Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

An analytical method was established by HPLC-DAD-ELSD with C18-NH2 column tandem for the simultaneous determination of hydrophobic components atractylenolide I, II, III, atractylone and hydrophilic compounds glucose, fructose and sucrose in the dried rhizome of Atractylodes macrocephala Koidz (a natural raw material for health foods, Bai-Zhu aka. in Chinese). The method combines different separation capabilities of reversed-phase liquid chromatography and hydrophilic interaction liquid chromatography, can provide a new choice for the simultaneous determination of hydrophilic and hydrophobic compounds in traditional Chinese medicines and health foods. It provided a reference method for the quality control of Bai-Zhu. The results showed that the linear correlation coefficients of the established column tandem chromatographic method were all greater than 0.9990, the relative standard deviation was 0.1%-2.8%, and the average recovery was 96.7%-103.1%. The contents of atractylenolide I, II, III, atractylone, fructose, glucose, and sucrose in 17 batches of Baizhu were 172.3-759.8 μg/g, 201.4-612.8 μg/g, 160.3-534.2 μg/g, 541.4-8723.1 μg/g, 6.9-89.7 mg/g, 0.7-7.9 mg/g, and 1.2-21.0 mg/g, respectively.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

In the present work report, the MgAl₂O₄and the Ag/MgAl₂O₄ samples were successfully synthesized by the modified hydrothermal and the isovolumetric impregnation methods, respectively. The structural properties of the prepared samples were systematically characterized by XRD, SEM, TEM, DRS, XPS and et al techniques. The photocatalytic degradation of methylene blue by the Ag/MgAl₂O₄ and MgAl₂O₄ samples was comparatively studied under UV lamp irradiation. The results revealed that the prepared Ag/MgAl₂O₄ (pH=6) samples were the most active among the samples in photocatalytic of methylene blue. Under UV lamp irradiation, the Ag/MgAl₂O₄ (pH=6) photodegradation of methylene blue reached to 89.6% within 120 min. And the Ag/MgAl₂O₄ (pH=6) complex photocatalysts displayed a high photochemical stability under repeated irradiation. Repeated irradiate the Ag/MgAl₂O₄ (pH=6) compound, which indicated it had a high photochemical stability.

Brain tumors are abnormal cells growth in the brain tissues that can be cancerous, or not. In any case, they could be a very aggressive disease that should be detected as early as possible. Usually, magnetic resonance imaging (MRI) is the main tool commonly adopted by neurologists and radiologists to identify and classify any possible anomalies present in the brain anatomy. In the present work, an automatic unsupervised method called Z2-$\gamma$, based on the use of adaptive finite-elements and suitable pre-processing and post-processing techniques, is introduced. In particular, the proposed methodology is able to automatically classify whether a given MR image represents a healthy or a diseased brain and in this latter case, is able to locate the tumor area.

Staphylococcus aureus(S. aureus) is associated with mastitis in dairy cows, this study investigates the therapeutic effect of maggot antimicrobial peptides on S. aureus induced mastitis in mice. The maggot AMP was isolated and purified, tested for antimicrobial activity, and used to treat a pathological model of rat mastitis. The concentration of 1.5mg/（Kg. BW）AMP was selected as intramammary treatment in S. aureus-induced mastitis in mice. The mice were divided into four groups of 30 mice each: group I (healthy control), group II (disease control), group III (AMP), and group IV (ciprofloxacin). To evaluate the therapeutic efficacy of maggot AMP in mastitis induced by S. aureus based on clinical presentation, mammary gland structure, bacterial load, histopathology, and cure. During the 7-day treatment period, all the mice in Group II died in the afternoon of the fifth day, and the clinical signs of the mice in Group III began to improve on the third day, as evidenced by the gradual recovery of the mice's mental status, dietary intake, and water intake. During the treatment period, the bacterial load count of Group III was significantly lower than that of Group II but higher than that of Group IV, while the bacterial load count of Group III gradually decreased and approached that of Group IV from the fifth to the seventh day. The levels of TNF-α in groups III and IV were significantly lower than those in group II, suggesting that maggot AMP has a certain inhibitory effect on TNF-α. Treatment with AMP@ 1.5 mg/(Kg. BW) showed restoration of clinical signs, reduced bacterial load, and lower TNF-α levels in mice, leading to significant improvement in histopathological changes as compared to disease controls. The final cure rate was 40% for mice in Group III compared to 70% for mice in Group IV, compared to all mice in Group II that died. From this study, it can be concluded that maggot AMP can be used as a potential alternative treatment option to antibiotics for the treatment of bovine mastitis.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

