The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

Additive manufacturing (AM) processes, including stereolithography (SL), can fabricate complex ceramic parts layer by layer using computer-aided design (CAD) models. A ceramic slurry with high solid loading is usually used in SL to fabricate the desired shape, which is further sintered to produce the final part. The traditional SL system utilizes a tank filled with printable material, known as a vat, which for ceramic slurry contributes several limitations and operational difficulties, and further renders it non-recyclable mainly due to its high viscosity and the fragility of the green state. In this study, we utilized a continuous film supply (CFS) printer integrated with a tape casting system using in-house-designed ceramic slurry to print standard prototype specimens. Various printing parameters, including viscosity, layer thickness control, and slurry recycling efficiency, were studied. In addition, post-processing optimizations of the prototype, characterizations, and the microhardness of sintered samples were studied to determine their properties and compare them with traditional methods. The effectiveness of slurry reusability was demonstrated by printing with original and recycled slurry to produce consistent densification of final parts. Post-processing was optimized to achieve a relative sinter density of 99.02% and microhardness of 12.59 GPa. This method provides new opportunities to realize dense complex ceramic features with final properties comparable to those produced by subtractive machining and traditional SL. Furthermore, slurry recycling helps to reduce the overall cost and material consumption.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Although health policy resides mainly with the government, industry can play an important role in building a health ecosystem. From March to May, we administered questionnaires to 1,200 individuals from the general Korean population asking about their perception of health-friendly labels, and if they would purchase such labeled products (foods, pharmaceuticals, etc.) and services (purifying water, preventing air pollution, etc.) at extra cost. The participants placed a high value on the importance of mental, social, spiritual, and physical health factors in terms of company’s products and services with a score of about 8 out of 10 (range, 7.74-8.33). Most respondents (72.4%) said they were interested in adopting health-friendly labels. When a health-friendly label is introduced (such as one by the Business for Social Responsiveness), 65.1% of the respondents said they intended to purchase the product or service, while 6.8% said they did not, and 75.0% said they were willing to pay extra for the health-friendly product or service. Multivariate logistic regression models showed urban residence, high education level, and good social health to be significantly associated with positive attitudes toward health-friendly labels. People with high income, no religion, or normal weight were more likely to say they intend to purchase products and services with health-friendly labels. They also had a more positive attitude toward paying more for such products and services, as did people with good spiritual health. This study provides data that illustrate the importance of health-friendly products and services to the general population and companies.

The superharmonic imaging of tissue has the potential for high spatial and contrast resolutions, compared to the fundamental and second harmonic imaging. For this technique, the spectral bandwidth of an ultrasound transducer is divided for transmission of ultrasound and reception of its superharmonics (i.e., higher than the second harmonic). Due to the spectral division for the transmission and reception, transmitted ultrasound energy is not sufficient to induce superharmonics in media without using contrast agents, and it is difficult that a transducer has a -6-dB fractional bandwidth of higher than 100%. For the superharmonic imaging of tissue, thus, multi-frequency array transducers are the best choice if available; transmit and receive elements are separate and have different center frequencies. However, the construction of a multi-frequency transducer for intravascular ultrasound (IVUS) imaging is particularly demanding because of its small size of less than 1 mm. Here, we report a recently developed dual-element focused IVUS transducer for the third harmonic imaging of tissue, which consists of a 35-MHz element for ultrasound transmission and a 105-MHz element for third harmonic reception. For high quality third harmonic imaging, both elements were fabricated to have the same focus at 2.5 mm. The results of tissue mimicking phantom tests demonstrated that the third harmonic images produced by the developed transducer had higher spatial resolution and deeper imaging depth than the fundamental images.

Alzheimer’s disease (AD) is a chronic neurodegenerative disease, and typical pathologic findings include abnormally hyperphosphorylated tau aggregation and neurofibrillary tangles. Insulin resistance and hyperglycemia have been assessed as risk factors for AD development. As the maintenance of optimal blood glucose levels is an important indicator of diabetes mellitus (DM) treatment, diet control is essential. AMPK is a crucial sensor of cellular bioenergetics for controlling anabolic and catabolic metabolism. Diet restriction to achieve euglycemia can increase AMPK activity in the liver and heart. Since AMPK is a direct regulator of tau phosphorylation, we hypothesized that strict diet control to achieve euglycemia affects tau protein phosphorylation through increased AMPK activity in the hippocampus of DM rats. To confirm this hypothesis, we generated insulin-deficient DM rats by subtotal pancreatectomy. Animals were categorized into the restriction (R) group, control (C) group and ad libitum (AL) group according to the diet. We found that tau phosphorylation was significantly increased in the R group compared with the C or AL group. AMPK activity in the R group significantly increased compared to that of the C group or AL group, as expected. Furthermore, the R group showed more critical tau pathology in the hippocampus than the other groups. These results suggest that diet control to achieve euglycemia in insulin-deficient DM conditions is harmful because of the increased possibility of AD development through increased tau phosphorylation by AMPK activation in the hippocampus. We propose that not only hyperglycemia but also euglycemia, which is beneficial in DM patients, must be considered a potential risk factor for AD development, especially when euglycemia is achieved by diet control during insulin deficiency.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

This study investigated the relationship of acrosome reactions and fatty acid composition on fertility in boar sperm. The acrosome reaction of sperm was induced via methyl-beta-cyclodextrin (MBCD), and acrosome reaction, plasma membrane integrity, and fertility were analyzed. The fatty acid composition of the excess acrosome reacted sperm was determined via gas chromatography. The results showed that the acrosome reaction in sperm was induced over 85% of the time by 60 mM MBCD treatment, and the plasma membrane integrity was significantly decreased and was dependent on the MBCD level. The acrosome reacted sperm resulted in significantly higher saturated fatty acids (SFAs) and lower unsaturated fatty acids (PUFAs) than the non-acrosome reaction group. Moreover, the acrosome reacted sperm from 60 mM MBCD significantly decreased in vitro fertility and blastocyst formation relative to non-acrosome reacted sperm, and the acrosome reaction was positively correlated with SFAs and negatively correlated with PUFAs. Of these fatty acids, C22:5n-6 (docosapentaenoic acid [DPA]) and C22:6n-3 (docosahexaenoic acid [DHA]) were directly negatively correlated with the acrosome reaction (r = -0.982 and -0.947, respectively). In conclusion, the excessive acrosome reactions may occur by reducing the PUFAs, which may then dramatically decrease sperm fertility in pigs.

The purpose of this study is to analyze the causes of cost variation in natural disaster prevention projects (NDPP) in Gyeongsangbuk-do and to develop effective cost and risk management strategies. The study collected data by conducting an online survey of 244 stakeholders. Binary logistic regression was used to analyze the impact of various variables on cost deviation, in-cluding project management risk (PMR), project costing and execution risk (PCER), project exe-cution strategy risk (PESR), construction project risk (CPR), project cost and schedule risk (PCSR), project management challenges (PMC), and construction project subcontractor and safety man-agement (CPSSM). The results showed that PMR (OR=3.744, 95% C.I. [1.657, 8.457]), PCER (OR=5.068, 95% C.I. [2.236, 11.484]), PESR (OR=3.447, 95% C.I. [1. 853, 6.413]), CPR (OR=2.292, 95% C.I. [1.020, 5.151]), PCSR (OR=4.817, 95% C.I. [2.250, 10.317]), PMC (OR=2.954, 95% C.I. [1.452, 6. 013]), and CPSSM (OR=2.419, 95% C.I. [1.297, 4.515]) had statistically significant effects on cost deviation. In particular, PMR, PCER, and PESR were identified as the main causes, and the effects of additional factors such as CPSSM were also important. The developed predictive model plays an important role in helping stakeholders of NDPP to manage risks in advance and take appro-priate preventive measures to ensure the success of the project. This study empirically supports the theoretical hypotheses of previous studies and provides a clear understanding of the causes of cost deviation in NDPP, which provides important insights for strategic decision-making and provides a new perspective on risk management.

This paper comprehensively reviews sensors and sensing devices developed or/and proposed so far utilizing two smart materials: electrorheological fluids (ERFs) and magnetorheological materials (MRMs) whose rheological characteristics such as stiffness and damping can be controlled by external stimuli, an electrical voltage for ERFs and a magnetic field for MRMs, respectively. In this review article, the MRMs are classified into magnetorheological fluid (MRF), magnetorheological elastomer (MRE) and magnetorheological plastomer (MRP). To easily understand the history of sensing research using the two smart materials, the order of this review article is organized in a chronological manner of ERF sensors, MRF sensors, MRE sensors and MRP sensors. Among many sensors fabricated from each smart material, one or two sensors or sensing devices are adopted to discuss on the sensing configuration, working principle and specifications such as accuracy and sensitivity. Some sensors adopted in this article include force sensor, tactile device, strain sensor, wearable bending sensor, magnetometer, display device and flux measurement sensor. After briefly describing what have been reviewed in a conclusion, several challenging future works, which should be done for practical applications as sensors or sensing devices, are remarked in terms of new technologies such as artificial intelligence neural network in which several parameters affecting the sensor signals can be precisely tuned or controlled. It is sure that this review article is very helpful to make creative sensors using not only the proposed smart materials but also several different types of smart materials including shape memory alloys and active polymers.

Large epidemiological studies show U-shaped relationships between high-density lipoprotein cholesterol (HDL-C) levels and all-cause mortality in individuals without atherosclerotic cardiovascular diseases (ASCVD). Association in those with ASCVD by sex is unclear. We examined the association between HDL-C levels and 10-year all-cause mortality in subjects (≥40 years of age) with ASCVD using the 2010 National Health Insurance Service and the National Death Registry of Korea. We categorized HDL-C levels into three groups (low: <40 mg/dL for males, <50 mg/dL for females; high: 40-90 mg/dL for males, 50-90 mg/dL for females; extremely high: >90 mg/dL) and 10 mg/dL intervals. We conducted a sex-stratified and adjusted Cox proportional hazards analysis. Out of 1,711,548 individuals (54% female, mean age 61.4 years), 10-year mortality was observed in 218,252 (12.8%). Males had a higher mortality rate than females (16.2% vs 9.8%; P<0.001). When adjusting for age, body mass index, LDL-cholesterol, triglycerides, hypertension, diabetes, smoking, and alcohol consumption, the low and extremely high HDL-C groups had significantly higher hazard ratios for 10-year mortality compared to the high HDL-C group in males [1.183 (1.166-1.199), 1.359 (1.288-1.434)] and in females [1.153 (1.138-1.169), 1.095 (1.029-1.167)]. The frequency distribution bars for the 10-year mortality rate showed sex-specific nadirs of 50-59 mg/dL in males and 70-79 mg/dL in females. In this ASCVD cohort, the extremely high HDL-C (>90 mg/dL) group had 35.9% and 9.5% higher 10-year mortality risk than the high HDL-C group for males and females, respectively. There was a slightly U-shaped relationship between baseline HDL-C levels and 10-year mortality rate, with earlier inflection in males than in females.

Objective: The main purpose of the study is to investigate the combined effects of polydeoxyribonucleotide (PDRN) and extracorporeal shock wave therapy (ESWT) sequences on the regenerative processes in atrophied animal muscles. Methods: Thirty male New Zealand rabbits, aged 12 weeks, were divided into five groups: normal saline, PDRN, ESWT, PDRN injection before ESWT, and PDRN injection after ESWT. Following 2 weeks of cast immobilization, the respective treatments were administered to the atrophied calf muscles. Radial ESWT was performed twice weekly. The evaluation included measurements of calf circumference, tibial nerve compound muscle action potential (CMAP), and gastrocnemius (GCM) muscle thickness after 2 weeks of treatment. Histological and immunohistochemical staining, as well as Western blot analysis, were conducted 2 weeks post-treatment. Staining intensity and extent were assessed using semi-quantitative scores. Results: Groups 4 and 5 demonstrated significantly greater calf muscle circumference, GCM muscle thickness, tibial nerve CMAP, and GCM muscle fiber cross-sectional area (types I, II, and total) than in the remaining three groups (p < 0.05), while they did not did not differ significantly in these parameters. Groups 2 and 3 showed the higher values for all the observations compared to group 1 (p < 0.05). Group 4 had the greatest ratio of vascular endothelial growth factor (VEGF) to platelet endothelial cell adhesion molecule-1 (PECAM-1) in the gastrocnemius muscle fibers than in the other four groups (p < 0.05). Western blot analysis revealed significantly higher expression of angiogenesis cytokines in groups 4 and 5 than in the remaining (p < 0.05). Conclusion: The combination of ESWT and PDRN injection demonstrated superior regenerative efficacy for atrophied calf muscle tissue in rabbit models than these techniques alone or saline. Particularly, administering ESWT after PDRN injection yielded the most favorable outcomes in specific parameters.

