The design of binders plays a pivotal role in achieving enduring high power in lithium-ion batteries (LIBs) and extending their overall lifespan. This review underscores the indispensable characteristics that a binder must possess when utilized in LIBs, considering factors such as electrochemical, thermal, and dispersion stability, compatibility with electrolytes, solubility in solvents, mechanical properties, and conductivity. In the case of anode materials, binders with robust mechanical properties and elasticity are imperative to uphold electrode integrity, par-ticularly in materials experiencing substantial volume changes. For cathode materials, the se-lection of a binder hinges on the crystal structure of the cathode material. Other vital consid-erations in binder design encompass cost-effectiveness, adhesion, processability, and envi-ronmental friendliness. Incorporating low-cost, eco-friendly, and biodegradable polymers can contribute significantly to sustainable battery development. This review serves as an invaluable resource for comprehending the prerequisites of binder design in high-performance LIBs and offers insights into binder selection for diverse electrode materials. The findings and principles articulated in this review can be extrapolated to other advanced battery systems, charting a course for the development of next-generation batteries characterized by enhanced perfor-mance and sustainability.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

As argued by ‘Declaration of Concrete Environment (2010)’ of Korea and ‘Declaration of Asian Concrete Environment (2011)’ of six Asian countries, concrete as a single material has lately shown extremely large impact on environmental issues such as climate change. Assessment of environmental impact from concrete material and production has considerable importance. Concrete is a major material used in the construction industry that emits a large amount of substances with environmental impacts during its life cycle. Accordingly, technologies for the reduction in and assessment of the environmental impact of concrete from the perspective of Life Cycle Assessment must be developed. At present, the studies in relation to greenhouse gas emission from concrete are being carried out globally as a countermeasure against climate change. In this study, a sustainable concrete mix design algorithm was designed using correlation analyses, and its carbon emission and cost reduction performances were assessed. Using correlation analyses, the concrete strength, w/b and s/a ratios, and CO₂ emissions were identified as major variables of concrete mix design that influenced other variables. Also, this study aims to evaluate the CO₂ emission reduction performance of the algorithm-deduced sustainable concrete mix design, and therefore, the CO₂ emissions of the sustainable concrete mix design are compared with those of the actual concrete mix design applied to the construction of the office building A in South Korea.

Although chronic obstructive pulmonary disease (COPD) and interstitial lung disease (ILD) have distinct clinical features, both diseases may coexist in a patient because they share similar risk factors such as smoking, male sex, and old age. Patients with both emphysema in upper lung fields and diffuse ILD are diagnosed with combined pulmonary fibrosis and emphysema (CPFE), which causes substantial clinical deterioration. Patients with CPFE have higher mortality compared with patients who have COPD alone, but results have been inconclusive compared with patients who have idiopathic pulmonary fibrosis (IPF). Poor prognostic factors for CPFE include exacerbation, lung cancer, and pulmonary hypertension. The presence of interstitial lung abnormalities, which may be an early or mild form of ILD, is notable among patients with COPD, and is associated with poor prognosis. Various theories have been proposed regarding the pathophysiology of CPFE. Biomarker analyses have implied that this pathophysiology may be more closely associated with IPF development, rather than COPD or emphysema. Patients with CPFE should be advised to quit smoking and undergo routine lung function tests, and pulmonary rehabilitation may be helpful. Various pharmacologic agents may be beneficial in patients with CPFE, but further studies are needed.

The aim of this study is to investigate transient dynamic flow characteristics of the fluid flow through 5-way electric coolant valve (PCCV : Penta-Control Coolant Valve). To achieve this goal, the present paper attempts the three-dimensional dynamic simulation of the fluid flow through the valve using a commercial CFD solver with moving mesh technique to consider flow inertia and dynamic flow in the opening and closing stages of the ball valve rotating motion. Firstly, dynamic flow characteristics and the thermal mixing inside the PCCV ball valve during the opening and closing stage was analyzed. It is found that the discrepancies between dynamic and steady state simulation is remarkable when fluxes with different levels of enthalpy and momentum flow into the PCCV leads to strong flow interference and flow inertia, while the discrepancies are relatively small at low rotation speed and weak flow interference. Then, the effect of dynamic flow characteristics of the valve on dynamic thermal mixing characteristics at two different ball valve rotational speeds and rotational directions were investigated. It was found that the dynamic flow and thermal mixing characteristics inside the PCCV are greatly affected by the rotation speed, rotation direction, and degree of flow interference between fluxes. It is helpful for the design of the better coolant control strategies and the improvement of the FCEV thermal management system.

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

We examine here characteristics of electromagnetic waves that propagate through an unbounded space filled with a homogeneous isotropic chiral medium. Resulting characters are compared to those of the electromagnetic waves propagating through an achiral free space. To this goal, we form energy conservation laws for key bilinear parameters in a chiral case. Due to a nonzero medium chirality, conservation laws turn out to contain extra terms that are linked to the spin-orbit coupling, which is absent for an achiral case. As an example, we take a plane wave for achiral case to evaluate those bilinear parameters. Resultantly, the conservation laws for a chiral case are found to reveal inconsistencies among several bilinear parameters that constitute the con-servation laws , thereby prompting us to establish partial remedies for formulating proper wave-propagation problems.

Metal oxide p-n heterojunction nanofibers (NFs) are among the most promising approaches to enhancing the efficiency of gas sensors. In this paper, we report the preparation of a series of p-NiO-loaded n-ZnO NFs, namely (1 − x) ZnO-xNiO (x = 0.03, 0.05, and 0.1 wt%), for hydrogen gas sensing experiments. Samples were prepared through the electrospinning technique followed by a calcination process. The sensing experiments showed that the sample with 0.05 wt% NiO loading resulted in the highest sensing performance at an optimal sensing temperature of 200 °C. The sensing mechanism is discussed in detail and contributions of the p-n heterojunctions, metallization of ZnO and catalytic effect of NiO on the sensing enhancements of an optimized gas sensor are analyzed. This study demonstrates the possibility of fabricating high-performance H₂ sensors through the optimization of p-type metal oxide loading on the surfaces of n-type metal oxides.

This study investigated a novel radioimmunotherapy strategy for targeting tumor angiogenesis. We developed a radiopharmaceutical complex by labeling an anti-adenosine triphosphate syn-thase (ATPS) monoclonal antibody (mAb) with the radioisotope 177Lu using DOTA as a chelating agent. 177Lu-DOTA-ATPS mAb demonstrated high labeling efficiency (99.0%) and stability in se-rum. MKN-45 cancer cells exhibited the highest cellular uptake, which could be specifically blocked by unlabeled ATPS mAb. In mice, 177Lu-DOTA-ATPS mAb accumulated significantly in tumors, with a tumor uptake of 16.0 ± 1.5%ID/g on day 7. 177Lu-DOTA-ATPS mAb treatment sig-nificantly reduced the viability of MKN-45 cells in a dose-dependent manner. In a xenograft tumor model, this radioimmunotherapy strategy led to substantial tumor growth inhibition (82.8%). Furthermore, combining 177Lu-DOTA-ATPS mAb with sunitinib, an anti-angiogenic drug, en-hanced the therapeutic efficacy of sunitinib in the mouse model. Our study successfully developed 177Lu-DOTA-ATPS mAb, a radioimmunotherapy agent targeting tumor blood vessels. This ap-proach demonstrates significant promise for inhibiting tumor growth, both as a single therapy and in combination with other anti-cancer drugs.

In order to reduce the large damage caused by train derailment, protective facilities of various shapes and conditions can be installed on railroad tracks. These protective facilities are referred to as derailment containment provisions (DCPs) and three different types are used worldwide. However, there are no clear standards for DCPs design such as installation location, size, and design load, and performance verification of DCPs installed in the actual railway field is not sufficiently performed. In this paper, the functionality of DCPs is analyzed through the full-scale derailment test. In order to propose a method for estimating the collision load acting on the DCP type I after derailment, the experimental results and simulation results are compared. The function of DCP type I according to the change of the vehicle's center of gravity is identified through comparative analysis of the post derailment behavior.

