The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

In terahertz communication systems, lens antennas used in transceivers are basically plano-convex dielectric lenses. As the aperture increases and the focal length decreases, the thickness and mass of the plano-convex lens increase rapidly. Through theory and simulation, we designed a Fresnel lens suitable for the terahertz band to meet the requirements of large aperture and short focal length, and simulated the performance, advantages and disadvantages of the terahertz Fresnel lens. A 300GHz terahertz wireless communication system was built to verify the gain effect of the Fresnel lens antenna. The experimental results show that the Fresnel lens can amplify the signal in the terahertz band. The theoretical gain of a 30 cm Fresnel lens is 48.83dB, while the actual measured gain is approximately 45dB.

Lactic acid (LA) is a significant byproduct in Baijiu fermentation, with both D(-)-lactic acid (D(-)-LA) and L-lactic acid (L(+)-LA) being present due to the diverse microbial metabolism involved. L(+)-LA, a key industrial raw material, is metabolizable by humans, unlike D(-)-LA. This study aims to isolate microorganisms from fermented grains that preferentially produce L(+)-LA and apply these strains to Baijiu fermentation processes. We analyzed 106 commercially available Baijiu samples, along with fermented grains, yellow water, and Baijiu samples from 10 Baijiu factories, confirming the coexistence of D(-)-LA and L(+)-LA in fermentation products. Notably, a strong correlation was found between L(+)-LA in fermented grains and L-ethyl lactate (L(+)-EL) in Baijiu. Microbial community analysis revealed that Lactobacillus and Bacillus were the dominant bacterial groups, with a succession of microbial communities throughout fermentation. Two strains, A6 and B12, identified as Bacillus licheniformis and Bacillus cereus, respectively, were isolated for their high selectivity in L(+)-LA production. Both strains demonstrated a high yield of L(+)-LA in fermentation tests. Incorporating these strains into both liquid- and solid-state fermentation systems markedly increased the proportion of L(+)-EL relative to total ethyl lactate in Baijiu. This study successfully isolated and applied L(+)-LA-producing strains to fermentation models, offering a practical strategy for increasing L(+)-LA content in Baijiu.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

Due to their independent structure, piping, and access, townhouses offer great flexibility in floor plan changes and high spatial autonomy, making them the mainstream housing type in Taiwan. This study focuses on row houses and examines 2022 completion cases in Kaohsiung City. It collects floor plans from 14 newly constructed buildings, totaling 227 units, and analyzes spatial dimensions including facade width, depth, habitable room, staircases, bathrooms, and total floor area for each case. The objective of this study is to examine the spatial layout of row houses in Kaohsiung City, with the aim of providing reference for future planning and design of such structures. The study resulted showed that 81.8% of the row houses analyzed have a total floor area per unit ranging from 136 to 192 m², a facade width between 4.1 and 6.38 meters, and a building depth from 7.67 to 12.68 meters. In addition, low negative correlation between facade width and total floor area, a high positive correlation between building depth and total floor area, and a moderate negative correlation between facade width and building depth. The spatial distribution within these houses includes 78% allocated to habitable room, 13.1% to staircases, and 8.7% to bathrooms. The total area of habitable room and bathrooms increases with the total floor area of the building. However, the total area of staircases remains almost constant as the area of habitable room increases. Furthermore, the most common location for staircase planning is the rear-right (RB) position, while the least common is the rear-left (LB) position. Among various staircase types, the C-shaped staircase has the largest average area per floor and the highest average proportion. Conversely, the I-shaped staircase has the smallest average area and the lowest average proportion. The U-shaped staircase is the most frequently planned, whereas the C-shaped staircase is the least frequently used.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

BACKGROUND: Qu-aroma is a critical quality indicator for medium-high temperature Daqu (MT-Daqu), significantly influencing the aroma profile of strong-aroma Baijiu (SAB). SAB is produced across various regions in China, each with unique environmental conditions and production techniques. These regional differences are likely to cause variations in the Qu-aroma of MT-Daqu. Despite this, comprehensive research on the variations in Qu-aroma across different regions has been lacking. This study aims to address this gap by utilizing Gas Chromatography-Olfactometry-Mass Spectrometry (GC-O-MS) and electronic nose (E-nose) technology, combined with sensory evaluation, to analyze the differences in Qu-aroma characteristics and volatile compound profiles of MT-Daqu from seven distinct production areas.RESULTS: Sensory analysis identified seven broad aroma categories and 25 specific aromas characterizing the Qu-aroma of MT-Daqu samples. Chen aroma and roasted aroma were notably more prevalent in MT-Daqu samples from Sichuan compared to those from other regions (P < 0.05), while the fermentation aroma was less prominent in Sichuan samples. In total, 123 volatile compounds were detected in MT-Daqu, with 46 classified as aroma-active compounds. Among these, 21 aroma-active compounds were identified as markers distinguishing Sichuan MT-Daqu from those produced in non-Sichuan regions, showing significant differences in their concentrations (P < 0.05). Additionally, six major aroma-active compounds-ethyl isovalerate, ethyl heptanoate, hexanal, 1-nonanal, (E)-2,4-decadienal, and 2,3-dimethyl-5-ethylpyrazine-were found to significantly contribute to the aroma differences between Sichuan and non-Sichuan MT-Daqu.CONCLUSION: This study delineates the distinct Qu-aroma characteristics of MT-Daqu from various SAB production areas and identifies the aroma-active compounds responsible for these differences. The insights gained from this research offer valuable guidance for optimizing flavor profiles in MT-Daqu production, potentially enhancing the overall quality and regional distinctiveness of the product.

This paper discovers that current variational principle and Noether theorem for different physics systems with (in)finite freedom systems have missed the double extremum processes of the general extremum functional that both is deduced by variational principle and is necessarily taken in deducing all the physics laws, but these have not been corrected for over a century since Noether's proposing her famous theorem, which result in the crisis deducing relevant mathematical laws and all physics laws. This paper discovers there is the hidden logic cycle that one assumes Euler-Lagrange equations, and then he finally deduces Euler-Lagrange equations via the equivalent relation in the whole processes in all relevant current references. This paper corrects the current key mistakes that when physics systems choose the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current articles, reviews and (text)books. The real physics should be after choosing the variational extreme values of physics systems, the general extremum functional of the physics systems needs to further choose the minimum absolute extremum zero of the general extremum functional, otherwise, the appearing processes of physics systems are still virtual processes. Using the double extremum processes of the general extremum functionals, the crisis and the hidden logic cycle in current variational principle and current Noether theorem are solved. Furthermore, the new mathematical and physical double extremum processes and their new mathematical pictures and physics for (in)finite freedom systems are discovered. This paper gives both general variational principle and general Noether theorem as well as their classical and quantum new physics, which would rewrite all relevant current different branches of science, as key tools of studying and processing them.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

This paper discovers that current canonical variational principle and canonical Noether theorem of (in)finite freedom systems for different physics systems have neglected doublet extreme value processes of the general extreme value functional that both is derived by variational principle and is necessarily be taken in deriving all ( quantum ) physics laws in phase space, but which have not been done for over one century since Noether's showing her distinguished theorem, which lead to the crisis deriving all (quantum) physics laws (necessary) in phase space. We discover there is the hidden logic cycle that people assume canonical equations, and then they finally deduce canonical equations by the equivalent relation in the whole processes in all current references. We correct the current key mistake concepts that when physics systems take the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current references. The real physics should be what after taking the physics systems' variational extreme values, the physics systems' general extremum functional needs to further take the general extremum functional's minimum absolute extremum zero, otherwise, the appearing processes of physics systems still are virtual processes. Conservation current equations and conservation currents, in phase space, of general canonical variational principle and general canonical Noether theorem are, respectively, deduced for the first time. Using the general extremum functionals' doublet extreme value processes, the hidden logic cycle and the crisis in current canonical variational principle and current canonical Noether theorem are solved. Consequently, the new mathematical pictures, classical and quantum new physics in phase space and the new mathematical and physical doublet extremum processes for (in)finite freedom systems are discovered. General canonical variational principle and general canonical Noether theorem naturally are given, which would rewrite all the different sciences in phase space, as key tools of studying and dealing with them.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

This paper gives both a general canonical quantum gravity theory and the general canonical quantum gravity theories of the Universe and general black hole, and discovers the relations reflecting symmetric properties of the standard nonlinear gravitational Lagrangian, which are not relevant to any concrete metric models. This paper concretely shows the general commutation relations of the general gravitational field operators and their zeroth, first, second and third style, respectively, of high order canonical momentum operators for the general nonlinear system of the standard gravitational Lagrangian, and then has finished all the four styles of the canonical quantization of the standard gravity.