At the end of the dry season in early March to early April each year, extensive agricultural biomass waste burnings occur throughout insular mainland Southeast Asia. During this biomass burnings period, smoke aerosols blanket the whole regions and were transported and dispersed by predominant westerly and south westerly winds to southern China, Taiwan and as far southern Japan and the Philippines. The extensive and intense burnings coincided with some wildfires in the forests due to high temperature making the region one of the global hot spots of biomass fires. In this study, we focus on the effect of pollutants emitted from biomass burnings in March 2019 at the height of the burnings period to the exposed population and their health impact. The Weather Research Forecast- Chemistry (WRF-Chem) model was used to predict the PM2.5 concentration over the simulating domain and health impacts are then assessed on the exposed population in the four countries of Southeast Asia, namely Thailand, Laos, Cambodia and Vietnam. Using the health impact based on log-linear concentration response function and Integrated Exposure Response (IER), the results show that at the peak period of the burnings from 13 to 20 March 2019, Thailand experienced the highest impact, with an estimated 2170 premature deaths. Laos, Vietnam, and Cambodia followed, with estimated mortalities of 277, 565, and 314 deaths respectively. However, when considering the impact per head of population, Laos exhibited the highest impact, followed by Thailand, Cambodia, and Vietnam. The results highlight the significant health impact and associated economic cost of agricultural waste burnings in Southeast Asia at the end of the dry season. And hence policy makers should take these into account to design measures to reduce the negative impact of widespread burnings on exposed population in the region.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

Background and Objectives: This study aimed to evaluate the effects of subtalar joint axis-based balance exercises on the anterior talofibular ligament (ATFL) thickness, ankle strength, and ankle stability after an arthroscopic modified Broström operation (AMBO) for chronic ankle instability (CAI). Materials and Methods: The study included 47 patients diagnosed with CAI who underwent AMBO and were randomly divided into three groups: control (n=11), general balance exercise (n=17), and subtalar joint axis balance exercise (n=19), regardless of the affected area. Participants in the exercise rehabilitation group performed exercises for 60 min twice a week for 6 weeks, starting 6 weeks after AMBO. ATFL thickness, ankle strength, and ankle dynamic stability were measured using musculoskeletal ultrasonography, Biodex, and Y-balance test, respectively, before and after treatment. Results: Compared with the remaining groups, the subtalar joint axis balance exercise group had reduced ATFL thickness (p = 0.000), improved ankle strength for eversion (p = 0.000) and inversion (p = 0.000), and enhanced ankle stability (p = 0.000). Conclusions: The study results suggests that subtalar joint axis-based balance exercises may contribute to the early recovery of the ankle joint after AMBO.

Dengue fever is a persistent public health issue in tropical regions, including Vietnam, where climate variability plays a crucial role in disease transmission dynamics. This study focuses on developing climate-based machine learning models to forecast dengue outbreaks in Ba Ria Vung Tau (BRVT) province, Vietnam, using meteorological data from 2003 to 2022. We utilized four predictive models—Negative Binomial Regression (NBR), Seasonal AutoRegressive Integrated Moving Average with Exogenous Regressors (SARIMAX), Extreme Gradient Boosting (XGBoost), and Long Short-Term Memory (LSTM)—to predict weekly dengue incidence. Key climate variables, including temperature, humidity, precipitation, and wind speed, were integrated into these models, with lagged variables included to capture delayed climatic effects on dengue transmission. The NBR model demonstrated the best performance in terms of predictive accuracy, achieving the lowest Mean Absolute Error (MAE) compared to other models. The inclusion of lagged climate variables significantly enhanced the model’s ability to predict dengue cases. SARIMAX and LSTM models, although effective in capturing seasonal trends, struggled with overfitting and failed to accurately predict short-term outbreaks. XGBoost exhibited moderate predictive power but was sensitive to overfitting, particularly without fine-tuning. Our findings confirm that climate-based machine learning models, particularly the NBR model, offer valuable tools for forecasting dengue outbreaks in BRVT. However, improving the models’ ability to predict short-term peaks remains a challenge. The integration of meteorological data into early warning systems is crucial for public health authorities to plan timely and effective interventions. This research contributes to the growing body of literature on climate-based disease forecasting and underscores the need for further model refinement to address the complexities of dengue transmission in highly endemic regions.

This study investigated the physical properties of section-restoration mortar with calcium nitrite and carbon dioxide (CO2) nanobubble mixing water to develop materials and methods for the repair and reinforcement of cracks in reinforced concrete (RC) structures. As the calcium nitrite content increased, the generation rate and generated amount of nitrite-based hydration products increased, owing to the rapid reaction between NO2- ions in calcium nitrite and C3A(Al2O3). Further, the reaction with C3S and C2S was accelerated, thereby increasing the generation rates of Ca(OH)2 and C-S-H. Further, the large amount of Ca2+ ions in these hydration products reacted with CO32- ions in CO2 nanobubble water, thereby increasing the generation of calcite-based CaCO3 in the cement matrix. This appears to have affected the strength development and durability improvement via the densification of the structure. These results suggest that the performance of polymer cement mortar for repairing concrete structures can be improved if calcium nitrite and CO2 nanobubble water are properly combined and applied.

This paper proposes an algorithm for transmitting and reconstructing the estimated point cloud using temporally estimating a dynamic point cloud sequence. When a non-rigid 3D point cloud sequence (PCS) is input, the sequence is divided into groups of point cloud frames (PCF), and a key PCF is selected. After the 3D skeleton is predicted through 3D pose estimation, the motion of the skeleton is estimated by analyzing the joints and bones of the 3D skeleton. For the deformation of the non-rigid human PC, the 3D PC model is transformed into a mesh model, and the key PCF is rigged using the 3D skeleton. After deforming the key PCF into the target PCF utilizing the motion vector of the estimated skeleton, the residual PC between the motion compensation PCF and the target PCF is generated. If there is a key PCF, the motion vector of the target PCF, and a residual PC, the target PCF can be reconstructed. Just as compression is performed using pixel correlation between frames in a 2D video, this paper compresses 3D PCF by estimating the non-rigid 3D motion of a 3D object in a 3D PC. The proposed algorithm can be regarded as an extension of the 2D motion estimation of a rigid local region in a 2D plane to the 3D motion estimation of a non-rigid object (human) in 3D space. Experimental results show that the proposed method can successfully compress 3D PC sequences. If it is used together with a PC compression technique such as MPEG PCC (point cloud compression) in the future, a system with high compression efficiency may be configured.

A nanocomposite rod-shaped structure with single-walled carbon nanotube (SWCNT) embedded in polypyrrole (PPy) doped with nonafluorobutanesulfonic acid (C4F), SWCNT/C4F-PPy, was synthesized using emulsion polymerization. The hybrid ink was then directly coated on a polyimide film interdigitated with the Cu/Ni/Au electrodes via a screen-printing technique to create a flexible film sensor. The sensor film showed a response of 1.72% at 25 °C/atmospheric pressure when acetone gas of 5 ppm was injected, which corresponds to almost 95% compared to the Si wafer-based array interdigitated with the Au electrode. Additionally, C4F was used as a hydrophobic dopant of PPy to improve the stability of humidity and to produce a highly sensitive film-type gas sensor that provides stable detection even in humid conditions.

In Korea, rice is a major staple grain and is mainly cultivated using various agricultural machinery. Air pollutants emitted from agricultural machinery have their origins mainly from the exhaustion of internal combustion engines. In this study, emission characteristics of five main air pollutants by European Environment Agency's Tier 1 method for rice cultivation was analyzed. Diesel is a main fuel for agricultural machinery and gasoline is generally used only for rice transplanters as a fuel in Korea. Tractors consume 46% of total fuel consumption and 56% of diesel fuel consumption. Gasoline used for rice transplanters accounts for 17% of total fuel consumption each year. Tractors and rice transplanters are emitting 82% of all total pollutants. From 2011 to 2019, the total amount of air pollutant emissions was decrease by 15%. That accounted for the reduction of rice cultivation fields in those periods. Rice transplanting operation was in charge of 42% of total emissions. Then, harrowing, harvesting, tilling, leveling, and pest control operations generated 10%, 10%, 8%, 8% and 7% of total emissions, respectively. The contribution of each air pollutant held 54% of CO, 39% of NOx, 5% of NMVOC, and 2% of TSP from the total emission inventory. The three major regions emitting air pollutants from mechanized agricultural practices were Jeollanam-do, Chungcheongnam-do, and Jeollabuk-do, which consume 55% of total fuel usage in rice farming. The total amount of air pollutant emissions from rice cultivation practices in 2019 was calculated as 8,448 Mg in Korea.

In this paper, a multi-mode waveguide-based optical resonator is proposed for an integrated optical refractive index sensor. Conventional optical resonators have been studied for single-mode waveguide-based resonators to enhance the performance, but mass production is limited owing to the high fabrication costs of nano-scale structures. To overcome this problem, we designed an S-bend resonator based on a micro-scale multi-mode waveguide. In general, multi-mode waveguides cannot be utilized as optical resonators, because of a performance degradation resulting from modal dispersion and an output transmission with multi-peaks. Therefore, we exploited the mode discrimination phenomenon using the bending loss, and the resulting S-bend resonator yielded an output transmission without multi-peaks. This phenomenon is utilized to remove higher-order modes efficiently using the difference in the effective refractive index between the higher-order and fundamental modes. As a result, the resonator achieved a Q-factor and sensitivity of 2.3x10³ and 52 nm/RIU, respectively, using the variational finite-difference time-domain method. These results show that the multi-mode waveguide-based S-bend resonator with a wide line width can be utilized as a refractive index sensor.

In this study, the effect of heat treatment was investigated to influence the occurrence of fracture during manufacturing process of Alloy B steel with boron contents as high as 130 ppm. As the content of boron increases, it affects the phase transformation temperature and texture. The development of {111}<uvw> components in the γ-fiber is affected depending on the austenite fraction after phase transformation. The Alloy B steel indicated that the increase in the boron content increased the α to γ phase transformation temperature such that sufficient transformation did not occur in the normalizing condition. The cracks occurred at the point of the transition from elastic to plastic deformation in the ND direction during the rolling process, thereby resulting in failure. Therefore, it is necessary to avoid the intermediate heat treatment condition in which γ-fiber does not fully develop, i.e., an imperfect normalization.

Background: Even though a number of studies have verified the positive effect of physical activity (PA) on self-related health (SRH) no previous research has examined this association among pediatric patients with Type 1 diabetes mellitus (T1DM). Objective: The purpose of this study was to investigate the association between regular physical activity (PA) and self-rated health (SRH) in pediatric patients with Type 1 diabetes mellitus (T1DM) who lacked diabetes care. Methods: We conducted a retrospective study among pediatric patients with T1DM who lacked diabetes care and were enrolled in a diabetes education program between January 2011 to January 2015 at the endocrinology clinic of Seoul National University Children’s Hospital in South Korea. The eligible participants for this study were 37 pediatric patients with T1DM aged 9 to 17 years. PA was divided into regular PA and muscle strength exercise to analyze the relationship with SRH using binomial logistic regression analysis. Results: The results showed SRH of pediatric patients with T1DM who did not engage in regular PA was significantly lower than those who did (OR in regular PA = .199 [95% CI: .040, .995]; OR in regular muscle strength exercise = .097 [95% CI: .023, .825]). Conclusions: In conclusion, regular PA and muscle strength exercise in pediatric patients with T1DM who lacked diabetes care were effective in improving their SRH. A systematic plan is required to enhance regular PA for pediatric patients with T1DM.

