Autophagy is a highly conserved catabolic mechanism that mediates the degradation of damaged cellular components by inducing their fusion with lysosomes. This process provides cells with an alternative source of energy for the synthesis of new proteins and the maintenance of metabolic homeostasis in stressful environments. Numerous studies have demonstrated beneficial roles for the induction as well as the suppression of autophagy in cancer cells. Autophagy may induce either survival or death depending on the cell/tissue type. Radiation therapy is widely used therapeutic option to treat cancer, and it induces autophagy in human cancer cell line. Also, melatonin seems to affect cancer cell death via regulation of programmed cell death. In this review, we summarize the current understanding of autophagy and its regulation in cancer.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Large lithium-ion batteries (LIBs) in electric vehicles and energy storage systems demonstrate different performance and lifetime compared to small LIB cells, owing to the size effects generated by the electrical configuration and property imbalance. However, the calculation time for performing life predictions with three-dimensional (3D) cell models is undesirably long. In this paper, a lumped cell model with equivalent resistances (LER cell model) is proposed as a reduced order model of the 3D cell model, which enables accurate and fast life predictions of large LIBs. The developed LER cell model is validated via the comparisons with results of the 3D cell models by simulating a 20-Ah commercial pouch cell (NCM/graphite) and the experimental values. In addition, the LER cell models are applied to different cell types and sizes, such as a 20-Ah cylindrical cell and a 60-Ah pouch cell.

The purpose of this paper is to explore which financial performance indicators (FPIs) evaluate the level of supply chain capability (SCC) that explicitly touches all of the business functions and processes within and beyond the company. The authors investigated nine FPIs that were selected from the financial statements of 155 companies within nine industries. The authors find that suitable FPIs to measure SCC for shareholders’ value are return-on-assets (ROA), days-sales-outstanding (DSO), and current ratio (CR). This means that higher ROA, shortened DSO, and an appropriate level of CR could reach a sustainable supply chain. These results will help the industry to avert a major disruption in supply chain processes and activities using suitable financial performance indicators.

Cloud Manufacturing (CMfg) has attracted lots of attention from scholars and practitioners. The purpose of quality of service (QoS)-aware manufacturing cloud service composition (MCSC), as one of the key issues in CMfg, is to combine different available manufacturing cloud services(MCSs) to generate an optimized MCSC that can meet diverse requirements of customers. However, many available MCS, deployed in the CMfg platform, have same function but different QoS attributes. It is a great challenge to achieve optimal MCSC with high QoS. In order to obtain better optimization results efficiently for the QoS-MCSC problems, a whale optimization algorithm(WOA) with adaptive weight, Lévy flight, and adaptive crossover strategies (ASWOA) is proposed. In the proposed ASWOA, the adaptive crossover inspired by the genetic algorithm is developed to balance the exploration and exploitation. The Lévy flight is designed to expand the search space of WOA and accelerate the convergence of WOA with adaptive crossover. The adaptive weight is developed to extend the search scale of the exploitation. Simulation and comparison experiments are conducted on different scale QoS-MCSC problems. The experimental results demonstrate that the proposed ASWOA outperforms other compared cutting-edge algorithms.

Autism spectrum disorder (ASD) refers to the diverse range of neurodevelopmental disorders accompanying impairments in social interaction, difficulties in communication, and stereotyped or repetitive behaviors. Unlike the older term, autism, the newer term, ASD, better reflects the broad range of autistic symptoms and denotes a single diagnostic category of autism accompanied by numerous conditions. The pineal hormone melatonin is a well-known neuroprotectant and circadian entrainer. This hormone crosses the placenta and enters the fetal circulation, then conveys photoperiodic information to the fetus during pregnancy. These actions enable normal sleep patterns and circadian rhythms, followed by normal neurodevelopment. Melatonin also reduces oxidative stress, which is harmful to the central nervous system. Therefore, melatonin acts as a neuroprotectant and circadian entrainer, and may reduce the risk of neurodevelopmental disorders such as ASD.

Irisin, a skeletal muscle-secreted myokine, produced in response to physical exercise, has protective functions in both the central and the peripheral nervous systems, including the regulation of brain-derived neurotrophic factors and modification of telomere length. Such beneficial effects may inhibit or delay the emergence of neurodegenerative diseases, including Alzheimer’s disease (AD). This review is based on the hypothesis that irisin produced by physical exercise helps control AD progression. Herein, we describe the physiology of irisin and its potential role in delaying or preventing AD. Although current and ongoing studies on irisin show promising results, further research is required to clarify its potential as a meaningful therapeutic target for treating human diseases.

Dogs population increased exponentially in the past decade while the birth rate decreased gradually, especially in the developed countries. Due to dogs’ characteristics of loyalty and obedience, most pet owners treated their dogs as their family members or companions, therefore they are willing to select and purchase safe, high quality and nutrition dog food to their dogs. However, there is lack of regulation or standard to reinforce the production or distribution of dog food in Hong Kong. Consequently, this paper will first review the relationship between high dog population and declining birth rate, types of dog food and typical ingredients. Secondly, the potential health implications of various “toxic” food ingredients for dog, hazard analysis of dog food and its testing methods will be investigated. Lastly, this paper will summarize worldwide existing standards and regulations, quality and hygiene management system related to dog food safety to provide insights and suggestions to Hong Kong government about the importance and urgency of implementing regulations and policies to oversee the imported and local manufactured dog food.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

GABAA receptors are channel proteins crucial to mediating neuronal balance in the CNS. The structure of GABAA receptors allows for multiple binding sites and is key to drug development. Yet, the formation mechanism of the receptor’s distinctive pentameric structure is still unknown. This study aims to investigate the role of three predominant subunits of the human GABAA receptor in the formation of protein pentamers. Through purifying and refolding the protein fragments of the GABAA receptor α1, β2, and γ2 subunits, homopentamers were visualised with negative staining and Cryo-EM. To aid the analysis, AlphaFold2 was used to compare the structures. Results show that α1 and β2 subunit fragments successfully formed homo-oligomers, particularly homopentameric structures, while the predominant heteropentameric GABAA receptor was also replicated through the combination of the three subunits. However, it is still unclear whether γ2 subunits can form homopentamers or their main purpose is to bring together the α1 and β2 subunits to form GABAA receptors. Nevertheless, this study will lead to a deeper understanding of the atomic structure of GABAA receptors, especially in the formation mechanism of complex protein structures, and hopefully pave the way to the development of novel therapeutics for neuropsychiatric diseases.

This study critically reviews the situation of Language teachers in China, who transited from on-campus face-to-face teaching to online teaching within one week of the official school opening dates, which were postponed due to the outbreak of the COVID-19 pandemic. Presently, the study is located in an interpretive research paradigm, and hence, it takes the human experiences within educational setups to be subjective and complex. In so doing, to elude this educational transition and its complex dynamics, the research uses such qualitative research methods as document analysis and interviews. Painting a picture of great variety in individual experiences and challenges, strategies, and outcomes not only across these two specific institutions but, certainly, more broadly through the lens of previous case studies. First, it values depth over breadth and tries to unearth the varied experiences, challenges, innovations, and achievements faculty made during their transition into online Language Teaching. The results of the study are believed to be able to contribute quite a rich, detailed, and multi-faceted perspective to the pool of knowledge for the complexities of online Language education in China, which may be of interest to educators, policymakers, and researchers.

An efficient stereoselective three-component reaction for the synthesis of spiro[4H-chromene-3,3’-oxindole] derivatives was realized through an organocatalyzed cascade Knoevenagel/Michael/cyclization reaction using a quinidine-derived squaramide as the catalyst. Under the optimized conditions, the reactions of isatins, malononitrile, and sesamol yield the desired spirooxindoles in good yields (75–87%) and moderate to high ee values (up to 90% ee). Two pairs of selected enantiomers were subjected to evaluate their antiproliferative activities on three types of human cancer cell lines using the MTT assay. The results indicated that stereoselectivity and electrical effect showed significant impact on activity. Enanotiomer R-3f exhibited optimal cytotoxic activity against U2OS cell line, which was close to the inhibitory activity of positive control, Adriamycin.

The pursuit of materials that offer both wear comfort and protection for functional and protective clothing has led to the exploration of weft-knitted spacer structures. Traditional cushioning materials such as spacer fabrics and laminated foam often suffer from deformation under compression stresses, thus compromising their protective properties. This study investigates the enhancement of the force absorption, stress-strain and thermal properties of weft-knitted spacer fabrics with inlays. Surface yarns with optimal stretchability and thermal properties are used and combined with elastic yarns in various patterns to fabricate nine different inlay samples. The mechanical and thermal properties of these samples are systematically analyzed, including their compression, stretchability, thermal comfort and surface properties. The results show that the inlay spacer fabric exhibits superior compression properties and thermal conductivity compared to traditional laminated foam and spacer fabrics, while maintaining stretchability, thus providing a better performance than traditional fabrics for protective clothing and wearable cushioning products. This study further confirms that the type of inlay yarn and inlay structure are crucial factors that significantly influence the thermal, tensile and compressive properties of fabric. This research provides valuable insights into the design and development of advanced textile structures to improve wear comfort and protection in functional garment applications.

Artificial intelligence (AI) is revolutionizing the textile industry by improving the prediction of fabric properties and handfeel, which are essential for assessing textile quality and performance. However, the practical application and translation of AI-predicted results into real-world textile production remain unclear, posing challenges for widespread adoption. This paper systematically reviews AI-driven techniques for predicting these characteristics by focusing on model mechanisms, dataset diversity, and prediction accuracy. Among 811 papers initially identified, 26 were selected for in-depth analysis through both bibliometric and content analysis. The review categorizes and evaluates various AI approaches, including machine learning, deep learning, and hybrid models, across different types of fabric. Despite significant advances, challenges remain, such as ensuring model generalization and managing complex fabric behavior. Future research should focus on developing more robust models, integrating sustainability, and refining feature extraction techniques. This review highlights the critical gaps in the literature and provides practical insights to enhance AI-driven prediction of fabric properties, thus guiding future textile innovations.

Despite existing strong evidence on oxidative markers overproduction following ischemia/reperfusion (I/R), the mechanism by which oxidative enzyme Cytochrome P450-2E1 (CYP2E1) contributes to I/R outcomes is not clear. In this study, we sought to evaluate the functional significance of CYP2E1 in I/R. CYP2E1 KO mice and controls were subjected to middle cerebral artery occlusion (MCAo-90min) followed by 24hr of reperfusion to induce focal I/R injury models. Then, histological and chemical analyses were conducted to investigate the role of CYP2E1 in lesion volume, oxidative stress, and inflammation exacerbation. Also, the role of CYP2E1 on the BBB integrity was investigated by measuring 20-Hydroxyecosatetraenoic acid (20-HETE) activity, as well as, in vivo BBB transfer rate. Following I/R, the CYP2E1 KO mice exhibited a significantly lower lesion volume, and neurological deficits compared to controls (p<0.005). Also, ROS production, apoptosis, and the neurodegeneration were significantly lower in the CYP2E1(-/-) I/R group (p<0.001). The BBB damage was significantly lower in CYP2E1(-/-) mice compared to WT (p<0.001), while 20-HETE production was increased by 41%. Besides, inflammatory cytokines expression and the number of activated microglia were significantly lower in CYP2E1(-/-) mice following I/R. CYP2E1 suppression ameliorates I/R injury and protects BBB integrity by reducing both oxidative stress and inflammation.

