vibration-assisted stretching compared to static stretching and muscle energy technique stretching is a beneficial method for flexibility, muscle activation, and pressure pain threshold in ballet dancers.

In this study, the microbial community during the barley yeast fermentation of stevia leaves and its correlation with antioxidant, antiobesity, and anti-inflammatory properties, as well as metabolites, were investigated using UPLC-Q-TOF-MS. Stevia was fermented using commercial TSB media (TSB 1, TSB 2, and TSB 3) and sucrose (Sucrose 1, Sucrose 3, and Sucrose 3) for 1, 3, and 5 days, respectively. Stevia ferments showed higher DPPH and ABTS radical scavenging capacity compared to samples incubated with sucrose for 5 days, and all six ferments inhibited nitric oxide production in a concentration-dependent manner in LPS-induced mouse macrophages. Furthermore, UPLC-QTOF-MS analysis identified 23 related substances, including 10 terpenoids, including rubusoside, steviolbioside, and rebadioside derivatives; dulcoside A; and phlomisoside II, which are indicators of stevia, as well as five flavonoids, four phenolic acids, and four fatty acids. We also identified the microbial community during fermentation via the next-generation sequencing of the 16S rRNA gene for bacteria and the internal transcribed spacer (ITS) gene for fungi. The results showed that TSB 1 and Sucrose 1 ferments were dominated by the pathogens Enterococcus hirae (58.93%) and Cronobacter sakazakii (80.92%), while samples fermented for more than 3 days were pathogen-free and dominated by lactic acid bacteria such as Pediococcus stilesii (73.37%). Microbial community analysis using the ITS region showed that Saccharomycopsis fibuligera, classified as a yeast rather than a mold, dominated the stevia fermentation regardless of the fermentation duration. In particular, the microbial community of the fermentation with a sugar solution was dominated by S. fibuligera by more than 99% throughout the fermentation periods of 1, 3, and 5 days. Finally, to apply the stevia ferments topically to human skin, skin irritation tests were performed on 30 volunteers. The results showed that the highly concentrated extracts (1 mg/mL) of all six stevia ferments were hypoallergenic. Taken together, these findings suggest that brewer's yeast fermented from stevia leaves with a sugar solution offers promise as a natural ingredient for use in functional foods and cosmetics.

Tightly regulated and robust mitochondrial activities are critical for normal hearing. Previously, we demonstrated that Fus1 KO mice with mitochondrial dysfunction exhibit premature hearing loss. Molecular analysis of the cochlea revealed hyperactivation of the mTOR pathway, oxidative stress, altered mitochondrial morphology and quantity, suggesting compromised energy sensing and production. Here, we investigated whether pharmacological modulation of metabolic pathways using rapamycin (RAPA) or 2-deoxy-D-glucose (2-DG) supplementation can protect against hearing loss in female Fus1 KO mice. Additionally, we aimed to identify mitochondria- and Fus1-dependent molecular pathways and processes critical for hearing. We found that inhibiting mTOR or activating alternative mitochondrial energetic pathways to glycolysis protected hearing in the mice. Comparative gene expression analysis revealed dysregulation of critical biological processes in the KO cochlea, including mitochondrial metabolism, neural and immune responses, and cochlear hypothalamic–pituitary–adrenal axis signaling system. RAPA and 2-DG mostly normalized these processes, although some genes showed a drug-specific response or no response at all. Interestingly, both drugs resulted in a pronounced upregulation of critical hearing-related genes not altered in the non-treated KO cochlea, including cytoskeletal and motor proteins, and Ca2+-linked transporters and voltage-gated channels. These findings suggest that pharmacological modulation of mitochondrial metabolism and bioenergetics may restore and activate processes critical for hearing, thereby protecting against hearing loss

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

The Geostationary Ocean Color Imager (GOCI) of the Communication, Ocean, and Meteorological Satellite (COMS) increases the chance of acquiring images with greater clarity at eight times a day and is equipped with spectral bands suitable for monitoring crop yield with a moderate spatial resolution. The objectives of this study were to classify nationwide paddy fields and to project rice (Oryza sativa) yield and production using the grid-based GRAMI-rice model and GOCI satellite products over South Korea from 2011 to 2014. Solar insolation and temperatures were obtained from COMS and the Korea local analysis and prediction system for model inputs, respectively. The paddy fields and transplanting dates were estimated using Moderate Resolution Imaging Spectroradiometer (MODIS) reflectance and land cover products. The crop model was calibrated using observed yield data in 11 counties and was applied to 62 counties in South Korea. The overall accuracies of the detected paddy fields ranged from 89.5 to 90.2%. The simulated rice yields statistically agreed with observed yields, with root-mean-square errors of 0.219 to 0.451 ton ha-1 and Nash–Sutcliffe efficiencies of 0.241 to 0.733 in four years, respectively. According to paired t-tests (α = 0.05), the simulated and observed rice yields were not significantly different. These results demonstrate the possible development of a crop information delivery system that can classify land cover, simulate crop yield, and monitor regional crop production on a national scale.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

The seedling plant factory requires precise environmental control to ensure uniform growth within a short time cultivation period. To provide optimal temperature, humidity, and airflow, it is necessary to interpret the internal aerodynamics. However, the analysis based on field experiments has limitations in interpreting the invisible flow patterns. To overcome this limitation, CFD simulations were employed. The objective of this study was to develop and validate a CFD model of the seedling plant factory with the porous panel for improving the internal environment and to identify the fluid dynamics issues using the validated model. Based on the field monitoring data obtained by 90 data loggers, the average temperature and humidity during the 16-hour light period and 8-hour dark period were maintained within 1% of the set values. However, regional differences occurred, which led to the design of a CFD model incorporating the porous panel to simulate these variations. The Realizable k-ε turbulence model, which exhibited an error of 4.0% in comparison with the field data, was selected through validation test among four different turbulence models with the same configuration of the seedling plant factory. The CFD simulation results were interpreted quantitatively and qualitatively, focusing on the airflow, temperature, and humidity distributions caused by the air conditioner and humidifier. Variations in average temperature of up to 0.5 degrees and velocity differences of 0.28 m/s were observed depending on the location of the cultivation shelves. The locations and causes of stagnant regions resulting from the airflow patterns were identified through the simulations.