Due to the impacts from climate change, the allocation of water resources must urgently be optimized worldwide to ensure that the needs of both water managers and farmers are balanced. In this study, manager-oriented and farmer-oriented assessment models were developed for irrigation water optimization and allocation. The distance from water sources and hydraulic head were the main factors in the manager-oriented assessment model; crop value, water demand of crops, and soil type were additional factors in the farmer-oriented assessment model. The developed assessment models were used to assess irrigation water allocation in five villages in Neimen District. Cadasters at high elevation were discovered to not be suitable for cultivation of crops because of the difficulties in constructing irrigation facilities and the loss of irrigation water during transportation. The result obtained from the manager-oriented assessment system was related to the costs involved in the construction and maintenance of irrigation facilities, which indicated that cadasters located at long distances from water sources and at high elevation are unsuitable for cultivation. By contrast, the result obtained from the farmer-oriented assessment system was related to the profits of farmers and revealed that more cadasters would be suitable for cultivation if suitable crops were chosen.

This paper gives solutions to puzzles of double Wheeler’s delayed choice experiments, a photon’s passing two paths simultaneously and wave collapse velocity measure, and shows new quantum control, new quantum oscillation and new controlling photon oscillator (that can be arranged in quantum computer and quantum network as their classical correspondences) in experiments. Furthermore, this paper obtains the measured attractive state and the new useful key technology of altering state’s evolving paths for quantum systems. We discover the reason and the technological way for the present changes the past, further show their feasible experiments of new quantum control, new quantum oscillation and new quantum oscillator. Finally, this paper achieves the collapse response time t of wave, further concretely deduces the measured collapse velocity of quantum system. In the past, the collapse velocity cannot be objectively deduced and experimentally measured.

The Yixian Formation (Lower Cretaceous) of China is famous worldwide for its fossils of early angio-sperms, but there is only one record of flower bud hitherto. A previous fossil record of flower bud just showed the appearance and lacked any internal details. Such a lacuna in knowledge of flower buds hin-ders our understanding of the evolution of flowers. Our new specimen was collected from an outcrop of the Yixian Formation (the Barremian-Aptian, Lower Cretaceous) near Dawangzhangzi, Lingyuan, Liao-ning, China. The specimen was observed and photographed using a Sony ILCE-7 digital camera and a Nikon SMZ1500 stereomicroscope, and details were observed using a TESCAN MAIA3 SEM. Our ob-servations document a fossil flower bud, Archaebuda cretaca sp. nov, from the Lower Cretaceous of China. The occurrence of two species of Archaebuda in the Yixian Formation not only confirms the ex-istence of the expected gynoecium (and possible androecium) in a flower bud, but also underscores the occurrence of typical flowers in the Early Cretaceous.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The exceptional performance advantages of the fiber optic gyroscope (FOG) position it as a dominant player in middle and high-end inertial navigation systems. To prevent the loss of sensor precision caused by algorithm design and simplify the complex modeling strategy in traditional methods. We gradually demonstrate the significant role of Convolutional Neural Network (CNN) in the navigation system based on FOG, and utilize the particle swarm optimization algorithm (PSO) to expedite the convergence of the network. The experimental results demonstrate that the initial alignment method based on deep learning is more accurate than the traditional method. The attitude angle error is reduced by 81.25%, 92.54% and 36.53% respectively. The research provides support for the future application of deep learning in optical navigation systems.

This paper uncovers that quantum uncertain principle makes the single particle with global property have no certain path, and then wave of quantum particle can simultaneously do pass the double slits. The two subwaves after passing Young’s double slits are entanglement, they may form interference of subwaves. Consequently, we find a kind of quantum probabilistic entanglements with Wheeler's delayed choice. Quantum particles such as photons, electrons, neutrons, protons etc mean that wave of the quantum particle can simultaneously do pass through Young's double slits, rather than individual quantum particle may pass through Young's double slits at the same time. When considering wave property, we cannot consider particle property (Just as in the photoelectric effect, considering the particle nature of the system, people cannot consider wave property, otherwise the photoelectric effect cannot appear). Therefore, this paper discovers that the ability of single photon to hit electrons out in photoelectric effect is complementarily equivalent to the ability of wave of the single photon to simultaneously pass through Young's double slits in wave-particle duality. Objective criteria for distinguishing classical and quantum particles are discovered and objectively give the applicable realm of quantum mechanics for the first time. The crisis of the single particle’s simultaneously passing through Young's double slits, which has been plaguing physicists in the whole world up to now for decades, is solved, in which the studies are classified as classical and quantum particles, the classical particle and quantum particle wave cannot and can pass the Young’s slits, respectively. This paper discovers both the new physics mechanism of passing the double slits of the wave with the amplitude of 4-dimensional momentum representation wave function reflecting particle nature and the principle of self-adaptive emergence of wave-particle duality, and then using the principle, this paper gives both direct explanations to the current experiments and new predictions of new some experiments for wave-particle duality. All the deduced results here are consistent with all relevant physics experiments.

Density distribution function of classical statistical mechanics is generally generalized as a product of a general complex function and its complex Hermitian conjugate function, and the average of classical statistical mechanics is generalized as the average of the quantum mechanics. Furthermore, this paper derives three ones of the five axiom presumptions of quantum mechanics, e.g., deduces Schrȍdinger equation by two general ways, makes the three axiom presumptions into three theorems of quantum mechanics, not only solves the crisis to hard understand, but also gets new theories and new discoveries, e.g., this paper solves the crisis of the origin of the wave-particle duality, derives operators, eigenvalues and eigenstates, deduces commutation relations for coordinate and momentum as well as the time and energy, and discovers quantum mechanics is just a generalization ( mechanics ) theory of the complex square root of ( real density function of ) classical statistical mechanics. Quantum mechanics being just a generalization theory of the complex square root of classical statistical mechanics is both new physics and revolutionary discovery, which are affecting people’s deep philosophical thinking for modern physics development, solve all the crisises of quantum mechanics, quantum information and so on, and make quantum mechanics have scientific solid bases being checked and both no basic axiom presumption and no all the quantum strange incomprehensible properties, because classical statistical mechanics and the complex square root of classical statistical mechanics have the scientific solid bases being checked. In addition, this paper discovers the reason no taking the time derivative of space coordinates in Schrȍdinger equation. Therefore, this paper gives solution to the crisis of the first quantization origin, and mainly deduces quantum physics no all the quantum current strange incomprehensible properties.

This paper derives measurement and identical principles, then makes the two principles into measurement and identical theorems of quantum mechanics, plus the three theorems derived earlier, we deduce the axiom system of current quantum mechanics, the general quantum theory no axiom presumptions not only solves the crisis to understand in current quantum mechanics, but also obtains new discoveries, e.g., discovers the velocities of quantum collapse and entanglement are instantaneously infinitely large. We deduce the general Schrȍdinger equation of any n particles from two aspects, and the wave function not only has particle properties of the complex square root state vector of the classical probability density of any n particles, but also has the plane wave properties of any n particles. Thus, the current crisis of the dispute about the origin of wave- particle duality of any n microscopic particles is solved. We display the classical locality and quantum non-locality for any n particle system, show entanglement origins, and discover not only any n-particle wave function system has the original, superposition and across entanglements, but also the entanglements are of interactions preserving conservation or correlation, three kinds of entanglements directly give lots of entanglement sources. This paper discovers, one of two pillars of modern physics, quantum mechanics of any n particle system is a generalization ( mechanics ) theory of the complex square root ( of real density function ) of classical statistical mechanics, any n particle system’s quantum mechanics of being just a generalization theory of the complex square root of classical statistical mechanics is both a revolutionary discovery and key new physics, which are influencing people’s philosophical thinking for modern physics, solve all the crisises in current quantum theories, quantum information and so on, and make quantum theory have scientific solid foundations checked, no basic axiom presumption and no all quantum strange incomprehensible properties, because classical statistical mechanics and its complex square root have scientific solid foundations checked. Thus, all current studies on various entanglements and their uses to quantum computer, quantum information and so on must be further updated and classified by the new entanglements. This and our early papers derive quantum physics, solve all crisises of basses of quantum mechanics, e.g., wave-particle duality & the first quantization origins, quantum nonlocality, entanglement origins & classifications, wave collapse and so on.Key words: quantum mechanics, operator, basic presumptions, wave-particle duality, principle of measurement, identical principle, superposition principle of states, entanglement origin, quantum communication, wave collapse, classical statistical mechanics, classical mechanics