People with aphantasia exhibit the inability to voluntarily generate or form mental imagery in their minds. Since the term “aphantasia” was proposed by Zeman et al. in 2015 to describe this, it has gained increasing attention from psychiatrists, neuroscientists, and clinicians. Previous studies have mainly focused on definition, prevalence, and measurement, its impacts on individuals’ cognitive and emotional processing, and theoretical frameworks synthesizing existing findings, which have contributed greatly to our understanding of aphantasia. However, there are still some debates regarding the conclusions derived from existing research and the theories that were constructed from various sources of evidence. Building upon existing endeavors, the current systematic review emphasizes that future research is much needed to refine definition and diagnosis of aphantasia, strengthen empirical investigations at behavioral and neural levels, and more importantly, develop or update theories. These multiple lines of efforts could lead to a deeper understanding of aphantasia and further guide researchers in future research directions.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

Optimum postharvest storage conditions increase the shelf life and postharvest quality of horticultural crops. The effects of forced-air precooling (FAP) and modified atmosphere packaging (MAP) on shelf life, physicochemical quality, and health-promoting properties of bell pepper (Capsicum annuum L. cv. Nagano) harvested at 90% and 50% coloring stages in May and July respectively, stored at 11℃, 95% relative humidity were assessed. Fruits were treated with FAP + 30 μm polyethylene liner (FOLO), FAP (FOLX), 30 μm polyethylene liner (FXLO), and control (FXLX). The quality attributes, viz. weight loss, firmness, color, SSC, soluble sugars, TPC, TFC, DPPH, and ABTS were evaluated. FOLO maintained sensory quality (weight loss, firmness, and color), physicochemical (soluble solids content and soluble sugars), and health-promoting properties compared to other treatments during storage. The investigated parameters differed significantly (p &lt; 0.05) among treatments except soluble sugars. The 50% coloring fruits had a huge variation between treatments than 90% coloring. The results revealed more TPC and antioxidant capacity in 50% than in 90% coloring fruits. The study highlights the need to consider the ideal fruit coloring stage at harvest under the effect of FAP and MAP treatments in preserving bell pepper's postharvest quality and shelf life.

Attention mechanisms have become a fundamental component of deep learning, including the field of computer vision. The key idea behind attention in computer vision is to help the model focus on the relevant spatial regions of the input image, rather than treating all regions equally. The traditional approaches to attention mechanisms in computer vision often suffer from distribution inconsistencies in the attention maps, resulting in sharp transitions that negatively affect model’s focus and lead to poor generalization on complex shapes. The problem of spatial incoherence is particularly pronounced in the task of semantic segmentation, where accurate pixel-level predictions require a detailed understanding of the spatial relationships within the image. In this paper, we propose an attention mechanism called Smooth Attention designed for convolutional neural networks to address the problem of spatial inconsistency in attention maps through multidimensional spatial smoothing. We conduct a series of experiments to evaluate the effectiveness of the proposed mechanism and demonstrate its superior performance compared to traditional methods.

The rapid growth of the sharing economy has propelled shared mobility to the forefront of attention. The continuous advancement of autonomous driving technology also brings new opportunities and challenges to the shared mobility market. This study comprehensively analyzes the market potential concerning autonomous vehicles (AVs) to provide shared mobility services, utilizing SWOT analysis, PESTLE analysis, and Porter’s Five Forces. The findings reveal that AVs can provide improved shared mobility services by increasing transportation safety, reducing emissions, reducing costs, enhancing traffic efficiency, and increasing customer satisfaction and the profitability of shared mobility services. However, challenges such as technological and policy uncertainties, safety concerns, high initial costs, inadequate public communication infrastructure, and the absence of standardized regulations can hinder the widespread adoption of AVs. The benefits are also restricted with a low market penetration rate of AVs. To promote AVs in the shared mobility market, this study also provides implications for AV stakeholders tailored to the evolving shared mobility market dynamics.

The objective of this study was to determine the effects of supplementing L-isoleucine (L-Ile) on milk protein synthesis, using an immortalized bovine mammary epithelial (MAC-T) cell line. In this case, the cells were treated with 0, 0.3, 0.6, 0.9, 1.2 and 1.5 mM of supplemental Isoleucine (Ile), and the most efficient time for protein synthesis for each amino acid was determined by measuring the cell, medium and total protein at 0, 24, 48, 72 and 96 h. Confirmatory tests showed that 48h incubation time and 0.6 mM dosage of L-Ile are considered as the optimal time and dosage. The mechanism of milk protein synthesis was elucidated through proteomics analysis to clarify the metabolic pathway. When the L-Ile was supplemented, extracellular protein (medium protein) reached a peak at 48h, whereas in the case of the intracellular cell protein, it was shown to have reached to its peak at 24h in all L-Ile dosage treatments. In total, it is noted that there were 63 upregulated and 52 downregulated proteins. The results of the protein pathway analysis showed that the L-Ile group stimulated insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade, insulin/IGF pathway-protein kinase B signaling cascade, p53 pathway, de novo purine biosynthesis, Wnt signaling pathway, glycolysis, pentose phosphate pathway, and ATP synthesis which are pathways involved and related to protein and energy metabolism. Together, these results demonstrate that L-Ile supplementation was effective in stimulating β-casein synthesis by stimulating genes and pathways which are significantly related to protein and energy metabolism.

Based on the two-flavors Polyakov quark-meson model, we study the bubble dynamics of a first-order phase transition in chiral phase diagram at high density but low temperature in the framework of the homogeneous thermal nucleation theory. Under the mean-field approximation, after obtaining the effective potential with inclusion of the fermionic vacuum term, we build a geometric approach to probe two possibly existing minima, which can actually tunnel through a bounce interpolated between a metastable vacuum to an adjacent true vacuum. By separating our discussions into a weak first-order hadron quark phase transition and strong ones, the bubble profiles, the surface tension, the typical radius of the bounce and the saddle point action in the presence of a nucleation bubble as a function of temperature are numerically calculated in detail as the chemical potentials are fixed at $\mu=306 \mathrm{MeV}$ and $\mu=310 \mathrm{MeV}$. our results show that the surface tension remains a small value even when the density is very high and phase boundaries for hadron and quark matter should be resized properly according to the saddle point action evaluated on the bounce. It is also noticed that the inclusion of the deconfinement phase transition in term of the Polyakov loop does not change chiral phase transition dramatically for light quarks.

In the context of global climate change, the frequency of sudden natural disasters is increasing. Assessing traffic road damage post-disaster is crucial for emergency decision-making and disaster management. Traditional ground observation methods for evaluating traffic road damage are limited by the timeliness and coverage of data updates. Relying solely on these methods does not adequately support rapid assessment and emergency management during extreme natural disasters. Social media, a major source of big data, can effectively address these limitations by providing more timely and comprehensive disaster information. Motivated by this, we utilized multi-source heterogeneous data to assess the damage to traffic roads under extreme conditions and established a new framework for evaluating traffic roads in cities prone to flood disasters caused by rainstorms. The approach involves several steps: First, extracting the surface area affected by precipitation using a threshold method constrained by confidence intervals derived from microwave remote sensing images; Second, collecting disaster information from the Sina Weibo platform, where social media information is screened and cleaned. A quantification table for road traffic loss assessment was defined, and a social media disaster information classification model combining text convolutional neural networks and attention mechanisms was proposed (TextCNN-Attention Disaster Classification); Finally, matching traffic road information on social media with basic geographic data, visualizing the classification of traffic road disaster risk levels, and completing the assessment of traffic road disaster levels based on multi-source heterogeneous data. Using the "7.20" rainstorm event in Henan Province as an example, this study categorizes the disaster impact on traffic roads into five levels: particularly severe, severe, moderate, mild, and affected, as interpreted from remote sensing images. The evaluation framework for flood disaster traffic roads based on multi-source heterogeneous data provides important data support and methodological support for enhancing disaster management capabilities and systems.

With increasing air and sea temperatures, the thermodynamic environments over the oceans become more favourable for the development of intense tropical cyclones (TCs) with rapid intensification (RI). In fact, the number of TCs undergoing RI is rising (Zhao, et al., 2018; Bhatia, et al., 2019; Song, et al., 2020; Hong & Wu, 2021; Liu, et al., 2022). RI over coastal sea areas before landfalling is particularly impactful and threatening to coastal lives and properties. There have been studies showing that offshore areas within 400 km of the coastline have experienced a significant increase in RI events with the count tripling from 1980 to 2020 (Li et al., 2023). The south China coastal region consists of highly densely populated cities especially the Pearl River Delta (PRD) region. Intense TCs maintaining its strength or RI of TCs close to the coastal region presents substantial forecasting challenges. This study investigates the effect of sea surface and subsurface temperature and salinity on the intensification of five TCs, namely Super Typhoons Hato in 2017 and Mangkhut in 2018, Typhoon Talim, Super Typhoon Saola and Severe Typhoon Koinu in 2023, which significantly affected the south China coastal region and triggered high TC warning signals in Hong Kong. The analysis utilized the Hong Kong Observatory (HKO) TC track and intensity data, along with the sea temperature and salinity profiles generated using the China Ocean ReAnalysis version 2 (CORA2) of the National Marine Data and Information Service (NMDIS) of China. While high sea surface temperature (SST) of 30°C or above, low surface sea surface salinity (SSS) of 34 psu or below, and strong salinity stratification of at least 0.8 psu per 100 m depth may offer useful hints for predicting RI, they are part of a broader set of contributing factors. This study represents the initial documentation of sub-surface salinity's impact on intense TCs over the South China Sea (SCS) in recent years and will encourage further research to refine forecasting RI of TCs before making landfall near PRD taking into account the effect of freshwater from the Pearl River.

The cyclic lipopeptide produced from Bacillus pumilus strain HY1 was isolated from Korean soybean sauce. The chemical structures of the surfactin isomers were analyzed using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and electrospray ionization tandem mass spectrometry (ESI-MS/MS). The five potential surfactin isoforms were detected with protonated masses of m/z 994.7, 1,008.7, 1022.7, 1036.7, and 1,050.7 and different structures in combination with Na+, K+, and Ca2+ ions. ESI-MS/MS analysis revealed that the isolated surfactin possessed the precise amino acid sequence LLVDLL and hydroxyl fatty acids with 12 to 16 carbons. The surfactin content during cheonggukjang fermentation increased from 0.3 to 51.2 mg/kg over 60 h of fermentation. The surfactin extraction of cheonggukjang inhibited the growth of two cancer cell lines. The growth of both MCF-7 and Caco-2 cells was strongly inhibited with 100 μg/μL surfactin. These results suggest that surfactins produced from strain HY1 have anticancer properties.