The phenolics concentrations of rapeseed are important because they are antinutritional com-pound or directly positive related to antioxidant actives. In this study, single nucleotide poly-morphisms (SNPs) identified from genotyping-by-sequencing (GBS), and genome-wide associa-tion study of phenolic contents were investigated in 95 rapeseed mutant lines derived from gamma rays and their original cultivar. A total of 3,196,318 SNPs were detected, identifying a set of 70,208 union SNPs used to perform association studies. Six phenolics and glucosinolate (pro-goitrin) were identified, sinapine was the major phenolic compound (91.2–99.2%) in all geno-types. The association study was conducted for six phenolic compounds, progoitrin, total sinap-ine content (TSC), total phenolic content (TPC) and seed yield. The association study identified 241 SNPs that were significantly associated with six phenolic compounds, progoitrin, TSC and TPC. Based on the detected SNP markers, BnaA06g31740D, a gene associated progoitrin, BnaC-nng39930D, a gene associated trans-sinapine 1, BnaA07g31720D, a gene associated trans-sinapine 2, BnaC03g31950D and BnaA06g09180D, a gene associated TSC, and BnaAnng27700D, a gene associ-ated TPC, were selected as candidate genes. The SNP makers associated major phenolic com-pounds identified and could be used as targets for breeding programs aimed at improving anti-oxidant contents and reducing antinutritional components.

Rapeseed (Brassica napus L.) is one of the most oil crop, and its commercial value is contingent upon its agronomic characteristics and oil quality. In this study, 73,226 single nucleotide polymorphisms (SNPs) across 95 rapeseed mutant lines derived from gamma rays and their original cultivar (‘Tamra’) obtained from genotyping-by-sequencing (GBS) was investigated gene ontology (GO) analysis and genome-wide association study (GWAS). GWAS was conducted on agronomic (plant height, ear length, thousand seed weight and seed yield) and oil (fatty acid and crude fat) traits. GO analysis showed that many genes displaying SNPs were involved in cellular processes, intracellular anatomical structures and organic cyclic compound binding. A total of 149 significant SNPs were associated with the agronomic traits (76 SNPs) and oil traits (73 SNPs). Bna.A05p02350D (SFGH) and Bna.C02p22490D (MDN1) were selected as novel candid genes for thousand seed weight. In addition, Bna.C03p14350D (EXO70) and Bna.A09p05630D (PI4Kα1) were selected as novel candidate genes for the erucic acid and crude fat content, respectively. These findings could facilitate the identification of optimal genotypes for breeding new cultivars, and association studies represent an economically efficient tool for mutant screening and the selection of elite rapeseed-breeding lines.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation < 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

This work focuses on forced combustion with regards to the relationship between vent mixer models and several injection locations in unheated supersonic flow. A plasma jet torch was used to ignite the hydrogen–air mixture in a laboratory-scaled combustor duct. The flow field of the combustion was visualized with pressure and gas-sampling measurements. The vent mixers indicate good dispersion characteristics of the mixture for both parallel and normal 1 injections. However, forced combustion is dominantly governed by the injection rate toward the plasma jet (hot source) because the combustible region is restricted under the cold main flow. For this reason, the parallel injection, which provides the hydrogen–air mixture directly toward the plasma jet, shows good combustion performance. The normal 1 injection interacted with the vent mixers and shows slightly good combustion performance. Lastly, the normal 2 injection is little affected by the vent mixers and has poor combustion performance.

The aim of this study is to evaluate the optimal conditions of membrane filtration process. Both laboratory test and pilot-scale test were conducted to examine a treated water on blending water. The water sample were prepared by blending a raw water and the effluent water filtered through an organic membrane. The optimal efficiency in the treatment of water quality at the lab-scale test was generated under conditions of flux at 2.0 m³/m²∙day, the blending ratio of 4:1, and the optimal dosage of coagulant at 20 ppm. The pilot-scale test resulted in that the optimal efficiency was obtained under conditions of flux at 2.0 m³/m²∙day and the blending ratio of 6.0:1. However, the different results between lab-scale and pilot-scale tests on the optimal dosage of coagulant implied that it is difficult to achieve the stable condition of process operation at the low level of coagulant. In summary, the results indicated that, in the combination process of organic membrane and ceramic membrane, the recovery efficiency was achieved above the level of 98.4 %. Compared to 92.1 % in a single organic membrane process, the combination process is 6.3 % more efficient than the single one. This combination process of water treatment lead to stable recovery rates by the optimal input of dosage, less pollution load to water, and a stabilized filtration system.

Kummerowia striata is a traditional medicine used for the therapy of inflammation-related diseases. Herein, we investigated the anti-melanogenic and antioxidant activities of an ethanolic extract of K. striata (EKS) using a number of in vitro and cell culture model systems. The anti-melanogenic effect was assessed in B16F10 melanoma cells based on melanin synthesis and in vitro tyrosinase inhibitory activity and the anti-oxidant activity assays were performed using 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2,2ʹ-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS); EKS exhibited strong anti-oxidant activities in both the assays. The expression of tyrosinase, tyrosinase-related protein 1, tyrosinase-related protein 2, and microphthalmia-associated transcription factor was decreased in a dose-dependent manner at mRNA and protein levels upon treatment with EKS. Notably, EKS did not affect the cell viability at all the EKS concentrations used in this study, indicating that EKS-mediated inhibition of melanin synthesis is not accompanied with cytotoxicity. Collectively, our findings demonstrate, for the first time, that EKS possesses anti-melanogenic and anti-oxidant activities, and suggest that further evaluation and development of EKS as a functional supplement or cosmetic might be useful for skin whitening and for reduction wrinkles.

A review is here provided on the thermal effects on the optical chirality. To this goal, chiral objects dispersed in an embedding fluid are examined for their magnetoelectric coupling. Archetypal twisted-Omega particles are examined with respect to electron transport, phonon dynamics, and temperature effects. Continuum-mechanical aspect of thermo-elasticity is reviewed along with transverse deformations. A transition temperature delineating a sign flip in the chirality parameter is identified as well.

A review is here provided about the thermal effects on the optical chirality. To this goal, chiral objects dispersed in an embedding fluid are examined for their magnetoelectric coupling. Thermal effects on several chiral meta-atoms and their ensembles are examined. To this goal, DNA-like helical structures are examined in detail. Mechanical aspect of thermo-elasticity is reviewed along with transverse deformations, while drawing analogies from condensed-matter physics. In this respect, chirality-induced spin selection is reviewed along with the temperature-mediated elec-tron-phonon interactions. A wide range of materials such as polymers and biological cells are also examined for temperature effects. A transition temperature delineating a sign flip in the chirality parameter is identified as well. Chirality-associated functionalities such as ratchet motions, switching, and modulations are investigated for their respective thermal effects. Issues of fabri-cating chiral meta-atoms are also discussed.

Surface area and pore size distribution of Eucalyptus samples pretreated by different methods were determined by the Brunauer-Emmett-Teller (BET) technique. Three methods were applied to prepare cellulosic biomass samples for BET measurements: air, freeze, and critical point drying (CPD). Air and freeze drying caused severe collapse of biomass pore structures, but CPD effectively preserved biomass morphology. Surface area of CPD prepared Eucalyptus samples was determined to be 58–161 m2/g, whereas air and freeze dried samples were 0.5–1.3 and 1.0–2.4 m2/g, respectively. Average pore diameter of CPD prepared Eucalyptus samples were 61–70Å. CPD preserved Eucalyptus sample morphology by replacing water with a non-polar solvent, CO2 fluid, which prevented hydrogen bond reformation in the cellulose.