Suppressing the charge recombination at the interface of photoanode/electrolyte is the crucial way to enhance the photovoltaic performance of quantum dot sensitized solar cells (QDSSCs). In this scenario, ZnS/SiO2 blocking layer was deposited on TiO2/CuInS2 QDs to inhibit the charge recombination at photoanode/electrolyte interface. As a result, the TiO2/CuInS2/ZnS/SiO2 based QDSSCs delivers a power conversion efficiency (η) value of 4.63%, which is significantly higher than the 2.15% and 3.23% observed for QDSSCs with a TiO2/CuInS2 device and TiO2/CuInS2/ZnS, respectively. Electrochemical impedance spectroscopy and open circuit voltage decay analyses indicate that ZnS/SiO2 passivation layer on TiO2/CuInS2 suppress the charge recombination at the photoanode/electrolyte interface and prolongs the electron lifetime.

Diastolic dysfunction, a prevalent condition characterized by impaired relaxation and filling of the left ventricle, significantly contributes to heart failure with preserved ejection fraction (HFpEF). Galectin-3, a β-galactoside-binding lectin, has garnered attention as a potential biomarker and mediator of fibrosis and inflammation in cardiovascular diseases. This comprehensive review investigates the impact of galectin-3 on diastolic dysfunction. We explore its molecular mechanisms, including its involvement in cellular signaling pathways and interaction with components of the extracellular matrix. Evidence from both animal models and clinical studies elucidates galectin-3's role in cardiac remodeling, inflammation, and fibrosis, shedding light on the underlying pathophysiology of diastolic dysfunction. Additionally, we examine the diagnostic and therapeutic implications of galectin-3 in diastolic dysfunction, emphasizing its potential as both a biomarker and a therapeutic target. This review underscores the significance of comprehending galectin-3's role in diastolic dysfunction and its promise in enhancing diagnosis and treatment approaches for HFpEF patients.

This study explores the significance of active suspension systems for vehicles with lower chassis compared to conventional ones, aiming at the development of future automobiles. Conventional linear MR (Magneto-Rheological) dampers were found inadequate in ensuring sufficient vibration control because the vehicle's chassis becomes lowered in the unmanned vehicles or purposed based vehicles. As an alternative, a rotary type of MR damper is proposed in this work. The proposed damper is designed based on pre-specified design parameters through mathematical modeling and magnetic field analyses. Subsequently, a prototype of the rotary MR damper identical to the design is fabricated, and effectiveness is shown through experimental investigations. In configuring the experiments, a proportional-integral (PI) controller is employed for current control to reduce the response time of the damper. The results presented in this work provides useful guidelines to develop a new type of MR damper applicable to various types of future vehicles’ suspension systems with low distance from the tire to the body floor.

Candida albicans, a prominent constituent of the human microbiota, poses a significant health threat due to its opportunistic pathogenicity and adept biofilm-forming capabilities. This research delves into the antifungal attributes and biofilm inhibition potential of Tea Tree Oil (Melaleuca alternifolia) cultivated in Vietnam. Renowned for its bioactive compounds, including terpinen-4-ol, 1,8-cineole, and terpinolene, the essential oil of Melaleuca alternifolia, commonly referred to as tea tree oil (TTO), is scrutinized for its impact on Candida albicans. The study meticulously determines the Minimum Inhibitory Concentration (MIC) and Minimum Fungicidal Concentration (MFC) of TTO against Candida albicans in both planktonic and biofilm states. Additionally, it assesses the biofilm-forming capacity of Candida albicans and establishes the Minimum Biofilm Inhibitory Concentration (MBIC) and Minimum Biofilm Eradication Concentration (MBEC) of TTO. Employing a liquid culture dilution method within a defined concentration range of 0.1 μL/mL to 10 μL/mL, the experimental approach adheres to established protocols. The outcomes reveal a noteworthy MIC and MIC₈₀ of 0.1 μL/mL and 2 μL/mL, respectively, and an MFC of 10 μL/mL for TTO against Candida albicans. Furthermore, TTO exhibits an MBIC of 2 μL/mL, showcasing its efficacy in inhibiting biofilm formation. However, the MBEC of TTO remains uncertain, possibly due to insufficient concentration tested, which may not effectively disrupt over 50% of the pre-formed biofilm mass within 24 hours. These results underscore the promising potential of TTO as a potent antifungal agent and biofilm inhibitor against Candida albicans, offering valuable insights for the innovation of novel therapeutic strategies in the realm of fungal infections.

Azapeptides have gained much attention due to their ability to enhance the stability and bioavailability of peptide drugs. Their structural preferences, essential to understanding their function and potential applica-tion in the peptide drug design, remain largely unknown. In this work, we systematically investigated the conformational preferences of three azaamino acid residues in tripeptide models, Ac-azaXaa-Pro-NHMe [Xaa= Asn (4), Asp (5), Ala (6)], using the popular DFT functionals, B3LYP and B3LYP-D3. A solvation model density (SMD) was used to mimic the solvation effect on the conformational behaviors of azapep-tides in water. During the calculation, we considered the impact of the amide bond in the azapeptide mod-els on the conformational preferences of models 4-6. We analyzed the effect of the hydrogen bond be-tween the side-chain main chain and main-chain main-chain on the conformational behaviors of azapep-tides 4-6. We found that the predicted lowest energy conformation for the three models differs depending on the calculation methods. In the gas phase, B3LYP functional indicates that the conformers tttANP-1 and tttADP-1 of azapeptides 4 and 5 correspond to the type I of -turn, the lowest energy conformation with all-trans amide bonds, respectively. Considering the dispersion correction, B3LYP-D3 functional predicts the conformers tctANP-2 and tctADP-3 of azapeptide 4 and 5, which contain the cis amide bond preceding the Pro residue, as the lowest energy conformation in the gas phase. The results imply that azaAsx and Pro residues may involve cis-trans isomerization in the gas phase. In water, the predict-ed lowest energy conformer of azapeptides 4 and 5 differs from the gas phase results and depends on the calculational method. For azapeptide 6, regardless of calculation methods and phases, tttAAP-1 (-I turn) is predicted as the lowest energy conformer. The results imply that the effect of the side chain that can form hydrogen bonds on the conformational preferences of azapeptides 4 and 5 may not be negligible. We compared the theoretical results of azaXaa-Pro models with those of Pro-azaXaa models, showing that in-corporating azaamino acid residue in peptides at different positions can significantly impact the folding patterns and stability of azapeptides.

In patients with unilateral tinnitus with normal hearing, several studies have compared the ipsilateral and contralateral ears; however, few studies have investigated its relationship with the duration of tinnitus. We compared the auditory brainstem response and otoacoustic emission parameters between ipsilateral and contralateral ears in adults with unilateral tinnitus and normal hearing. This retrospective review included 84 patients with unilateral tinnitus and normal hearing who underwent auditory brainstem response and otoacoustic emission; they were categorized according to the duration of tinnitus. The latencies and amplitudes of waves I, III, and V, and V/I ratio of both ears in auditory brainstem response, and the results of distortion-product otoacoustic emission and transient evoked otoacoustic emission were examined. The auditory brainstem response parameters, distortion-product otoacoustic emission parameters, and transient evoked otoacoustic emission parameters between the ipsilateral and contralateral ears along the duration of tinnitus were analyzed. Moreover, the failure rates of both distortion-product otoacoustic emission and transient evoked otoacoustic emission between the ears along with the duration and the effects of the variables on the amplitude and latency of each wave were examined. Although there was little significant difference between the ipsilateral and contralateral ears, laterality seemed to have an effect on wave I latency in the multiple linear regression analysis. The distortion-product otoacoustic emission failure rate of the ipsilateral ear was higher than that of the contralateral ear in all patients. However, there was no remarkable difference between the ears in the distortion-product otoacoustic emission and transient evoked otoacoustic emission parameters throughout the duration. We found that outer hair cells and the distal portion of the cochlear nerve are possible pathologic lesions in tinnitus with normal hearing and cochlear synaptopathy could be suspected. Further studies, including those on inner hair cells and higher central cortex, are needed.

We report the development of an extrinsic self-healing coating system that shows no fluorescence from the intact coating, yellowish fluorescence in cracked regions, and greenish fluorescence in healed regions, thus allowing the separate monitoring of cracking and healing of coatings. This fluorescence monitoring self-healing system consisted of a top coating, an epoxy matrix resin containing mixed dye-loaded in single microcapsule. The dye-loaded microcapsules consisted of a poly(urea-formaldehyde) shell encapsulating a healing agent containing MAT-PDMS and styrene, a photo-initiator and a mixture of two dyes, one that fluoresces only in the solid state (DCM) and a second that fluoresces dramatically increased in the solid than solution state (4-TPAE). A mixture of the healing agent, photo-initiator and the two dyes was yellow due to fluorescence from DCM. On UV curing of this mixture, however, the color changed from yellow to green and the fluorescence intensity increased due to fluorescence from 4-TPAE in the solid state. When a self-healing coating embedded with microcapsules containing the DCM/4-TPAE dye mixture was scratched, the damaged region exhibited a yellowish color that changed to green after healing. Thus, the self-healing system reported here allows the separate monitoring of cracking and healing based on changes in fluorescence color.

Excessive oxidative stress and exercise-induced fatigue reduce physical performance and can lead to dysfunction in antioxidant systems within muscular and hepatic tissues. Integrating natural substances with exercise may mitigate fatigue via anti-oxidant effects. This study aims to compare and evaluate the effects of exercise and supplementation with Sundarbans honey vs energy drinks on the strength, anxiety physiological profiles, and hepatic antioxidant capacity in mice undergoing extraneous exercise and fatigue. Forty-eight four-week-old Swiss albino mice were randomly assigned to one of eight groups: (1) Control, (2) Speed™ (Sp), (3) Royal Tiger™ (RT), (4) Sundarbans Honey (SH), (5) Exercise (Ex), (6) Exercise + Sundarbans Honey (Ex+SH), (7) Exercise + Speed™ (Ex+Sp), and (8) Exercise + Royal Tiger™ (Ex+RT). Supplements were administered via oral gavage: Sp (2.5 ml/kg BW), RT (2.5 ml/kg BW), and SH (1 g/kg BW), four times a week for 60 days. Mice in the Ex, Ex+SH, Ex+Sp, and Ex+RT groups underwent daily swimming and running. The strength, fatigue, anxiety levels, lipid profiles, and antioxidant biomarkers were evaluated post-treatment. The SH, Ex, and Ex+SH groups exhibited significantly enhanced physical performance (p<0.05). Plasma lipid profiles, including LDL, triglycerides, total cholesterol, and fatigue-related biomarkers (ALP, AST, ALT, LDH, CK, LA, BUN, and glucose) were markedly increased in the Sp and RT groups but decreased in the SH, Ex, and Ex+SH groups compared to control (p<0.05). Exercise-induced fatigue elevated the Nrf2/HO-1 antioxidant defense system in liver tissue. IL-6 levels were reduced in the SH, Ex, and Ex+SH groups (p<0.05). These findings indicate that regular exercise combined with SH supplementation increases strength and improves lipid profiles, reducing exercise-induced oxidative stress and fatigue via modulation of the Nrf2/HO-1 pathway in liver tissue. These results highlight SH supplementation’s potential as a complementary strategy to enhance exercise outcomes and mitigate exercise-induced stress.

Dengue fever remains one of the most significant public health challenges globally, particularly in tropical and subtropical regions. Traditional early warning systems (EWS) for dengue outbreaks, based on retrospective epidemiological data, suffer from delays and limited predictive accuracy. Modern systems, leveraging real-time data, artificial intelligence (AI), and machine learning (ML), improve accuracy but can be costly and difficult to implement in resource-constrained settings. This paper proposes a novel hybrid model that integrates the strengths of both traditional and modern EWS, with real-world examples from Brazil, and Malaysia. The hybrid model balances accuracy, scalability, and cost-effectiveness, making it a feasible option for low- and middle-income countries.