It is imperative to conduct experimental studies on the seepage behavior of gas-bearing coal under cyclic dynamic loading conditions. This paper focuses on the evolution of coal permeability under the combined effects of dynamic loading, static loading, and gas adsorption. The principal conclusions are as follows. (1) As the frequency and amplitude of dynamic loading increase, the development of pore and fissure structures within the coal body becomes increasingly pronounced during dynamic loading cycles, resulting in a gradual rise in permeability. Notably, as the coal approaches its yielding stage, the permeability can increase by up to 47%. (2) The permeability curve is divided into four regions: the compaction reduction zone, the oscillation zone, the gradual recovery zone, and the abrupt increase zone of failure. Ultimately, in the failure phase, the permeability surges dramatically, potentially reaching 4 to 5 times the initial permeability. (3) When the static load stage is constant, the rate of change in permeability of the coal under dynamic loading decreases with increasing adsorption amount. When the adsorption amount is constant, the rate of change in permeability of the coal under dynamic loading increases with the increase in static load stress stage, with the maximum increase reaching 75.2%. It can be concluded from the rate of change in permeability and the dynamic loading sensitivity coefficient that the permeability of the coal is highly sensitive to cyclic dynamic loading, with increased sensitivity associated with larger static load stages and decreased sensitivity with greater adsorption amounts.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

Hydro generator sets serve as the peak and frequency regulation of the power system,and play a very important role in maintaining system stability and improving power quality.Based on the internal characteristics model of a specific type of hydro generator,this paper constructs a hydroelectric coupling model for hydropower units,studies the influence of the regulation system of hydropower units on low-frequency oscillations under different load conditions,and adopts variable speed reaching law and fuzzy sliding mode control strategy to improve the regulation quality of the system and ensure the stable operation of the units.Results of simulation and water turbine set under different load conditions show that varible speed reaching law can effectively improve the power-angle oscillation behavior of the hydropower set and suppress the occurrence of low-frequency oscillations of the system when the system is subject to power disturbance,which provide a new theoretical basis and solution for the vibration analysis and control optimization of hydraulic turbine units.

Strong-aroma Baijiu is a traditional Chinese spirit distilled from grains that undergo solid-state fermentation. At the end of each fermentation cycle, a significant quantity of Huangshui accumulates at the bottom of the fermentation pit, constituting one of the primary by-products in the brewing process of strong-flavor liquor. In this report, the chemical component analysis of Huangshui obtained from a strong-flavor liquor factory revealed a diverse array of organic acids, alcohols, esters, starch, reducing sugars, amino acids, and other compounds present in Huangshui. Additionally, two specialized solid-state fermentation models were developed to investigate the formation process of Huangshui. Our findings demonstrate a positive correlation between the yield of Huangshui and the initial moisture content of fermented grains. It is concluded that Huangshui is the percolate produced during the solid-state brewing process of strong-flavor liquor, with its water content originating from the initial moisture of fermented grains.

Baijiu is popular with its long history and balanced flavor, and flavor type was the most widely used classification mode for Baijiu. However, the evolution relationship of Baijiu flavor types and the differential markers between flavor types are still unclear, which has greatly affected the development of Baijiu industry. In this study, a total of 319 trace components were identified by gas chromatography-olfactometry-mass spectrometry and gas chromatography-mass spectrometry. Among them, 91 trace components with high odor active values or taste active values were recognized as flavor components. Then random forests were conducted to screen differential markers between derived and basic flavor types, and principal component analysis was carried out to evaluate their effectiveness in distinguishing the flavor types of Baijiu. Finally, 19 differential markers were screened and proved to effectively reveal the evolution Baijiu flavor types, and were further verified as key differential markers by addition test and correlation analysis.

As a fundamental, overall, and strategic issue facing human society, human migration is a key factor affecting the development of countries and cities given constantly changing population numbers. The fuzziness of the spatiotemporal attributes of human migration limits the pool of open-source data for human migration prediction, leading to a relative lag in human migration prediction algorithm research. This study expands the definition of human migration research, reviews the progress of research into human migration prediction, and classifies and compares human migration algorithms based on open-source data. It also explores the critical uncertainty factors restricting the development of human migration prediction. Given the effect of human migration prediction, in combination with artificial intelligence and big data technology, the paper concludes with specific suggestions and countermeasures aimed at enhancing human migration prediction research results to serve economic and social development and national strategy.

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

This paper proposed an optimal tracking control scheme through adaptive dynamic programming(ADP) for a class of partially unknown discrete-time nonlinear systems based on radial basis function neural network(RBF-NN). In order to acquire the unknown system dynamics, we use two RBF-NNs, the one is used to construct the identifier, and the another is used to directly approximate the steady-state control input, where a novel adaptive law is proposed to update neural network weights. While the optimal feedback control and the cost function are derived via feedforward neural networks approximating, it is proposed to regulate the tracking error, the critic network and the actor network are then trained online to obtain the solution of the associated Hamilton–Jacobi–Bellman (HJB) equation being built under the ADP framework. Simulations verify the effectiveness of the optimal tracking control technique using the neural networks.

This paper proposes a novel facial expression recognition network called the Lightweight Facial Network with Spatial Bias (LFNSB). The LFNSB model balances model complexity and recognition accuracy. It has two key components: a lightweight feature extraction network (LFN) and a Spatial Bias (SB) module for aggregating global information. The LFN introduces combined channel operations and depthwise convolution techniques, effectively reducing the number of parameters while enhancing feature representation capability. The Spatial Bias module enables the model to focus on local facial features while also capturing the dependencies between different facial regions. Additionally, a novel loss function called Cosine-Harmony Loss is designed. This function optimizes the relative positions of feature vectors in high-dimensional space, resulting in better feature separation and clustering. Experimental results on the AffectNet and RAF-DB datasets show that the proposed LFNSB model performs excellently in facial expression recognition tasks. It achieves high recognition accuracy while significantly reducing the number of parameters, thus substantially lowering model complexity.

Complex models have received significant interest in recent years and are being increasingly used to explain the stochastic phenomenon with upward and downward fluctuation such as the stock market. Different from existing semi-variance methods in traditional integer dimension construction for two variables, this paper proposes a simplified multi-factorized fractional dimension derivation with the exact Excel tool algorithm involving the fractional center moment extension to covariance, which is a complex parameter average that is a multi-factorized extension to Pearson covariance. By examining the peaks and troughs of gold price averages, the proposed algorithm provides more insight into revealing underlying stock market trends to see who is the financial market leader during good economic times. The calculation results demonstrate that the complex covariance is able to distinguish subtle differences among stock market performances and gold prices for the same field that the two variable covariance may overlook. We take the London, Tokyo, Shanghai, Toronto and Nasdaq as the representative examples.

This study investigated whether reciprocal collaborative pedagogy significantly impacts Indonesian electrical engineering polytechnic students in reducing reading anxiety and improving self-efficacy in ESP reading comprehension skills. Fifty Polytechnic students were equally assigned to two groups. Control groups learned in the traditional reciprocal teaching method individually. Experimental group engaged in reciprocal collaborative pedagogy. Each group received a 6-week reading strategy training. E-learning platforms were used in this study as a complementary tool to distribute ESP reading materials, announcements, and the experiment details being taught. The quantitative and qualitative results demonstrated that the tasks in reciprocal collaborative pedagogy positively affects Indonesian electrical engineering polytechnic students' learning experience and outcomes. This pedagogy promotes a productive learning environment through peer interaction, active engagement, and peer group discussions of the whole learning activities, reducing feelings of anxiety and building confidence in ESP-specialized text.