This paper reports the efforts made and experiences gained in developing the Flood Prevention and Emergency Response System (FPERS) powered by Google Earth Engine, with focus on its applications at the three stages of floods. At the post-flood stage, FPERS integrates various remote sensing imageries, including Formosat-2 optical imagery, to detect and monitor barrier lakes, synthetic aperture radar imagery to derive an inundation map, and high-spatial-resolution photographs taken by unmanned aerial vehicles to evaluate damage to river channels and structures. At the pre-flood stage, a huge amount of geospatial data are integrated in FPERS and are categorized as typhoon forecast and archive, disaster prevention and warning, disaster events and analysis, or basic data and layers. At the during-flood stage, three strategies are implemented to facilitate the access of the real-time data: presenting the key information, making a sound recommendation, and supporting the decision-making. The example of Typhoon Soudelor in August of 2015 is used to demonstrate how FPERS was employed to support the work of flood prevention and emergency response from 2013 to 2016. The capability of switching among different topographic models and the flexibility of managing and searching data through a geospatial database are also explained, and suggestions are made for future works.

In a super-aged society, maintaining healthy aging, preventing death, and enabling a continua-tion of economic activities are crucial. This study sought to develop a model for predicting the survival time in community-dwelling older individuals by using a deep learning method, and to identify the level of influence of various risk factors on the survival period, so that older in-dividuals can manage their own health. This study used the Korean National Health Insurance Service claims data. We observed community-dwelling older people, aged 66 years, for 11 years and developed a survival time prediction model. Of the 189,697 individuals enrolled at baseline, 180,235 (95.0%) survived from 2009 to 2019, while 9,462 (5.0%) died. Using deep learning based models (C statistics = 0.7011), we identified Charlson’s comorbidity index; the frailty index; long-term care benefit grade; disability grade; income level; a combination of diabetes mellitus, hypertension, and dyslipidemia; sex; smoking status; and alcohol consumption habit as factors impacting survival. In particular, Charlson’s comorbidity index (SHAP value: 0.0445) and frailty index (SHAP value: 0.0443) were strong predictors of survival time. Older individuals should rec-ognize modifiable risk factors that affect survival period in order to manage their own health.

Blending lignin as the second most abundant polymer in nature with nanostructured compounds such as dendritic polymers will not only add value to lignin, but also increase its application in various fields. In this study, softwood Kraft lignin/polyamidoamine dendritic polymer (PAMAM) blends were fabricated by solution electrospinning method to produce bead-free nanofiber mats. The mats were characterized by scanning electron microscopy (SEM), Fourier transform infrared (FTIR), zeta potential, and thermogravimetry analysis (TGA). The chemical intermolecular interactions between lignin functional groups and abundant amino groups in PAMAM were investigated by FTIR and viscosity measurement. These interactions enhanced the mechanical and thermal characteristics of lignin/PAMAM mats, providing further potential applications at industry level.

Hyperacusis, i.e., an increased sensitivity to sounds, is described in several neurodevelopmental disorders (NDDs), including Fragile X Syndrome (FXS). The mechanisms underlying hyperacusis in FXS are still largely unknown and effective therapies are lacking. Big conductance calci-um-activated potassium (BKCa) channels have been proposed as a therapeutic target to treat several behavioral disturbances in FXS preclinical models, but their role in mediating their au-ditory alterations has not been specifically addressed. Furthermore, studies on the acoustic phe-notypes of FXS animal models have mostly focused on central rather than peripheral auditory pathways. Here we provided an extensive characterization of the peripheral auditory phenotype of the Fmr1-knockout (KO) mouse model of FXS at adulthood. We also assessed whether the acute administration of Chlorzoxazone, a BKCa agonist, could rescue the auditory abnormalities of mutant mice. Fmr1-KO mice both at 3 and 6 months showed a hyperacusis-like startle pheno-type with paradoxically reduced auditory brainstem responses associated with a loss of ribbon synapses in the inner hair cells (IHCs). BKCa expression was markedly reduced in the IHCs of KO mice, but only at 6 months, when Chlorzoxazone rescued mutant auditory dysfunction. Our findings highlight the age-dependent and progressive contribution of peripheral mechanisms and BKCa channels to hyperacusis in FXS, suggesting a novel therapeutic target to treat auditory dysfunction in NDDs.

(1)Background: This report was an effective evaluation of using multimedia educational program for self-care and quality of life in patients with a stoma at postoperative and established a simple threshold for enterostomy self-care skills.(2)Methods:108 patients with enterostomy were randomly assigned to receive either the intervention multimedia education program (including information about preparation for enterostomy care, cleaning method, manual bag replacement steps and precautions). The primary outcome was self-care ability and quality of life (defined as overall enterostomy self-care ability and overall quality of life), which was assessed at 2 weeks after intervention via an interview.(3)Results: Compared with those who in the conventional stoma education program, patients received the multimedia education program significantly improved their overall self-care ability and quality of life in statistically. The threshold of the enterostomy self-care skill scale was 20 points, and its corresponding sensitivity was 77.8%, and the specificity was 75.7%.(4)Conclusions: According to our study, the multimedia education program could enhance self-care ability of home care and quality of life in patients with enterostomy.