This study proposed to use wearable EEG to study the impact of vipassana mindfulness practice on beginner's physiological and neurological responses. Mindfulness meditation has been shown to have numerous benefits, including stress reduction, improved attention and cognitive function, and enhanced emotional regulation. The roots of mindfulness meditation in Buddhism emphasize cultivating present-moment awareness and insight. However, the neural mechanisms together with physiological mechanism and their interaction underlying these benefits remain poorly understood. Method: One middle age man (50 years old) participated in this longitudinal study using wearable EEG to investigate the neurophysiological change during a one-month consecutive vipassana mindfulness practice. Both EEG and heart rate responses were recorded each time, before (5 minutes), during (20 minutes), and after (5 minutes) meditation sessions. The EEG and HR data were analyzed by Matlab and EEGlab to examine changes in brainwave activity and heart rate. Results: alpha peak frequency (APF) is significantly lower after mindfulness meditation, as shown by comparison of APF before mindfulness (pre-5) and during mindfulness practice (med-20), and comparison between APF of pre-5 and after mindfulness practice (post-5). The same is with the beta peak power. While for theta peak frequency, it is significant lower during mindfulness meditation (med-20), when comparing to either pre-5 or post-5. See figure 1a. However, peak power index is not so sensitive, and it is more obvious in theta wave band. That is, the theta power peak is significantly lower after meditation, as can be observed in comparison between pre-5 and med-20, also between pre-5 and med-20. See figure 1b. STATE Heart-mean (bpm) Heart-std(bmp) pre-5 69.88 3.88 med-20 68.36 2.81 post-5 69.55 4.13 t-value test (pre-med) 0.0694 0.0003 t-value test (pre-post) 0.7934 0.3656 t-value test (post-med) 0.3193 0.0001 Table 1. The difference of Heart rate (mean and SD) in before (pre-5), during (med-20) and after (post-5)mindfulness meditation. We find significant change in standard deviation (SD) of heart rate between meditation and non-meditation mental states, as shown in table 1. The study provides insights into the underlying neurophysiological mechanisms of mindfulness meditation using wearable EEG devices. It demonstrates that in term of EEG measurement, spectrum frequency can be more sensitive than spectrum power; also heart rate variability as measured by SD is more sensitive to mean of HR. The proposed study contributes to the literature by using wearable EEG devices to collect data in a more accessible and convenient manner.

High-wind structures were identified in the Cross-Calibrated Multi-Platform (CCMP) ocean wind vector reanalysis for comparison with winds measured by satellite radiometers and synthetical aperture radar (SAR) instruments from February to October 2023. The comparison aims to evaluate bias, uncertainty, and spatial correlations with the goal of enhancing the accuracy of ocean wind datasets during tropical cyclones (TCs). In 10°longitude×10°latitude blocks, each containing a TC, Soil Moisture Active Passive (SMAP) and Advanced Microwave Scanning Radiometer 2 (AMSR2) winds are 6.5% and 4.8% higher than CCMP, while Advanced Scatterometer (ASCATB) is 0.8% lower. For extratropical cyclones, AMSR2 and SMAP also show stronger winds with a 5% difference, and ASCATB is about 0.3% weaker compared to CCMP. The comparison between SAR and CCMP for TC winds, sampled at the locations and time frames of SAR tiles, indicates that SAR winds around TCs are about 9% higher than CCMP winds. Using empirically defined TC structural indices, we find that the TCs observed by CCMP are shifted in locations and lack a compact core region. A Random Forest (RF) regressor was applied to TCs in CCMP with corresponding SAR observations, nearly correcting the full magnitude of low bias in CCMP statistically, with a 15m/s correction in the core region. The hierarchy of importance among the predictors is as follows: CCMP wind speed (62%), distance of SAR pixels to the eye region (21%) and eye center (7%), and distance of CCMP pixels to the eye region (5%) and eye center.

This paper presents a comparative study of fundamental similarity functions for Siamese networks in semantic textual similarity (STS) tasks. We evaluate various similarity functions using the STS Benchmark dataset, analyzing their performance and stability. Additionally, we introduce a multi-objective approach for optimal threshold selection. Our findings provide insights into the effectiveness of different similarity functions and offer a straightforward method for threshold selection optimization, contributing to the advancement of Siamese network architectures in STS applications.

This study presents a critical literature review on the models of users' adoption of blockchain applications in supply chains. This review pertaining to blockchain technology adoption by supply chain stakeholders is significant as it is a pre-requisite for the technical sustainability of blockchain technology in supply chains. Through a critical literature review, the previous studies related to technology adoption models were analyzed to explore practices brought about by blockchain applications for supply chain management. This study examined the suitability of the existing models (e.g., the technology-organization-environment (TOE) framework, task technology fit (TTF), unified theory of acceptance and use of technology (UTAUT)) of technology adoption for blockchain applications in supply chains and came up with a new unified model, namely, TOE-TTF-UTAUT. This review provides implications for a more appropriate research design using mixed methods. When adopting the TOE-TTF-UTAUT model in a study, two phases of research using mixed methods can be performed. The first phase is an exploratory sequential design in which a qualitative approach to explore the TOE and supply chain task constructs is followed by a quantitative approach using a survey and quantitative analyses to investigate the factors affecting blockchain adoption in supply chains. The second phase adopts explanatory sequential design in which the quantitative findings from the first phase are reviewed for follow-up by qualitative interviews to obtain explanations.

Objective: The study aimed to characterize the changing landscape of circulating SARS-CoV-2 lineages in the local community of Hong Kong throughout 2022. We examined how adjustments to quarantine arrangements influenced the transmission pattern of Omicron variants in a city with relatively rigorous social distancing measures at that time. Methods: In 2022, a total of 4,684 local SARS-CoV-2 genomes were sequenced using the Oxford Nanopore GridION sequencer. SARS-CoV-2 consensus genomes were generated by MAFFT, and the maximum likelihood phylogeny of these genomes were determined using IQ-TREE. The dynamic changes in lineages were depicted in a time tree created by Nextstrain. Statistical analysis was conducted to assess the correlation between changes in the number of lineages and adjustments to quarantine arrangements. Results: By the end of 2022, a total of 83 SARS-CoV-2 lineages were identified in the community. The increase in the number of new lineages was significantly associated with the relaxation of quarantine arrangements (One-way ANOVA, F(5,47)=18.233, p&lt;0.001)). Over time, Omicron BA.5 sub-lineages replaced BA.2.2 and became the predominant Omicron variants in Hong Kong. The influx of new lineages reshaped the dynamics of Omicron variants in the community without fluctuating the death rate and hospitalization rate (One-way ANOVA, F(5,47)=2.037, p=0.091). Conclusion: The study revealed that even with an extended mandatory quarantine period for incoming travelers, it may not be feasible to completely prevent the introduction and subsequent community spread of highly contagious Omicron variants. Ongoing molecular surveillance of COVID-19 remains essential to monitor the emergence of new recombinant variants.

Many corporations have now revised their value statements to showcase their commitment to sustainable development and green business due to the pressing issues of climate and environmental damage. Despite the importance of value statements that can direct companies to achieve sustainable goals, what kind of values can be perceived as organizational orientations to sustainability remains unknown. This study explores how the general public views the inclusion of sustainable components in value statements from the listed companies in Hong Kong by using Q-sort methodology (n = 30). Analyzing the final sample of 40 value statements extracted from 27 listed companies, we identified three factors related to sustainability, namely, Empowering business process management, Empowering customer-centric excellence, and Empowering sustainable progress. This study provides an additional component to the traditional triple bottom line by suggesting that internal operation of a company is an emerging idea to understand corporate sustainability.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Objective: Identify factors associated with excessive day time sleepiness (EDS) in individuals with obstructive sleep apnea (OSA), and analyze the effects that obesity and gender have on excessive daytime sleepiness in such individuals. Methods: A total of 160 people were selected for this study. All the people have completed a clinical evaluation, and whose apnea-hypopnea index (AHI) > 10 events/hour of sleep on polysomnography were included in the study from the Department of otolaryngology. Results: The Mean age was 43.87±11.34 years, mean EDS score was 14.09± 4.91, and mean AHI was 43.88±20.66 events/hour of sleep. Male presented lower mean age, higher EDS scores, and more time in apnoea, whereas females presented with higher mean age, lower EDS scores, and less time in sleep apnea. The EDS score showed best correlation with duration of apnoea (r = 0.448; p < 0.01), peripheral oxygen saturation (SpO₂; r = -0.458; p < 0.01) and AHI (r = 0.484; p < 0.01). The mean body mass index (BMI) was 27.41±3.86 kg/m². Normal, Overweight, obese, and morbidly obese were observed in 20%, 61%, 18%, and 0.6% of cases, respectively. Severity of the disease best correlated with BMI (r = 0.421; p < 0.01). Conclusions: OSA is predominant in males (M/F 5:1), and obese population. Females diagnosed with OSA have higher mean age. However, EDS scores and time spent in sleep apnoea is lower in females. Higher BMI is associated with EDS, irrespective of gender.

In this paper, a new axial-type magnetic gear with auxiliary flux-enhancing structure (AFS-AMG) is proposed. Compared to conventional AFS-AMG, it has the higher torque density and higher permanent magnet (PM) utilization factor. Firstly, the design rules and operating principles of proposed AFS-AMG are elaborated. Then, the mapping relation between the radial-type magnetic gears (RMGs) and AMGs are elucidated. Compared to its counterpart in RMGs, AFS-AMGs achieve small size. Then, the geometrical parameters of AFS-AMGs are optimized to obtain the better electromagnetic performances, where the torque density per volume and per PM volume is adopted as the evaluation standard. Finally, three different AMG topologies are constructed in finite element analysis (FEA) software for comparison. It is proven that the AFS-AMG has the largest torque density per volume and per PM volume.

This paper addresses the analysis for the nonlinear vibration response of a rectangular tube with a flexible end and non-rigid acoustic boundaries. This is a further work of the linear structural acoustic problem in a well-known acoustic book. In fact, the acoustic boundaries of an enclosed space sometimes are non-rigid and the structural vibration responses are nonlinear. These two points are the focuses of this paper. The multi-level residue harmonic balance method is applied to this nonlinear structural acoustic problem. The results obtained from the multi-level residue harmonic balance method and numerical method are generally in good agreement. The effects of excitation magnitude, tube length, and phase shift parameter etc. are examined.

PURPOSE: To investigate the oxylipin profiles in aqueous humor of primary open angle glaucoma (POAG) patients. METHODS: Aqueous humor samples were collected from 17 POAG patients and 15 cataract subjects and subjected to the liquid chromatography-mass spectrometry (LC-MS) analysis to detect the oxylipins. The prediction potential of the differential abundant oxylipins was assessed by the receiver operating characteristic (ROC) curves. Pathway and correlation analyses on the oxylipins and clinical and biochemical parameters were also conducted. RESULTS: The LC-MS analysis detected a total of 76 oxylipins, of which 29 oxylipins reached the detection limit. The multivariate analysis identified 5 differential abundant oxylipins, 15-keto-prostaglandin F2 alpha (15-kPGF2α), Leukotriene B4 (LTB4), 12,13-Epoxyoctadecenoic acid (12,13-Epome), 15-Hydroxyeicosatetraenoic acid (15-HETE) and 11-Hydroxyeicosatetraenoic acid (11-HETE). The 5 oxylipins are enriched in the arachidonic acid metabolism and linoleic acid metabolism pathways. Pearson correlation analysis showed that 11-HETE was positively correlated with intraocular pressure and central corneal thickness and negatively with cup/disk ratio in the POAG patients. In addition, 15-kPGF2α was positively correlated with visual field defect, and LTB4 was negatively correlated with macular thickness.  CONCLUSIONS: This study revealed the oxylipin profile in the aqueous humor of POAG patients. Oxylipins involved in arachidonic acid metabolism pathway could play a role in POAG and anti-inflammatory therapies could be potential treatment strategies for POAG.

Autoantibodies against specific lung cancer-associated antigens have been suggested for lung cancer diagnosis. This study aimed to evaluate the diagnostic performance of anti-gen-autoantibody immune complex (AIC) against its free antigens for CYFRA21-1, ProGRP, NGAL, and NSE in non-small cell lung cancer (NSCLC). In total, 85 patients with NSCLC and 120 healthy controls (HCs) were examined using a 9G DNA chip method. The ratios of AICs to their antigens and combinations of ratios consisting of two to four markers were calculated. The levels of AICs for CYFRA21-1, ProGRP, NGAL, and NSE were higher than their free antigens in all participants. The levels of each free antigen distinguished patients with NSCLC from HCs. The ratios of AIC to its antigen and seven combinations consisting of two to four ratios were significantly higher in patients with NSCLC than those in HCs. Excellent diagnostic performance was observed for all combination ratios (C4-1), with 85.9% sensitivity and 86.7% specificity at cutoff 3.51. Higher sensitivity was observed in the very early stages (0–I) and adenocarcinoma than in stages II–IV and other pathological types. The combination of all ratios of AICs and their antigens for all four markers is useful in the diagnosis of NSCLC.