Reconstructing 3D indoor scenes from 2D images has always been an important task in computer vision and graphics applications. For indoor scenes, traditional 3D reconstruction methods suffer from the lack of surface details, poor reconstruction of large flat surface textures and areas with uneven lighting, and many falsely reconstructed floating debris noises in the reconstructed models. We add adaptive normal priors to the neural implicit reconstruction process to optimize the network, and improve the accuracy of volume density prediction by adding regularization terms to the neural radiation field to constrain the volume density obtained by weight distribution, and learn a smooth SDF surface from the network to obtain an explicit mesh model. Experiments show that the method proposed in this paper outperforms the state-of-the-art methods on ScanNet, Hypersim, and Replica datasets.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

The correlation and comorbidity between depression and chronic pain have been observed for a long time. Generally, it is considered that the two conditions reinforce each other, whereas the causal relationship between them is not clear. However, some evidence suggested that chronic pain may reverse the progression of depression in some cases. This article presents a selective review of clinical and pharmacological relationship between depression and pain, and their interactions at neurochemical and neurobiological levels. In addition, we open a discussion on a recent case report of repeated success of using short but continuous pain (SCP) during meditation as the only treatment for depression, compared to initial success but no remission with other conventional antidepressants on the same patient. Together this review proposes an updated model for depression and its various treatments that is based on synaptic and system homeostasis. More importantly, it suggests that SCP may benefit depression recovery through its properties that are different from either acute or chronic pain and represents a novel research area that has been largely neglected to date.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&amp;LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&amp;LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

AI-driven tools can identify nursing students' strengths and weaknesses, thus enabling the development of customized learning plans that target specific areas for improvement. This targeted approach can enhance knowledge retention and skill development, resulting in better prepared healthcare professionals. Nursing students are required to overcome their own psychological stress during their internship in order to understand sick children’s emotional reactions, as well as to be able to interact and communicate with such children. The application of AI picture-based teaching e-books helps nursing students to understand how to use therapeutic games to improve communication with sick children. A comparison of the differences between nursing teachers’ self-efficacy scores and nursing students’ application of AI picture-based teaching e-books (experimental group) and narrative handouts (control group) was achieved via therapeutic games to deal with sick children’s fear of medical examinations and treatments. In addition, a comparison was also conducted on the differences between the impact of the self-efficacy of the experimental group and that of the control group in dealing with sick children’s behavioral responses with respect to fears of medical examinations and treatments. This study is a quasi-experimental study, in which the self-efficacy scores of 30 nursing students were collected and analyzed in both the experimental group and the control group before and after intervention in dealing with sick children’s behavioral responses to fears of medical examinations and treatments. It was found that the self-efficacy score of the experimental group was higher than that of the control group (β coefficient is 0.356) when assessing the self-efficacy scores and behavior of the experimental and control groups in dealing with sick children’s fears of medical examinations and treatments through one-way analysis of covariance (one-way ANCOVA), moreover, a statistically significant difference (p < 0.05) was observed. The experimental group’s score of behavioral responses to the fears of sick children to examinations and treatments was lower than that of the control group (β coefficient was -1.540), wherein a statistically significant difference (p < 0.05) was shown. The self-efficacy of the experimental group in dealing with sick children’s fears of medical examinations and treatments had a statistically significant impact on the sick children’s behavioral responses to the fear of medical examinations and treatments (p < 0.05). In addition, the higher the self-efficacy scores of the experimental group in dealing with sick children’s fear of medical examinations and treatments, the lower the sick children’s behavioral responses to fears of medical examinations and treatments (the β coefficient was -0.914), the control group’s self-efficacy scores in dealing with sick children’s fears of medical examinations and treatments did not have a statistically significant impact on the sick children’s behavioral responses to fears of medical examinations and treatments (p > 0.05). This study proves that the application of AI picture-based teaching e-books by nursing teachers is more effective than narrative handouts in improving nursing students’ self-efficacy when using therapeutic games to deal with, as well as reduce, sick children’s fears of medical examinations and treatments.

Metasurface constitutes one of the most promising technologies for holographic imaging; however, the work for terahertz (THz) metasurface holographic imaging is relatively limited. Here, we propose a THz dielectric geometric-propagation phase metasurface, which can operate dual-mode (reflection and transmission) and reconfigurable multifunctional holographic imaging. The dual-mode is realized by controlling the Fermi energy level (Ef) of the graphene integrated into the metasurface unit, and the reconfigurable three-channel holographic imaging in reflection or transmission mode are achieved by switching the feed polarization among left-handed circular polarization (LCP), right-handed circular polarization (RCP) and linear polarization (LP). The metasurface is designed based on the transmission mode, and a physical model for switching to the reflection mode is established. For the first time to the best of our knowledge, a reflection-transmission dynamic modulation THz holographic imaging metasurface has been developed. The holographic metasurface operates in transmission mode at Ef = 0.1 eV, and in reflection mode at Ef = 0.9 eV. Compared with recently published holographic imaging metasurfaces, the proposed metasurface offers the following advantages: high holographic efficiencies (42.5% to 49%), more holographic imaging channels, dynamic modulation dual-mode operations, and reconfigurability.

Using data from the China Family Panel Studies, this study examines the socioeconomic characteristics of Internet users, as well as the relationships between the dynamics of different forms of online activities and the subjective well-being of urbanites and rural migrants in urban China. The study finds that online behaviour may clearly reflect differences in individuals’ personal traits and socioeconomic positions. Patterns of the association between online activities and subjective well-being tend to differ among rural migrants and urbanites, especially in terms of depression. A difference-in-differences model is employed to estimate the impact of intensified engagement in online activities on depression and life satisfaction from 2010 to 2016. The results show that increased frequency of online entertainment exhibits a comparatively positive effect on depression and life satisfaction. Spending more time on online social networking has a similar impact on rural migrants, but not on urbanites. These findings suggest that the rapid development of urban China’s online community has important implications for residents’ subjective well-being.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Cesarean Section (CS) is one of the most frequently executed surgical procedures in gynecology and obstetrics. After a cesarean section, surgical site infection (SSI) increases hospital stay, lengthens maternal morbidity, and upsurges treatment costs. The current study determines the prevalence and risk factors for surgical site infection following cesarean section in China. A retrospective study was conducted on 23 cases of pregnant women who underwent cesarean section and incision severe infection and detection from March 2017 to January 2020 at Wuhan Maternal and Child Healthcare Hospital in China as the study group, and 20 cases of uninfected cesarean section during the same period were selected as the control group. Data were compared with the controls based on study variables and the presence of SSI. The mean age was 31±2.6. High fever and blood loss were observed in serous SSI-infected patients. The incidence rate of severe surgical site infection was 0.15 %. SSI was observed to be expected in pregnant women who had premature rupture of membrane before surgery (p < 0.001), who underwent postoperative antibiotic therapy (p < 0.001), and the patients who had gestational diabetes mellitus (p <0.001) and hematoma (p < 0.001) during surgery. Hence, following a cesarean section, surgical site infection is common. This research discovered several modifiable risk factors. SSI is associated with multifactorial rather than a single one. The development and strict implementation of a procedure by all health care practitioners can successfully reduce and prevent infection rates following cesarean section.

The characteristics of gap plasmon formed by nanoparticle-on-mirror (NPOM) structure composed of metal nanoparticles (MNP) and metal thin films have aroused the interest of various optoelectronic devices. The resonant spectrum obtained by the internal coupling effect of gap can be flexibly controlled by the polarization of incident light and the thickness of the dielectric layer between MNP and metal thin films. We have theoretically studied the resonance spectra of polarization-dependent gold ellipsoidal nanoparticles (GENP) and gold thin films in the gap region of NPOM structures. GENP and gold thin films are separated by a dielectric layer with a refractive index of 1.36. We observe that the intensity of the local electric field resonance peak in the gap region is inversely proportional to the polarization angle. Similarly, the intensity of the local electric field resonance peak in the gap region is inversely proportional to the thickness of the dielectric layer. We have obtained more than 2200 V/m local electric field intensity (dielectric layer thickness 0.3nm). Finally, the resonant peak wavelength of the electric field in the gap region of the NPOM structure is also controlled by the polarization angle of the incident light and the thickness of the dielectric layer.