During the recent decades, global warming by greenhouse gas evolution has attracted worldwide attention and evermore strict regulations thereon have become institutionalized as international policies. In the process, more environment-friendly power generation technologies have been developed utilizing fossil fuels with a view to timely commercialization. As one of such “clean coal” technology, Integrated Gasification Fuel Cell system is a promising power generation means and COS hydrolysis reactor is installed downstream of coal syngas to remove acidic gas constituents such as H2S and COS. The most significant design parameters affecting performance of the COS hydrolysis reactor were selected to be GHSV, (catalytic) reaction temperature, and length ratio and numerical modeling was performed considering heat and fluid flow transfer as well as chemical reaction kinetics. Effect of the selected design parameters on the variation of conversion rate and reactant gas mixture concentration were comprehensively investigated to predict performance of COS hydrolysis reactor. Stochastic modeling of reactor performance was finally performed using Monte Carlo simulation and linear regression fitting.

Patients undergoing dialysis through a permanent catheter often experience infection or malfunction. However, few studies have clarified the predictors of permanent catheter patency survival in patients undergoing hemodialysis. We assessed the relationship between parameters of body composition monitoring (BCM) determined before the initiation of dialysis and the patency survival of the permanent catheters inserted in 179 patients who commenced hemodialysis between January 14, 2020 and August 31, 2021. The relationships between permanent catheter patency at 6 weeks and BCM parameters, laboratory tests, age, sex, comorbidities, and medications at baseline were studied using Kaplan–Meier survival curves. Permanent catheter patency was observed to be superior at high extracellular-to-intracellular (ECW/ICW) ratio (P<0.005). After adjustment for covariates, the ECW/ICW ratio remained an independent factor associated with permanent catheter patency survival. When patients with non-patent catheters were subdivided into infection and malfunction groups, and the associations of BCM parameters were evaluated in those groups, the ECW/ICW ratio was not significantly associated with permanent catheter patency survival in the infection group (P = 0.327); instead, a significant association was found for the lean tissue index (P<0.001). In the malfunction group, the ECW/ICW ratio remained significantly associated with permanent catheter patency survival (P < 0.001).

Melon pest management relies on the excessive application of pesticides. Reducing pesticide spraying has become a global issue for environmental sustainability and human health. Therefore, developing a new cropping system that is sustainable and eco-friendly is important. This study found that melon seedlings irrigated with ultrafine water containing H2 and O2 (UFW) produced more root hairs, increased shoot height, and produced more flowers than the control irrigated with reverse osmosis (RO) water. Surprisingly, we also discovered that UFW irrigation significantly reduced aphid infestation in melon. Based on cryo-scanning electron microscope (cryo-SEM) observations, UFW treatment enhanced trichome development and prevented aphid infestation. To investigate whether it was H2 or O2 that helped to deter insect infestation, we prepared UF water enrichment of H2 (UF+H2) and O2 (UF+O2) separately and irrigated melons. Cryo-SEM results indicated that both UF+H2 and UF+O2 can increase the density of trichomes in melon leaves and petioles. RT-qPCR showed that UF+H2 significantly increased the gene expression level of the trichome-related gene GLABRA2 (GL2). We planted melons in a plastic greenhouse and irrigated them with ultrafine water enrichment of hydrogen (UF+H2) and oxygen (UF+O2). The SPAD value, photosynthetic parameters, root weight, fruit weight, and fruit sweetness were all better than the control without ultrafine water irrigation. UFW significantly increased trichome development, enhanced insect resistance, and improved fruit traits. This system thus provides useful water management for pest control and sustainable agricultural production.

Software-In-The-Loop (SITL) simulation tools have been extensively used in development of safety-critical software. Utilizing these tools substantially accelerates software development eliminating potential risks and resource costs of physical experiments. This paper investigates the effects of model specific parameters on the development and testing of custom module in PX4 SITL environment. Models of a fixed-wing unmanned aerial vehicle with vertical takeoff and landing capabilities and steerable sensor platform/gimbal are used as case study for this investigation. The effects of parameters of these aerial vehicle and sensor platform models are taken into consideration in the development of custom module that controls the dynamics of steerable sensor platform mounted on the vehicle model. The work also presents steps necessary to customize PX4 SITL and Gazebo simulation environment to incorporate parameters of the vehicle and sensor platform models in the development and testing process of custom module. Based on these instances, simulation results are obtained and discussed. The results show that reliability of PX4 SITL simulation framework is justified by proper customization and integration of PX4 SITL and Gazebo simulator.

The pond slider (Trachemys scripta) was designated as an invasive alien species in South Korea in 2001. Although the prevention and control of invasive species have received considerable atten-tion worldwide, studies on the current status and effective management of T. scripta in South Korea are lacking. This study aimed to elucidate the status of domestic reuse of T. scripta and provide effective management suggestions. Analysis of the National Institute of Ecology's “Na-tionwide Survey of Non-native Species in Korea” conducted from 2015 to 2022 confirmed the habitats of 1,440 T. scripta individuals at 295 sites. T. scripta is the most frequently observed among invasive turtles identified in the Korean Peninsula. To determine the reuse of T. scripta, 13 tradi-tional markets were surveyed; five markets were confirmed to have T. scripta. Although the exact distribution route is unknown, individuals living or abandoned in the region might be resold in the market. T. scripta is mostly sold for ritual purposes. Moreover, T. scripta accounted for 31% of freshwater turtles abandoned between 2019 and 2022. Their continuous reuse has been confirmed 22 years after their designation as an invasive alien species. Therefore, effective and fundamental management measures for T. scripta are required.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Non-alcoholic fatty liver disease (NAFLD) has emerged as a significant liver ailment attributed to factors like obesity and diabetes. While ongoing research explores treatments for NAFLD, further investigation is imperative to address this escalating health concern. NAFLD manifests as hepatic steatosis, precipitating insulin resistance and metabolic syndrome. This study aims to validate the regenerative potential of chimeric fibroblast growth factor 21 (FGF21)-Hepatocyte Growth Factor Receptor (HGFR) in NAFLD-afflicted liver cells. AML12, a murine hepatocyte cell line, was utilized to gauge the regenerative effects of chimeric FGF21/HGFR expression. Polysaccharide accumulation was affirmed through periodic acid-Schiff (PAS) staining, while LDL uptake was microscopically observed with labeled LDL. mRNA analysis via RT-PCR revealed reduced expression of key NAFLD markers, including acetyl-CoA carboxylase 1 (ACC1) and sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP), alongside elevated levels of hepatocyte growth factor (HGF), hepatocyte nuclear factor 4 alpha (HNF4A), and albumin (ALB). These findings affirm the hepatoregenerative properties of chimeric FGF21/HGFR within AML12 cells, opening novel avenues for NAFLD therapeutic exploration.