In this paper, a multi-mode waveguide-based optical resonator is proposed for an integrated optical refractive index sensor. Conventional optical resonators have been studied for single-mode waveguide-based resonators to enhance the performance, but mass production is limited owing to the high fabrication costs of nano-scale structures. To overcome this problem, we designed an S-bend resonator based on a micro-scale multi-mode waveguide. In general, multi-mode waveguides cannot be utilized as optical resonators, because of a performance degradation resulting from modal dispersion and an output transmission with multi-peaks. Therefore, we exploited the mode discrimination phenomenon using the bending loss, and the resulting S-bend resonator yielded an output transmission without multi-peaks. This phenomenon is utilized to remove higher-order modes efficiently using the difference in the effective refractive index between the higher-order and fundamental modes. As a result, the resonator achieved a Q-factor and sensitivity of 2.3x10³ and 52 nm/RIU, respectively, using the variational finite-difference time-domain method. These results show that the multi-mode waveguide-based S-bend resonator with a wide line width can be utilized as a refractive index sensor.

Despite the increasing prevalence of pet ownership in Chinese societies, standardized tools to assess grief from pet loss remain lacking. Research predominantly focuses on Western populations, creating a gap in understanding pet bereavement in Chinese cultural settings. This study aimed to adapt and validate the Pet Bereavement Questionnaire (PBQ-C) for a Chinese context to create a culturally appropriate assessment tool. A total of 245 participants with companion animal loss experiences were recruited through the university of the research team. They were invited to complete an online survey including the Chinese PBQ, the Depression subscale of the Depression Anxiety Stress Scales (DASS-21), and the Inventory of Complicated Grief (ICG). Both Exploratory Factor Analysis and Confirmatory Factor Analysis were conducted to examine the psychometric properties of the PBQ-C and the findings supported a three-factor structure—grief, anger, and guilt—aligned with the original PBQ, with three items were reassigned to different factors. Despite these adjustments, the PBQ-C showed strong internal consistency, split-half reliability, and concurrent validity. The validated PBQ-C provides a culturally sensitive tool for assessing pet bereavement in Chinese society that can promote research and counselling support for this under-researched and under-recognized type of loss of human-animal relationships.

Blockchain technology (BCT) has the potential for sustainable development, enhancing business efficiency, reducing costs, and strengthening data security. Despite its potential, adoption among small and medium-sized enterprises (SMEs) is low due to the need for significant changes in technology infrastructure and the challenge of interoperability. A cross-sectional survey was done with 226 Hong Kong SMEs. The PLS-SEM results highlighted favorable transformation conditions as the most critical factor for SMEs considering the adoption of BCT. These conditions address both internal and external readiness for adopting the disruptive strategy. Other contributing factors to BCT adoption include trust in BCT developers, perceived usefulness and ease of use, government support, and perceived security. The research results contributed to the literature on disruptive technology acceptance, adoption, transformation conditions, technology readiness, and SMEs’ technology adoption. Government-supported policies and initiatives can promote BCT adoption, including educational programs, case studies, and resources for readiness. Financial support and regulatory frameworks can further encourage adoption. BCT developers can demonstrate the value of their systems, effectively communicate potential ROI and cost savings, and provide user-friendly interfaces to increase SMEs’ intention to adopt BCT.

We assessed the growth performance, physiological traits, and gene expressions in steers fed with dietary rumen-protected L-tryptophan (RPT) under cold environment. Eight Korean native steers were assigned to two dietary groups, no RPT (Control) and RPT (0.1% RPT supplementation on a dry matter basis), 6 wks. Maximum and minimum temperatures throughout the experiment were 6.7°C and -7.0°C, respectively. Supplementation of 0.1% RPT to a total mixed ration did not increase body weight but had positive effects of elevating average daily gain (ADG) and reducing the feed conversion ratio (FCR) at day 27 and 48. Metabolic parameter showed higher glucose level (at day 27) in the 0.1% RPT group compared to the control group. Real-time PCR analysis showed no significant differences in the expression of muscle (MYF6, MyoD, and Desmin) metabolism genes between the two groups, whereas the expression of fat (PPARγ, C/EBPα, and FABP4) metabolism genes was lower in the 0.1% RPT group than in the control group. Thus, we demonstrate that long-term (6 wks) dietary supplementation of 0.1% RPT was beneficial owing to enhanced growth performance by increasing ADG and glucose level, decreasing FCR, and maintaining homeostasis in immune responses in beef steers during cold environment.

In spite of unique structural, spectroscopic and redox properties, the synthetic variants of the planar, antiaromatic hexaphyrin (1.0.1.0.1.0) derivatives 2, has been limited due to the low yields and difficulty in access to the starting material. A chemical modification of the meso-substituents could be good alternative overcoming the synthetic barrier. Herein, we report a regio-selective nucleophilic aromatic substitution (SNAr) of meso-pentafluorophenyl group in rosarrin 2 with catechol. The reaction afforded benzodioxane fused rosarrin 3 as single product with high yield. The intrinsic antiaromatic character of the starting rosarrin 2 retained throughout the reactions. Clean, two electron reduction was achieved by treatment of 3 with SnCl2•2H2O affording 26pi-electron aromatic rosarrin 4. The synthesized compounds exhibited noticeable changes in photophysical and redox properties compared with starting rosarrin 2. .

In wideband radar systems, the performance of motion parameters estimation can significantly affect the performance of object detection and the quality of inverse synthetic aperture radar (ISAR) imaging. Although the traditional motion parameters estimation methods can reduce the range migration (RM) and Doppler frequency migration (DFM) effects in ISAR imaging, the computational complexity is high. In this paper, we propose a new fast non-searching motion parameters estimation method based on cross-correlation of adjacent echoes (CCAE) for wideband LFM signals. A cross-correlation operation is carried out for two adjacent echo signals, then the motion parameters can be calculated by estimating the frequency of the correlation result. The proposed CCAE method can be applied directly to the stretching system, which is commonly adopted in wideband radar systems. Simulational results demonstrate that the new method can achieve better estimation performances, with much lower computational cost, compared with existing methods. The experimental results on real radar data sets are also evaluated to verify the effectiveness and superiority of the proposed method compared to the state-of-the-art existing methods.

An accurate assessment of the stage-discharge relationship in open channel flows is necessary and important to the design and management of hydraulic structures and engineering in practical hydrosystems such as rivers and streams. While the flow structures and patterns at open channel junctions are interesting and have been widely studied in the literature, this paper focuses further on the effect of flow junctions on stage-discharge relationship at mountain river confluences. In this study, both the flume and physical model experiments are designed and performed carefully to test and analyze the complex flow structures and characteristics at river confluences with different configurations and hydraulic conditions. The impacts of the flow junctions on the traditional stage-discharge relationship are analyzed in this study. The results of this study are discussed in the paper for the understanding of flow structures at flow junctions and the design and management of hydraulic structures in river engineering.

This study presents a comprehensive ecological evaluation of avian species based on 5,322 photographs obtained through camera-trap sampling. We identified 1,427 independent bird sightings, encompassing 26 families and 49 species. The study focused on temporal activity patterns, nesting behaviors, habitat preferences, and the overlap coefficient of activity patterns among 22 species of Passeriformes. Two species exhibited predominant morning activity, while five species were active in the afternoon, and 15 exhibited cathemeral activity (activity throughout the day). A cross-analysis revealed varying degrees of overlap in the activity patterns of pairs of species with similar behavioral ecology. Our findings indicate that despite exhibiting similar ecological behavior, these species display unique activity patterns, likely influenced by factors such as resource availability, competition avoidance, and thermoregulation strategies. The results highlight the richness and complexity of avian temporal niches and emphasize the need for further research into their correlation with environmental factors. This study contributes to a deeper understanding of niche separation within Passeriformes and expands our knowledge of avian behavioral ecology.

Periostracum cicadae, the cast-off shell of the cicada Cryptotympana pustulata Fabricius, is used in traditional Chinese medicine for its diaphoretic, anticonvulsive, sedative, antipyretic, and antiallergic effects. However, the exact pathogenesis of immunoglobulin A nephropathy (IgAN) remains unclear, thereby hindering investigations to identify novel therapeutic agents. A rat IgAN model was established by administration of bovine serum albumin, lipopolysaccharide, and carbon tetrachloride, which simultaneously established blood stasis and a heat syndrome model. The animals were sacrificed to detect changes in protein levels in urine and blood. Immunofluorescence was performed to assess IgA deposition in the glomeruli. Tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin 6 (IL-6) levels were measured in bronchoalveolar lavage fluid (BALF) by enzyme-linked immunosorbent assay. Hematology and eosin, periodic acid-Schiff, TUNEL, and immunohistochemical staining were performed to evaluate histopathological changes in kidney tissues. Additionally, target-related proteins were measured by western blotting. Periostracum cicadae resulted in a reduction in blood and urine protein levels. Serum TNF-α, IL-1β, and IL-6 levels significantly decreased in the periostracum cicadae-treated groups compared to the IgAN group. Furthermore, a reduction in MCP-1, TLR4, and IgA expression levels and a dose- dependent increase in caspace-3 expression were observed in response to periostracum cicadae treatment. TGF-β1 levels decreased, whereas that of Fas increased in the kidney tissues of the periostracum cicadae-treated groups. The findings of the present study indicate that periostracum cicadae induces apoptosis and improves kidney inflammation and fibrosis in IgA nephropathy rat models.

The aim of this study was to examine oxidative stress and low level of alpha-1-antitrypsin (A1AT) in primary Sjögren's syndrome (pSS), and evaluate the associated autoreactivity against unmodified and their 4-hydroxy-2-nonenal (HNE)-modified peptides with pSS. Two differentially expressed proteins, alpha-1-acid glycoprotein 1 (A1AG1) and A1AT, exhibited 2-fold differences, and their HNE modifications were identified by depleted-albumin and immunoglobulin G (IgG) serum protein, in-solution digestion, in-gel digestion, and nano-LC-MS/MS from pSS patients and age-matched healthy controls (HCs). Furthermore, levels of proteins, confirmation of HNE modifications, HNE-protein adducts and autoreactivity against unmodified and their HNE-modified peptides were further validated. Levels of the HNE-protein adduct and A1AG1 were significantly higher in pSS patients than HCs, but levels of A1AT were significantly lower in pSS patients compared to HCs. Only the HNE modification of A1AT was confirmed. Further, concentrations of anti-A1AT^50-63 IgG and anti-A1AT^50-63 HNE IgA were significantly lower in pSS patients than HCs. Our study suggests that elevated HNE-protein adduct, oxidative stress, level [odds ratio (OR) 4.877, p = 0.003], lowered A1AT level (OR 3.910, p = 0.010) and a decreased level of anti-A1AT^50-63 IgG (OR 3.360, p = 0.010) showed an increased risk in pSS patients compared to HCs, respectively.