Flexible humidity sensors (FHS) with fast response and durability to high-humidity environment are highly desirable for practical applications. Herein, an FHS based on crosslinked sodium alginate (SA) and MXene was fabricated, which exhibited high sensitivity (impedance varied from 107 to 105 Ω between 10% and 90% RH), good selectivity, prompt response (response/recover time of 4 s/11 s), high sensing linearity (R2 = 0.992) on a semi-logarithmic scale, relatively small hysteresis (~5% RH), good repeatability, and good resistance to high humid environment (negligible change in sensing properties after placed in 98% RH over 24 h). It is proposed that the formation of crosslinking structure of SA and introduction of MXene with good conductivity and high specific surface area contributed to the high performance of the composite FHS. Moreover, the FHS could promptly differentiate respiration status, recognize speech and measure fingertip movement, indicating potentials in breath monitoring and non-contact human-machine interactions. This work provides guidance for developing advanced flexible sensors with wide application scope in wearable electronics.

Based on the perspective of complex directed weighted network analysis, this paper constructs a static resilience evaluation framework for trade networks from two dimensions: structural resilience and node resilience. It studies the evolution of static resilience in the upstream, midstream, downstream, and recycling trade networks of global wood forest products from 2002 to 2021. The study finds that the total trade volume of global wood forest products has increased by 58.0%, 77.3%, 71.2%, and 77.2% in the upstream, midstream, downstream, and recycling sectors, respectively. The downstream trade network exhibits efficient information transmission and resource mobility capabilities. All four types of trade networks exhibit scale-free characteristics, with core countries such as China, the United States, and Germany playing a dominant role in the network and playing a crucial role in network robustness, but also increasing network vulnerability. In terms of unweighted assortativity, all four networks exhibit the characteristic of "small countries relying on hubs," while the weighted assortativity of the downstream network is positive, indicating enhanced network resilience. In terms of node resilience, countries exhibit significant differences and dynamic changes. China demonstrates strong resilience and adaptability, while the United States maintains its core position. China's influence in the downstream network has significantly increased, and India has rapidly emerged in the recycling network. To enhance network resilience, it is necessary to increase diversity and redundancy, establish effective emergency response mechanisms, and promote the diversification and green transformation of the supply chain.

The basic oxygen furnace slag (BOF) was wide used in road construction, but there was a lack of characteristics in different asphalt mixtures. This study investigates the properties of hot-mixed asphalt (HMA) containing stone mastic asphalt (SMA), porous asphalt (PA) and dense-graded BOF as a partial substitution for natural aggregates. The purpose of this study is to evaluate various BOF slag contents in the asphalt mixtures would affect the cooling behavior after compaction. Asphalt mixture specimens contained 0%, 20%, 40% and 60% BOF slag, respectively, as coarse aggregate. Test results showed that BOF slag has a lipophilic property, so it can be adsorbed by asphalt cement, thereby reducing the cost of asphalt. The stability value of all asphalt mixtures increases with the proportion of BOF slag replacement. In addition, the voids in the mineral aggregate (VMA) value variable exhibited significant differences among asphalt mixtures, and could determine the deviation of the cooling trend of asphalt mixtures. Furthermore; it was found that the cooling procedure of the BOF slag used in dense-graded asphalt mixture takes about 100 min, and that the temperature tends to be moderate; however, it took about 120 min of cooling the SMA and PA mixture with BOF slag. In addition, the voids distribution of dense asphalt mixture was not uniform. It would result in various locations of thermal energy temperature on asphalt mixtures that were inconsistent.

It seems that natural compounds with bioactivity are the food constituents, present in the diets, that may provide protective effects on health due to their biochemical effects. The main benefits appear to be decline in oxidative stress and inflammation that are crucial in the pathogenesis of obesity, diabetes and metabolic syndrome. Apart from anti-inflammatory activity, these molecules also possess antifungal, and anti-infective preventative effects. Further evidence indicate that these bioactive molecules are the constituents, which are known to increase function of the foods. This review aims to emphasize that plant based diet is rich in phytochemicals such as antioxidants, vitamins, minerals, polyphenolics and flavonoids, amino acids and fatty acids, that are able to cause benefits via these compounds. These bioactive molecules can target mechanisms of oxidative stress and inflammation that are crucial in the management of metabolic syndrome. These antioxidant compounds appear to be essential component of plant based diets and are crucial for healthiness. Most investigators have proposed that bioactive compounds act as nutraceuticals which are able to regulate certain patho-physiological mechanisms responsible for metabolic diseases. The bioactive compoundspresent in the plant based diets are primary and secondary metabolites of nutritive and non-nutritive natural components generating health benefits by preventing or managing chronic disease or its symptoms. The bioactive compounds are known for their beneficial effects to health. Despite their small quantity in the diets, these bioactive compounds may trigger certain mechanisms that may cause alteration with improvement in health. It seems that most of the bioactive compounds co-existing in the plant-based diets, may be extremely healthful. However, if they are taken in excess, they can cause toxic effects. There is an urgent need to evaluate each bioactive compound to establish a beneficial quantity and a threshold of toxicity, while treating metabolic syndrome.

Session-based recommendations which aim to predict subsequent user-item interaction based on historical user behavior during anonymous sessions can be challenging tasks. Two main challenges need to be addressed and improved: (1) How to analyze these sessions to accurately and completely capture users’ preferences, and (2) how to identify and eliminate any interference caused by noisy behavior. Existing methods have not adequately addressed these issues since they either neglected the valuable insight that can be gained from analyzing consecutive groups of items or failed to take these noisy data in sessions seriously and handled them properly, which can jointly impede recommendation systems from capturing users’ real intentions. To address these two problems, we designed a multi-order semantic denoising (MSD) model for session-based recommendations. Specifically, we grouped items of different lengths as varying multi-order semantic units to mine the user’s primary intention from multiple dimensions. Meanwhile, a novel denoising network was designed to alleviate the interference of noisy behavior and provide a more precise session representation. The result of extensive experiments on three real-world datasets demonstrated that the proposed MSD model exhibited improved performance compared with existing state-of-the-art methods in session-based recommendation.

Background/Objectives: Dental implants have become a cornerstone of restorative dentistry, providing a long-lasting method for tooth replacement. The level of osseointegration has a big impact on the biomechanical stability at the bone-implant contact (BIC), which determines how long these implants will work. However, the exact consequences of changing osseointegration levels on different implant designs, especially in bones with variable densities, are not well known. Three short dental implants were tested in this study: BioMet 3iT3, Straumann® Standard Plus Short Regular Neck (SPS-RN), and Straumann® Standard Plus Short-Wide Neck (SPS-WN). 3D finite element analysis (FEA) was used to look at how well they worked biomechanically. This paper tests the implants at four stages of osseointegration: 25%, 50%, 75%, and 100% in both high-density (Bone Type III) and low-density (Bone Type IV) cancellous bone. It also created and examined realistic CAD models under static occlusal loading conditions to assess stress distribution and major strains at the bone-implant contact.; Results: The study discovered that as osteointegration increases, von Mises stress and principal strains go down significantly for all implant types. The SPS-WN implant had the lowest strain values, especially for bone with low density. These reductions demonstrate increased mechanical stability as the bone-implant inter-face becomes more capable of dispersing mechanical stresses, minimizing the potential for localized deformation and bone resorption.; Conclusions: The results highlight the importance of achieving optimum osseointegration to reduce mechanical stress and increase the lifespan of dental implants. The SPS-WN type implant performed better in biomechanical tests than the others, especially when bone conditions were not ideal. This makes it a great choice for clinical applications that need long-term implant success.

To analyze the impact of weather factors on the resilience of airport flight operations, particularly on flight operation, economic performance, and transportation capacity, Kolmogorov-Arnold Network (KAN) model was used to identify key weather features and establish the mapping relationship between weather factors and airport operational resilience. Taking Xi'an Xianyang International Airport as an example, the weights of each route were determined using the Grey Relational Analysis method considering average daily flight volume, flight distance, and airport flow stability indicators. Flight operation records and weather data were utilized to calculate the importance of key weather factors on the resilience of critical flight operation indicators. The results indicate significant differences in average daily flight volume, flight distance, and airport flow stability across different routes, with routes in economically developed areas having a greater impact on airport flow stability. Temperature and wind speed changes are the key factors affecting flight operation and economic indicators, with importance values of 0.35 and 0.32 respectively. Wind direction change and wind speed change have the greatest impact on flight transportation capacity, with importance values of 0.7 and 0.65 respectively. Therefore, when conducting flight scheduling and risk assessment, special attention should be paid to key weather factors such as temperature and wind speed, while also considering the weight of each route to ensure flight safety, efficiency, and economic benefits.