Surgical ciliated cysts occur primarily in the maxilla after radical maxillary sinus surgery. We report a first case of a surgical ciliated cyst that developed in the infratemporal fossa 25 years after the patient sustained severe facial trauma. The patient complained of mandibular pain and limited mouth opening. The patient’s condition was completely resolved 5 months after marsupialization via Le Fort I osteotomy. Surgical morbidities can be minimized by proper diagnosis and less invasive surgery.

Although many attempts have been made to improve the efficacy of radiotherapy to treat cancer, radiation resistance is still an obstacle in lung cancer treatment. Oridonin is a natural compound with promising antitumor efficacy that can trigger cancer cell death; however, its direct cellular targets, efficacy as a radiosensitizer, and underlying mechanisms of activity remain unclear. Herein, we report that oridonin exhibits additive cytotoxic and antitumor activity with radiation using H460 non-small cell lung cancer cell lines. We assessed the radiosensitizing effect of oridonin by MTT, clonogenic, reactive oxygen species (ROS) production, DNA damage, and apoptosis assays. In vitro, oridonin enhanced the radiation-induced inhibition of cell growth and clonogenic survival. Oridonin also facilitated radiation-induced ROS production and DNA damage and enhanced apoptotic cell death. In vivo, the combination of oridonin and radiation effectively inhibited H460 xenograft tumor growth, with higher caspase-3 activation and H2A histone family member X (H2AX) phosphorylation compared with that of radiation alone. Our findings suggest that oridonin possesses a novel mechanism to enhance radiation therapeutic responses by increasing DNA damage and apoptosis. In conclusion, oridonin may be a novel small molecule to improve radiotherapy in non-small cell lung cancer.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Hereditary Parkinson’s disease (PD) can be triggered by an autosomal dominant overdose of alpha-Synuclein (SNCA) as stressor or the autosomal recessive deficiency of PINK1 Serine/Threonine-phosphorylation activity as stress-response. We demonstrated the combination of PINK1-knockout with overexpression of SNCAA53T in double mutant (DM) mice to exacerbate locomotor deficits and to reduce lifespan. To survey posttranslational modifications of proteins underlying the pathology, brain hemispheres of old DM mice underwent quantitative label-free global proteomic mass spectrometry, focused on Ser/Thr-phosphorylations. As exceptionally strong effect, we detected >300-fold reductions of phosphoThr1928 in MAP1B, a microtubule-associated protein, and a similar reduction of phosphoSer3781 in ANK2, an interactor of microtubules. MAP1B depletion is known to trigger perturbations of microtubular mitochondria trafficking, neurite extension and synaptic function, so it was noteworthy that relevantly decreased phosphorylation was detected also for other microtubule and microfilament factors, namely MAP2S1801, MARK1S394, MAP1AT1794, KIF1AS1537, 4.1NS541, 4.1GS86 and ADD2S528. While the MAP1B heavy chain supports regeneration and growth cones, its light-chain assists DAPK1-mediated autophagy. Interestingly, relevant phosphorylation decreases of DAPK2S299, VPS13DS2429 and VPS13CS2480 in the DM brain affected regulators of autophagy, which are implicated in PD. Overall, significant downregulations were enriched for PFAM C2 domains, other kinases, and synaptic transmission factors upon automated bioinformatics, while upregulations were not enriched for selective motifs or pathways. Validation experiments confirmed the change of LC3 processing as reflection of excessive autophagy in DM brain, and dependence of ANK2/MAP1B expression on PINK1 levels. Our new data provide independent confirmation in a mouse model with combined PARK1/PARK4/PARK6 pathology that MAP1B/ANK2 phosphorylation events are implicated in Parkinsonian neurodegeneration. These findings expand on previous observations in D. melanogaster that the MAP1B ortholog futsch in the presynapse is a primary target of the PARK8 protein LRRK2, and on a report that MAP1B is a component of the pathological Lewy body aggregates in PD patient brains. Similarly, ANK2 gene locus variants are associated with the risk of PD, ANK2 interacts with PINK1/Parkin-target proteins such as MIRO1 or ATP1A2, and ANK2-derived peptides are potent inhibitors of autophagy.

In South Korea, the residential real estate market is influenced not just by traditional supply and demand dynamics, but also by external factors such as housing policies and macroeconomic conditions. Given the significant role of housing assets in individual wealth, market fluctuations can have profound implications. While prior research has utilized variables like GDP growth rate, patent issuance, and birth rates, and employed models like LSTM and ARIMA for housing price predictions, many overlook key localized factors. Notably, the impact of subway stations and living SOC facilities on housing prices, especially in metropolitan areas, remains underexplored. This study addresses these gaps by analyzing usage trends across subway stations, assessing the influence of living SOC facilities on housing values, and identifying the optimal machine learning model for price predictions near transport hubs. Through a comparative analysis of machine learning techniques, we aim to provide insights for more informed housing price determinations, promoting a more stable real estate market.