The present study examines the long-term care service awareness, needs, and usage intention of elderly male homosexuals in Taiwan and their ideal long-term care service model. This study of five elderly male homosexual subjects aged 66 to 73 years was intended as a preliminary exploration. Interviews were used to collect data. The study determined that the five subjects had high awareness of long-term care services, as they had actual experience of long-term care services or even participated in care service staff training to obtain certificates. Some even had experience in applying for home care services and experienced problems during use. The subjects perceived that they were very likely to require long-term care services in the future and tended to use home care services if they required long-term care services. Due to their personal experiences, the subjects had negative awareness of long-term care services and worried that long-term care service staff had poor attitudes toward homosexuals. The subjects considered the most important aspects of long-term care to be basic medical care and lifestyle care. However, they worried that long-term care staff would delay or refuse to provide such services due to the subjects’ sexual orientation or stereotypes, and they were concerned above all about the “friendly attitude” of long-term care staff. They hoped that long-term care staff were friendly toward homosexuals and did not discriminate against them, and they felt that it would be more appropriate for homosexual long-term care staff to provide assistance. In terms of vision, while preferring organizations with homosexual employees, the subjects worried that they would be stigmatized and discriminated against . With regard to ideal long-term care services, while considering institutions with homosexual staff to be ideal, the subjects also worried that these would be labeled as institutions that were dedicated to homosexuals, potentially resulting in discrimination. Therefore, they hoped that the sexuality sensitivity of long-term care staff could be improved and that they would undergo professional continuing education to learn about homosexuals, the situation and care needs of homosexuals, and care techniques for homosexuals.

Proteomics is the study of cellular proteome by investigating how different proteins interact with each other and the roles they play in the organism. For mRNA expression levels do not always correlate well with protein expression levels, and the study of mRNA does not consider protein posttranslational modifications (PTMs), complex formation and localization; all of which are key to protein function. Quantitative proteomics uses mass spectrometry to identify and quantify proteins so as to find differentially expressed proteins under different condition. This allows us to gain biological insights under stress or other pathological conditions. posttranslational modifications, such as lysine acetylation, succinylation and lactylation, occur after protein biosynthesis and play vital roles in protein activity and cell physiology regulation. Here we present the mass spectrometry analysis in detail to unveil protein acylase and deacylase’ roles in metabolic regulation based on PTMomics lysine acetylome and suincylome.

Immunohistochemistry (IHC) helps identify different types of tissues and provides important information about the pattern, shape, and structure of cells in a tissue sample. It is a very useful tool and widely used to uncover histology and pathology diagnosis uses. The IHC is a very useful tool to conduct research in the developmental biology area. Some insects, like butterflies, bees, beetles, ants, wasps, and moths, undergo a unique life cycle called complete metamorphosis, which has four distinct stages: egg, larva, pupa, and adult. Larvae are often wingless and have different habits and forms than adults, which are better suited for growth and development. During the metamorphosis, how does the insect legs change is a really an interesting issue.To better understand insect development, agriculture pest control, and insect pathogen interaction, here we use an insect Bombyx mori (domestic silk moth) as a model to detail how to conduct the IHC assays, such as HE staining, TUNEL to see the cell apoptosis, pH3 and BrdU staining to check cell division. The reagents can be easily found, and this step-by-step protocol is easily reproduced.

Ventilation in cities is crucial for the well being of their inhabitants. Therefore, local governments require air ventilation assessments (AVAs) prior to the construction of new buildings. In a standard AVA, however, only neutral stratification is considered, although diabatic and particularly unstable conditions may be observed more frequently in nature. The results presented here indicate significant changes in ventilation within most of the area of Kowloon City, Hong Kong, included in the study. A new definition for calculating ventilation was introduced, and used to compare the influence of buildings on ventilation under conditions of neutral and unstable stratification. The overall ventilation increased due to enhanced vertical mixing. In the vicinity of exposed buildings, however, ventilation was weaker for unstable stratification than for neutral stratification. The influence on ventilation by building parameters, such as the plan area index, was altered when unstable stratification was considered. Consequently, differences in stratification were shown to have marked effects on ventilation estimates, which should be taken into consideration in future AVAs.

This paper uses panel data to find the determinants of tracking errors in exchange traded funds (ETFs) in the Hong Kong stock market. A comparison of tracking errors between physical and synthetic ETFs also indicates that the synthetic ETFs have higher tracking errors. The magnitude of tracking errors is found to be negatively related to size but positively related to dividend yield, trading volumes of funds, and market risk. However, this study also finds that expense ratio has a negative impact on tracking error, which is not consistent with previous studies, and which this paper addresses.

Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

This study was undertaken to investigate and analyze noise pollution in a large Chinese governmental hospital’s medical intensive care unit and compare to the WHO guidelines.This cross-sectional study was conducted in a MICU at a public governmental teaching hospital in Fujian province between July and August of 2017. A WENSN® WS1361 Integrated Sound Level Meter (China) was used for continuous every five seconds one week noise levels recording. After this measurement, the decibel meter was used for recording different location of isolation rooms and open bays, including occupied and unoccupied patient, and recording sound events occurs in the ICU to identify sources of noise. Peak and average noise levels were obtained from the meter, and data were downloaded from the WS1361 into a laptop computer. The measured mean equivalent sound pressure levels (L) and standard Aeq deviation over one week period were 66.64±7.57 dB(A), with acute spikes reaching 119.7 dB(A), the average sound level for a 24 hour period in a work day was 68.03±5.07 dB(A). These are higher than the current daytime environmental noise limit of 40-45 decibels in China and WHO. Mean work day noise was significantly louder than weekend time, there was a significant difference in work days and weekend (t=16.85;P=0.000).There was a statistical difference between the day time and night time shifts (t=34.67;P=0.000). The isolation rooms were significantly quieter than the open-bay rooms(t=46.15; p=0.00), sound levels in the occupied and unoccupied rooms also had significant difference(t=17.26; P=0.000).Two types of noise resources, including twenty kinds sources were identified and measured, mean noise levels ranged from of 61.33 to 79.21 dB(A). This study shows noise levels in intensive care units were exceeded the recommended. The study of the influence of noise on patient and staff is needed, and noise reduction strategies must be conduct in ICU.

Myelolipoma is a benign, typically inert neoplasm of uncertain aetiology that is rarely reported in cats. Although commonly asymptomatic, in some cases, myelolipomas can cause abdominal discomfort or present with rupture and haemorrhage. Here, we describe a rare case of a splenic myelolipoma in a Domestic Long Hair cat in which, after extensive diagnostic investigations, clinical signs of hyporexia and weight loss were attributable to the presence of an intra-abdominal mass. The patient was treated by splenectomy and unexpectedly died during the post-operative period. Although splenectomy appears to be a sensible intervention in symptomatic patients, the optimal management of splenic myelolipomas in cats remains unknown. The risk-benefit ratio of surgical management needs to be carefully considered, and therapeutic intervention should be tailored individually to each patient.

β-apopicropodophyllin (APP), a derivative of podophyllotoxin (PPT), has been identified as a potential anti-cancer drug. This study tested whether APP acts as an an-ti-cancer drug and can sensitize colorectal cancer (CRC) cells to radiation treatment. APP had an anti-cancer effect against the CRC cell lines HCT116, and DLD-1, SW480 and COLO320DM with IC50 values of 7.88 nM, and 8.22 nM, 9.84 nM and 7.757 nM, respec-tively induction of DNA damage. Colonogenic and cell counting assays indicated that the combined treatment of APP and γ-ionizing radiation (IR) showed greater retardation of cell growth than either alone, suggesting that APP sensitizes CRC cells to IR. Annexin V-propidium iodide (PI) assays and immunoblot analysis showed that the combined treatment of APP and IR increased apoptosis in CRC cells compared with either APP or IR alone. Results obtained from the xenograft experiments also indicated that the combination of APP and IR enhanced apoptosis in in vivo animal model. Apoptosis induction by the combined treatment of APP and IR resulted from reactive oxygen species (ROS). Inhibition of ROS by N-acetylcysteine (NAC) restored cell viability and decreased the induction of apoptosis by APP and IR in CRC cells. Taken together, these results indicate that a combined treatment of APP and IR might promote apoptosis by inducing ROS in CRC cells.

Power system decentralization has been an emerging topic for the past decade in an effort to improve power quality and environment protection via increased integration of renewable energy sources. Towards these objectives, decentralized microgrids have been proposed and thoroughly investigated in terms of technical capabilities and economic performance. In fact, the planning and actual operation of small-scale, decentralized microgrids has started in countries such as Canada, Japan, USA, UK and other countries. It is expected that the research in this area will progress and eventually take over the existing paradigm of large-scale power generation in the future. These small-size decentralized microgrids could be connected with nearby microgrids under normal operating conditions, but under special events, such as natural or man-made disasters, they would be disconnected and run in islanded mode. Under such high impact – low probability events, the microgrid must have resiliency to successfully re-connect with other microgrids and the main grid. In this paper, an Energy Management System (EMS) for a microgrid having a resiliency function, allowing to operate under islanded mode after an accident, is proposed. The proposed tool, called Resilient Energy Management System (ResEMS), aims at procuring reserve power into the microgrid’s Battery Energy Storage System (BESS) effectively, by importing it from the nearby connected power system. The accident is assumed to be a predictable natural disaster, which means that the accident occurrence time, duration and level of damage can be estimated. The proposed ResEMS has been applied to a microgrid comprising of a BESS, a diesel generator and several photovoltaic devices. The simulation results verify its beneficial operation.

Affordable Housing, the basic human necessity has now become a critical problem in global cities with direct impacts on people's well-being. While a well-functioning housing market may augment the economic efficiency and productivity of a city, it may trigger housing affordability issues leading crucial economic and political crises side by side if not handled properly. In global cities e.g. Singapore and Hong Kong where affordable housing for all has become one of the greatest concerns of the Government, this issue can be tackled capably by the provision of public housing. In Singapore, nearly 90% of the total population lives in public housing including public rental and subsidized ownership, whereas the figure tally only about 45% in Hong Kong. Hence this study is an effort to scrutinizing the key drivers of success in affordable public housing through following a qualitative case study based research methodological approach to present successful experience and insight from different socio-economic and geo-political context. As a major intervention, this research has clinched that, housing affordability should be backed up by demand-side policies aiming to help occupants and proprietors to grow financial capacity e.g. subsidized rental and subsidized ownership can be an integral part of the public housing system to improve housing affordability.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

This paper proposes two max-pooling engines, named the RTB-MAXP engine and the CMB-MAXP engine, with a scalable window size parameter for FPGA-based convolutional neural network (CNN) implementation. The max-pooling operation for the CNN can be decomposed into two stages, i.e., a horizontal axis max-pooling operation and a vertical axis max-pooling operation. These two one-dimensional max-pooling operations are performed by tracking the rank of the values within the window in the RTB-MAXP engine and cascading the maximum operations of the values in CMB-MAXP engine. Both the RBM-MAXP engine and the CMB-MAXP engine were implemented using VHSIC Hardware Description Language (VHDL) and verified by simulations. They have been employed for and tested in our CNN accelerator targeting at the CNN model YOLOv4-CSP-S-Leaky for object detection.

In this paper, the sol−gel method was used to synthesize powders of LaMnO3 (LMO), La0.85Ca0.15MnO3 (LCM), and La0.85Sr0.15MnO3 (LSM). We investigated the impact of substituting Ca and Sr at the A−site on the perovskite crystal structure and electrochemical capabilities of LMO. LCM retained its orthogonal structure in comparison to the parent LMO components, whereas LSM transitioned to a rhombic structure. At 0.5 A/g, the specific capacitance of LCM and LSM electrodes is 185.5 F/g and 248 F/g, respectively.The specific capacitance of LCM was more three times than that of the LMO electrode. Among the three samples (LMO, 22.25 m2 g−1; LSM, 31.56 m2 g−1), the LCM sample exhibited the highest specific surface area of 38.79 m2 g−1. The charge transfer resistances of the LMO, LCM, and LSM are 0.48 Ω, 0.36 Ω, and 0.38 Ω, correspondingly. The LCM electrode exhibits the greatest capacitance performance due to its more refined morphology, increased concentration of oxygen vacancy, and more complete utilization of the perovskite bulk structure. The above results demonstrate that Ca or Sr substitution of A−site compounds has great potential for supercapacitor applications.