Aim The use of prophylactic antibiotics prior to colorectal surgery reduces surgical site infections. Cefazolin and metronidazole is a standard regimen. Ampicillin-sulbactam may be an alternative, but the data are limited. We compared the efficacy of ampicillin-sulbactam with cefazolin and metronidazole as prophylactic antibiotics. Methods Patients who underwent colorectal surgery at Inha University Hospital between 2010 and 2020 were treated prophylactically with cefazolin and metronidazole or ampicillin-sulbactam, and observed for 30 days following surgery. The primary outcome was surgical site infections. Secondary outcomes were deep/organ infections and the need for drainage. Results SSIs occurred in 2.6% (17/646) of the ampicillin-sulbactam group and was not inferior to the occurrence in the cefazolin and metronidazole group (3.8%, 21/556). There was no significant difference between the two groups in the secondary outcomes. Conclusion Compared with the cefazolin and metronidazole combination, the ampicillin-sulbactam group is non-inferior as a preoperative prophylactic antibiotic regimen for colorectal surgery.

Static and dynamic analysis of website security risks is generally used for website security meas-urements. The website security measurements method recently proposed includes similarity hash-based website security risk analysis and machine learning-based website security risk anal-ysis. In this study, a method that can be performed through information disclosed on the Internet was proposed to measure the risk of a website. DNS information, IP information, and website history information are required to measure the risk of a website. In addition, global traffic rank-ing, malicious code distribution history, and HTTP access status can be checked in the website history information. In this study, information related to the security risk of websites in a total of 2,000 domains was collected and analyzed in 1,000 normal and malicious domains. Through the experiment results, 11 open information collection items were selected to measure the security risk of the website. This study presented the possibility of using public information collection to measure website security risk.

The common dolphin is the second most bycaught species in Korean waters. To provide key information about their habitat boundaries and hotspots for spatial conservation and management, the spatial use of this species was examined using data obtained from sighting and bycatch surveys of cetacean during the past 20 years. The 95% minimum convex polygon and 95% density contour of fixed kernel suggested that the boundary of home range of common dolphins is limited to the coastal region (Busan-Sokcho) of the East Sea/Sea of Japan. From 50% density contours dawn by kernel density estimation, it was suggested that their hotspots are around the cost of Ulsan-Pohang, Doghae, and Sokcho within the home range. Common dolphins are not at all distributed in the Yellow Sea. Hence, shallow waters, such as the coastal region of the Yellow Sea, are not suitable habitats for common dolphins.

Non-alcoholic steatohepatitis (NASH) is diagnosed by the occurrence of fat buildup, inflammation, and fibrotic changes within the liver. NASH has the capacity to proceed to the advancement of decompensated cirrhosis and carcinoma by inflammation and oxidative stress. Although Agrimonia pilosa has traditionally been used medicinal purposes, its effects on the liver remains incompletely elucidated. In this research, we assessed the therapeutic outcomes of Agrimonia pilosa extract (APE) on free fatty acid (FFA)-treated HepG2 cellular hepatic steatosis and in a choline-deficient, L-amino acid-defined, high-fat diet with 0.1% methionine (CDAHFD)-induced NASH mouse model. In FFA-treated cells, APE inhibited intracellular lipid accumulation, and regulated the mRNA and protein expressions of modulators of fatty acid (FA) synthesis as well as FA oxidation proteins, through down-regulation of the AMP-activated protein kinase/sirtuin 1 signaling pathway. In the CDAHFD-induced NASH mouse model, APE significantly enhanced liver histology and serum levels of liver damage. APE also significantly attenuated hepatic expression of mRNA and proteins related to FA synthesis, inflammation, and fibrosis. Furthermore, APE mitigated the expression levels of oxidative stress and endoplasmic reticulum stress. Overall, these discoveries indicate that Agrimonia pilosa has the potential to treat NASH by regulating hepatic lipid metabolism, alleviating inflammation, and mitigating oxidative stress.

β-apopicropodophyllin (APP), a derivative of podophyllotoxin (PPT), has been identified as a potential anti-cancer drug. This study tested whether APP acts as an an-ti-cancer drug and can sensitize colorectal cancer (CRC) cells to radiation treatment. APP had an anti-cancer effect against the CRC cell lines HCT116, and DLD-1, SW480 and COLO320DM with IC50 values of 7.88 nM, and 8.22 nM, 9.84 nM and 7.757 nM, respec-tively induction of DNA damage. Colonogenic and cell counting assays indicated that the combined treatment of APP and γ-ionizing radiation (IR) showed greater retardation of cell growth than either alone, suggesting that APP sensitizes CRC cells to IR. Annexin V-propidium iodide (PI) assays and immunoblot analysis showed that the combined treatment of APP and IR increased apoptosis in CRC cells compared with either APP or IR alone. Results obtained from the xenograft experiments also indicated that the combination of APP and IR enhanced apoptosis in in vivo animal model. Apoptosis induction by the combined treatment of APP and IR resulted from reactive oxygen species (ROS). Inhibition of ROS by N-acetylcysteine (NAC) restored cell viability and decreased the induction of apoptosis by APP and IR in CRC cells. Taken together, these results indicate that a combined treatment of APP and IR might promote apoptosis by inducing ROS in CRC cells.

To date, various chimeric lysins have been developed as efficacious antibiotics against multidrug-resistant bacteria, but direct comparisons of their antibacterial activities have been difficult due to the preparation of multiple recombinant chimeric lysins. Previously, we reported an E. coli cell-free expression method to screen better chimeric lysins against Staphylococcus aureus, but we still needed to increase the amounts of expressed proteins enough to be able to detect them non-isotopically for quantity comparisons. In this study, we improved the previous cell-free expression system by adding a previously reported artificial T7 terminator and reversing the different nucleotides between the T7 promoter and start codon to those of the T7 phage. The new method increased the expressed amount of chimeric lysins enough for us to detect them using Western blotting. Therefore, the qualitative comparison of activity between different chimeric lysins has become possible via the adjustment of the amount variables between samples without protein purification. We applied it to select more active chimeric lysins derived from our previously reported chimeric lysin (ALS2). Finally, we compared the antibacterial activities of our selected chimeric lysins with reported chimeric lysins (ClyC and ClyO) and lysostaphin, and determined the rank orders of antibacterial activities on different S. aureus strains in our experimental conditions.

Pancreatic cancer has a poor prognosis with its five-year survival rate lower than that of any other cancer type because it is difficult to detect in the early stages. Gemcitabine, a standard treatment for pancreatic cancer, often has poor outcomes for patients as a result of chemoresistance. Therefore, novel therapeutic targets must be identified to overcome gemcitabine-resistance. Here, we found that SLC38A5, a glutamine transporter, is more highly overexpressed in gemcitabine-resistant patients than in gemcitabine-sensitive patients. Furthermore, the deletion of SLC38A5 decreased the proliferation and migration of gemcitabine-resistant PDAC cells. We also found that the inhibition of SLC38A5 triggered the ferroptosis signaling pathway via RNA sequencing. Also, silencing SLC38A5 induced mitochondrial dysfunction and reduced glutamine uptake and glutathione (GSH) levels, and downregulated the expressions of GSH-related genes NRF2 and GPX4. The blockade of glutamine uptake negatively modulated the mTOR-SREBP1-SCD1 signaling pathway. Therefore, suppression of SLC38A5 triggers ferroptosis via two pathways that regulate lipid ROS levels. Similarly, we observed knockdown of SLC38A5 restored gemcitabine sensitivity by hindering tumor growth and metastasis in the orthotopic mouse model. Altogether, our results demonstrated that SLC38A5 could be a novel therapeutic target to overcome gemcitabine-resistance in PDAC therapy.

This paper examines the moral community thesis in the secular context of China. Using multilevel logistic regression, we test (1) whether both individual- (measured by affiliation with institutional religion) and aggregate-level religiosity (measured by the number of religious sites per 10,000 people in province) are inversely related to law and rule violations at the individual level and (2) whether the province-level religiosity enhances the inverse relationship between individual religiosity and the deviant behaviors. Results from analyzing data from the 2010 China General Social Survey and the Spatial Explorer of Religions show that both individual- and aggregate-level religiosity are inversely related to the odds of violating the law and various rules of government, transportation, workplace, and other organizations. However, the cross-level interactions are not significant across models, indicating that the contextual religiosity does not increase the effect of individual-level religiosity on deviance. Implications of findings for the moral community thesis are discussed.