The secretory pathway Ca2+-ATPase SPCA2 is a tumor suppressor in triple receptor negative breast cancer (TNBC), a highly aggressive molecular subtype that lacks tailored treatment options. Low expression of SPCA2 in TNBC confers poor survival prognosis in patients. Previous work has established that re-introducing SPCA2 to TNBC cells restores basal Ca2+ signaling, represses mesenchymal gene expression, mitigates tumor migration in vitro and metastasis in vivo. In this study, we examined the effect of histone deacetylase inhibitors (HDACi) in TNBC cell lines. We show that the pan-HDACi vorinostat and the class I HDACi romidepsin induce dose-dependent upregulation of SPCA2 transcript with concurrent downregulation of mesenchymal markers and tumor cell migration characteristic of epithelial phenotype. Silencing SPCA2 abolished the ability of HDACi to reverse epithelial to mesenchymal transition (EMT). Independent of ATPase activity, SPCA2 elevated resting Ca2+ levels to activate downstream components of non-canonical Wnt/Ca2+ signaling. HDACi treatment led to SPCA2-dependent phosphorylation of CAMKII and -catenin, turning Wnt signaling off. We conclude that SPCA2 mediates the efficacy of HDACi in reversing EMT in TNBC by a novel mode of non-canonical Wnt/Ca2+ signaling. Our findings provide incentive for screening epigenetic modulators that exploit Ca2+ signaling pathways to reverse EMT in breast tumors.

(1) Background: To identify the association between the presence or absence of raphe and aortic valve dysfunction as well as the presence of aortopathy in patients with bicuspid aortic valve (BAV); (2) Methods: This retrospective study enrolled 312 participants (mean [SD] age, 52.7 [14.3] years; 227 men [72.8%]) with BAV. The BAVs were divided into those with presence (raphe+) or absence (raphe-) of raphe. Valvular function was classified as normal, aortic regurgitation (AR), or aortic stenosis (AS) using TTE. The pattern of BAV aortopathy was determined by the presence of dilatation at the sinus of Valsalva and the middle ascending aorta using CCT.; (3) Results: BAVs with raphe+ had a higher prevalence of AR (148 [79.5%] vs. 48 [37.8%], P < .001) but a lower prevalence of AS (90 [48.6%] vs. 99 [78.0%], P < .001) compared with those with raphe-. The types of BAV aortopathy were significantly different (P = 0.021) according to those with BAV-raphe+ and BAV-raphe-.; (4) Conclusions: The presence of a raphe was significantly associated with a higher prevalence of AR but a lower prevalence of AS and combined dilatation of the aortic root and middle ascending aorta. The presence of raphe was an independent determinant of AR.

Heavy metal contaminants have serious consequences for the environment and human health. Consequently, effective methods for detecting their presence, particularly in water and food, are urgently required. Accordingly, the present study proposes a sensor for the detection of mercury Hg(II) and lead Pb(II) ions using graphene oxide (GO) as a quenching agent and aptamer solu-tion as a reagent. In the proposed device, the aptamer sequences are labeled by FAM and HEX fluorescent dyes, respectively, and are mixed with 500 ppm GO solution in a microfluidic device. The presence of Hg(II) and Pb(II) ions is then detected by measuring the change in the fluores-cence intensity of the GO/aptamer suspension as the aptamer molecules undergo fluorescence resonance energy transfer (FRET). The experimental results show that the aptamer sensors have a linear range of 10~250 nM (i.e., 2.0~50 ppb) for Hg(II) ions and 10~100 nM (i.e., 2.1~20.7 ppb) for Pb(II) ions. Furthermore, the limit of detection is around 2 ppb for both metals, which is signifi-cantly lower than the maximum limits of 6 ppb and 10 ppb prescribed by the World Health Or-ganization (WHO) for Hg(II) and Pb(II) in drinking water, respectively.

An 18.8–33.9-GHz, 2.26-mW current-reuse (CR) injection-locked frequency divider (ILFD) for radar sensor applications is presented in this paper. A fourth-order resonator is designed using a transformer with a distributed inductor for wideband operating of the ILFD. The CR core is employed to reduce the power consumption compared to conventional cross-coupled pair ILFDs. The targeted input center frequency is 24 GHz for radar application. The self-oscillated frequency of the proposed CR-ILFD is 14.08 GHz. The input frequency locking range is from 18.8 to 33.8 GHz (57%) at an injection power of 0 dBm without a capacitor bank or varactors. The proposed CR-ILFD consumes 2.26 mW of power from a 1-V supply voltage. The entire die size is 0.75 mm ´ 0.45 mm. This CR-ILFD is implemented in a 65-nm CMOS technology.