Wheat, a component of the staple diet globally, is a common food allergen in children. The symptoms of wheat allergy (WA) range from skin rash to shortness of breath, significantly impairing quality of life. Following initial clinical suspicion, individuals may undergo wheat allergen-specific skin prick test (SPT), blood test for serum immunoglobulin E (sIgE) levels or oral food challenge. Conventional management of WA lies in wheat avoidance, yet accidental consumption may be inevitable owing to the ubiquity of wheat in various food products. This article aims to provide an overview of the immunologic pathway of WA, followed by its novel diagnostic methods, namely alcohol-soluble SPT extracts, component-resolved diagnosis and basophil activation test (BAT). The mechanisms underlying wheat allergen-specific oral immunotherapy (OIT) as well as a summary of the efficacy, tolerability and safety of related clinical trials will then be discussed.

.With the increasing use of carbon fiber reinforced plastics in various area, carbon fiber composites based on prepregs have attracted attention in industries and academia research. However, prepreg manufacturing processes are costly, and the strength of structures varies depending on the orientation and defects (pores and delamination). For non-contact evaluation of internal defects, we proposed lock-in infrared thermography to investigate orientation angles after a compression test. We also conducted a drop-weight impact test to study the behaviour of the composites after impact according the fibers orientation for composite fabricated using unidirectional carbon fiber prepregs. Using CAI tests, we determined the residual compressive strength and confirmed the damage modes using a thermal camera. The results of the drop weight impact tests show that the specimen laminated at 0° suffered the largest damage because of susceptibility of the resin to impact. In contrast, the specimens oriented in of 0°/90° and +45°/–45° directions transferred more than 90% of the impact energy back to the impactor because of the lamination of fibers in the orthogonal directions. Furthermore, the specimens that underwent complete damage in the impact tests were subjected to the lock-in method and showed internal delamination and cut fibers. With the finite elements analysis, the damage of each ply could be observed. Moreover, the temperature differences in the residual compression tests were not significant.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Coaches are vital stakeholders in sports development and player/team performances. However, how they perform as coaches is significantly anchored on their relationship with players as the coach-player relationship influences coach’s roles and responsibilities. This study aimed to establish an understanding of how coaching behavior positively influences job satisfaction in Hong Kong. This study sought to achieve the following objectives; to investigate coaching traits for coaching different sports, explore the factors contributing to a coaching behavior, identify effects of coaching behavior on job satisfaction, and describe how coaching behaviors influence the way coaches react to player behavior and competitions. The study used a quantitative research approach to collect and analyze data. A closed-ended questionnaire was used. Both descriptive and inferential statistics were used to analyze data. The main finding of this study is that career commitment positively influences coaches’ job satisfaction; however, their coaching behavior plays a substantial mediating role. This implies that coaches with high career commitment are positively satisfied with coaching when they focus on coaching behavior factors such as effective communication to have their players perform and achieve common goals.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

As the smallest member of the fullerene family, C20 is yet to be discovered in planetary nebulae. In this work, we present a quantum chemical study via density functional theory (DFT) on the ionization tolerance of this molecule in the space environment. Considering that the ionization and excitation phenomena play key roles in alerting the lifetime of a molecule, we examined both ground and excited electronic states potential energy surfaces (PES) of C20 and its cations C20q+. Our theoretical results indicate that the C20 cage tolerates a positive charge as high as 13+ via characterizing local minimum geometries on both mentioned electronic states. We also explored theoretically and systematically, scenarios in which the electronic structure of neutral C20 is excited to very high spin multiplicity (beyond triplet state) and local minimum molecular geometries with cage structure are well characterized. We anticipate that such structural resistance to excitation and ionization deliver a prolonged lifetime necessary for the spectroscopic detection of this interesting molecule and its cations in space and potentially in planetary nebulea (PN).

In order to cope with the challenges of physical and psychological aging in the indigenous people in Taiwan, most of the tribes in Taiwan set up cultural health stations for indigenous elderly. These community care facilities have practiced many health promotion activities, such as the reminiscence, life review, and arts activity. However, there was little exploration into the benefit of indigenous people’s practice the life review activity in Taiwan—the gap this study aimed to fill. This study adopts life review therapy through a set of innovative life review activity designs in indigenous older adults, including activity planning, and indigenous cultural elements. A qualitative study design using semi-structured interviews was used to obtain data from a purposive sample. Ten participants who assessed to the cultural health stations services and participated in the life review activities of the indigenous older adults in southern Taiwan were interviewed individually. The data were analyzed using Graneheim and Lundman’s qualitative content analysis. The theme—“experiences and benefits of participating”—and two categories with six subcategories emerged. The results demonstrated that the participation of the indigenous elderly in life review activities with cultural elements had obvious benefits for their mental health. Life review therapy can be incorporated as a supplementary LTC treatment for the indigenous people, thereby, promoting the positive emotions of the indigenous elderly.

In tire tread applications, achieving enhanced abrasion resistance, wet grip, and rolling resistance is crucial for optimizing overall performance. To realize improvements in these attributes for silica-filled tire tread compound, it becomes imperative to improve dispersity of silica filler with investigating the effect of each component in tire tread compound. In this work, we study the effect of styrene content within solution styrene butadiene rubber (SSBR) on the properties of tire tread compounds. A higher styrene segment within SSBR contributes to increased silica dispersion and crosslink density. Thus, tire tread compounds featuring SSBR with increased styrene content not only improve physical and mechanical properties but also enhance major characteristics tailored for tire tread applications. These findings provide valuable insights into advancing the reinforced performance of tire tread compounds through the strategic utilization of SSBR enriched in styrene content.

This review article delves into the multifaceted nature of primary ovarian insufficiency (POI), a condition marked by diminished ovarian function before age 40, underscoring the complexity of its aetiology encompassing genetic, autoimmune, infectious, and environmental factors. A significant focus is placed on the potential role of single-gene mutations, such as those in FMR1, BMP15, and GDF9, in the pathogenesis of POI, highlighting the intricate interplay between genetics and ovarian health. The article also explores innovative therapeutic avenues, including the activation of dormant follicles in vitro, offering hope for fertility restoration in affected individuals. Despite the prevalence of traditional treatments, such as Chinese medicine and hormone therapy, in China, these approaches often need to meet therapeutic needs, underscoring the urgency for advanced research and tailored treatment strategies. The discovery of a pituitary tumour-associated POI case further complicates the diagnostic landscape, suggesting a broader diagnostic lens and more in-depth research to unravel the complex underpinnings of POI and enhance patient care.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

Hong Kong was under strike from Super Typhoon Saola (2309), necessitating the issuance of the highest tropical cyclone warning signal. Saola skirted past the south-southwest of Hong Kong, bringing hurricane force winds and significant storm surge. Saola had its closest approach to Hong Kong on 1 September 2023, posing a unique challenge in forecasting and early warning for the commencement date of the new school term, where higher impact to traffic and public safety was anticipated. This paper covers the challenges on the forecasting aspect of the super typhoon. The predicted tropical cyclone track, intensity and wind structure are reviewed. Experience in this case showed that while there was not a perfect numerical weather prediction model in terms of the forecast track, intensity and wind structure of Saola, multi-model approach provided very use-ful and crucial information for operational weather warning services.

75.6% of land comprising Hong Kong remains undeveloped according to the special administrative region’s planning department. In turn, Hong Kong’s constricted real estate, now estimated to be the world’s costliest, has created eye-popping living arrangements historically and contemporarily. Denizens’ colorful reputation and imagination for flouting city ordinances, zoning laws, and spatial management stand emblematic of tenacious self-sufficiency and a free-spirited brand of runaway capitalist initiative. Why is this conspicuous trademark of Hong Kong’s societal fabric very much alive in the 21st Century? Why does this matter in a rapidly urbanizing world witnessing the ascension of mega-urban centers alongside ever-widening socioeconomic chasms? This paper intends to illuminate the peculiar origins and longevity of the Kowloon Walled City, an urban monolith of notoriety and autonomy that blossomed in a semi-legal grey zone unencumbered under British protectorate rule for nearly a century. Parallels will connect the linear trajectory between Kowloon’s hardnosed living to today’s comparable Chungking Mansions and the hundreds of thousands of cage homes appearing in all corners of the city. This paper aims to answer why these residential paradoxes continue to function with efficiency and relevancy, posing solutions for indigent housing while exacerbating the stigma of social and economic ostracism.

Objectives: 1) To describe the cardiovascular health of the construction workers in Hong Kong, 2) to examine the demographic differences in cardiovascular health, and 3) to examine the association between modifiable lifestyle behaviors and cardiovascular conditions. Methods: 626 registered construction workers were included in the analysis. Blood chemistry, blood pressure, weight and height were measured. Face-to-face questionnaire interview was conducted. T-tests and One-way ANOVAs were used to compare the cardiovascular health score, cardiovascular outcomes, and lifestyle behaviors by demographic characteristics. Logistic regressions were performed to assess the cardiovascular outcomes by lifestyle behaviors. Results: Two-thirds of the construction workers failed to achieve three out of the seven “ideal” cardiovascular health indicators. The younger, more educated, and female subjects had better cardiovascular health scores than their counterparts. The ideal fish and seafood consumption was associated with 1) ideal weight status and 2) ideal cholesterol level, whereas less soft drink consumption was associated with ideal cholesterol level. Conclusions: The findings highlighted the importance of promoting cardiovascular health in the construction industry. This study provided insights for future interventions, which should include increasing fish and seafood intake, decreasing soft drink consumption, and enhancing the health literacy amongst older, less educated, and male construction workers.

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

A special vibration damper is proposed for material property identification through a scratching process on a vibrating object. This paper presents the design and working principle of a scratching damper based on a scratch test device. A non-contact electromagnetic shaker is used to generate the shaking force for the vibration of the tested object. The required pressure on the scratched material during the scratching process is generated by a compression spring and adjusted by changing the amount of compression of the spring. The proposed damper is designed and tested on extruded aluminum samples for the determination of its Young’s modulus and hardness and validated by using the standard test instruments. Observations of physical dimensions of the scratching tracks are determined by microscope and were utilized to compute the scratching energy factor. Load curves are obtained at different pressure of the scratching process. The hysteresis loop energy during the scratching process of the tested object is measured and used for the determination of material properties of the object. Furthermore, energy conservation law, scratch energy release rate and loop energy release rate are used to determine the Young’s modulus and hardness of the sample. The measurement accuracy of the modulus and hardness of the tested sample is evaluated. The proposed method of material testing has several advantages over the traditional methods such as low cost and high repeatability, and may be used as an alternative to the standard modulus and hardness testers.