Background and Objectives: The arthroscopic biceps rerouting (BR) technique was introduced as a novel technique for large-to-massive rotator cuff tears (LMRCT). This method can restore shoulder stability, and its biomechanical effect was verified in a cadaver experiment. Recent reports have shown favourable clinical outcomes. This study aimed to compare the clinical outcomes of partial repair with those of BR technique in LMRCT. Materials and Methods: We included 72 patients who had undergone LMRCT. Arthroscopic partial repair was performed in 31 patients (group I), while repair with the BR technique was performed in 41 patients (group II). Functional and imaging outcomes were evaluated and compared using a visual analogue scale for pain, range of motion (ROM), American Shoulder and Elbow Surgeons (ASES) score, Constant score, and Korean Shoulder Score (KSS) before the surgery and at 3, 6, and 12 months after the surgery and at the last follow-up. Tendon integrity was investigated using magnetic resonance in all the patients at 12 months postoperative. Results: Mean follow-up period was 22.11 ± 10.47 months (range, 12–53 months). Forward flexion (P=0.02) and external rotation at the side (P=0.04) were significantly higher in group II than in group I on postoperative day (POD) 12. For internal rotation, group II showed significant improvement compared to group I on POD 3 (P=0.002) and at six months postoperative (P=0.01). On POD 12, the ASES (P=0.047) and KSS (P=0.048) were better in group II. Significant improvements in pain and clinical scores were observed in both groups at the last follow-up. However, there were no significant differences in pain, clinical scores, or ROM between the two groups at the last follow-up. Retear of the repaired tendon was observed in nine patients in group I (29.03%) and 8 in group II (19.51%, P = 0.35). Conclusions: Partial repair and repair using the BR technique effectively improved clinical and radiologic outcomes. The BR technique revealed early recovery of ROM and better clinical results than partial repair until one year postoperatively. This could be a useful method in LMRCT.

Intrahepatic cholangiocarcinoma (ICCA) is a malignant epithelial neoplasm characterized by biliary differentiation within the liver. ICCA is molecularly heterogeneous and exhibits a broad spectrum of histopathological features. It is a highly aggressive carcinoma with high mortality and poor survival rates. ICCAs are classified into two main subtypes: small duct type and large duct types. These two tumor types have different cell origins and clinicopathological features. ICCAs are characterized by numerous molecular alterations, including mutations in KRAS, TP53, IDH1/2, ARID1A, BAP1, BRAF, SAMD4, and EGFR, and FGFR2 fusion. Two main molecular subtypes–inflammation and proliferation–have been proposed. Recent advances in high-throughput assays using next-generation sequencing have improved our understanding of ICCA pathogenesis and molecular genetics. The diagnosis of ICCA poses a significant challenge for pathologists because of its varied morphologies and phenotypes. Accurate diagnosis of ICCA is essential for effective patient management and prognostic determination. This article provides an updated overview of ICCA pathology, focusing particularly on molecular features, histological subtypes, and diagnostic approaches.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Oscillometric blood pressure (BP) devices currently estimate a single point but do not identify fluctuations in BP or distinguish them from variations in response to physiological properties. In this paper, to analyze BP normality based on oscillometric measurements, we use statistical approaches including kurtosis, skewness, Kolmogorov-Smirnov, and correlation tests. Then, to mitigate uncertainties, we use a deep neural network (DNN) to determine the confidence limits (CLs) of BP measurements based on their normality. The proposed DNN regression model decreases the standard deviation of error (SDE) of the mean error (ME) and the mean absolute error (MAE) and reduces the uncertainty of the CLs and SDEs of the proposed technique. We validate the normality of the distribution of the BP estimation distribution which fits the Gaussian distribution very well. We use a rank test in the DNN regression model to demonstrate the independence of the artificial SBP and DBP estimations. First, we perform statistical tests to verify the normality of the BP measurements for individual subjects. The proposed methodology provides accurate BP estimations and reduces the uncertainties associated with the CLs and SDEs based on the DNN regression estimator.

The runtime environment is an important concern for self-adaptive systems (SASs). Although researchers have proposed many approaches for developing SASs that address the issue of uncertain runtime environments, the understanding of these environments varies depending on the objectives, perspectives, and assumptions of the research. Thus, the current understanding of the environment in SAS development is ambiguous and abstract. To make this understanding more concrete, we describe the landscape in this area through a systematic literature review (SLR). We examined 128 primary studies and 14 unique environment models. We investigated concepts of the environment depicted in the primary studies and the proposed environment models based on their ability to aid in understanding. This illustrates the characteristics of the SAS environment, the associated emerging environmental uncertainties, and what is expressed in the existing environment models. This paper makes explicit the implicit understanding about the environment made by the SAS research community and organizes and visualizes them.

Recent scholarship highlights the significant environmental impact of the expanding hydraulic fracturing industry, necessitating up-to-date, comprehensive, national-scale assessments. Addressing this gap, this literature review provides a thorough analysis of the contamination and induced seismicity associated with shale-gas hydraulic fracturing in the United States. Employing systematic reviews of literature and federal reports up until July 2023, this study reveals multiple areas of concern. Notably, water and soil contamination, seismic activity, and air pollution are identified as significant challenges linked to shale gas extraction. However, ongoing studies are actively exploring remediation strategies, including advancements in monitoring and treatment technologies, aimed at mitigating the impact of contamination. These findings underscore the need for stringent regulations, continuous research, and effective management practices. This work emphasizes the importance of a collaborative approach that leverages field studies, experimental investigations, and computational advancements to ensure the responsible development of shale gas resources.

Corrosion is considered as one of the main factors in the structural performance deterioration of steel members. In this study, experimental and numerical methods were used to assess the reduction in compressive strength of short tubular steel columns with local corrosion damage. The corrosion damage was varied with different depths (0, 1.5, 2, 3, 4, 4.5, and 6 mm), height (0, 20, 40, 60, 80, 100, 120, 140, 160, and 180 mm), circumference (0, 90, 180, 270, and 360°), and location along the column. A parametric numerical study was performed to establish a correlation between the residual compressive strength and the severity of corrosion damage. The results showed that as the corrosion depth, height and circumference increased, the compressive strength decreased linearly. As for the corrosion height, the residual compressive strength became constant after decreasing linearly when the corrosion height was greater than the half-wavelength of buckling of the short columns. An equation is presented to evaluate the residual compressive strength of short columns with local corrosion wherein the volume of the corrosion damage was used as a reduction factor in calculating the compressive strength. The percentage error using the presented equation was found to be within 11.4%.

This study presents structural analysis and optimization for the lightweight design of a buoyant rotor-type permanent magnet (BRPM) generator, which was first presented in Bang (2010), and compares its structural performances to a conventional generator with a spoke arm-type rotor and stator. The main benefit of a BRPM is that it can be realized as a bearing-less drive system, free from the mechanical failure of rotor bearings, by using a buoyant rotor. Also, the deformation of a generator by blade vibration can be effectively suppressed using joint couplings between the blades and the rotor. For the design optimization, the objective is set as the mass of the rotor and the stator, and the maximum deformation of the airgap clearance between the rotor and the stator by external forces is constrained below 10% of the gap width. The commercial software Optistruct is used for the analysis and optimization. In this investigation, the analysis and optimization are conducted for a 10 MW wind turbine generator. However, the proposed methods can be extended to larger generator designs without requiring considerable modification. The mass of the opti-mized 10MW BRPM generator is 160.7 tons (19.3 tons for the rotor and 141.4 tons for the stator) while that of an optimized conventional spoke arm-type generator is obtained as 325.6 tons.