Exposure to cadmium sulfate (CdSO4) can lead to neurotoxicity. Nevertheless, the precise molec-ular mechanisms underlying this phenomenon remain unclear, and effective treatment strategies are scarce. This study explored the protective effects of ellagic acid (EA), a natural polyphenolic compound, against CdSO4 exposure-induced neurotoxicity in HT22 cells. Additionally, the inves-tigation sought to elucidate the molecular mechanisms underlying this phenomenon. Our findings demonstrated that exposure of HT22 cells to CdSO4 resulted in apoptosis, which was effectively reversed by EA supplementation. EA supplementation also decreased reactive oxygen species (ROS) and mitochondrial ROS productions, reduced malondialdehyde (MDA) levels, and restored the activities of superoxide dismutase (SOD) and catalase (CAT). Additionally, EA supplementation at 5–20 μM significantly counteracted Cd-induced mitochondrial membrane potential and ATP losses and reduced the ratio of Bax/Bcl-2 and cleaved-caspase-3 protein expression. Furthermore, EA supplementation upregulated Nrf2 and HO-1 protein expression while downregulating the phosphorylation of JNK and p38 proteins. Pharmacological inhibition of JNK partially inhibited CdSO4-induced Nrf2/HO-1 activation and exacerbated its cytotoxicity. In conclusion, our results indicate that EA supplementation provides protection against CdSO4-induced cell apoptosis in HT22 cells by inhibiting oxidative stress and activating the Nrf2 pathway. Activation of the JNK pathway plays a protective role in CdSO4-induced cell apoptosis in HT22 cells.

Tenascin C (TNC) is an element of the extracellular matrix (ECM) of various tissues, including the skin, and is involved in modulating ECM integrity and cell physiology. Although skin aging is apparently associated with changes in the ECM, little is known about the role of TNC in skin aging. Here we found that Tnc mRNA level was significantly reduced in the skin tissues of aged mice compared with young mice, consistent with reduced TNC protein expression in aged human skin. TNC-large (TNC-L; 330-kDa) and -small (TNC-S; 240-kDa) polypeptides were observed in conditional media from primary dermal fibroblasts. Both recombinant TNC polypeptides, corresponding to TNC-L and TNC-S, increased the expression of type I collagen and reduced the expression of matrix metalloproteinase-1 in fibroblasts. Treatment of fibroblasts with a recombinant TNC polypeptide, corresponding to TNC-L, induced phosphorylation of SMAD2 and SMAD3. TNC increased the level of TGF-β1 mRNA and upregulated the expression of type I collagen by activating the TGF-β signaling pathway. In addition, TNC also promoted the expression of type I collagen in fibroblasts embedded in a three-dimensional collagen matrix. Our findings suggest that TNC contributes to the integrity of ECM in young skin and to prevention of skin aging.

Six solvent fractions isolated from flower bud and leaf ethanolic extracts of Cleistocalyx operculatus were analyzed for their phytochemical contents including phenolics, flavonoids, saponins, tannins, and alkaloids. Antioxidant activities were measured using the ABTS, DPPH, and FRAP assays. The results showed that flower bud aqueous fraction (BAF) and leaf aqueous fraction (LAF) rich in phenolic content (768.18 and 490.74 mg GAE/g dry extract, respectively) exhibited significantly higher antioxidant activities than other fractions. Flower bud hexane fraction (BHF) had remarkably high flavonoid and saponin contents (134.77 mg QE/g and 153.33 mg OA/g dry extract, respectively), followed by that of leaf hexane fraction (LHF) (76.54 mg QE/g and 88.25 mg OA/g dry extract, respectively). BHF and LHF were found to have extremely high antibacterial activity against two H. pylori strains ATCC 51932 and 43504 (MICs of 125 µg/ml). Interestingly, DMC (2’,4’-Dihydroxy-6’-methoxy-3’,5’-dimethylchalcone) isolated from BHF displayed greater antibacterial activity against the bacterial strains (MICs of 25–50 µg/ml) than those of the fractions. In addition, DMC presented potent inhibitory effects on H. pylori-urease (IC50 of 3.2 µg/ml) and α-amylase (IC50 of 83.80 µg/ml), but no inhibition against α-glucosidase. It was also demonstrated that DMC showed its pronounced inhibitory effects on urease activity and biofilm formation of H. pylori, and could increase the membrane permeability of the bacterial cells. Scanning electron micrographs depict that BHF and DMC had strong effects on the cell shape and significantly induced distortion and damage of the cell membrane. The fractions and DMC showed no significant toxicity to four tested human cell lines. Efforts to reduce antibiotic use indicate the need for further researches of the flower buds and DMC as potential products to prevent or treat gastric H. pylori infections.

Cervical cancer, primarily caused by high-risk human papillomavirus (HR-HPV) types 16 and 18, is a major global health concern. Persistent HR-HPV infection can progress from reversible pre-cancerous lesions to invasive cervical cancer, which is driven by the oncogenic activity of human papillomavirus (HPV) genes, particularly E6 and E7. Traditional screening methods, including cytology and HPV testing, have limited sensitivity and specificity. This review explores the ap-plication of p16/Ki-67 dual-staining cytology for cervical cancer screening. This advanced im-munocytochemical method allows for simultaneously detecting p16 and Ki-67 proteins within cervical epithelial cells, offering a more specific approach for triaging HPV-positive women. Dual staining and traditional methods are compared, demonstrating their high sensitivity and negative predictive value but low specificity. The increased sensitivity of dual staining results in higher detection rates of CIN2+ lesions, which is crucial for preventing cervical cancer progression. However, its low specificity may lead to increased false-positive results and unnecessary biopsies. The implications of integrating dual staining into contemporary screening strategies, particularly considering the evolving landscape of HPV vaccination and changes in HPV genotype prevalence are also discussed. New guidelines and further research are necessary to elucidate the long-term effects of integrating dual staining into screening protocols.

Anesthetics reduce cardiac functions and lower blood pressure (BP), potentially causing excessive BP reduction in dehydrated patients or those with heart conditions, such as coronary artery disease (CAD). Considering the increased prevalence of cardiovascular disease with age, anesthesiologists must be cautious about BP reduction during general anesthesia in older adults. In the present case, an undiagnosed CAD patient in a hypovolemic state experienced a significant systolic blood pressure drop to the 50s during propofol and sevoflurane anesthesia. Despite the use of vasopressors, excessive hypotension persisted, leading to anesthesia suspension. Subsequent cardiac examinations, including computed tomography heart angio and calcium score, and coronary angiogram, revealed a near total occlusion of the left main coronary artery and the formation of collateral circulation. After 5 days of hydration and anticoagulation medications and confirmation of normovolemic state, general anesthesia was attempted again and successfully induced; a normal BP was maintained throughout the surgery. Thus, it is important to conduct a thorough cardiac evaluation and maintain normovolemia for general anesthesia in older adults.

In urban area, one of the great problem is the rise of temperature, which leads to form the urban heat island effect. This paper refers to the trend of the urban surface temperature extracted from the Landsat images from which to consider changes in the formation of surface urban heat island for the north of Ho Chi Minh city in period 1995-2015. Research has identified land surface temperature from thermal infrared band, according to the ability of the surface emission based on characteristics of normalized difference vegetation index NDVI. The results showed that temperature fluctuated over the city with a growing trend and the gradual expansion of the area of the high-temperature zone towards the suburbs. Within 20 years, the trend of the formation of surface urban heat island with two typical locations showed a clear difference between the surface temperature of urban areas and rural areas with space expansion of heat island in 4 times in 2015 compared to 1995. An extreme heat island located in the inner city has an area of approximately 18% compared to the total area of the region. Since then, the solution to reduce the impact of urban heat island has been proposed, in order to protect the urban environment and the lives of residents in Ho Chi Minh City becoming better

This study reports rapid hydrolysis, acylation, and lipolysis with lipase B from Candida antarctica (CalB) and nanofructosome encapsulated CalB (CalB@NF) enzymes immobilized on silica-coated magnetic nanoparticles (Si-MNPs). Enzymatic hydrolysis was confirmed for conversion to p-nitrophenol (p-NP, λex=400 nm) from p-nitrophenyl butyrate (p-NPB, λex=270 nm), and various catalytic parameters such as Km, Vmax, and Kcat were calculated from Michaelis-Menten and Lineweaver-Burk plot. Efficiency of enzymatic hydrolysis was in the order of CalB > Si-MNPs@CalB > CalB@NF > Si-MNPs@CalB@NF, and reusability was much better with the enzyme immobilized on Si-MNPs than with the native enzyme. Enzymatic acylation was confirmed by the formation of benzyl benzoate (λex=229 nm) from benzoic anhydride (λex=240 nm), and efficiency exceeded 99% in all samples. Finally, enzymatic lipolysis was confirmed by the decomposition of olive oil to fatty acid such as oleic acid (λex=230 nm) using thin-layer chromatography (TLC), column chromatography, and proton nuclear magnetic resonance (1H -NMR). The lipases immobilized on Si-MNPs have the advantage of good thermal stability and reusability and are thus applicable to a wide range of industries.

.With the increasing use of carbon fiber reinforced plastics in various area, carbon fiber composites based on prepregs have attracted attention in industries and academia research. However, prepreg manufacturing processes are costly, and the strength of structures varies depending on the orientation and defects (pores and delamination). For non-contact evaluation of internal defects, we proposed lock-in infrared thermography to investigate orientation angles after a compression test. We also conducted a drop-weight impact test to study the behaviour of the composites after impact according the fibers orientation for composite fabricated using unidirectional carbon fiber prepregs. Using CAI tests, we determined the residual compressive strength and confirmed the damage modes using a thermal camera. The results of the drop weight impact tests show that the specimen laminated at 0° suffered the largest damage because of susceptibility of the resin to impact. In contrast, the specimens oriented in of 0°/90° and +45°/–45° directions transferred more than 90% of the impact energy back to the impactor because of the lamination of fibers in the orthogonal directions. Furthermore, the specimens that underwent complete damage in the impact tests were subjected to the lock-in method and showed internal delamination and cut fibers. With the finite elements analysis, the damage of each ply could be observed. Moreover, the temperature differences in the residual compression tests were not significant.

Pancreatic cancer has a poor prognosis with its five-year survival rate lower than that of any other cancer type because it is difficult to detect in the early stages. Gemcitabine, a standard treatment for pancreatic cancer, often has poor outcomes for patients as a result of chemoresistance. Therefore, novel therapeutic targets must be identified to overcome gemcitabine-resistance. Here, we found that SLC38A5, a glutamine transporter, is more highly overexpressed in gemcitabine-resistant patients than in gemcitabine-sensitive patients. Furthermore, the deletion of SLC38A5 decreased the proliferation and migration of gemcitabine-resistant PDAC cells. We also found that the inhibition of SLC38A5 triggered the ferroptosis signaling pathway via RNA sequencing. Also, silencing SLC38A5 induced mitochondrial dysfunction and reduced glutamine uptake and glutathione (GSH) levels, and downregulated the expressions of GSH-related genes NRF2 and GPX4. The blockade of glutamine uptake negatively modulated the mTOR-SREBP1-SCD1 signaling pathway. Therefore, suppression of SLC38A5 triggers ferroptosis via two pathways that regulate lipid ROS levels. Similarly, we observed knockdown of SLC38A5 restored gemcitabine sensitivity by hindering tumor growth and metastasis in the orthotopic mouse model. Altogether, our results demonstrated that SLC38A5 could be a novel therapeutic target to overcome gemcitabine-resistance in PDAC therapy.