An in-depth understanding of the Se uptake and metabolism in plants is necessary for developing Se biofortification strategies. Thus, hydroponic experiments were conducted to investigate the associated processes and mechanisms of organic Se [selenomethionine (SeMet) and selenomethionine-oxide (SeOMet)] uptake, translocation, transformation and their interaction in wheat, in comparison to inorganic Se. Results showed that Se uptake by roots and the root-to-shoot translocation factor under the SeMet treatment were higher than those under the selenite, selenate, and SeOMet treatments. The uptake and translocation of SeMet were higher than those of SeOMet within 72 h, although the differences gradually narrowed with time. The uptake of SeMet and SeOMet was also sensitive to the aquaporin inhibitor: AgNO3 addition resulted in 99.5% and 99.9% inhibition of Se in root in the SeMet and SeOMet treatments, respectively. Once absorbed by root, were rapidly assimilated to other Se forms, and SeMet and Se-methyl-selenocysteine (MeSeCys) were the dominant species in SeMet and SeOMet-treated plants, while notably, an unidentified Se form was also found in the root and xylem sap under the SeMet treatment. In addition, within 16 h, SeOMet inhibited the uptake and translocation of SeMet, while the interaction was weakened with longer treatment time. Taken together, the present study provides new insights for the uptake and transformation processes of organic Se within plants.

In the field of delta-sigma modulators, reducing system power consumption without sacrificing accuracy has become a challenge. The summing circuit, as the main part of the cascade-of-integrator-in-feedforward delta-sigma modulator, consumes a significant amount of power in active summing. On the other hand, passive summing circuits have low power consumption but can cause attenuation in the summing results. This article proposes a low-power multi-bit delta-sigma modulator based on passive and attenuationless summation scheme. The summation circuit achieves multiplication of the voltage signal carried on the summation capacitor through bidirectional sampling technique, compensating for the inherent attenuation caused by passive summation, thus eliminating the need for active OTA to achieve perfect summation. A 2-order delta-sigma modulator based on 4-bit 1-order passive noise-shaping (NS) SAR quantizer is designed to verify the scheme. By combining a passive NS SAR as the 4-bit quantizer and the third-stage integrator of the system, and incorporating an energy-efficient cascode floating inverter amplifier (FIA) structure as the core active OTA, these elements have significantly enhanced the energy-efficiency of the modulator. Simulation results show that at a supply voltage of 1.2 V and a bandwidth of 20 kHz, the SNDR reaches 102.62 dB, power consumption is only 148.32 μW, and Schreier figure-of-merit (FoM) of SNDR is 183.92 dB.

In this study, we demonstrate a high luminous efficacy of 118 lm/W and high reliability through 450°C thermal aging of white LEDs (WLEDs) utilizing four-inch YAG: Ce3+ phosphor-in-glass (PiG) plates designed for vehicle headlights. The sintering process of mixing glass and phosphor typically generates pores, which can scatter light and reduce the luminous efficacy of the fabricated PiG. In this study, we produced four-inch PiG plates under four different fabrication conditions to evaluate their luminous efficacy. Our results revealed that the PiG plate with a thin thickness of 0.08 mm exhibited a 16.83% increase in luminous efficacy compared to the 0.15 mm plate, attributed to reduced light interaction with the pores. Unlike silicone-based phosphor WLEDs, which offer high performance but lower reliability due to the silicone resin's low transition temperature (150°C), our novel thin PiG plate achieves high performance and reliability. This advancement suggests that the proposed thin PiG plate could replace traditional silicone-based phosphors, enabling the development of high-quality WLEDs for vehicle headlights in automotive applications.

NongXiangXing Baijiu (NBJ) is produced using a solid-state fermentation system, but the impact of stratified fermented grains on fermentation remains unclear. Therefore, in a typical distillery plant, we evaluated the physical and chemical composition, volatile compound profile, and microbial community of fermented grains in NBJ both above (FG-A) and below (FG-B) the Huangshui line. Significant differences in fermentation parameters between FG-A and FG-B were observed after 30 days of fermentation (P < 0.05). Additionally, the partial least squares projection to latent structure discriminant analysis (PLS-DA) revealed distinct differences in volatile compounds between FG-B and FG-A, identifying 26 discriminant markers. The diversity of short-chain fatty acids (SCFAs) and their esters was higher in FG-B compared to FG-A. Furthermore, microbial diversity and abundance differed significantly between the two layers of fermented grains (P < 0.05). Correlation and pathway enrichment analyses indicated that the higher SCFA content in FG-B could be attributed to the greater abundance of acid-producing microorganisms compared to FG-A. This study highlights the differences between the two layers of fermented grains in NBJ fermentation, offering new insights into solid-state fermentation and expanding the current understanding of the traditional NBJ fermentation process.

A novel drive current model covering the effects of source/drain voltage (VDS) and gate voltage (VGS) and incorporating drift and diffusion current on the surface channel at the nano-node level, especially beyond 28nm node is presented. The effect of the diffusion current added is more satisfactory to describe the behavior of the drive current in nano-node MOSFETs, fabricated with the atomic-layer-deposition (ALD) technology. This breakthrough in model establishment can expose the long and short channel devices together. Introducing the variables of VDS and VGS, the mixed current model more effectively and meaningfully demonstrates the drive current of MOSFETs under the operation of horizontal, vertical, or mixed electrical field. In comparison between the simulation and experimental consequences, the electrical performance is impressive. The error between both is less than 1%, better than the empirical adjustment to issue a set of drive current models.

An accurate, economical, and reliable device for detecting falls in persons ambulating with the assistance of an orthopedic walker is crucially important for the elderly and patients with limited mobility. Existing wearable devices such as wristbands are not designed for walker users, and patients may not wear them at all times. This research proposes a novel idea of attaching an internet-of-things (IoT) device with an inertial measurement unit (IMU) sensor directly to an orthopedic walker to perform real-time fall detection as well as activity logging. A dataset is collected and labeled for walker users in four activities, including idle, motion, step, and fall. Classic machine learning algorithms are evaluated using the dataset by comparing their classification performance. Deep learning with convolutional neural network (CNN) is also explored. Furthermore, the hardware prototype is designed by integrating a low-power microcontroller for onboard machine learning, an IMU sensor, a rechargeable battery, and Bluetooth wireless connectivity. The research results show the promise of improved safety and well-being of walker users.

Precipitation and human activities are two essential forcing dynamics that influence hydrological processes. To investigate those impacts, the Zuli River Basin (ZRB, a typical tributary basin of the Yellow River in China) was chosen to identify the impact of precipitation and human activities on runoff and sediment discharge. A double mass curve (DMC) analysis and the test methods, including accumulated variance analysis, sequential cluster, Lee-Heghnian, and moving t-test methods was utilized to determine the abrupt change point based on data from 1956 to 2015. Correlation formulas and multiple regression methods were used to calculate the runoff and sediment discharge reduction effects of soil conservation measures and to estimate the contribution rate of precipitation and soil conservation measures to runoff and sediment discharge. Our results show that the runoff reduction effect of soil conservation measures (45%) is greater than the sediment discharge reduction effect (32%). Soil conservation measures were the main factor controlling the 74.5% and 75.0% decrease in runoff and sediment discharge, respectively. Additionally, the contribution rate of vegetation measures was higher than that of engineering measures. This study provides scientific strategies for water resource management and soil conservation planning at catchment scale to face future hydrological variability.