Hispidulin is a natural bioactive flavonoid that has been studied for its potential therapeutic properties, including its anti-inflammatory, antioxidant, and neuroprotective effects. The aim of this study was to explore whether hispidulin could inhibit endothelial inflammation triggered by Porphyromonas gingivalis (P. gingivalis) lipopolysaccharide (LPS). The adhesion of monocytes to vascular endothelium was evaluated by in vitro and ex vivo monocyte adhesion assays. We analyze the migration of monocytes across the endothelial layer using transmigration assay. The result showed that treatment with hispidulin decreased P. gingivalis LPS-induced the adhesion of monocytes to endothelial cells and their migration by suppressing P. gingivalis LPS-triggered expression of intercellular adhesion molecule-1 (ICAM-1) through downregulating nuclear factor-қB (NF-қB). In addition, hispidulin inhibited P. gingivalis LPS-induced mitogen-activated protein kinases (MAPKs) and AKT in endothelial cells. Altogether, the results indicate that hispidulin suppresses vascular inflammation induced by P. gingivalis LPS. Mechanistically, it prevents the adhesion of monocytes to the vascular endothelium and migration and inhibits NF-қB, MAPKs, and AKT signaling in endothelial cells.

A real-time flight simulation tool is proposed using a Virtual Reality Head-Mounted Display (VR-HMD) for airships operating in beyond the line-of-sight (BLOS) conditions. Particularly, the VR-HMD is developed for stratospheric airships flying at low/high altitudes. The proposed flight simulation tool uses the corresponding aerodynamics characteristics of the airship, the buoyancy effect, mass balance, added mass, propulsion contributions and ground reactions in the FlightGear Fight Simulator (FGFS). The VR headset has been connected to the FGFS along with the radio controller containing the real-time orientation/state of each button that is also simulated to provide better situational awareness and a Head-Up Display (HUD) that has been developed to provide the required flight data. In this work, a system was developed to connect the FGFS and the VR-capable graphics engine, Unity, to a PC and a wireless VR-HMD in real-time with minimal lag between data transmission. A balance was found for FGFS to write to a CSV file at a period of 0.01s. For Unity, the file was read every frame which translates to around 0.0167s (60 Hz). A test procedure was also conducted with a similar rating technique based on the NASA TLX questionnaire that identifies the pilot’s spare mental capacity when completing an assigned task to assure the comfortability of the proposed VR-HMD. Accordingly, a comparison has been made for the aircraft control using the desktop simulator and the VR-HMD tool. Results, showed that the current iteration of the system is ideal to train pilots on using similar systems in a safe and immersive environment. Furthermore, such an advanced portable system may even increase the situational awareness of pilots and allow them to complete a sizeable portion of actual flight tests with the same data transmission procedures in simulation. The resulting VR-HMD flight simulator is also conceived to express the ground control station (GCS) concept and transmit flight information as well as the point of view (POV) visuals in real-time using the real environment broadcasted using an onboard camera.

The network pharmacology (NP) approach is a valuable novel methodology for understanding the complex pharmacological mechanisms of medicinal herbs. In addition, various in silico analysis techniques combined with the NP can improve the understanding of various issues in natural product research. This study assessed the therapeutic effects of Arum ternata (AT), Poria cocos (PC), and Zingiber officinale (ZO) on hyperlipidemia after network pharmacologic analysis. A protein–protein interaction (PPI) network of forty-one key targets was analyzed to discover core functional clusters of the herbal compounds. The KEGG pathway and gene ontology (GO) term enrichment analysis identified significant categories of hypolipidemic mechanisms. The STITCH database indicated a high connection with several statin drugs deduced by the similarity in targets. AT, PC, and ZO regulated the genes related to the energy metabolism and lipogenesis in HepG2 cells loaded with free fatty acids (FFAs). Furthermore, a combinational effect of the mixture of three herbs was found. The herbal combination exerted superior efficacy compared to a single herb, particularly in regulating acetyl-CoA carboxylase (ACC) and carnitine palmitoyltransferase 1 (CPT-1). In conclusion, the network pharmacologic approach was used to assess potential targets of the herbal combination for treatment. Experimental data from FFAs-induced HepG2 cells suggested that the combination of AT, PC, and ZO might attenuate hyperlipidemia and its associated hepatic steatosis.

Edge computing reduces the response time of real-time services with handling dynamic traffics reliably. Edge servers with limited resources utilize container technology that provides a lightweight execution environment. When deploying containers in edge servers, a container image is required and is downloaded from a remote registry. Therefore, these operations are dependent on network overhead between the container deployment system and the remote registry. Through motivation experiments, we show that container pooling time increases in proportion to physical distance and has characteristics that vary flexibly depending on runtime time. In this study, we define a system model for high-speed registry deployment in this edge system and propose a clustering technique into k groups based on the network overhead and affinity of the regionally distributed edge servers that make up the edge system. Also, considering idle resources, we propose a technique to deploy a registry after electing a leader for each cluster. A simulation experiment is conducted to verify the performance of the proposed technique and shows that performance improvement can be achieved regardless of the number of edge servers and the k value.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The increasing amount of data transmitted through digital broadcasting and communication channels requires efficient transmission methods that make the most of limited resources such as frequency, time, and power. The layered division multiplexing (LDM) system, which is adopted by the Advanced Television Systems Committee (ATSC) 3.0 standard, is considered one of a solution for achieving efficient transmission. Additionally, the layered time-division multiplexing (LTDM) and time layered division multiplexing (TLDM) systems have been developed as well. These layered transmission systems, utilizing multiple physical layer pipes (PLPs), offer a wide range of services including mobile and rooftop TV. To compare the efficiencies of different layered transmission systems, the article introduces the concept of normalized channel capacity. This measure allows for a fair comparison among the systems by taking into account the specific channel capacity requirements of each service. By summing the normalized channel capacities, a method is proposed to select the most efficient transmission system among the four systems: LDM, LTDM, TLDM, and time division multiplexing (TDM). The Lagrange multiplier method is employed to find the parameters that maximize the sum of the normalized channel capacities in these systems. Through simulations conducted with the determined parameters, it is demonstrated that the LDM system exhibits the highest efficiency among the four systems.

A flavonoid Astragalin (kaempferol-3-O-β-D-glucopyranoside, Ast) has several biological activities including anti-oxidant, anti-HIV, and anti-allergic effects. Nonetheless, its insolubility in hydrophilic solvents imposes restrictions on its therapeutic applications. In this study, we investigated the effects of water-soluble astragalin-galactoside (kaempferol-3-O- β-D-isomaltotrioside, Ast-Gal) on dendritic cell (DC) maturation and T helper (Th) cell-mediated immune responses. Ast-Gal significantly increased maturation and activation of DCs through up-regulation of surface markers, such as CD80, CD86, and MHC II in a dose-dependent manner, while Ast had little effects. Also, Ast-Gal-treated DCs markedly secreted immune-stimulating cytokines such as IL-1β, IL-6, and IL-12. Importantly, Ast-Gal strongly increased expression of IL-12, a polarizing cytokine of Th1 cells. In a co-culture system of DCs and CD4+ T cells, Ast-Gal-treated DCs preferentially differentiates naïve CD4+ T cells into Th1 cells. The addition of neutralizing IL-12 mAb to cultures of Ast-Gal-treated DCs and CD4+ T cells significantly increased IFN- γ production, thereby indicating that Ast-Gal-stimulated DCs enhance the Th1 response through IL-12 production by DCs. Injection with Ast-Gal-treated DCs in mice increased IFN-γ-secreting Th1 cell population. Collectively, these findings indicate that hydrophilically modified astragalin can enhance Th1-mediated immune responses via DCs, and point to a possible application of water-soluble astragalin-galactoside as an immune adjuvant.