This study aimed to assess the feasibility of employing audio and vision technologies as an integrated monitoring system to monitor the health and behavior of pigs under different environmental conditions and to associate these factors. A total of 81 growing pigs ((Landrace x Largewhite) x Duroc) with distinct weight categories (10.47 ± 2.57 kg and 28.81 ± 5.03 kg) were distributed into two distinct housing conditions: Control (characterized by low NH3 levels and low stocking density) and Treatment (marked by elevated NH3 levels and varying stocking densities). Each house was installed with a SoundTalks monitor for automated daily evaluation of respiratory health status (ReHS), and a camera with a microphone to facilitate manual tracking of respiratory symptoms and behavioral patterns. Results showed that the Treatment group encountered significantly high room temperature, NH3 concentration, and carbon dioxide levels, resulting in compromised growth performance—a phenomenon further exacerbated in high stocking density conditions. Pigs within the treatment exhibited increases (p &lt; 0.05) in lateral and total lying behaviors, and incidences of ear and tail injuries, increases screaming frequency, conjunctivitis incidences, coughing frequency, elevated respiration rates, and a decrease in ReHS. The environmental conditions affect the behavior and health of the pigs. Moreover, the behavioral patterns of the pigs are associated with their health conditions. The SoundTalks system did not trigger any warnings during the experimental period. Nevertheless, trend analysis indicated a significant reduction in respiratory health in the treatment. In conclusion, this study underscores the efficacy of merging audio and visual technologies to holistically monitor pig health and behavior, enabling enhanced management strategies. Findings emphasize that monitoring the ReHS trend serves as a pivotal marker for identifying respiratory health problems, complementing the system's innate alarm functions.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Phytocannabinoids, including the non-addictive cannabis component cannabidivarin (CBDV), have been reported to hold therapeutic potential in several neurodevelopmental disorders (NDDs). Nonetheless, the therapeutic value of phytocannabinoids for treating Fragile X syndrome (FXS), a major NDD, remains unexplored. Here, we characterized the neurobehavioral effects of CBDV at doses of 20 or 100 mg/kg in the Fmr1-knockout (Fmr1-KO) mouse model of FXS using two temporally-different intraperitoneal regimens: subchronic 10-day delivery during adulthood (Study 1: rescue treatment) or chronic 5-week delivery at adolescence (Study 2: preventive treat-ment). Behavioral tests assessing FXS-like abnormalities included anxiety, locomotor, cognitive, social and sensory alterations. Expression of inflammatory and plasticity markers was investigated in the hippocampus and prefrontal cortex. When administered during adulthood (Study 1), the effects of CBDV were marginal, rescuing at the lower dose only the acoustic hyper-responsiveness of Fmr1-KO mice and at both doses, their altered hippocampal expression of neurotrophins. When administered during adolescence (Study 2), CBDV at both doses prevented the cognitive, social and acoustic alterations of adult Fmr1-KO mice and modified the expression of several inflammatory brain markers in both wild-type littermates and mutants. These findings warrant the therapeutic potential of CBDV for preventing neurobehavioral alterations associated with FXS, highlighting the relevance of its early administration.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Software Defined Networking (SDN) is positioning the standard for the management of networks due to its scalability and flexibility to program the network. The SDN provides many advantages but it also involves some specific security problems take down the controller using cyber attack and in result the whole network will shut down which makes it a single point of failure. In this paper, the DDoS attacks in SDN were detected using AI-enabled, machine and deep learning, models with some specific features for data-set under normal and DDoS traffic. In our approach, initial data-set is collected from 84 features on kaggle and then the 20 top most features are selected using permutation importance algorithm. The data-set were learned and tested with AI-enabled 5 models. Our experimental results showed that the use of machine learning based random forest model has achieved the highest accuracy rate of 99.97%, in DDoS attack detection in SDN. Our contributions through this study are, first, we found highest 20 attacks that absolutely contributed to DDoS attacks. Secondly, it can reduce the time and cost of comparing various learning models and performance required for determining a learning model suitable for DDoS detection. Finally, various experimental methods for evaluating the performance of the learning model are presented so that related researchers can utilize them.

The purpose of this paper is to evaluate the timing of innovative investment in technology product life cycles using a compound binomial option with management flexibility. Considering the business cycles changes in the macroeconomic will affect consumer purchasing power. The focus is how to evaluate the optimal investment strategy and the project value. It was applied to different product stages (three stages including production innovation, manufacture innovation, and operation innovation) and factored to different risks to build a technology innovation strategy model. An aim of this study is the options premium of the best strategy timing for each innovation stage. Its application of the compound binomial options for the manufacture innovation will only be considered after the execution of the production innovation. The same condition is applied to the operation innovation, which will only be considered after the execution of the manufacture innovation. Then, this paper constructs the dynamic investment sequential decision model, assesses the feasibility of an investment strategy, and makes a decision on the appropriate project value and options premium for each stage under the possible change of Gross Domestic Product (GDP). This paper investigates the product life cycle innovation investment topic by using the compound binomial options method and will provide a more flexible strategy decision compared with other trend forecast criteria.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

In the heterogeneous wireless networked control system (WNCS), age of information (AoI) of the actuation update and actuation update cost are important performance metrics. To reduce the monetary cost, the control system can wait for the availability of WiFi network of the actuator and then conduct the update by using WiFi network in an opportunistic manner, but it leads to the increased AoI of the actuation update. To assess this problem, this paper proposes a priority-aware actuation update scheme (PAUS) where the control system decides whether to deliver or delay the actuation update to the actuator by considering the control priority (i.e., robustness of AoI of the actuation update). For the optimal decision, we formulate a Markov decision process model and derive the optimal policy based on Q-learning. Simulation results demonstrate that PAUS outperforms the comparison schemes in terms of the expected reward.