Polygonatum cyrtonema Hua. is an important medicinal and edible food in China and the traditional processing method of nine-steaming and nine-drying has been used to process its rhizome. However, the global dynamic changes in secondary metabolites during the processing and whether this method could enhance the accumulation of functional components remain unclear. This study aimed to explore the processing-induced mechanisms involved in the accumulation of secondary metabolites and provide theoretical support for the pharmacological study on P. cyrtonema. Results showed the first 6 processing cycles induced drastic changes in the accumulation of secondary metabolites, while the last 3 did not induce further changes. The accumulation of most secondary metabolites significantly increased after the first 3 cycles and stabilized after 6 cycles. The first 3 cycles led to numerous newly added metabolites while the last 6–9 cycles led to a small number of disappeared metabolites. Processing enhanced the biosynthesis of various secondary metabolites and significantly affected the metabolisms of amino acids. Together, a short period of processing was helpful for enhancing the biosynthesis of secondary metabolites. However, the enhancing effects will be reversed or weakened under continuous processing. The processing cycles should be reduced to 3–6 to maintain the enhancing effects.

This article explores the specific impact of artificial intelligence (AI) -driven data visualisation technologies in the user experience of the Internet industry. Through the introduction of machine learning and data mining technologies, AI has significantly improved the intelligence and automation of data visualization tools, promoting innovation in visualization methods and improving the quality and efficiency of data cleaning, processing, and analysis. In addition, AI has also promoted the development of personalised data visualization, providing users with a richer and more intuitive way to present data. This paper analyses the applications of AI-driven data visualization in machine learning, natural language processing, and computer vision. It demonstrates the positive effects of AI data visualization on user understanding and optimisation of models through practical feedback from Yellowbrick tools.

Dental implantology has evolved greatly as a result of the application of biomechanical engineering concepts, notably the utilization of additive manufacturing technologies that recreate the intricate architecture of real bone. This technique intends to improve functional compatibility with bone tissue while also addressing continuing problems of stress distribution inside dental implants. The research examines two types of dental implants: fully gyroid latticed and hybrid gyroid latticed with a solid neck, comprising three different cell sizes—FI-111, FI-222, FI-333, and their hybrid equivalents HI-111, HI-222, and HI-333. Traditional solid implants often cause stress shielding, which reduces long-term osseointegration and implant durability. Developed using nTopology for lattice configuration and meshing, this design undergoes a comprehensive stress analysis using finite element analysis (FEA). The study seeks to determine the most efficient implant design by maximizing stress distribution and mechanical stiffness. Analyses suggest that hybrid latticed implants, notably the HI-222 type, possess superior mechanical characteristics. These implants successfully balance stiffness and flexibility, reducing stress concentrations and improving stress distribution throughout the implant structure. This balance is critical for decreasing micromotions at the bone-implant interface, boosting osseointegration, and, ultimately, increasing implant longevity and success rates in clinical settings. The paper describes a substantial redesign of dental implants by combining biomechanical engineering and modern additive manufacturing. The novel proposed hybrid structure not only addresses typical challenges such as stress shielding, but it also establishes new standards in implantology, potentially leading to better clinical results and patient quality of life. This complete approach emphasizes the ability of personalized implant designs to fulfill individual clinical demands, indicating a significant improvement in dental treatment technology.

Lentiviral vectors (LVs) are a powerful tool for gene and cell therapy and human embryonic kidney cells (HEK293) have been extensively used as a platform for production of these vectors. Like most cells and cellular tissues, HEK293 cells release extracellular vesicles (EVs). EVs released by cells share similar size, biophysical characteristics and even a biogenesis pathway with cell-produced enveloped viruses, making it a challenge to efficiently separate EVs from LVs. Thus, EVs co-purify with LVs during downstream processing, becoming “impurities” in the context of cell therapy. To characterize EVs from an inducible lentivirus producing cell line, two conditions were studied: non-induced and induced. EVs’ identity was confirmed by transmission electron microscopy and western blot. Seven proteins were identified by mass spectrometry as potential EV markers. Lipid composition of EVs and LVs showed similar enrichment in phosphatidylserine. RNA cargos in EVs showed enrichment in genes involved in viral processes and binding functions. Flow virometry, GTA and ddPCR results also confirmed the heterogenic nature of EVs and LVs populations. These findings provide insights on the product profile of lentiviral preparation and could help develop separation strategies of co-produced EVs.

The circular supply chain was applied to many industries in the past studies, whereas the rubber recycling industry has not been explored in detail yet. Therefore, this study indentified the key factors of the circular supply chain used in remanufactured products, thereby perfecting its framework. This study put forward 5 aspects and 19 criteria for reference, so that companies in the rubber recycling industry are able to clearly know the direction of implementation when con-structing the circular supply chain for remanufactured products. This study integrated expert opinions with the fuzzy Delphi method and the fuzzy decision making trial and evaluation laboratory proposed key factors, and performed the ranking of importance. The results have displayed that key aspects include the circular business model (A3), increasing the value of resources in the supply chain (A4), and risk management of the circular supply chain (A2). The factors that the rubber recycling industry needs to pay attention to are: optimizing the production process (C2), sharing data in the product lifecycle (C4), effectively tracking and recycling products (C5), redesigning remanufactured products (C13), enhancing resource efficiency (C16), and identifying waste composition and separating materials (C14) . Based on the abovementioned, we had a discussion in this study.

In this study, the effects of various beryllium (Be) addition (Be-free, 0.1, 0.25, 0.50 wt.%) on the microstructure, mechanical properties, and corrosion corrosion of the Al-Mg-Li alloys were systematically investigated. The best performance was obtained in alloy with 0.1 wt.% Be addition. Trace Be addition promotes the grain refinement of the as-cast alloy ingot and contributes positive effects to the recrystallization, bringing improvement of tensile property. Meanwhile, the best anti-corrosion behavior is also presented at 0.1 wt.% Be addition, due to its potential to reduce the width of precipitates free zone (PFZ). As the Be content increase to an excessive level, the comprehensive performance decreases. Therefore, it is strongly recommended that adding trace Be element into Al-Mg-Li alloys has a positive effect on the comprehensive service performance.

Although Shannon mutual information has been widely used, its effective calculation is often difficult for many practical problems, including those in neural population coding. Asymptotic formulas based on Fisher information sometimes provide accurate approximations to the mutual information but this approach is restricted to continuous variables because the calculation of Fisher information requires derivatives with respect to the encoded variables. In this paper, we consider information-theoretic bounds and approximations of the mutual information based on Kullback--Leibler divergence and Rényi divergence. We propose several information metrics to approximate Shannon mutual information in the context of neural population coding. While our asymptotic formulas all work for discrete variables, one of them has consistent performance and high accuracy regardless of whether the encoded variables are discrete or continuous. We performed numerical simulations and confirmed that our approximation formulas were highly accurate for approximating the mutual information between the stimuli and the responses of a large neural population. These approximation formulas may potentially bring convenience to the applications of information theory to many practical and theoretical problems.

A novel five-surface phosphor-in-glass (FS-PiG) for high illumination and excellent color uniformity in larger-scale LEDs for sensor light source application is demonstrated. YAG phosphor (Y3Al5O12:Ce3+) was uniformly mixed with ceramic and sintered at 680°C to form a phosphor wafer. A sophisticated laser engraving was employed on the phosphor wafer to form a saddle-shaped large-scale FS-PiG LEDs. The performance of the FS-PiG LEDs exhibited the illumination of 401lm, average color temperature (CCT) of 5488K±110K, and color coordinates (CIE) of (0.3179±0.003, 0.3352±0.003). In contrast to convention single-surface phosphor-in-glass (SS-PiG) LEDs, the performance exhibited the illumination of 380lm, average CCT of 5830K±758K, and CIE of (0.3083±0.07, 0.3172±0.07). These indicated that the performance of the FS-PiG LEDs was higher than the SS-PiG LEDs for illumination, CCT, and CIE of 1.7, 7, and 23 times, respectively. Furthermore, the FS-PiG LEDs demonstrate lower lumen loss of 2% and less chromaticity shift of 5.4x10-3 under accelerated aging at 350°C for 1008 hours, owing to the high ceramic melting temperature of up to 510°C. In this study, the proposed FS-PiG larger-scale LEDs having excellent optical performance and high reliability may be the promising candidates to replace the convention phosphor-in-organic silicone material used in high-power LEDs for the next generation of sensor light sources, display, and headlight applications.