Stereotactic radiosurgery (SRS) is considered the initial treatment for lung cancer patients with small-sized and limited number of brain metastases. The objective of this study was to assess clinical outcomes of SRS treatment using CyberKnife (CK) for recursive partitioning analysis (RPA) class II/III patients with one to three brain metastases from lung cancer and identify which patients in the high RPA class could benefit from SRS. A total of 48 lung cancer patients who received CK-based SRS for their metastatic brain lesions from 2010 to 2017 were retrospectively analyzed. Radiographic response was evaluated during follow-up period. Overall survival (OS) and intracranial progression-free survival (IPFS) were calculated and prognostic variables associated with OS and IPFS were evaluated. Median follow-up time was 6.6 months. Local control rates at 6 months and 1-year following SRS were 98% and 92%, respectively. The median OS of all patients was 8 months. One-year and 2-year OS rates were 40.8% and 20.9%, respectively. In multivariate analysis, uncontrolled primary disease (p = 0.008) and ECOG performance status of 2 or 3 (p = 0.001) were independent prognostic factors for inferior OS. These two factors were also significantly associated with inferior IPFS. In subgroup analysis according to RPA class, primary disease status was the only prognostic factor, showing statistically significant OS differences in both RPA class II and III (controlled vs. uncontrolled: 41.1 vs. 12.3 months in RPA class II, p = 0.031; 26.9 vs. 4.1 months in RPA class III, p = 0.011). Our results indicated that SRS could be an effective treatment option for RPA class II/III patients with brain metastases from lung cancer in the modern treatment era. SRS might be particularly considered for patients with controlled primary disease.

The vascular endothelium is key target for immune, and thrombotic responses that has to be controlled in successful xenotransplantation. Several genes were identified that if induced or overexpressed help to regulate the inflammatory response and preserve the transplanted organ function and metabolism. However, few studies addressed combined expression of such genes. The aim of this work was to evaluate in vivo the effects of the simultaneous expression of a three human genes in a mouse generated using the multi-cistronic F2A technology. Male 3-month-old mice that express human heme oxygenase 1 (hHO-1), ecto-5’-nucleotidase (hE5NT), and ecto-nucleoside triphosphate diphosphohydrolase 1 (hENTPD1) (Transgenic) were compared to wild-type FVB mice (Control). Background analysis include extracellular nucleotide catabolism enzymes profile on the aortic surface, blood nucleotide concentration and serum L-arginine metabolites. Furthermore, inflammatory stress induced by LPS in transgenic and control mice was used to characterize interleukin 6 (IL-6) and adhesion molecules endothelium permeabil-ity responses. Transgenic mice had significantly higher rates of extracellular adenosine triphosphate and adenosine monophosphate hydrolysis on the aortic surface in comparison to control. Increased levels of blood AMP and adenosine were also noticed in transgenics. Moreover, transgenic ani-mals demonstrated the decrease in serum monomethyl-L-arginine level and a higher L-arginine/ monomethyl-L-arginine ratio. Importantly, significantly decreased serum IL-6, and adhesion mol-ecule levels were observed in transgenic mice in comparison to control after LPS treatment. Fur-thermore, reduced endothelial permeability in the LPS-treated transgenic mice was noted as com-pared to LPS-treated control. The human enzymes (hHO-1, hE5NT, hENTPD1) simultaneously encoded in transgenic mice demonstrated benefits in sev-eral biochemical and functional aspects of endothelium. This is consistent in use of this approach in the context of xenotransplantation.

Ho Chi Minh City (HCMC), the most crowded city and economic hub of Viet Nam, has been experiencing land subsidence over the past decades. This effort aims to contribute the spatial distribution of subsidence in HCMC in its horizontal and vertical components using synthetic aperture radar interferometry (InSAR) time series. To this purpose, an advanced Persistent Scatterers and Distributed Scatterers (PSDS) InSAR technique was applied to two European Space Agency (ESA) Sentinel-1 datasets consisting of 96 ascending and 202 descending images, acquired from 2014 to 2020 over the HCMC area. A time series of 33 COSMO-SkyMed ascending images was also used for comparison. The combination of ascending and descending satellite passes is used to decompose the light of sight velocities into horizontal east-west and vertical components. Taking into account the presence of east-west horizontal motion, our findings indicate that the accuracy of the decomposed vertical velocity can be improved by up to 3 mm/year for Sentinel-1 data. The obtained results revealed that subsidence is most pronounced in the areas along the Sai Gon River, in the northwest-southeast axis, and in the southwest of the city, with a maximum value of 80 mm/yr, which is in accordance with the findings of the literature. The amplitude of east-west horizontal velocities is relatively small and large-scale eastward movement can be observed in the west of the city at a rate of 3-5 mm/yr. This confirmed that the displacement in Ho Chi Minh City area is mainly vertical downward. Together, these results reinforced the remarkable suitability of ESA's SAR Sentinel-1 for subsidence applications, even for non-European countries such as Vietnam and Southeast Asia.

Ongoing climate change causes abnormal climate events worldwide such as increasing temperatures and changing rainfall patterns. With South Korea facing growing damage from the increased frequency of localized heavy rains, the country is not an exception. In particular, its steep slope lands, including mountainous areas, are vulnerable to damage from landslides and debris flows. In addition, localized short-term heavy rains that occur in urban areas with extremely high intensity tend to lead a sharp increase in damage from soil-related disasters and cause huge losses of life and property. Currently, South Korea predicts landslides and debris flows using the standards for forecasting landslides and heavy rains. However, as the forecasting is conducted separately for rainfall intensity and accumulated rainfall, this lacks a technique that reflects both amount and intensity of rainfall in an episode of localized heavy rainfall. This study, therefore, aims to develop such a technique by collecting past cases of debris flow occurrences and rainfall events that accompanied debris flows to calculate the rainfall triggering index (RTI) reflecting accumulated rainfall and rainfall intensity. In addition, the RTI is converted into the critical accumulated rainfall (Rc) to use precipitation information and provide real-time forecasting. The study classifies the standards for flow debris forecasting into three levels: ALERT (10%–50%), WARNING (50%–70%), and EMERGENCY (70% or higher), to provide a nomogram for 6 hr, 12 hr, and 24 hr. As a result of applying this classification into the actual cases of Seoul, Chuncheon, and Cheongju, it is found that about 2–4 hr of response time is secured from the point of the Emergency level to the occurrence of debris flows.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

Objectives: Stress urinary incontinence (SUI) negatively affects the quality of life and sexual function in women. This study aimed to evaluate the efficacy of radiofrequency (RF) therapy in reducing SUI symptoms and its impact on sexual function. Methods: Thirty-four women with SUI were enrolled and underwent a single RF treatment session using the Viveve® System (Viveve Medical Inc., USA) with parameters of 90 J/cm² and 220 pulses per hour. Assessments at baseline and 6 months post-treatment included perineal ultrasound and personal interviews to evaluate lower urinary tract symptoms and sexual function. Urodynamic studies, voiding diaries, and questionnaires such as the Female Sexual Function Index (FSFI), Overactive Bladder Symp-tom Score (OABSS), Urogenital Distress Inventory-6 (UDI-6), Incontinence Impact Question-naire-7 (IIQ-7), and International Consultation on Incontinence Questionnaire-Short Form (ICIQ-SF) measured outcomes. Results: RF therapy significantly improved sexual function, with higher FSFI scores in all domains except pain at 6 months. SUI symptoms were significantly re-duced, as indicated by improved scores on OABSS, UDI-6, IIQ-7, and ICIQ-SF, alongside better voiding diary results. Anatomical changes included reduced bladder neck mobility, decreased vaginal width, and a reduced rotation angle of the proximal urethra. Conclusions: RF therapy is effective and safe for treating mild to moderate SUI and enhances sexual function, potentially due to changes in vaginal topography. These results suggest RF therapy as a viable non-surgical op-tion for managing SUI and improving sexual health.

Background: Autonomic neuropathy commonly arises as a long-term complication in end stage kidney disease (ESKD) and can be diagnosed from heart rate variability (HRV), calculated from electrocardiogram (ECG) recordings. There is limited data about HRV using real-time ECG to predict HD efficiency in patients with ESKD who are routinely doing HD in real-world practice. Methods: Total of 50 patients (62.1 ± 10.7 years) with ESKD underwent continuous real-time ECG monitor (237.4 ± 15.3 min) during HD for HRV using remote monitoring system and checked electrolyte levels before/after HD. And we compared HRV according to electrolyte levels. Results: During the monitor, we checked total 2374 times of ECG and electrolyte level simultaneously of all patients. Both time and frequency domain HRV were higher when the patients had lower K+ level (&lt;0.5 mEq/L) and P+ level change (&lt;2 mEq/L) before/after HD as compared with those with higher K+ level (≥0.5 mEq/L) and P+ level (≥2 mEq/L) change respectively. In addition, there were higher incidence of arrhythmic events including atrial/ventricular premature complexes, even though no difference of mean heart rate in patients with lower K+ and P+ level change group (p &lt; 0.001). Conclusions: Higher HRV was independently associated with poor controlled K+ and P+ level during hemodialysis in patients with ESKD. This is further substantiated by independent continuous associations between real-time measures of higher HRV and K+ and P+ level. These data strongly suggest that cardiac autonomic dysfunction can be caused by lower change of electrolytes before/after hemodialysis alone.

Since first described by Dr. Tomisaku Kawasaki in 1967, the clinical diagnosis of Kawasaki disease (KD) has remained relatively unchanged. However, studies since then have suggested that diagnoses using only that original clinical criteria may lead to underdiagnosis. In this review, updated KD diagnostic methods, diagnostic methods for “atypical” KD, diagnostic pitfalls, and other differential diagnoses are discussed. Peripheral blood eosinophil showed important in distinguishing KD from febrile children. We review herein the current literature regarding new biomarkers, scoring systems, and microRNA panels that may aid in the diagnosis of KD, the importance of eosinophil and treatment updates.

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

Manipulating autophagy is a promising strategy for treating cancer as several autophagy inhibitors shown to induce autophagic cell death. One of these, autophagonizer (APZ), induces apoptosis-independent cell death by binding an unknown target via an unknown mechanism. To identify APZ targets we used a label-free drug affinity responsive target stability (DARTS) approach with a liquid chromatography/tandem mass spectrometry (LC-MS/MS) readout. Of 35 protein interactors, we identified Hsp70 as a key target protein of unmodified APZ in autophagy. Either APZ treatment or Hsp70 inhibition attenuates integrity of lysosomes, which leads to autophagic cell death exhibiting an excellent synergism with a clinical drug, temozolomide, in vitro, in vivo, and orthotropic glioma xenograft model. These findings demonstrate the potential of APZ to induce autophagic cell death and its development to combinational chemotherapeutic agent for glioma treatment. Collectively, our study demonstrated that APZ, a new autophagy inhibitor, can be used as a potent antitumor drug candidate to get over unassailable glioma and revealed a novel function of Hsp70 in lysosomal integrity regulation of autophagy.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation &lt; 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

The growing threat of antibiotic pollution in water systems demands innovative and sustainable remediation strategies. Nanocellulose-based magnetic metal-organic frameworks (MOFs) represent a cutting-edge solution for the adsorption and removal of antibiotics, leveraging their high porosity, magnetic properties, and environmentally friendly nature. This paper provides an in-depth review of recent advancements in nanocellulose-based MOFs, focusing on their synthesis, adsorption mechanisms, and applications in environmental remediation between 2020 and 2024. By summarizing key studies, we highlight their performance in targeting widely used antibiotics such as tetracyclines and fluoroquinolones. The integration of nanocellulose with MOFs not only enhances adsorption capacity but also offers easy recovery, recyclability, and environmental compatibility. This review explores their adsorption mechanisms, practical applications, and future research directions, contributing to the advancement of scalable and sustainable water treatment technologies.

The Korean Pathfinder Lunar Orbiter (KPLO)-MAGnetometer (KMAG) consists of three triaxial fluxgate sensors (MAG1, MAG2, and MAG3) to measure the magnetic field around the Moon. The three sensors are mounted in the order of MAG3, MAG2, and MAG1 inside a 1.2 m long boom away from the satellite body. Before it arrived on the Moon, we compared the magnetic field measurements taken by DSCOVR and KPLO in the solar wind to verify the measurement performance of the KMAG instrument. We found that there were artificial disturbances in the KMAG measurement data, such as step-like and spike-like disturbances, which were produced by the spacecraft body. To remove spacecraft-generated disturbances, we applied a multi-sensor method, employing the gradiometer technique and principal component analysis and using KMAG magnetic field data and confirmed the successful elimination of spacecraft-generated disturbances. This indicates that the multi-sensor method is able to clean the magnetic field data measured onboard the KPLO.