Transcriptionally controlled tumor protein (TCTP) is a highly conserved protein performing a large number of cellular functions by binding with various partner proteins. The importance of its roles in many diseases requires an assay method to find regulatory compounds. However, the molecular characteristics of TCTP made it difficult to search for chemicals interacting with it. In this study, a tryptophan-based assay method was designed and Y151W mutant TCTP was constructed to search binding chemicals. Since there is no tryptophan in the native sequence of TCTP, the incorporation of tryptophan in the Y151W mutant was very effective to establish the method. A flavonoid library was employed to the assay with the method. With the native and Y151W mutant TCTPs, three flavonoids such as morin, myricetin and isobavachalcone have been found to interact with TCTP. Combined with native gel electrophoresis, the binding region of isobavachalcone was suggested to be the flexible loop of TCTP. This approach can be easily applicable to find binding compounds of proteins with similar molecular characteristics of TCTP.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Aquaporins (AQPs) are a family of integral membrane proteins that selectively transport water and glycerol across the cell membrane. Because AQPs are involved in a wide range of physiological functions and pathophysiological conditions, AQP-based therapeutics may have broad potential for clinical utility, including disorders of water and energy balance. However, AQP modulators have not yet been developed as suitable candidates for clinical applications. In this study, to identify potential modulators of AQPs, we screened 32 natural products by measuring the water and glycerol permeability of mouse erythrocyte membranes using a stopped-flow light scattering method. None of the tested natural compounds substantially affected osmotic water permeability. However, several compounds considerably affected glycerol permeability. Stichoposide C increased the glycerol permeability of mouse erythrocyte membranes, whereas rhizochalin decreased it at nanomolar concentrations. Immunohistochemistry revealed that AQP7 was the main aquaglyceroporin in mouse erythrocyte membranes. We further verified the effects of stichoposide C and rhizochalin on aquaglyceroporins using human AQP3 expressing keratinocyte cells. Stichoposide C, but not stichoposide D, increased AQP3-mediated transepithelial glycerol transport, whereas the peracetyl aglycon of rhizochalin was the most potent inhibitor of glycerol transport among the tested rhizochalin derivatives. Collectively, stichoposide C and the peracetyl aglycon of rhizochalin might function as modulators of AQP3 and AQP7, and suggest the possibility of these natural products as potential drug candidates for aquaglyceroporin modulators

Oriental melons have a relatively short shelf life as they are harvested during the summer season and susceptible to cold-induced injuries. Typical chilling injury when stored at 4℃ is expressed as browning of the fruit suture. To prolong the shelf life and reduce browning of the fruit, the effects of modified atmosphere packaging (MAP), X-tend modified atmosphere (MA)/modified humidity (MH) bulk packaging (XF), and polyethylene (PE) packaging, on oriental melons were investigated during storage at 4℃ and 10℃ for 14 days and under retail display conditions at 20℃. The O2 concentrations in PE packages stored at 4℃ and 10℃ ranged from 17.4–18.5%, whereas those in XF packages were reduced to 16.3–16.6%. The CO2 content of XF package (4.2–4.6%) was higher than that of PE package (1.4–1.9%) stored at 4℃ or 10℃. Relative humidity (RH) saturated in the PE packages but not in the XF packages after seven days of storage. Furthermore, PE packages performed better at maintaining melon weight and firmness than XF packages during storage at 10℃ for 14 days and under retail display conditions at 20℃. PE and XF packages effectively reduced the browning index of the peel and white linear sutures of oriental melons compared with the unpackaged control during cold storage at 4℃, and this observation was maintained at the retail display condition at 20℃. The enhanced CO2 levels, reduced O2 levels, and optimal RH values that were provided by the MAP, prevented the browning symptoms and improved the marketability and shelf life of oriental melons.

We used a metal-organic chemical vapor deposition technique to synthesize a boron-doped reduced graphene oxide (B-rGO) material with various electrical characteristics, dependent on simultaneous reduction and doping procedures. The effect of the doping level on the B bonding in the reduced graphene oxide (rGO) layer controlled by the annealing temperature was investigated using X-ray photoelectron spectroscopy (XPS). The XPS data indicated that the B-rGO layer had a higher B concentration and a considerable number of O-B bonds as a result of the appreciable annealing temperature, which resulted in a decreased work function and Schottky contact between B-rGO and n-type Si. Owing to the higher proportion of B-C and B-C3 bonding in the B-rGO device than that in the rGO/Si device, the lower Schottky barrier height of the B-rGO/n-Si vertical junction photodetector resulted in a higher responsivity. This work suggests a facile method of B doping to alter the electrical properties of graphene materials.

Despite accumulating evidence for the pro-apoptotic role for X-linked inhibitor of apoptosis-associated factor 1 (XAF1), its involvement in endoplasmic reticulum (ER) stress response remains undefined. Here, we report that XAF1 enhances cell sensitivity to ER stress and acts as a switch in unfolded protein response (UPR)-mediated cell-fate decisions favoring apoptosis over adaptive autophagy. XAF1 interacts with and destabilizes ER stress sensor GRP78 through the assembly of zinc finger protein 313-mediated destruction complex. Moreover, XAF1 gene transcription is activated by ER stress through PERK-Nrf2 signaling to direct an adaptive to apoptotic switch of stress response by blocking C-terminus of Hsc70-interacting protein (CHIP)-mediated K63-linked ubiquitination and subsequent phosphorylation of inositol-required enzyme-1α (IRE1α). In tumor xenograft assays, XAF1-/- tumors display substantially lower regression compared to XAF1+/+ tumors in response to cytotoxic dose of ER stress inducer. XAF1 and GRP78 expression show an inverse correlation in human cancer cell lines and primary breast carcinomas. Collectively this study uncovers an important role for XAF1 as a linchpin to govern the sensitivity to ER stress and the outcomes of UPR signaling, illuminating the mechanistic consequence of XAF1 inactivation in tumorigenesis.

Purpose: Physical activity (PA) is likely the most important modifiable element for the growth of skeletal muscle. However, a detailed investigation of PA’s impact on preschoolers’ of skeletal muscle development is lacking. This study aimed to determine whether PA level is related to skeletal muscle thickness among preschool children. Methods: 275 healthy preschoolers between the ages 4–6 were instructed to wear an accelerometer for 4 consecutive days. The daily steps and minutes spent in moderate-to-vigorous PA (MVPA) and total PA (TPA) were examined. Muscle thickness (MT) was measured by B-mode ultrasonography. The MT was measured at the anterior (AT) and posterior thigh (PT) and the anterior (AL) and posterior lower leg (PL). Results: Boys were more physically active and engaged in significantly more TPA and MVPA on weekdays compared with girls. Compared with that on the weekends, more physical activity, and significantly greater number of daily steps and higher TPA and MVPA were recorded for both boys and girls on the weekdays. Multivariable regression analyses, after adjusting for daylight duration, indicated that a daily increase in the TPA and MVPA would lead to higher muscle size in AT (β=1.11 and β=1.37, p<0.05), and PL (β=1.18 and β=0.94, p<0.05) among preschool children. Conclusions: The time spent involved in most of the different categories of MVPA was significantly higher for boys than for girls on the weekdays and weekends. MVPA was positively correlated with greater skeletal muscle development in the lower body.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