Background: Capmatinib and savolitinib, selective MET inhibitors, are widely used to treat various MET-positive cancers. In this study, we aimed to determine the effects of these inhibitors on MET-amplified gastric cancer (GC) cells. Methods: After screening 37 GC cell lines, the following cell lines were found to be MET-positive with copy number variation &gt; 10: SNU-620, ESO51, MKN-45, SNU-5, and OE33 cell lines. Nest, we assessed the cytotoxic response of these cell lines to capmatinib or savolitinib alone using cell counting kit-8 and clonogenic cell survival assays. Western blotting was performed to assess the effects of capmatinib and savolitinib on the MET signaling pathway. Xenograft studies were performed to evaluate the in vivo therapeutic efficacy of savolitinib in MKN-45 cells. Results: Savolitinib and capmatinib exerted anti-proliferative effects on MET-amplified GC cell lines in a dose-dependent manner. Savolitinib inhibited the phosphorylation of MET and downstream signaling pathways, such as the protein kinase B (AKT) and extracellular signal-regulated kinase (ERK) pathways, in MET-amplified GC cells. Additionally, savolitinib significantly decreased the number of colonies formed on the soft agar and exerted dose-dependent anti-tumor effects in a MKN-45 GC cell xenograft model. Furthermore, combination of trastuzumab and capmatinib exhibited enhanced inhibition of AKT and ERK activation in human epidermal growth factor receptor-2 (HER2)- and MET-positive OE-33 cells. Conclusions: Therefore, targeting MET with savolitinib and capmatinib efficiently suppressed the growth of MET-amplified GC cells. Moreover, these MET inhibitors exerted synergistic effects with trastuzumab on HER2- and MET-amplified GC cells.

Chemical investigation of the Chinese soft coral Lobophytum sp. has resulted in the isolation of six new compounds, namely lobosteroids A–F (1–6), along with four known compounds. Their structures were determined by extensive spectroscopic analysis and comparison with the spectral data reported in the literature. Among them, the absolute configuration of 1 was determined by X-ray diffraction analysis. These steroids characterized by either the presence of an α,β-αꞌ,βꞌ-unsaturated carbonyl or an α,β-unsaturated carbonyl moiety in ring A, or the existence of a 5α,8α-epidioxy system in ring B, as well as diverse oxidation sites of side chains. The prelimi-nary antibacterial bioassay showed all compounds exhibited significant antibacterial activities against the fish pathogenic bacteria Streptococcus parauberis FP KSP28 and Phoyobacterium damselae FP2244 with all inhibition rates more than 90% at the concentration of 150 µM. And at the same concentration, compounds 2, 6–10 also displayed potent inhibitory effects against vancomy-cin-resistant Enterococcus faecium bacteria G7 with all inhibition rates more than 90%.

Surface-enhanced Raman spectroscopy (SERS) is commonly used for super-selective analysis through nanostructured silver layers in the environment, food quality, biomedicine, and materials science. To fabricate a high-sensitivity but more accessible device of SERS, dc magnetron sputtering technology was used to realize high sensitivity, low cost, stable deposition rate, and rapid mass production. This study investigated various thicknesses of a silver film ranging from 3.0 to 12.1 nm by field-emission-scanning-electron microscope, X-ray diffraction, and X-ray photoelectron spectroscopy. In the rhodamine 6G (R6G) testing irradiated by a He-Ne laser beam, the analytical enhancement factor (AEF) of 9.35x108, the limit of detection (LOD) of 10-8 M, and the relative standard deviation (RSD) of 1.61% were better than other SERS substrates fabricated by the same dc sputtering process because the results show that the 6 nm thickness silver layer has the highest sensitivity, stability, and lifetime. The paraquat and acetylcholine analytes were further investigated and high sensitivity was also achievable. The proposed SERS samples were evaluated and stored in a low humidity environment for up to forty weeks, and no spectrum attenuation could be detected. Soon, the proposed technology to fabricate high sensitivity, repeatability, and robust SERS substrate will be an optimized process technology in multiple applications.

This work presents emission line flux and kinematic structure mapping based on IFU data of the planetary nebulae Abell 30 (A30). The IFU has a field of view (FoV) of 16" x 12.3" and was used to partially cover knots J1 and J2, and completely cover knots J3 and J4 of A30. Our emission line flux map shows recombination species C II, C III, He I, O II as well as forbidden line species [O III], [Ne III] and [Ne IV] of high excitation level are all distributed in different parts of the knots. The kinematic structure shows considerable variation in both the velocities and spatial locations of these knots with positive and negative velocity excursions from the systematic value. Forbidden line species [O III], [Ne III] are distributed in both knots J3 and J4 but they are travelling at different speeds in opposite directions. Despite variation in distribution of the species, the velocities of [Ne IV] and [O III] are similar and travelling in the same direction while the other species [Ne III], He I, and O II share similar velocity of 200kms−1 up in the opposite direction. The complexity of distribution and kinematic structure of the knots revealed in this work indicates a strong tendency towards the hypothesis of multiple triggering events in the past history of A30.

One characteristic of mammalian species is their capacity to produce and secrete milk from their mammary glands to feed and provide vital nutrients for the growth of their offspring. Even though mammary glands provide the same function in different species, their development, shape, and structure can vary according to their reproductive and ecological adaptations. Reproduction studies are important for cetacean conservation because they provide essential information to assess the dynamics of populations and species, particularly in relation to the management of animals under human care. A vast majority of literature on the female cetacean reproductive anatomy and physiology has focused on the ovaries, which can be used to infer life history characteristics, or genital diseases and anomalies. However, literature regarding the morphology, physiology, and developmental pattern of their mammary glands is scarce, with few anatomical and histological descriptions in species such as baleen whales; and more recently it has been assessed with the use of ultrasound in finless porpoises (Neophocaena asiaeorientalis). The aim of this review is to describe the current diagnostic tools applied in human and veterinary medicine to assess the mammary glands and how marine mammal medicine could benefit from these tools to evaluate the mammary glands in free-ranging and captive cetaceans. With the use of imaging techniques such as B-mode ultrasound, non-invasive studies could be performed to assess the mammary tissues, as what has been done to characterize the morphology of other organs in cetaceans, such as the reproductive tract of Indo-Pacific bottlenose dolphins under human care. By understanding and revising the current diagnostic tools to assess the mammary gland of humans and domestic animals, such as ultrasonography, it might be possible to determine which techniques could be applied by marine mammal veterinarians to enhance the evaluation of the cetacean mammary gland morphology and physiology.

Background: Most prevalence surveys on nocturia have focused on older populations. This study aimed to measure the nocturia prevalence across the full spectrum of male adults living in Hong Kong, where severity and associated quality-of-life (QoL) were also explored. Methods: A cross-sectional population-based survey was conducted in men aged 18 or above using the ICIQ-NQoL Questionnaire. Results: With 1,239 respondents at age ranged 18-99, the overall nocturia prevalence were found to be 63.0% (ranged 41.6-84.6% at different age groups) and 31.2% (ranged 13.0-56.3% at different age groups), for ≥1 and ≥2 bedtime voiding episodes, respectively. The chance of nocturia was dramatically increased at age 60 or above while both prevalence and voiding frequency were increased with advancing age. About 83% of the nocturia men experienced 1-2 voiding episodes per night, but many of them had self-rated their QoL poor or very poor and indicated moderate-to-high bothersome. Younger men at age 18-39 were found to have high prevalence as 41.6% and almost 30% of them rated poor or very poor QoL. Conclusions: Nocturia was not only affecting the older populations but also caused significant bothersome and negative impacts on QoL in younger males.

In this study, the impact of the addition of high-aspect-ratio nano-ettringite to photocurable epoxy acrylate resin was explored, with a specific focus on the changes observed in viscosity, shrinkage, tensile strength, and elongation at the break of composites formed. Herein, the nano-ettringite samples were modified using KH-570. The 3 wt% or 6 wt% KH-570-modified and unmodified nano-ettringite were dispersed into the resin by ultrasonic treatment in conjunction with mechanical stirring. The grafting effects of nano-ettringite onto KH-570 were analyzed through scanning electron microscopy (SEM), X-ray diffraction (XRD), thermogravimetric (TG) analysis, and Fourier transform infrared spectroscopy (FTIR). The results demonstrate that increased dosages of unmodified and modified nano-ettringite led to increased viscosity of the composite while reducing shrinkage. At the same dosage, the photocurable resin with modified nano-ettringite demonstrated a lower shrinkage and a higher tensile strength. Notably, when the amount of modified nano-ettringite was 3 wt%, the highest tensile strength of the composite was 64.61 MPa, presenting a 72.57% increase compared to the blank sample. Furthermore, the incorporation of modified nano-ettringite as a filler provides a new perspective for improving the performance of photocurable epoxy acrylate resin composites.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The management of vision-threatening retinal diseases remains challenging due to the lack of an effective drug delivery system. Encapsulated cell therapy (ECT) offers a promising approach for the continuous delivery of therapeutic agents without the need for immunosuppressants. In this context, an injectable and terminable collagen-alginate composite (CAC) ECT gel, designed with a Tet-on pro-caspase-8 system, was developed as a safe intraocular drug delivery platform for the sustained release of glial cell line-derived neurotrophic factor (GDNF) to treat retinal degenerative diseases (RDDs). This study examined the potential clinical application of the CAC ECT gel, focusing on its safety, performance, and termination through doxycycline (Dox) administration in the eyes of healthy New Zealand White rabbits, as well as its therapeutic efficacy in rabbits with sodium iodate (SI)-induced retinal degeneration. The findings indicated that CAC ECT gel can be safely implanted without harming the retina or lens, displaying resistance to degradation, facilitating cell attachment, and secreting bioactive GDNF. Furthermore, the GDNF levels could be modulated by the number of implants. Moreover, Dox administration was effective in terminating gel function without causing retinal damage. Notably, rabbits with retinal degeneration treated with the gels exhibited significant functional recovery in both a-wave and b-wave amplitudes and showed remarkable efficacy in reducing photoreceptor apoptosis. Given its biocompatibility, mechanical stability, controlled drug release, terminability, and therapeutic effectiveness, our CAC ECT gel presents a promising therapeutic strategy for various retinal diseases in a clinical setting, eliminating the need for immunosuppressants.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

Background: This study aimed to investigate the impact of the COVID-19 pandemic on breast reconstruction trends in the United States, focusing on implant-based and autologous techniques, as well as the timing of reconstruction (immediate vs. delayed). Methods: A retrospective analysis of data from the American Society of Plastic Surgeons' National Plastic Surgery Statistics from 2015 to 2022 was conducted. Annual trends in breast reconstruction procedures were analyzed, comparing the pre-pandemic (2015-2019) and pandemic (2020-2022) periods. Results: The total number of breast reconstructions increased from 106,338 in 2015 to 151,641 in 2022. The proportion of implant-based reconstructions decreased from 81.41% pre-pandemic to 76.51% during the pandemic (p < 0.001), with a notable rise in direct-to-implant procedures from 10.37% to 19.12% (p < 0.001). Autologous reconstructions increased from 18.59% to 23.49% (p < 0.001). Among autologous techniques, DIEP flaps remained the most popular. Immediate reconstruction rates increased from 72.61% pre-pandemic to 75.57% during the pandemic, while delayed recon-struction rates decreased from 27.39% to 24.43% (p < 0.001). Conclusions: The COVID-19 pandemic has significantly influenced breast reconstruction trends in the United States, with a shift towards autologous techniques, particularly DIEP flaps, and an in-crease in immediate reconstructions. These changes may reflect adaptations in surgical practice and decision-making processes in response to the unique challenges posed by the pandemic. Further research is needed to assess the long-term outcomes and patient satisfaction associated with these trends.