In order to better realize rural revitalization, this paper analyzes the spatial and temporal char-acteristics and influencing factors of agricultural surface source pollution in the Yangtze River Economic Belt from the three perspectives of government, enterprise and agriculture by using the spatial Durbin model and the dynamic GMM method in the period of 2006-2021, and further re-searches the threshold characteristics of the distortion of the factor market on the agricultural surface source pollution under the different strengths of environmental regulation. The results show that there is a positive spatial correlation between agricultural surface pollution in the Yangtze River Economic Belt, and government environmental regulation, input factor market distortion and labor force transfer all have a significant impact on agricultural surface pollution. Among them, factor market distortion has a significant spatial spillover effect on agricultural surface pollution in the Yangtze River Economic Zone, and has a significant single-threshold ef-fect on environmental regulation. Accordingly, the government should strengthen environmental regulation, continuously improve the agricultural factor market mechanism, and pay attention to the construction of talents to provide support for rural revitalization.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

Forests have multifunctional roles. They not only increase forest carbon sinks through afforestation and management, but also indirectly realize multiple benefits of "economy + ecology + society". Therefore, we construct a multiple output-benefit system of forest carbon sinks based on the development of forest carbon sinks in provinces of China. This system is also able to distinguish the importance of forest carbon sinks from other outputs. For the efficiency evaluation of multi-level output systems, this paper constructs a cross-evaluation model based on evidential reasoning method, the original efficiency information by conducting efficiency evaluation before information fusion. Further, the spillover effects and influencing factors of forest carbon sink efficiency are analyzed through a spatial regression model to explore the spatial characteristics of forest carbon sink efficiency in China. The results show that: (1) there is a large gap between the cross-efficiency levels of forest carbon sinks in various regions of China, with significant spatial correlation. For the perspective of direct output benefits, the cross-efficiency of the eastern region is higher, while the cross-efficiency of the northwestern region is lower; for the perspective of indirect output benefits, the cross-efficiency of the southeastern region is higher. (2) China's forest carbon sink has a significant positive spillover effect, and the indirect output cross-efficiency has a significant negative impact on the forest carbon sink in its own region. Further analyzing the impact of indirect output cross-efficiency, it is found that the cross-efficiency of the ecological dimension and the cross-efficiency of the social dimension have a significant negative impact on the forest carbon sink in its own region, and the economic dimension has a significant positive impact on the forest carbon sink in its own region. In conclusion, corresponding policy recommendations are proposed for the development of forest carbon sinks to promote the realization of the dual-carbon goal.

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

The research on the excavation mechanical properties of underpass tunnels has already had certain results, but fewer of them consider the effects of dynamic and static loads on the excavation mechanical properties of underground tunnels at the same time, especially the lack of research cases of double-line highway tunnels with angled underpasses of existing railway tunnels. In this paper, based on the tunnel project of the new double-line Shiqian Highway Tunnel passing under the Hurong Railway at an oblique angle, the mechanical parameters of the rock body in the cross-tunneling area under the influence of static and dynamic load coupling are obtained by using the disturbance quantification coefficients and the Hoek-Brown criterion based on the method of over-advanced geological prediction and the investigation of the surrounding rock on the palisade face, and the engineering-scale finite element model is constructed and the mechanical characteristics of the excavation in the tunnel of the double-lane highway tunnel passing under the existing railroad under the influence of the static and dynamic loads are analyzed. The results show that: the new tunnel rock movement law for the top of the arch sinking, bottom plate bulging, side wall to move outward, the height and width of the arch and bottom plate arch with the tunnel excavation and increase, the side wall rock displacement effect is smaller; left and right lines of the tunnel disturbed area of the rule of change is similar; the existing tunnel bottom plate displacement is more than the top plate and the left and right side walls by the excavation of the time step influence is larger. Typical profile displacement is mainly determined by the distance from the excavation surface; the new tunnel in the four types of calculation conditions of the rock disturbance angle is the same; the existing tunnel roof and side wall Von Mises stress extreme occurs in the tunnel structure, the bottom plate there are pressure relief and pressure-bearing areas; based on the displacement control criteria, the recommended upper and lower step blasting method.

In this study, the effects of combined addition of CeLa and GdY on microstructure and mechanical properties of as-cast Al-4Cu-1Mn alloys were investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopies (TEM) and tensile testing. The results show that the minor addition of CeLa and GdY leads to the refinement of grain size. The addition of CeLa results in the formation of supersaturated vacancies in the Al matrix, whereas the addition of GdY leads to a decrease in the precipitation temperature of the Al2Cu phase. The combined CeLa and GdY addition can significantly increase ultimate tensile strength (UTS) while losing only a small amount of elongation (EL). Compared with the unmodified alloy, the grain size and SDAS of the alloy (0.2 wt% CeLa + 0.1 wt% GdY) were diminished by 67.2% and 58.7%, respectively, while maximum hardness and UTS rose by 31.2% and 36.9%, correspondingly.

Patients receiving hemodialysis are at risk of vascular access infections (VAIs) and particularly vulnerable to the opportunistic pathogen Staphylococcus aureus. Hemodialysis patients were also at increased risk of infection during the COVID-19 pandemic. Therefore, this study determined the change in the molecular and antibiotic resistance profiles of S. aureus isolates from VAIs during the pandemic compared with before. 102 S. aureus isolates were collected from VAIs between November 2013 and December 2021. Before the pandemic, 69 isolates were collected, 58%, 39.1%, and 2.9% from arteriovenous grafts (AVGs), tunneled cuffed catheters (TCCs), and arteriovenous fistulas (AVFs), respectively. The prevalence of AVG and TCC isolates changed to 39.4% and 60.6%, respectively, of 33 isolates during the pandemic. Sequence type (ST)59 was the predominant clone in TCC-methicillin-resistant S. aureus (MRSA) and AVG-MRSA before the pandemic, whereas the predominant clone was ST8 in AVG-MRSA during the pandemic. ST59 carrying the ermB gene was resistant to clindamycin and erythromycin. By contrast, ST8 carrying the msrA gene was exclusively resistant to erythromycin. The ST distribution for different VAIs changed from before to during the pandemic. The change in antibiotic resistance rate for different VAIs was closely related to the distribution of specific STs.

The crosslinking behavior of polyethylene (PE) determines its exceptional performance and application. In this study, we investigated the crosslinking behaviors of different PE resins through model simulation and rheological methods. Specifically, the mathematical equation of "S" model was established for PE resin. According to this equation, the optimal maximum gel content for high-density polyethylene (HDPE) was found to be around 85%. Moreover, the maximum crosslinking degrees for different PE resins depended largely on their density and molecular weight. The melt viscosities before crosslinking in PE resins were highly influenced by their melt index. The higher melt indexes resulted in the lower storage moduli, improving melt processability during processing. In addition, the crosslinking rates of PE resins were strongly influenced by peroxide concentration, independent of PE resin structures. For high molecular weight and low-density PE resins, they exhibited decreased ti values, increased A0 values, and decreased k6 values. However, there were no noticeable variations in the values of k2 and phi among different PE resins. And all simulated modeling outcomes showed the remarkable consistency with the experimental rheological data. These findings are of utmost significance in the industrial manufacture of PE resin.

[Research Objective] In the context of the rapid development of digital governance, understanding and analyzing the burden level of digital tools in the process of serving digital governance from multiple perspectives is an important prerequisite for improving the capacity and accuracy of government digital governance, promoting sustainable public participation, and maximizing digital value in the new era. [Research Method] By constructing a model of the burden of digital tools caused by technical, organizational and environmental factors on the public based on the TOE framework, using SPSS for data testing based on 275 research questionnaires, and using fuzzy set qualitative comparative analysis (fsQCA) to explore the linkage ways and paths of the burden-increasing effect of digital tools in a holistic perspective. [Research findings] does not constitute a necessary condition for high levels of digital tool affordances under a single condition, but improving users' digital literacy plays a more general role in optimising the efficiency of digital tool use. According to the results, there are five dominant patterns that have a significant impact, i.e. the driving paths that lead to high levels of digital tool affordability are characterised by a "homogeneous approach". In the cross-group study, significant differences were found in the driving paths of high digital tool affordability by group, depending on the level of digital tool mastery. This paper suggests that the government should continue to pay attention to affordability levels, rationalise the use of financial resources, improve the level of digital tool adaptation, and innovate the existing performance evaluation system for digital governance indicators.