We propose a deep learning algorithm that directly compensates for luminance degradation owing to the deterioration of organic light emitting diode (OLED) devices to address the burn-in phenomenon of OLED displays. Conventional compensation circuits are encumbered by a high cost of development and manufacturing processes owing to their complexity. However, given that deep learning algorithms are typically mounted on a system on chip (SoC), the complexity of the circuit design is reduced, and the circuit can be reused by re-learning only the changed characteristics of the new pixel device. The proposed approach comprises deep feature generation and multi-stream self-attention, which decipher the importance of the variables, and the correlation between burn-in-related variables. It also utilizes a deep neural network that identifies the nonlinear relationship between the extracted features and luminance degradation. Thereafter, the luminance degradation is estimated from the burn-in-related variables, and the burn-in phenomenon can be addressed by compensating for the luminance degradation. The experimental results revealed that compensation was successfully achieved within an error range of 4.56%, and demonstrate the potential of a new approach that can mitigate the burn-in phenomenon by directly compensating for pixel-level luminance deviation.

This study examined the impact of Vibration-Assisted Drilling (VAD) on hole quality and residual stress in Ti-6Al-4V ELI material. Ti-6Al-4V ELI possesses excellent mechanical properties but presents challenges in machining, including chip evacuation, burr formation, and elevated cutting temperatures. VAD, particularly Low-Frequency Vibration-Assisted Drilling (LF-VAD), has been explored as a potential solution to address these issues. The research com-pares LF-VAD with conventional drilling (CD) under various cutting and cooling conditions. LF-VAD exhibits higher maximum cutting forces under specific conditions, which result in accel-erated tool wear. However, it also demonstrates lower RMS (Root Mean Square) forces com-pared to CD, offering better control over chip formation, reduced burr formation, and improved surface roughness within the hole. Furthermore, LF-VAD generates greater compressive residual stresses on the hole's inner surface compared to CD, suggesting enhanced fatigue performance. These findings indicate that LF-VAD holds promise for improving hole quality, fatigue life, and overall component durability in Ti-6Al-4V machining applications.

Juvenile hormones (JH) play crucial roles in insect development, reproduction, and other physi-ological functions. Because JH is specific to arthropods, including insects, it has long been stud-ied for use in pest control. Accordingly, this study aimed to identify the substances that act as JH disruptors from edible plants. Curcuminoids generally exhibit a wide range of biological ac-tivities, such as antioxidant, anti-inflammatory, antibacterial, and insecticidal properties, and they exhibit insect growth inhibitory effects. Demethoxycurcumin and bisdemethoxycurcumin, two curcuminoids from the turmeric plant Curcuma longa L. inhibit the formation of a metho-prene-tolerant (Met)–Taiman (Tai) heterodimer complex as shown through in vitro yeast two-hybrid assays. An artificial diet containing 1% (w/v) demethoxycurcumin or bisdemethox-ycurcumin reduced the number of larvae, leading to no pupal development. Building on our re-sults regarding curcuminoids, researchers can use our study as a reference to develop eco-friendly pesticides.

Background: Disparity in adult mortality (AM) with reference to social dynamics and health care has not been sufficiently examined. This study aimed to identify the gap in the understanding of AM in relation to religion, political stability, economic level, and universal health coverage (UHC). Methods: A cross-national study was performed with different sources of data, using the administrative record linkage theory. We created a new data set using data from the 2013 World Bank data catalogue by region, The Economist (Political instability index 2013), Stuckler David et al. (Universal health coverage, 2010), and religious categories of all UN country members. Descriptive statistics, a t-test, an ANOVA followed by a post hoc test, and a linear regression were used where applicable. Result: The average AM rate for males and females was 0.20 ± 0.10 and 0.14 ± 0.10, respectively. AM was significantly higher in economically weak countries, countries with political instability, countries with traditional religion, without achievement of UHC, and Sub-Saharan Africa (p<0.01). There was high disparity of AM between countries with and without UHC (F = male: 61.89, female: 51.85, p<0.001) and between groups with low and high income (F = male: 36.33, female: 42.39, p<0.001). UHC and political stability would significantly reduce AMR by > 0.41 in both sexes and high economic status would reduce male AMR by 0.44, and female AMR by 0.70, in relation to countries without UHC, with political instability, and low economic status. Conclusions: Disparities in AM can be reduced after the achievement of UHC and economically productive activities for those adults affected by conflict and political unrest.

In industrial settings, gears play a crucial role by assisting various machinery functions such as speed control, torque manipulation, and altering motion direction.The malfunction or failure of these gear components can have serious repercussions, resulting in production halts and financial losses. As a result, there is an increasing requirement to monitor the state of these components in order to avoid such issues from occurring. To address this need, research efforts have focused on early defect detection in gears in order to reduce the impact of possible failures. This study focused on analyzing vibration and thermal datasets from two extruder machine gearboxes using an autoencoder Long Short-Term Memory (LSTM) model. The major goal is to implement an outlier detection approach to detect and classify defects. The results of this study highlighted the extraordinary performance of the Autoencoder LSTM model, which achieved an impressive accuracy rate of 94.42% in recognizing malfunctioning gearboxes within the extruder machine system. Furthermore, the study used a thorough global metrics evaluation methodology to further test the model’s dependability and efficacy, consequently substantiating the proposed approach’s validity.

Burrs form due to plastic deformation of materials during machining processes, such as milling and drilling. Deburring can be very difficult when the burrs are not easily accessible for removal. In this study, abrasive flow machining (AFM) was adopted for deburring the edges of milling specimens. Based on the experimental observations on AL6061 specimens, the deburring performance was characterized in terms of flow speed, the local curvature of the streamline near the burr edge, and shear stress. A new objective function that can predict the extent of deburring is proposed based on these characteristics and validated through experiments. Based on this new objective function, a prediction of deburring performance on the burr edge of the intersecting holes with offset was performed. The results between the predicted and experimental observation results were in reasonable agreement.

Background In this study, we describe our clinical experience with the fifth-generation of a breast implant with a smooth, fine surface from a Korean manufacturer (BellaGel^Ò SmoothFine; HansBiomed Co. Ltd., Seoul, Korea) in Asian women. Methods We analyzed 223 women (mean age=35.28±9.45 years and mean follow-up period=12.03±2.48 months), comprising 118 bilateral cases and 109 unilateral ones, who received breast augmentation using the BellaGel^Ò SmoothFine at our hospital between June 4, 2018 and February 28, 2019. For safety assessment, we analyzed frequencies of postoperative complications and overall survival of the BellaGel^Ò SmoothFine. Results Postoperatively, complications (12 cases, 5.38%) include asymmetry (3 cases, 1.35%), hematoma (2 cases, 0.90%), hypertrophic scars (2 cases, 0.90%), wound disruption (2 cases, 0.90%), rippling (1 case, 0.45%), capsular contracture (1 case, 0.45%), stretch deformities with skin excess (1 case, 0.45%). In addition, time-to-events were calculated as 10.94±0.64 months (95% CI 9.69-12.19) and the survival rate reached 0.290±0.168 (95% CI 0.094-0.901) at 12 months postoperatively. Conclusions Here, we describe our clinical experience with the BellaGel^Ò SmoothFine. Our results are of significance in that this is the first report about the fifth-generation of a breast implant with a smooth, fine surface from a Korean manufacturer in Asian women.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

The loss of vitamin D3 upregulated protein 1 (VDUP1) has been implicated in the pathogenesis of various inflammation-related diseases. Notably, reduced expression of VDUP1 has been observed in clinical specimens of ulcerative colitis (UC). However, the role of VDUP1 deficiency in colitis remains unclear. In this study, we investigated the role of VDUP1 in dextran sulfate sodium (DSS)-induced experimental colitis in mice. VDUP1-deficient mice were more susceptible to DSS-induced colitis than their wild-type (WT) littermates after 2% DSS administration. VDUP1-deficient mice exhibited an increased disease activity index (DAI) and histological scores, as well as significant colonic goblet cell loss and an increase in apoptotic cells. These changes were accompanied by a significant decrease in MUC2 mRNA expression and a marked increase in proinflammatory cytokines and chemokines within damaged tissues. Furthermore, phosphorylated NF-B p65 expression was significantly upregulated in damaged tissues in the context of VDUP1 deficiency. VDUP1 deficiency also led to significant infiltration of macrophages into the site of ulceration. An in vitro chemotaxis assay confirmed that VDUP1 deficiency enhanced bone marrow-derived macrophage (BMDM) chemotaxis induced by CCL2. Overall, the loss of VDUP1 plays a critical role in the pathogenesis of UC, and blocking VDUP1 dissociation may represent a promising therapeutic strategy for the treatment of UC.