In this study, a new type of temperature sensor device was developed. The circular electrode of the thermal sensitive sensor was modified with TMT and O₂ plasma to enhance the conductivity by forming a thin SnOxCy layer on the electrode surface. The Nano-Au particles were subjected to O₂ plasma pretreatment to form peroxide groups on the surface. The thermally sensitive sensor was made by mixing the above-treated Nano-Au particles with N-isopropylacrylamide (NIPAAm) to form solution and then UV-induced grafting polymerization of the NIPAAm-containing solution onto the electrode substrate. The composite hydrogels on the electrode introduce thermo-sensitive polymeric surface films for temperature sensing. Using ambient environment resistance test to measure the resistance, the LCST (lower critical solution temperature) of Nano-Au (MUA) mixed with NIPAAm hydrogel was found to be 32 °C. At ambient temperatures higher than LCST, the electrode resistance decreases linearly.

Background: Necrotizing enterocolitis (NEC) is one of the leading causes of death in newborns, however, little is understood of which patients can be treated medically or require surgery. The purpose of our study is to analyze the associated factors of surgically treated patients compared to patients requiring only medical treatment. Methods: Patients diagnosed with necrotizing enterocolitis over a period of 14 years in a single children’s hospital were retrospectively enrolled. Demographics and clinical data patients were collected and analyzed. Results: A total of 189 patients with NEC were included. Surgically treated patients had a lower gestational age (P = .018), body weight at birth (P = .034), and percentage of exclusive breast milk feeding (P= .001). They had increased comorbidity with respiratory distress syndrome (RDS) (P = .005), number of days of antibiotic use (P = .014), and length of hospital stay (P = .000). In multivariate logistic analysis, a lower percentage of exclusive breast milk feeding (OR = 0.366, 95% CI: 0.164-0.817) and a longer hospital stay (OR = 1.010, 95% CI: 1.001- 1.019) was associated with surgical NEC. Conclusion: Comparing medical and surgical NEC, a significantly lower percentage of surgical NEC patients were exclusively fed breast milk and their hospital stays were longer.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Chum salmon (Oncorhynchus keta) exhibit a remarkable ability to adapt to changes in salinity during their life cycle. However, the fertilized egg stages are sensitive to salinity, affecting on-togeny and hatching. This study investigated the effect of salinity (0, 1, 3, and 5 psu) on the sur-vival of two developmental stages (< 1 day after fertilization and < 1 day after the eyed-egg stage) of fertilized eggs. Based on the experimental results, we assessed the spawning ground environ-ment of the Namdae River, where the largest number of salmon in Korea migrate to spawn. Sur-vival of the < 1 day old fertilized eggs decreased sharply at 3 psu or more, and all eggs died at 5 psu. Hatching rates of the eyed-egg stage varied depending on salinity, but hatching occurred under all environmental conditions. After 2010, the salinity of the layer of water in contact with the sediment in the lower reaches of the river tended to increase (> 6.9 psu) with the frequency of high waves. Overall, the function of the lower river in spawning and hatching is weakening. This study enhances our understanding of the effects of climate change, including increased wave ac-tivity, on salmon spawning grounds

High-performance properties of interpenetration polymer network (IPN) hydrogels, based on physically crosslinked chitosan (CS) and chemically crosslinked poly(N-isopropylacrylamide) (PNiPAM), have been successfully developed. The IPN of CS/PNiPAM is proposed to overcome the limited mechanical properties of the single CS network. In this study, the viscoelastic behaviors of prepared materials in both solution and gel states have been extensively examined, considering the UV exposure time and crosslinker concentration as key factors. The effect of these factors on gel formation, hydrogel structures, thermal stabilities of networks, and HeLa cell adhesion were studied sequentially. The sol-gel transition was effectively demonstrated through the scaling law, which agrees well with Winter and Chambon's theory. By subjecting the CS hydrogel to the process operation in an ethanol solution, its properties can be significantly enhanced with increased crosslinker concentration, including the shear modulus, crosslinking degree, gel strength, and thermal stability in its swollen state. The IPN samples exhibit a smooth and dense surface with irregular pores, allowing for much water absorption. The HeLa cells were adhered to and killed using the CS surface cationic derivative, then released through hydrolysis by utilizing the hydrophilic/hydrophobic switchable property or thermo-reversible gelation of the PNiPAM network. The results demonstrated that IPN is a highly attractive candidate for anti-fouling materials.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Ulmus species have been widely used in Korean folk medicine because of their anti-inflammatory and antimicrobial properties. We intended to investigate the wound healing effect of the powder of Ulmus parvifolia (UP) root bark in a mouse wound healing model. We also determined the mechanisms of effects of Ulmus parvifolia (UP) in skin and skin wound healing effect using keratinocyte model. in vivo experiments showed that the wound lesions in the mice decreased by U. parvifolia with 200 mesh size of root bark powder and significantly reduced by treatment with UP, compared with those treated with U. macrocarpa (UM). Results from in vitro experiments also revealed that UP extract promoted the migration of human skin keratinocytes. UP powder treatment upregulated the expression of the matrix metalloproteinase-2 and -9 protein and significantly increased transforming growth factor (TGF)-β levels. We confirmed that topical administration of the bark powder of exerted a significant effect on skin wound healing by upregulating the expression of MMP and transforming growth factor-β. TGF-β In, Our study suggests that U. parvifolia may be a potential candidate for skin wound healing including epidermal skin rejuvernation.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.