In this study, ozone oxidation experiment was carried out for the removal of fluorescent whitening agent which is widely used in textile dyeing and paper industry. The stilbene fluorescent whitening agent has been industrialized since the earliest, and the amount of current production is the highest. Due to the characteristics of the fluorescent whitening agent that cannot be removed by conventional wastewater treatment methods, the fluorescent whitening agent in wastewater treatment has difficulty in using as recycled water in the process. Pre-treatment ozone oxidation experiment was conducted prior to the introduction of Membrane Bio Reactor (MBR) treatment process by converting biodegradable materials into biodegradable materials. The removal efficiencies of fluorescent whitening agents, a diaminostilbene disulfonic acid derivative by ozone oxidation were evaluated by UV254 Scan, COD, T-N and color using a synthetic wastewater sample (COD=433.0 mg/ℓ) and paper and paper mill wastewater (COD=157.2 mg/ℓ).

In this study, effluent water was produced through Submerged Membrane Bio-Reactor (SMBR) process, which is a simple system and decomposes organic matter contained in wastewater with biological treatment process and performs solid-liquid separation, Especially, ozone oxidation treatment process is applied to effluent water containing fluorescent whitening agent, which is a trace pollutant which is not removed by biological treatment, and influences the quality of reused water. The concentration of COD in the SMBR was 449.3 mg/ℓ-COD, and the concentration of permeate water was 100.3 mg/ℓ-COD. The removal efficiency was about 70.1%. The amount of ozone re- quired for the removal of the fluorescent whitening agent in the permeated water in SMBR was 6.67 g-O3/min, and the amount of ozone required to remove COD relative to the permeate water was calculated to remove 0.997 mg-COD for 1 mg of O3.

Although numerous citrus varieties have recently been developed to enhance their quality, information on their quality characteristics is limited. We assessed the quality characteristics of Yellowball, a novel citrus variety, by evaluating its appearance, storability, sensory properties, functionality, and metabolite profiles and comparing these characteristics with those of its parent varieties: Haruka and Kiyomi. The metabolite profiles between the citrus varieties differed significantly, resulting in distinct physicochemical and functional qualities. The storability of Yellowball was significantly increased compared with that of its parent varieties owing to its strong antifungal activity and unique peel morphology, including the stoma and albedo layers. While we did not investigate the volatile compounds, overall functional activities, and detailed characteristics of each metabolite, our data provide valuable insights into the relationship between citrus metabolites, peel morphology, physicochemical properties, and storability and demonstrate the potential of Yellowball as a promising variety in the citrus industry.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

The structure characterization of two new polysaccharides from Agrocybe aegerita (AA-P) and Hygrophorus olivaceoalbus (HO-P) by HPGPC, GC-MS, NMR and FT-IR indicated that AA-P was composed of Galactose, Glucose and Arabinose, in the ratio of 3:2:1. Its skeleton structure was consisted of (1→4)-Arap, (1→4,6)-Glup and (1→6)-Galp with one branched chain. The HO-P was consisted of mannose, galactose and glucose in a ratio of 1:1:2. Its skeleton structure was consisted of (1→6)-Galactose residues, (→1)-glucose residues, (1→4)-glucose residues and (1→4,6)-D-mannose residues. There were two branched chains connected to the main chain. AA-P and HO-P had the best stimulation effect on B cells and RAW264.7 cells, respectively, and could both mainly by impacting and reducing G0/G1 phase which lead to a significant proliferation of B cells, T cells and RAW264.7 cells. In addition, AA-P and HO-P could significantly promote the secretion of TNF-α from T cells, the secretion of IgA, IgD, IgE, IgG and IgM from B cells, and the secretion of TNF-α from RAW264.7 cells, but neither of them could impact the secretion of IL-1β from RAW264.7 cells.

Biofilm formation by unicellular eukaryotes presents major challenges in healthcare, agriculture, and food industries, primarily due to enhanced resistance to environmental stressors and antimicrobial agents. Understanding the regulatory mechanisms of biofilm formation, such as quorum sensing (QS) and cyclic di-GMP signaling, has led to the discovery of novel compounds that can inhibit biofilm development. In 2024, significant advancements were made in identifying compounds like betulinic acid, methyl anthranilate, and pulmonarin B analogues that target these pathways. This review explores the potential applications of these compounds, especially in Vietnam's agriculture and food industries, where biofilm formation contributes to contamination and antimicrobial resistance. The findings underscore the global relevance of biofilm-disrupting technologies and their role in combating biofilm-associated infections and resistance.

Pneumococcal disease, caused by Streptococcus pneumoniae is the leading cause of high mortality in children worldwide. The tremendous direct cost of hospital admissions and significant indirect costs from productivity loss contributed considerably to the economic burden, with vaccination being the only efficient way against the illness. Our study aims to summarize the cost-effectiveness of the pneumococcal conjugate vaccine (PCV) implemented in the pediatric population. Employing online databases from Pubmed, Embase, and Medline, we looked for economic evaluation from 2018 until March 2024. The Incremental Cost-Effectiveness Ratios (ICER) and Quality-Adjusted-Life-Years (QALY) were the primary outcomes for measuring PCV's cost-effectiveness. A 28-item CHEERS 2022 checklist was applied to assess the quality of collected studies. Of the 16 papers found, 9/16 discussed the lower-valent vaccine (PCV13, PCV10) and 7/16 examined the higher-valent vaccine. (PCV20, PCV15). PCV13 and PCV10 required more cost and generated more QALY compared to no vaccination. Both PCV15 and PCV20 averted substantial healthcare costs and yielded greater quality of life than PCV13. Additionally, PCV20 was a dominant strategy compared to PCV15. Utilizing PCV13 is a very cost-effective option compared to not getting vaccinated. Transitioning from PCV13 to PCV20 would result in higher QALY gain and more cost-saving than switching to PCV15.

Corresponding to the principles of biological synapses, an essential prerequisite for hardware neural networks using electronics devices is continuous regulation of conductance. We implemented artificial synaptic characteristics in a (GeTe/Sb2Te3)16 iPCM with a superlattice structure under optimized identical pulse trains. Based on atomically controlling the Ge switch in the phase transition that appears in the GeTe/Sb2Te3 superlattice structure, multiple conductance states were implemented by applying the appropriate electrical pulses. Furthermore, we found that the bidirectional switching behavior of a (GeTe/Sb2Te3)16 iPCM can achieve a desired resistance level using the pulse width. Therefore, we also fabricated a Ge2Sb2Te5 PCM and designed a pulse scheme based on the phase transition mechanism to compare to the (GeTe/Sb2Te3)16 iPCM. We designed an identical pulse scheme that implements linear and symmetrical LTP and LTD based on the iPCM mechanism. As a result, the (GeTe/Sb2Te3)16 iPCM showed relatively excellent synaptic characteristics by implementing gradual conductance modulation, a nonlinearity value of 0.32, and LTP/LTD 40 conductance states using identical pulses trains. Our results demonstrate the general applicability of the artificial synaptic device for potential use in neuro-inspired computing and next generation non-volatile memory.

Erlotinib inhibits epithelial growth factor receptor (EGFR) kinase activity and is used to treat non-small cell lung cancer (NSCLC). Despite its high efficacy, recurrence can occur in patients who become resistant to the drug. To address the underlying mechanism of Erlotinib resistance, we investigated additional mechanisms related to mode-of-drug-action, by multiple protein-binding interactions, besides EGFR by using drug affinity responsive target stability (DARTS) and liquid chromatography-mass spectrometry (LC-MS/MS) methods with non-labeled Erlotinib. DNA polymerase alpha subunit B (POLA2) was identified as a new Erlotinib binding protein that was validated by the DARTS platform, complemented with cellular thermal shift assays. Genetic knock-down of POLA2 promoted the anti-proliferative effect of the drug in the Erlotinib-resistant cell line H1299 with high POLA2 expression, whereas overexpression of POLA2 restored anti-proliferative effects in the Erlotinib-sensitive cell line HCC827 with low POLA2 expression. Importantly, POLA2 expression levels in four NSCLC cell lines were positively correlated with anti-proliferative Erlotinib efficacy, verified by bio-statistical analysis (Pearson correlation coefficient, R=0.9886). These results suggest that POLA2 is a novel complementary target protein of Erlotinib, and could clinically provide validity as a surrogate marker for drug resistance in patients with NSCLC.

Retinal apoptosis plays a critical role in the progression of diabetic retinopathy (DR), a common diabetic complication. Currently, the tight control of blood glucose levels is the standard approach to prevent or delay the progression of DR. However, prevalence of DR among diabetic patients remains high. Focusing on natural nutrients or herbal medicines that can prevent or delay the onset of diabetic complications, we administered an ethanol extract of the aerial portion of Osteomeles Schwerinae (OSSCE), a Chinese herbal medicine, over a period of 17 weeks to spontaneously diabetic Torii (SDT) rats. OSSCE was found to ameliorate retinal apoptosis through the regulation of advanced glycation end products (AGEs) accumulation, oxidative stress, and mitochondrial function via inhibition of NF-κB activity, in turn through the downregulation of PKCδ, P47phox, and ERK1/2. We further demonstrated in 25 mM glucose-treated human retinal microvascular endothelial cells (HRMECs) that hyperoside (3-O-galactoside-quercetin), quercitrin (3-O-rhamnoside-quercetin), and 2''-O-acetylvitexin (8-C-(2''-O-acetyl-glucoside)-apigenin) were the active components of OSSCE that mediated its pharmacological action. Our results provide evidence that OSSCE is a powerful agent that may directly mediate a delay in development or disease improvement in patients of DR.

This paper designs and fabricates a small-type permanent-magnet linear motor and driver for automation applications. It covers structural design, magnetic circuit analysis, control strategies, and hardware development. Magnetic circuit analysis software JMAG is used for flux density distribution, back electromotive force(back-EMF), and electromagnetic force analysis. To address end effects and cogging force, auxiliary core structures and control strategies are proposed. The motor has a three-phase, six-coil, seven-pole configuration, achieving a peak phase voltage of 3.621 V at 1.0 m/s with a total harmonic distortion(THD) of 0.49 % and the voltages of each phase are balancing a phase voltage error of -0.002 V. The average electromagnetic force is 5.46 N/A. The driver uses a three-phase inverter with voltage space vector pulse width modulation(VSVPWM), dq-axes current closed-loop control, electromagnetic force control, and S-curve motion trajectory control. Simulations with JMAG-RT models in MATLAB/Simulink verify the control strategies. A microcontroller (TMS320F280045) serves as the control core, and a magnetic encoder with a 488 nm resolution provides position feedback. Each phase winding has an equivalent resistance of approximately 3.0 Ω and an inductance of approximately 1.98 mH. The S-curve motion trajectory control achieves a maximum position error of approximately 5.0 μm and a speed ripple of approximately 0.03 m/s at steady speed. With cogging force improvement, the maximum electromagnetic force is 4.90 N, and the q-axis current compensates around 1.05 A based on mover position. S-curve motion trajectory control results in highly stable and responsive performance. Practical tests show that the designed small-type permanent-magnet linear motor and its driver provide efficient, stable, and high-precision solutions for automation applications.

The exponential growth of multimodal content across social media platforms, comprising text, images, audio, and video, has catalyzed substantial interest in artificial intelligence, particularly in multi-modal sentiment analysis (MSA). This study presents a comprehensive survey of 30 research papers published between 2020 and 2024 by eminent publishers such as Elsevier, ACM, IEEE, Springer, and others indexed in Google Scholar. Our analysis primarily focuses on exploring multimodal fusion techniques and features, with specific emphasis on the integration of text and image data. Additionally, the article offers an overview of the evolution, definition, and historical context of MSA. It delves into the current challenges and potential advantages of MSA, investigating recent datasets and sophisticated models. Furthermore, the study provides insights into prospective research directions. Notably, this review offers valuable recommendations for advancing research and developing more robust MSA models, thus serving as a valuable resource for both academic and industry researchers engaged in this burgeoning field.