Prompt removal of misfolded membrane proteins and misassembled membrane protein complexes is essential for membrane homeostasis. However, the elimination of these toxic proteins from the hydrophobic membrane environment has high energetic barriers. Transmembrane FtsH is the only known ATP-dependent protease responsible for this task, unlike other well-studied soluble ATP-dependent proteases. The mechanisms by which FtsH recognizes, unfolds, translocates, and proteolyzes its substrates remain unclear. Here, we report the crystal structures of the Thermotoga maritima FtsH periplasmic domain (PD) in an associative trimeric state at a 1.5-1.95 Å resolution. We also describe the pH-dependent oligomerization states of the isolated PD using dynamic light scattering. These observations help us understand how FtsH recognizes membrane-anchored misfolded proteins.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Research on piezo-composite actuators has been actively conducted over the past two decades as a response to strong demand for light, compact actuators to replace electro-magnetic motor actuators in micro robots, small flying drones, and compact missile systems. Layered piezo-composite unimorph actuators have been studied to provide active vibration control of thin-walled aerospace structures, control the shapes of aircraft wing airfoils, and control the fins of small missiles, because they require less space and provide better frequency responses than conventional electro-magnetic motor actuator systems. However, based on the limited actuation strains of conventional piezo-composite unimorph actuators with poly-crystalline piezoelectric ceramic layers, they have not been implemented effectively as actuators for small aerospace vehicles. In this study, a lightweight piezo-composite unimorph actuator (LIPCA-S2) was manufactured and analyzed to predict its flexural actuation displacement. It was found that the actuated tip displacement of a piezo-composite cantilever could be predicted accurately using the proposed prediction model based on the nonlinear properties of the piezoelectric strain coefficient and elastic modulus of a piezoelectric single crystal.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Background: Pathologic complete response (pCR) of breast cancer after neoadjuvant chemotherapy (NAC) is highly related to molecular subtypes. Patients who achieved tumor pCR after NAC have a better prognosis. However, despite of better prognosis, pCR patients have a potential for recurrence. There is little evidence of risk factors of recurrence in patients with pCR. We aim to analyze factors associated with tumor recurrence in patients who achieved pCR. Methods: This study retrospectively reviewed the data of patients diagnosed with breast cancer who achieved pCR after receiving NAC between January 2009 and December 2018 in Samsung Medical Center. pCR was defined as no residual invasive cancer in the breast and axillary nodes even if there is residual ductal carcinoma in situ (ypT0 or ypTis with ypN0). Breast cancers are classified into 4 subtypes based on hormone receptors (HR) and human epithelial growth factor receptor 2 (HER2) status. Patients who had bilateral breast cancer, inflammatory breast cancer, distant metastasis, unknown subtype, and histologically unique case were excluded from the study. Results: In total 483 patients were included in this study except for patients who corresponded to the exclusion criteria. The median follow-up duration was 59.0 months (range, 0.5-153.3 months). Breast cancer recurred in 4.1% of patients (20 of 483). There was a significant difference in clinical T (p = .004) and clinical N (p = .034) stage in the Kaplan-Meier curve for disease-free survival. Molecular subtypes (p = .573), Ki67 (p = 1.000), and breast surgery type (p = .574) were not associated with tumor recurrence in patients who achieved pCR after NAC. In the clinical T stage and clinical N stage, there was a significant difference between recurrence and no-recurrence groups (clinical T stage; p = .045, clinical N stage; p = .002). Univariable Cox regression revealed statistical significance in the clinical T stage (p = .049) and clinical N stage (p = .010), while multivariable Cox regression demonstrated non-significance in the clinical T stage (p = .320) and clinical N stage (p = .073). Conclusion: Results in this study showed that clinical T, clinical N stage, and molecular subtypes were not statistically significant predictors of recurrence in patients who achieved pCR after NAC. It is hypothesized that a multicenter-based study would lead to the identification of factors as predictors of recurrence after achieving pCR.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Autonomous Underwater Vehicles (AUVs) are emerging as pivotal tools in underwater applications such as seafloor exploration and the inspection of pipelines or cables. Traditional land-based avoidance methods prove insufficient when applied to the complex underwater environment, largely due to the unique constraints presented by marine environments and the specific dynamics of AUVs. In this study, we introduce an improved stream function-based obstacle avoidance algorithm specifically tailored for autonomous underwater vehicles. The proposed algorithm is based on a stream function that is derived from the stream function. The stream function is characterized by a radial histogram for the cost function. In addition, constraints related to the maximum path curvature are discussed to optimize the utility of the path. Our exhaustive simulation cases validate the robustness and adaptability of the proposed algorithm, demonstrating its ability to produce feasible and optimized avoidance paths in a variety of scenarios.

Cell-penetrating peptides (CPPs), a group of small peptides capable of promoting the transport of molecular cargo across the plasma membrane, have become important tools in promoting the cellular uptake of exogenously delivered macromolecules. GV1001, a peptide derived from a reverse-transcriptase subunit of telomerase (hTERT) and developed as a vaccine against various cancers, reportedly has unexpected CPP properties. Unlike typical CPPs, such as the HIV-1 TAT peptide, GV1001 enabled the cytosolic delivery of macromolecules such as proteins, DNA and siRNA via extracellular heat shock protein 90 (eHSP90) and 70 (eHSP70) complexes. The eHSP-GV1001 interaction may have biological effects in addition to its cytosolic delivery function. GV1001 was originally designed as a MHC class II-binding cancer epitope, but its CPP properties may contribute to its strong anti-cancer immune response relative to other telomerase peptide-based vaccines. Cell signaling via eHSP-GV1001 binding may lead to unexpected biological effects, such as direct anticancer or antiviral effects. In this review, we focus on the CPP effects of GV1001 bound to eHSP90 and ehsp70.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Background: Autonomic neuropathy commonly arises as a long-term complication in end stage kidney disease (ESKD) and can be diagnosed from heart rate variability (HRV), calculated from electrocardiogram (ECG) recordings. There is limited data about HRV using real-time ECG to predict HD efficiency in patients with ESKD who are routinely doing HD in real-world practice. Methods: Total of 50 patients (62.1 ± 10.7 years) with ESKD underwent continuous real-time ECG monitor (237.4 ± 15.3 min) during HD for HRV using remote monitoring system and checked electrolyte levels before/after HD. And we compared HRV according to electrolyte levels. Results: During the monitor, we checked total 2374 times of ECG and electrolyte level simultaneously of all patients. Both time and frequency domain HRV were higher when the patients had lower K+ level (&lt;0.5 mEq/L) and P+ level change (&lt;2 mEq/L) before/after HD as compared with those with higher K+ level (≥0.5 mEq/L) and P+ level (≥2 mEq/L) change respectively. In addition, there were higher incidence of arrhythmic events including atrial/ventricular premature complexes, even though no difference of mean heart rate in patients with lower K+ and P+ level change group (p &lt; 0.001). Conclusions: Higher HRV was independently associated with poor controlled K+ and P+ level during hemodialysis in patients with ESKD. This is further substantiated by independent continuous associations between real-time measures of higher HRV and K+ and P+ level. These data strongly suggest that cardiac autonomic dysfunction can be caused by lower change of electrolytes before/after hemodialysis alone.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