Applied talent is not only a builder of human civilization but also a promoter of economic development. They not only need systematic and solid engineering theoretical knowledge but also rich engineering practical experience. Applied undergraduate colleges are the cradle for cultivating applied talent and shoulder the important mission of cultivating various types of applied talent for society. With the rapid development of higher education, the number of applied undergraduate institutions has sharply increased, but the quality of applied talent cultivated by them has shown a significant decline, which greatly restricts the pace of industrial development in the world. This article proposes a new concept of promoting the "three certificates" (graduation certificate, degree certificate, and skill certificate) education model in applied undergraduate colleges, which is of great significance for the country to cultivate composite talents with the ability of "product design, production management, and product processing" at the same time.

The incidence of human papillomavirus (HPV)-associated oropharyngeal squamous cell carcinoma (OPSCC) is rising in the West, but little is known in Asia. This study elucidated changes in the incidence and HPV-positive portion of OPSCC in Hong Kong. Data from population-based cancer registry were used to analyze the incidence of OPSCC in associate with other head and neck cancers. Archived tumour tissues were tested for HPV. From 1986 to 2020, there was a marked decrease in the incidence of nasopharyngeal and laryngeal cancers, but a persistent increase in OPSCC from 36 cases in 1986 to 116 cases in 2020. The average positive rate for high-risk HPV was 36.1% (112/310) among OPSCC diagnosed in 2010-2020. The HPV positive rate in recent years was significantly higher than earlier cases (tonsil SCC: 64.7% (55/85) in 2016-2020 vs. 40.4% (19/47) in 2010-2015, P = 0.007). Patients with HPV-positive tonsil cancers were significantly younger than those negative (mean [SD]: 58.9 [9.9] vs. 64.3 [13.3] years, P = 0.006), but no significant difference between genders. A persistent increase in the incidence of oropharyngeal cancer over the last few decades was observed in Hong Kong, which can be explained by the remarkable increase in HPV-positive tonsil cancers.

Depression is one of the most prevalent mental disorders worldwide. This study examined the effect of a spiritual connectivity intervention on individuals with depression in a randomized waitlist control trial. Fifty-seven participants with mild or moderate depressive symptoms were randomly assigned to either the intervention group (n=28) or the waitlist control group (n=29). The intervention comprised eight weekly sessions focusing on divine connection, forgiveness and freedom, suffering and transcendence, hope, gratitude, and relapse prevention. The outcome measures included depressive symptoms, anxiety, hope, meaning in life, self-esteem, and social support. Participants completed self-administered questionnaires at baseline (week 0), post-intervention (week 8), and at a 3-month follow-up (week 20). Repeated-measures ANOVA and one-way ANCOVA were used to compare the within-group and between-group differences in the changes in outcome variables. Participants in the intervention group showed significant improvements in depression, anxiety, spiritual experience, hope, self-esteem, and perceived social support after the intervention. Effect size statistics showed small to large differences (Cohen’s d, 0.308 to -1.452). Moreover, 85.71% of participants in the intervention group also experienced clinically significant reductions in PHQ-9 scores from baseline to immediate post-intervention. This study highlights the effectiveness of a low-cost, accessible intervention suitable for community implementation by clergy and faith-based organizations.

Liquid biopsy, a non-invasive diagnosis that examines circulating tumor components in body fluids, is increasingly used in cancer management. An overview of relevant literature emphasizes the current state of liquid biopsy applications in cancer care. Liquid biopsy, particularly circulating tumor DNA (ctDNA), circulating tumor RNAs (ctRNA), circulating tumor cells (CTCs), extracellular vesicles, and other cell-free nucleic acids, offers promising opportunities for early cancer diagnosis, treatment selection, monitoring, and disease assessment. The implementation of liquid biopsy in precision medicine has shown significant potential in various cancer types, including lung cancer, colorectal cancer, breast cancer, and prostate cancer. Advances in genomic and molecular technologies, such as next generation sequencing (NGS) and digital polymerase chain reaction (dPCR) have expanded the utility of liquid biopsy, enabling the detection of somatic variants and actionable genomic alterations in tumors. Liquid biopsy has also demonstrated utility in predicting treatment responses, monitoring minimal residual disease (MRD), and assessing tumor heterogeneity. Nevertheless, standardizing liquid biopsy techniques, interpreting results, and integrating them into clinical routine remain challenges. Despite these challenges, liquid biopsy has significant clinical implications in cancer management, offering a dynamic and non-invasive approach to understanding tumor biology and guiding personalized treatment strategies.

Under the new pattern of “double carbon” development, good ESG performance is the best way to promote the sustainable development of enterprises, and the ESG investment strategies are directly affected by the strategic vision of managers. Based on the upper echelons theory and stakeholder theory, this paper takes Chinese A-share listed companies from 2011 to 2022 as samples to empirically analyze the impact of managerial myopia on corporate ESG performance. The results show that managerial myopia significantly inhibits corporate ESG performance, mainly by inhibiting corporate green investment and green innovation sustainability. Furthermore, for state-owned enterprises (SOE), heavy polluting enterprises (HPE) and non-high-tech enterprises, the inhibitory effect of manager myopia on ESG performance is stronger. When the enterprise is in the growth stage, the above inhibition effect is more severe. For external governance, the greater the analyst attention and public environmental attention are, the more conducive they are to alleviating the restraining effect of managerial myopia on enterprise ESG performance. Therefore, effectively improving the time cognition level of managers and strengthening external supervision have become important measures for comprehensively optimizing the ESG performance.

Diseases pose a significant and pressing concern for the sustainable development of the aquaculture sector, particularly as their impact continues to grow due to climatic shifts such as rising water temperatures. While various approaches, ranging from biosecurity measures to vaccines, have been devised to combat infectious diseases, their efficacy is disease- and species-specific and contingent upon a multitude of factors. The field of genetics and genomics offer effective tools to control and prevent disease outbreaks in aquatic animal species. In this study, we present the key findings from our recent research, focusing on the genetic resistance to three specific diseases: White Spot Syndrome Virus WSSV) in white shrimp, Bacterial Necrotic Pancreatitis (BNP) in striped catfish and skin fluke (a parasitic ailment) in yellowtail kingfish. Our investigations reveal that all three species possess substantial heritable genetic components for disease resistant traits, indicating their potential responsiveness to artificial selection in genetic improvement programs tailored to combat these diseases. Also, we observed a high genetic association between disease traits and survival rates. Through selective breeding aimed at enhancing resistance to these pathogens, we achieved substantial genetic gains, averaging 10% per generation. These selection programs also contributed positively to the overall production performance and productivity of these species. Although the effects of selection on immunological traits or immune responses were not significant in white shrimp, they yielded favourable results in striped catfish. Furthermore, our genomic analyses, including shallow genome sequencing of pedigreed populations, enriched our understanding of the genomic architecture underlying disease resistance traits. These traits are primarily governed by a polygenic nature, with numerous genes or genetic variants, each with small effects. Leveraging a range of advanced statistical methods, from mixed models to machine and deep learning, we developed prediction models that demonstrated moderate to high levels of accuracy in forecasting these disease-related traits. In addition to genomics, our RNA-seq experiments identified several genes that undergo upregulation in response to infection or viral loads within the populations. Preliminary microbiome data, while offering limited predictive accuracy for disease traits in one of our studied species, underscore the potential for combining such data with genome sequence information to enhance predictive power for disease traits in our populations. Lastly, this paper briefly discusses the roles of precision agriculture systems, AI algorithms, and outlines the path for future research to expedite the development of disease-resistant genetic lines tailored to our target species. In conclusion, our study underscores the critical role of genetics and genomics in fortifying the aquaculture sector against the threats posed by diseases, paving the way for more sustainable and resilient aquaculture development.

This study investigates the relationship between housing prices and vacancy rates in Hong Kong, offering insights distinct from previous cross-sectional analyses. Addressing limitations in data availability and methodological approaches, the study examines annual data spanning multiple housing size categories to uncover nuanced dynamics in the housing market. Two major contributions emerge: firstly, the analysis reveals the price elasticity of vacancy, elucidating how housing prices respond to changes in vacancy rates over time. Secondly, by considering housing vacancy changes as outcomes of the interactions between supply and demand, the study challenges the conventional independence assumption between these variables. The results support the hypothesis that housing vacancies exert a negative impact on housing prices, holding other factors constant. These findings have significant implications for policymakers, urban planners, and real estate investors, providing valuable insights for crafting targeted interventions and informing investment decisions.

This study aims at the sustainable valorization of eggshells (ES) from different countries of origin in cement concrete as a cement replacement for Hong Kong. For this purpose, sixteen different eggs from different regions across the world were selected from the local market. Firstly, the extent of uniformity in the weight and mineral content of sampled eggshells were assessed by a specific gravity test and thermogravimetric analysis (TGA), respectively. It was found that specific gravity varies between 2.02 and 2.39, with an average value of 2.20 ± 0.01, whereas CaCO₃ varies between 94.65% and 97.23%, with an average value of 96.33%. These values were a bit lower than those of extra-pure limestone (LS) because of the organic part and the porous structure of eggshells. Secondly, three different eggshells were selected for cement replacement in cement concrete, both in the uncalcined and calcined states, based on having the highest, medium, and lowest CaCO₃ content, respectively. To get the calcined eggshells, the eggshells were calcined at 800^oC for three hours. It was found that the strength of eggshells varies with CaCO₃, but the variation was acceptable. The calcined eggshells showed comparatively more compressive strength and were close to the LS because of the free CaO and the absence of an organic part. In general, the variation in the basic properties of eggshells from different regions across the world is negligible and suitable to use as a cement replacement with acceptable variation in strength in Hong Kong.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

Tongqi - women married to men who have sex with men (MSM) – from rural China encountered multi stigma with their male partners, family, community, local bureaucracies, and national laws, such as the hukou system, form a complex tapestry of life. The analysis navigates through various dimensions of stigma, reflecting systematically on their mutual implications. Social structures, including class and gender, shape societal norms and behaviors. This study explores the under-researched influence of social interaction, community relationships, and macrostructural factors contributing to the enacted stigma experienced by Tongqi Data collected from 59 rural Tongqi, 11 of whom contracted human immunodeficiency virus (HIV) or acquired immunodeficiency syndrome (AIDs), reveals the significant role of extended kinship networks and macrostructural elements, such as hukou (household registration) and government officers, in shaping the stigma faced by Tongqi. The importance of village-level lineage structures and dynamics highlights how these lineage relationships, interwoven with gender practices, contribute to the enacted stigma, physical and psychological health, and well-being of Tongqi. These include mental health, post-traumatic stress, depression, functional impairment, and permanent disability. Others include reproductive health, unwanted pregnancies, sexually transmitted infections (STIs), and pregnancy complications.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Several studies have highlighted the importance and evolution of process safety leadership and culture in various industries. However, none has focused on the palm oil milling industry yet. This paper critically reviews the latest developments in the palm oil milling process and unit operations leading to process safety concerns. It also discusses the Principle of 3C that is applied to explain repeat accidents and the four-level safety culture in the palm oil milling industry. For this purpose, the author presents case studies of two key palm oil companies in Malaysia. Overall, this paper offers guidelines to leaders in the palm oil milling industry about the required process safety leadership and culture to be understood in order to improve their safety outcomes.

This paper identifies a dilemma in the relationship between R^2 and price efficiency: After comprehensively studying the R^2 change around 7 well-known corporate events, neither the traditional understanding of R^2 as price inefficiency, nor the behavioral way of R^2 as price efficiency can explain the observed R^2 change around the events. We adopt an alternative methodology to replace the standard difference-in-difference regression and directly decompose the R^2 change. We find that, due to the endogeneity of events, the changes of R^2 are over-estimated. We further propose that in the event study setting, the R^2 change may be simply the consequence of the inflow/outflow of some trend-chasing investors, and it may be detached from price (in) efficiency. Empirical evidences are consistent with this hypothesis.