Most research findings in Ghana and all over the globe lay much emphasis on the technical knowledge of plastics; especially giving preference to the biodegradable over the synthetic/Single-Use plastics. Questionnaires were administered to about 200 respondents in the Ho Municipality out of which 163 responses were filled and returned. Results showed that of all the variables tested only Legislative Framework has a meaningful impact on the behaviour of Ho indigenes. Awareness level: (Synthetic Plastics and Biodegradable Plastics) as well as Attitudinal Change do not influence people’s behaviour when using plastics. Findings from this study are further discussed and recommendations were proffered to instil eco-friendly behaviour among people.

Background and objectives: TSC1 is a crucial component of the mTOR pathway, impacting cell growth, proliferation, and autophagy, while TSC2 is a tumor suppressor gene that regulates cell growth and is associated with the mTOR signaling pathway. In the present study, we analyzed TSC1 and TSC2 mRNA expression levels in rectal cancer, and evaluated the clinicopathological and prognostic characteristics of TSC1 and TSC2. Materials and Methods: TSC1 and TSC2 mRNA expression was examined in various cancer types. We further evaluated survival to determine the prognostic significance of TSC1 and TSC2 mRNA in CRC using The Cancer Genome Atlas (TCGA) data. Results: The study focused on rectal cancer, as it exhibited the most promising results. The patients were split into two subgroups, each comprising 50% of the total, based on the TSC gene expression levels. This division was made to assess the clinical characteristics associated with the expression of TSC1 and TSC2 genes. In the study, lower TSC1 expression was linked to venous invasion in rectal cancer patients, and there was also a related trend with lymphatic invasion, although it didn't reach statistical significance. Lower TSC2 expression was observed in younger patients and had some associations with sex and M stage, but these correlations were not statistically significant. When it came to survival analysis, TSC1 expression did not significantly impact overall survival, while higher TSC2 expression was associated with a poorer prognosis in rectal cancer. To enhance our comprehension, additional research, especially in larger case studies, is needed to explore the molecular mechanisms and clinical characteristics of TSC genes in colorectal cancer.

This paper examines the relationship between the ratio of independent board member to the financial performance of the company under the mediation of the three pillars of environment, society, and governance (ESG) in Taiwan. The study addresses a research gap between independent directors and corporate financial performance, an issue that is rarely discussed today. The author develops the hypotheses and tests them by applying panel data regression to the data tables taken from the Thomson Reuters Eikon database to analyze data on 173 Taiwanese companies that reported ESG from 2009 to 2021. The results show that the relationship between the ratio of independent directors and financial performance has a positive relationship. At the same time, the 3 pillars of ESG also clearly show the intermediary role in this relationship. Finally, this study provides additional insights into the relationship between the ratio of independent directors and financial performance in the Taiwan context.

Cannabidiol is a well-known non-psychotropic phytocannabinoid from Cannabis sativa, which exerts a broad range of neuropharmacological activities in the central nervous systems. Over the past years, compelling evidence from preclinical and clinical studies support therapeutic potentials of cannabidiol in various neurological disorders, including neurodegenerative diseases. Neurodegenerative diseases are characterized by the accumulation of misfolded or aggregated protein due to the defective protein homeostasis or proteostasis network, termed as proteinopathies. Because of its role in the protein homeostasis network, cannabidiol could be a potent molecule to revert not only age-associated neurodegeneration but also other protein misfolding disorders. In this review, we discuss the potentiality of cannabidiol as a pharmacological modulator of the proteostasis network, highlighting its neuroprotective and aggregates clearing system inducing potentials in the neurodegenerative diseases.

In this study, the literature on varnish contamination is investigated among the various con-taminations of lubricant. As the period of use of lubricant increases, the lubricant deteriorates and becomes contaminated. The varnish causes filter plugging, sticking of hydraulic valves and fuel injection pumps, obstruction of flow, reduction of clearance, poor heater and cooler perfor-mance, and increase of friction and wear in various lubrication systems. These problems also cause mechanical system failure, performance degradation, and increased maintenance and re-pair cost. To improve the problems causes by the varnish, an adequate understanding of varnish is required. Therefore, in this literature review, definitions and characteristics, generating ma-chinery, generating mechanisms, causes, measurement methods, and prevention or removal methods are summarized. Most of the data are reports of companies related to lubricant and machine maintenance, and are included in some papers. We hope that this summary of varnish will be helpful to those who are engaged in reducing or preventing varnish problems.

This study is the first to investigate the asymmetric effects of oil price volatility on stock returns for the Ho Chi Minh Stock Exchange (HOSE). We utilized weekly series of VN30-Index, WTI crude oil prices, geopolitical risks (GPR) index and gold prices spanning from 6 February 2012 to 31 December 2023 as data sources. Using a nonlinear Autoregressive Distributed Lag (NARDL) bounds testing approach, we found that in the short-term, oil price volatility has negative asymmetric effects on the market returns. Specifically, in the short-term, a one percent increase in oil price volatility immediately leads to a 2,6868 percent decrease in the market returns while a similar magnitude decrease in oil price volatility is associated with 6.3180 percent increase in the market returns. In addition, the results obtained from the NARDL model indicated that, in the long-term, the negative and positive changes of oil price volatility have significantly negative effects on the market returns. Finally, the findings derived from the error correction model (ECM) show that 98.21 percent of the disequilibria from the previous week are converged and corrected back to the long-term equilibrium in the current week.

Rotorcrafts operate HUMS for fault diagnosis, but the capabilities of HUMS analysts are important due to the complex mechanical configuration of rotorcraft and the difficulty of analysis. Accordingly, an advanced algorithm is needed to identify faults, and flight data can be used to develop the algorithm. However, flight data contains abnormal or missing data due to problems such as sensor defects, which can be a major problem in algorithm development. Therefore, in this paper, we study a gap filling method using MLP to obtain normal data when there are problems such as abnormal or missing data in rotorcraft flight data. Existing methods typically fill the gap through interpolation or curve fitting using the before and after values of missing data. However, in this study, normal values were estimated using the values of other parameters at the moment of missing or abnormal data occurred. As a result of evaluating the performance of the trained MLP using normal data, it was confirmed that the output of the model well estimates the changing trend of the target. And when abnormal data was applied to the trained model, it was confirmed that point outliers were eliminated and appropriate values were found in the case of missing data.

Although global life expectancy has increased over the past 20 years due to improvements in managing infectious diseases, one in five people still succumbs to infections. Humanity is tirelessly working towards developing vaccines and antimicrobial agents in response to this ongoing threat. However, pathogens continue to acquire numerous resistance mechanisms and proliferate. Meanwhile, the COVID-19 pandemic has prompted us to recognize that focusing solely on the killing strategies of immunology and microbiology in complex and multisystemic infectious diseases is insufficient for understanding survival. In essence, there is a need for a treatment approach centered on disease tolerance, capable of alleviating pathology and/or promoting physiological functions in conjunction with the existing strategies of host immune response and pathogen destruction. Against this backdrop, this narrative review comprehends and introduces microbiome therapeutics, which recently garnered attention as next-generation treatments regarding two defense strategies against infectious diseases. First, we delineate the application of existing probiotics and then the microbiome in infectious diseases. Subsequently, we expand this concept to encompass host microbiome crosstalk and present related microbiome therapeutics' current status and direction. Ultimately, the review presents a fresh perspective on understanding microbiome therapeutics in infectious diseases based on a cooperative defense system.

This study has investigated the effect of nutrition labeling on consumer guilt, in situations where consumers ingest products that have an unhealthy image. The first investigation has examined the effects of types of nutrition labeling (adding healthy ingredients/reducing unhealthy ingredients). The second investigation has examined the influence of two goal-activation types(utilitarian and hedonic) and nutrition labeling on consumer guilt. The findings reveal that the utilitarian-goal-activation group felt less guilty about consuming a product with a reduced unhealthy ingredient than they did about consuming a product with an added healthy ingredient. In addition, there were interactions between the two variables, since consumer goal activation had more effect on consumer guilt about products with reduced unhealthy ingredients than on products with added healthy ingredients. Based on these results, the academic and practical implications of the present study are discussed. and proposes several directions for future research.

Cafestol, a bioactive compound found in coffee, has attracted considerable attention due to its potential impact on cardiovascular health. This review aims to comprehensively explore the association between cafestol and cardiovascular diseases. We delve into the mechanisms through which cafestol influences lipid metabolism, inflammation, and endothelial function, all of which are pivotal in cardiovascular pathophysiology. Moreover, we meticulously analyze epidemiological studies and clinical trials to elucidate the relationship between cafestol and cardiovascular outcomes. Through a critical examination of existing literature, we aim to provide insights into the potential benefits and risks associated with cafestol concerning cardiovascular health.

Many theoretical models of iron-based superconductors have been proposed but Tc calculations based on the models are usually missing. We have chosen two models of iron-based superconductors in the literature and then compute the Tc values accordingly: Recently two models have been announced which suggest that superconducting electron concentration involved in the pairing mechanism of iron-based superconductors may have been underestimated, and that the antiferromagnetism and the induced xy potential may even have a dramatic amplification effect on electron-phonon coupling. We use bulk FeSe, LiFeAs and NaFeAs data to calculate the Tc based on these models and test if the combined model can predict the superconducting transition temperature (Tc) of the nanostructured FeSe monolayer well. To substantiate the recently announced xy potential in the literature, we create a two-channel model to separately superimpose the dynamics of the electron in the upper and lower tetrahedral plane. The results of our two-channel model support the literature data. While scientists are still searching for a universal DFT functional that can describe the pairing mechanism of all iron-based superconductors, we base on the ARPES data to propose an empirical combination of DFT functional for revising the electron-phonon scattering matrix in the superconducting state, which ensures that all electrons involved in iron-based superconductivity are included in the computation. Our computational model takes into account this amplifying effect of antiferromagnetism and the correction of the electron-phonon scattering matrix together with the abnormal soft out-of-plane lattice vibration of the layered structure, which allows us to calculate theoretical Tc values of LiFeAs, NaFeAs and FeSe as a function of pressure that correspond reasonably well to the experimental values. More importantly, by taking into account the interfacial effect between an FeSe monolayer and its SrTiO3 substrate as an additional gain factor, our calculated Tc value is up to 91 K high, and provides evidence that the strong Tc enhancement recently observed in such monolayers with Tc reaching 100 K may be contributed from the electrons within the ARPES range.

In the era of the post-quantum Internet of Things (IoT), the implementation of anti-quantum cryptographic algorithms in numerous terminals can successfully defend against prospective quantum computing assaults. Lattice-based cryptography can withstand quantum computing attacks, making it a viable substitute for the currently prevalent classical public-key cryptographic technique. Nevertheless, the algorithm’s significant time complexity will result in a substantial computational burden on the edge computing chip in the IoT terminal. The computation of polynomial multiplication is the most demanding task in lattice-based cryptographic algorithms. Therefore, the investigation into efficient methods for calculating polynomial multiplication is highly important. Quick number theory transformations (NTT) are a widely employed technique to accelerate polynomial multiplication. This study presents a hardware implementation of an efficient number theory transformation. We utilize a multi-level pipeline architecture in the design to accomplish parallel calculations and execute it on a low-profile Artix7-XC7A100T FPGA device. The performance evaluation results demonstrate that our implementation significantly enhances performance and reduces resource usage compared to other existing proposals on the same platform. We suggested NTT core can be implemented in edge computing chips to enhance computational speed due to its small and low-latency design. The experimental results show that the proposed design, which supports both NTT and inverse NTT, achieves 417-Megahertz and consumes only 541-LUTs on Artix-7 XC7A100T.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Modified mRNAs (modRNAs) are an emerging delivery method for gene therapy. In particular, the modRNA-based COVID-19 vaccines have proven that modRNA is a safe and effective therapeutic tool. Moreover, modRNA has the potential to treat various human diseases including cardiac dysfunction. Acute myocardial infarction (MI) is a major cardiac disorder that currently lacks curative treatment options. MI is commonly accompanied by fibrosis and impaired cardiac function. Our group previously demonstrated that the matricellular protein CCN5 inhibits cardiac fibrosis (CF) and improves cardiac dysfunction. However, it remains elusive whether the early intervention of CF under stress conditions is beneficial or more detrimental due to potential adverse effects such as left ventricular (LV) rupture. To obtain acute CCN5 expression, we used modRNA-mediated gene transfer in a mouse MI model. To evaluate CCN5 activity, we established two independent experimental schemes: 1) preventive intervention and 2) therapeutic intervention. Cardiac function and structural changes were measured by echocardiography and magnetic resonance imaging. Finally, fibrosis and the underlying molecular pathway were analyzed by western blotting, quantitative real-time polymerase chain reaction, and immunohistochemistry. The modRNA-CCN5 gene transfer successfully ameliorated CF and enhanced cardiac function in both preventive and therapeutic interventions without LV rupture or any adverse cardiac remodeling. Conclusively, early intervention in CF by modRNA-CCN5 gene transfer is an efficient and safe therapeutic modality for treating MI-induced heart failure without adverse structural remodeling.