To analyze the combined response of ocular cyclotorsion and head tilt during body tilt and to interpret the physiologic role of those movements, each of the three subjects completed six different experiments of body tilt not fixating their head movements using a flight simulator, which consisted of combinations of three tilt angles (30, 45, and 60) and two visual conditions. Head tilt and ocular cyclotorsion of the right eye before, during, and after the tilt maneuver were recorded and analyzed by time sequence. In the active tilting phase, the right eye showed a stepladder pattern of multiple repeats of fast and slow cyclotorsion along with head tilt to obtain maximum visual information. During the stationary tilting phase, there occurred a small amount (mean, 2.3) of ocular cyclotorsion which was reciprocal to that of head tilt. The visual cue of body tilt through the central visual field induced a larger amount of head tilt but affected little ocular cyclotorsion. The maximum degree of ocular cyclotorsion during each experiment was 10.2 on average. In conclusion, the combined response of ocular cyclotorsion and head tilt develops during body tilt and it compromises the conflicting needs between binocular vision and gravitational orientation.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

This study aimed to identify the utility of diffusion-weighted magnetic resonance (MR) imaging with an apparent diffusion coefficient (ADC) map as a predictor of the intrahepatic response of hepatocellular carcinoma (HCC) to cisplatin-based hepatic arterial infusion chemotherapy (HAIC). We retrospectively evaluated 113 consecutive patients with HCC who underwent gadoxetic acid-enhanced and diffusion-weighted MR imaging. The appropriate cutoff for the tumor-to-liver ADC ratio was determined to be 0.741. Of the 113 patients, 51 (45%) presented with a tumor-to-liver ADC ratio < 0.741. Evaluation of the intrahepatic treatment response after 2-3 cycles of HAIC in these 51 patients revealed that 20 patients (39%) experienced an objective response to HAIC. On the other hand, only 10 of the 62 patients with a tumor-to-liver ADC ratio ≥ 0.741 (16%) experienced an objective response. Thus, the objective response rate was significantly higher in patients with a tumor-to-liver ADC ratio < 0.741 than in those with a tumor-to-liver ADC ratio ≥ 0.741 (P = 0.006). Multivariate logistic regression analysis using parameters including perfusion alteration, percentage of a non-enhancing portion, and tumor-to-liver ADC ratio revealed that a tumor-to-liver ADC ratio < 0.741 (odds ratio 3.03; P = 0.015) is the sole predictor of an objective response to HAIC. Overall survival rates were significantly higher in patients with objective responses to HAIC than in those without objective responses (P = 0.001 by log-rank test). In conclusion, patients with unresectable HCC with a tumor-to-liver ADC ratio < 0.741 showed a favorable intrahepatic response to HAIC. Therefore, diffusion-weighted MR imaging can play a critical role as a predictor of response to cisplatin-based HAIC in unresectable HCC.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

The educational and play-related activities of children are proceeded mainly indoors in a kin-dergarten. The exposure of children to high concentrations of PM2.5 and CO2 indoors have leaded to various harmful effects and negatively impact educational outcomes in a kindergarten. Therefore, this study presents a numerical model of CO2 and PM2.5 concentration based on two classrooms in a kindergarten. Using this numerical model, we present different scenarios of oper-ating mechanical ventilation and air purifiers in kindergartens with the aim of optimizing for reducing the concentrations of CO2 and PM2.5. We found that the amount of ventilation required to maintain good air quality, per child, was approximately 20.4 m3/h. However, we also found that as the amount of ventilation increased, so did the concentration of indoor PM2.5; we found that this issue can be resolved through the use of a high-grade filter (i.e., a MERV 13 grade filter with a collection efficiency of 75%). This study provides a scientific basis for reducing PM2.5concentrations in kindergartens, while keeping CO2 levels low.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Neurofibromatosis type 2 (NF2) is a genetic syndrome characterized by the growth of benign tumors in the nervous system, particularly bilateral vestibular schwannomas, meningiomas, and ependymomas. This review consolidates the current knowledge on NF2 syndrome, emphasizing the molecular pathology associated with the mutations in the gene of the same name, the NF2 gene, and the subsequent dysfunction of its product, the Merlin protein. Merlin, a tumor suppressor, integrates multiple signaling pathways that regulate cell contact, proliferation, and motility, thereby influencing tumor growth. The loss of Merlin disrupts these pathways, leading to tumorigenesis. We discuss the roles of another two proteins potentially associated with NF2-deficiency as well as Merlin: Yes-associated protein 1 (YAP), which may promote tumor growth, and Raf kinase inhibitory protein (RKIP), which appears to suppress tumor development. Additionally, this review discusses the efficacy of various treatments, such as molecular therapies that target specific pathways or inhibit neomorphic protein-protein interaction caused by NF2-deficiency. This overview not only expands on the fundamental understanding of NF2 pathophysiology but also explores the potential of novel therapeutic targets that affect the clinical approach to NF2 syndrome.

Since 2007, highly pathogenic clade 2.3.2 H5N1 avian influenza A [A(H5N1)] viruses have evolved to clade 2.3.2.1a, b and c, and currently only 2.3.2.1c A(H5N1) viruses circulate in wild birds and poultry. During antigenic evolution, clade 2.3.2.1a and c A(H5N1) viruses acquired both S144N and V223I mutations around the receptor binding site of hemagglutinin (HA), with S144N generating an N-glycosylation sequon. We introduced single or combined reverse mutations, N144S and/or I223V, into the HA gene of clade 2.3.2.1c A(H5N1) virus and generated PR8-derived, 2 + 6 recombinant A(H5N1) viruses. When we compared replication efficiency in embryonated chicken eggs, mammalian cells and mice, the recombinant virus containing both N144S and I223V mutations showed increased replication efficiency in avian and mammalian hosts and pathogenicity in mice. The N144S mutation significantly decreased avian receptor affinity and egg white inhibition, but not all mutations increased mammalian receptor affinity. Interestingly, the combined reverse mutations dramatically increased the thermostability of HA. Therefore, the adaptive mutations possibly acquired to evade avian immunity may decrease viral thermostability as well as mammalian pathogenicity.

We propose a wave-like design on the surface of cathode channels (wave form cathode channels) to improve oxidant delivery to gas diffusion layers (GDLs) [1-2]. We performed experiments using PEMFCs combined with wave form surface design on cathodes. We varied the factors of the distance between wave-bumps (the Adhesive distance, AD), and the size of the wave-bumps (the Expansion ratio, ER). The ADs are 3, 4, and 5 times the size of the half-circle bump’s radius, and the ERs are 1/1.5, 1/2, and 1/3 times the channel’s height. We evaluated the performances of the fuel cells, and compared the current-voltage (I-V) relations. For comparison, we prepared PEMFCs with conventional flat-surfaced oxygen channels. Our aim in this work is to identify fuel cell operation by modifying the surface design of channels, and ultimately to find the optimal design of cathode channels that will maximize fuel cell performance.

Developing high performance HVAC system using natural refrigerants including carbon dioxide (CO₂) has been important in respect of environmental preservation and associated technologies. Thus studies to optimize the HVAC (heating ventilation air conditioner) system using natural refrigerants through clarifying the cycle performance characteristics are necessary. The CO₂ heat pump system using air and water sources was consisted to examine its performance characteristics, and by varying conditions of several factors that affect or characterize the system performance like the amount of refrigerant charge, EEV (electronic expansion valve) opening, and internal heat exchanger under cooling mode. The performance characteristics of CO₂ heat pump system were tested by using an air enthalpy calorimeter. In the case of the CO₂ heat pump system without internal heat exchanger, the opening of #3 EEV and #4 EEV was 60% and refrigerant charge amount was 5,600g. However, in the case of that with internal heat exchanger, the best performance was obtained when the opening of #2 EEV is 20%. From the present studies, it was observed that the performance variation and operational characteristics of the CO₂ heat pump system were affected by design factors like refrigerant charge amount, EEV opening, and internal heat exchanger and thereby, the configuration on an optimal operation conditions of the system was enabled.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.