Abstract: The frequency and intensity of air pollution are two of most critical issues the world faces in dealing with global environmental problems. They are both important areas that need to be improved. Our previous research [20] examines the assessment of fine dust pollution in Baekryeong island by statistical reasoning through one specific example of inland city (Yanggu) in Republic of Korea; however, given that Baekryeong Island is a remote island, there has been little focus on in-depth examination of its effect on the high density of fine dust in Baekryeong Island. The purpose of this article is twofold: (i) to examine the effect of a remote island on the high density of fine dust on Baekryeong Island using statistical reasoning and to provide a more specific statistical basis for the claim that one of the non-negligible factors influencing the high density of fine dust on Baekryeong Island is the geographic proximity to China; and (ii) to present brief discussion of fundamental cause of fine dust and global air pollution issues, which are not discussed in [20].

This study aimed to increase the energy independence of buildings by utilizing solar energy to produce renewable energy. The subject of this study was a shading structure installed in an outdoor space to provide solar energy. Solar panels were applied to the shaded structures to generate energy actively. The solar panels were designed to be moved according to the optimal tilt angle each month to produce the optimal renewable energy. The architectural design of the shading structure and the energy simulation of the solar panels were conducted using a parametric design. The results of the energy simulation showed the generation of 31,570 kWh· year−1 of renewable energy. This amount of energy is 10% higher than that produced by fixed solar panels. Thus, the moving solar panel system developed in this study not only increases the energy independence of buildings, but also has the advantage of higher renewable energy production compared with fixed solar panels. Additionally, various types of shading structures can be designed depending on the combination of solar panel modules; in particular, moving solar panels have the potential to facilitate ecofriendly designs when applied to the exterior of buildings.

This study aimed to improve sensitivity of ferrous particle sensors used in various mechanical systems such as wind power gearboxes to detect abnormalities by measuring the amount of ferrous wear particles generated by metal-to-metal contact. Existing sensors collect ferrous particles using a permanent magnet. However, its ability to detect abnormalities is limited because it only measures amounts of ferrous particles collected on the top of the sensor. To overcome this limitation, this study evaluated sensibility of an existing sensor using a multi-physics analysis method and improved it by changing the core shape inside the sensor. The detection ability of the improved sensor was analytically shown to be better than the existing sensor. This study highlights the use of analytical methods and multi-physics analysis for developing a ferrous particle sensor and presents a method to compare sensibility analytically. Results of the improved sensor are expected to enhance the ability to detect abnormalities in the lubrication system where ferrous wear particles are generated. This study will contribute to the development of more effective ferrous particle sensors, which can potentially improve the performance and reliability of mechanical systems.

Background: To date, FM using middle ear packing has rarely reported. In this study, we hypothesized that middle ear packing with dexamethasone soaked gelfoam and fibrin glue over the fat graft could promote the success rate of TMP closure regardless of perforation size. Methods: Between January 2005 and July 2020, a total of 209 patients who underwent fat myringoplasty due to chronic TMP at tertiary referral center were encountered and analyzed. The success rate and audiologic outcome was analyzed. Results: The mean successful TM closure rate was 88.0 %. The success rate by different age generation was not significant difference. The size of the perforation grade showed no significant difference. The perforation site by anterior or posterior was not significant. The preoperative mean threshold of AC, BC and ABG were 55.71, 12.98 and 42.73 dB respectively. The postoperative mean threshold of AC, BC and ABG were 23.67, 12.98 and 10.69 dB. The change of preoperative and postoperative hearing showed statistically significant. Conclusion: From our results, the simple trimming of the perforation edge and middle ear packing with external ear canal packing using fibrin glue induced the stable adhesion between the remnant TM and the fat graft.

This study analysed trends of first-time patients visiting the paediatric psychiatry clinic in a university hospital. The medical records from 2009 to 2016 of first-time patients visiting the Kyung Hee university hospital were reviewed, focusing on children in grades 1–12. We analysed the prevalence rate of psychiatric disorders per 100,000 general populations by gender and grade, and the characteristics of patients who sought outpatient care more than three times. The study included 1,467 participants, of which 931 were males (63.5%). The number of male patients per 100,000 populations significantly decreased from 4.14 in 2009 to 2.03 in 2016. While hyperkinetic disorders had the highest prevalence in males, neurotic disorders were most frequent in females. Prevalence of disruptive behaviour disorders in males and mental retardations in females decreased significantly during the study period. The factors affecting continuity were being female, studying in grades 7–12, and diagnosis of depressive, hyperkinetic, and tic disorders. Physicians should consider the new paediatric patients’ gender, grade, and expected diagnosis from their first visit to improve treatment compliance.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

A digital text abstract presents the essential information of an article, and we can find the trend and value of the research by analyzing it rigorously and digging up knowledge. Therefore, this study focuses on the abstracts of index journals in China and Taiwan from July 2010 to June 2020 (a total of 3,283 abstracts). Through the concepts of text mining and natural language processing (NLP), it constructs processes such as text retrieval, text segmentation and word cloud analysis, TF-IDF weight analysis, co-word analysis, network analysis, and trend analysis, and analyses a large amount of text data. The results show that the scope of research in China covers the fields of social sports and sports science, and research in Taiwan covers both natural and social sciences. The network diagram highlights the richness of sports-related research fields in the two regions, but research on sports philosophy is relatively rare. It is suggested that all disci-plines/departments should re-allocate the same resources, so as to show a balanced development trend and help expand a new chapter in the sports academic field.

(1) Background: This study aimed to compare the effect of polyetheretherketone (PEEK) and titanium abutments on implant prosthetic systems and supporting bone using three-dimensional finite element analysis (FEA); (2) Methods: A three-dimensional finite element analysis was conducted using CATIA and Abaqus software to model mandibular first molar implant systems with titanium and PEEK abutments. Under external loading conditions, finite element analysis was conducted for the stresses in implant components and surrounding bones of each group; (3) Results: The implant fixture of the PEEK model exhibited the highest von Mises stress (VMS). The lowest VMS was observed in the abutment screw of the titanium model. Both implant systems demonstrated similar stress distribution and magnitudes in cortical and cancellous bones; (4) Conclusion: PEEK abutments show similar stress distribution in surrounding bone compared to titanium. However, PEEK absorbs the stresses within the implant system and exhibits the highest VMS values due to its low mechanical and physical properties. Therefore, PEEK abutments need improved mechanical properties for better clinical application.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

Weighted Student Funding (WSF) systems have been implemented in various countries to give schools more autonomy over how to allocate their funding. School principals use funding to maintain school operations and foster innovation for achieving educational goals. However, despite the importance of this process, scholarly research has largely overlooked how principals make decisions about their financial resources. Accordingly, this study seeks to provide practical insights into the strategies used by one school by highlighting their staff’s perceptions about using their WSF to maintain school operations and spur innovation. Using a case study approach, we investigated a principal who effectively used a school’s WSF to transform a failing school into an innovative one. The findings revealed that the principal strategically implemented financial management mechanisms in a way that inspired teachers to deeply consider how a school's WSF can help achieve educational goals. The principal fostered consensus on the school's direction, encouraged innovation through hands-on experiential learning and strategic planning, and facilitated funding for innovative teachers by guiding proposal development. Insights into the shifting cultural and practical landscape of financial resource utilization within schools are discussed.

Maxillomandibular advancement (MMA) is a surgical intervention that reduces the symptoms of obstructive sleep apnea via anterior repositioning of the upper and lower jaws. Pre-operative orthodontic alignment is often a critical component in aiding MMA. Orthodontia are important in intraoperative anchorage for intermaxillary fixation, healthy post-operative occlusion, and post-operative skeletal stability. Sequential clear aligners (SCA) refer to removable orthodontic appliances that are replaced at regular intervals to stimulate dental migration without the use of bonded hardware. These aligners have demonstrated efficacy in aiding orthognathic surgery for dentofacial deformities, which share some technical similarities with MMA for OSA. Here, we explore the treatment protocol for MMA followed by post-operative SCA treatment. Our experiences show that post-operative orthodontic treatment with SCAs results in similarly successful post-operative surgical outcomes given that the patient’s pre-operative occlusion is stable.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Postpartum haemorrhage remains a significant contributor to maternal mortality and morbidity worldwide, particularly in low- and middle-income countries. PPH continues to pose challenges in both developed and developing nations despite being preventable. This review examines the current state of knowledge regarding PPH within the context of Vietnam, a country with its unique healthcare landscape. This review identifies critical areas for improvement and future research directions based on a comprehensive literature analysis, including epidemiological insights, risk factors, prevention strategies, and management approaches. Discrepancies in PPH definitions and prevalence rates across regions highlight the need for tailored interventions and policies. Understanding the specific challenges and opportunities related to PPH in Vietnam is crucial for informing evidence-based interventions and policies to improve maternal health outcomes. This review contributes to the broader global effort to reduce maternal mortality by addressing gaps in knowledge and proposing strategies to enhance PPH prevention and management in Vietnam.

CASBEE-City tool determines the city’s Built Environment Efficiency (BEE) by calculating the improvement of Quality of Life (Q) over human activities’ Environmental Load (L) within the city’s hypothetical boundary. A total of 58 variables (57 Q indicators and one variable for L) are used in the worldwide version of CASBEE-City which were grounded using ISO 37120:2014 Sustainable Development of Communities and 17 Sustainable Development Goals (SDGs) by the United Nations (UN). This paper examines the application of CASBEE-City for Malaysian cities using the case of Johor Bahru City and identifies assessment indicators which are customised based on the data availability, reliability and suitability through focus group discussions (FGDs) which involved 36 respondents (researchers, urban planners and stakeholders). This paper reveals Johor Bahru with moderate score B+ in 2010 and 2025. Consensus were also achieved from the 36 FGD respondents for the practicability and future potential of CASBEE-City and BEE framework in Johor Bahru.

Claudin-18.2 (CLDN18.2) is specifically expressed in pancreatic precancerous lesions and pancreatic ductal adenocarcinoma (PDAC). We assessed clinical characteristics of patients with CLDN18.2 overexpressing pancreatic cancer to identify patients who might benefit from CLDN18 targeted treatment. 130 patients with surgically resected PDAC were investigated the immunohistochemical expression of claudin-18 (CLDN18). The CLDN18 staining intensities (0-3+) and relative proportion of positive tumor cells were analyzed by two independent raters. Tumor as positive for CLDN18 expression was defined as ≥80% of tumor cells with 2+ or 3+ staining intensity on CLDN18 immunohistochemical assay. Positive CLDN18 expression was present in 41/130 (31.5%) surgically resected PDAC and the relative proportion of positive tumor cells and the staining intensity were directly correlated (p &lt; 0.001). Positive CLDN18 expression was significantly associated with well-differentiated tumor (p&lt;0.001) and less regional node involvement (p=0.045). The positive CLDN18 expressing group showed no statistical difference in median overall survival (17.4 months vs. 20.6 months, p=0.770) compared to negative CLDN18 expressing group. Distant nodal metastasis was more frequent in positive CLDN18 expressing group (p=0.011). CLDN18 is frequently expressed in PDAC, and high CLDN18 expressing PDAC showed some different clinicopathologic characteristics. High CLDN18 expression was not associated with prognosis in patients with surgically resected PDAC.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.