In this study, the impact of the addition of high-aspect-ratio nano-ettringite to photocurable epoxy acrylate resin was explored, with a specific focus on the changes observed in viscosity, shrinkage, tensile strength, and elongation at the break of composites formed. Herein, the nano-ettringite samples were modified using KH-570. The 3 wt% or 6 wt% KH-570-modified and unmodified nano-ettringite were dispersed into the resin by ultrasonic treatment in conjunction with mechanical stirring. The grafting effects of nano-ettringite onto KH-570 were analyzed through scanning electron microscopy (SEM), X-ray diffraction (XRD), thermogravimetric (TG) analysis, and Fourier transform infrared spectroscopy (FTIR). The results demonstrate that increased dosages of unmodified and modified nano-ettringite led to increased viscosity of the composite while reducing shrinkage. At the same dosage, the photocurable resin with modified nano-ettringite demonstrated a lower shrinkage and a higher tensile strength. Notably, when the amount of modified nano-ettringite was 3 wt%, the highest tensile strength of the composite was 64.61 MPa, presenting a 72.57% increase compared to the blank sample. Furthermore, the incorporation of modified nano-ettringite as a filler provides a new perspective for improving the performance of photocurable epoxy acrylate resin composites.

In this paper, we study the global existence and exponential decay for a dynamic contact problem between a Timoshenko beam with second sound and two rigid obstacles, of which the heat flux is given by Cattaneo's law instead of the usual Fourier's law. The main difficulties arise from the irregular boundary terms, from the low regularity of the weak solution and from the weaker dissipative effects of heat conduction induced by Cattaneo's law. By considering related penalized problems, proving some a priori estimates and passing to the limit, we prove the global existence of the solutions. By considering the approximate framework, constructing some new functionals and applying the perturbed energy method, we obtain the exponential decay result for the approximate solution, and then prove the exponential decay rate to the original problem by utilizing the weak lower semicontinuity arguments.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

Smart City has emerged as the mainstream paradigm for urban governance innovation, sustainable development, and strategy upgrades, which is drawing attention from scholars worldwide. However, current frameworks for Smart City assessment remain incomplete and simplistic. In is paper, 30 national or provincial capitals in China were selected and we designed a tri-dimensional SPI model—Social, Physical, and Information Space—for smart city spatial development assessment. Utilizing methods such as entropy weighting, coupled coordination degree models, and the Dagum Gini coefficient, this study assesses the spatial development and coupled coordination of 30 cities from 2011 to 2019. Finally, by means of BP neural networks, the study examines the contribution of each indicator to the spatial coupled coordination. The results indicated that with a narrowing disparity in development speeds among different regions, the spatial coupled coordination development level of smart capitals in China has steadily increased, presenting a pattern of staggered distribution. Moreover, the IS subsystem plays the most significant role in coupled coordination. The significance of this research lies in its tri-dimensional spatial perspective of the spatial development and coupled coordination differences of the Smart City, providing evidence-based support for the regional layout and optimization in China.

Although the Orthotropic steel decks (OSDs) have been widely used in the construction of long-span bridges, there are frequently reported fatigue cracks after years of operation, and the bridge deck overlay also presents severe damage due to OSD crack-induced stiffness reduction. The ultra-high performance concrete (UHPC), recognized as the most innovative cementitious composites and the next generation of high-performance materials, shows high strength, ductility, toughness and well performance on durability. After its first application to the OSD bridge in early 2000s, the orthotropic Steel-UHPC composite deck has been comprehensively studied worldwide. This review will summarize some important studies and findings on behavior and fatigue performance of orthotropic steel-UHPC composite deck. The existing studies and engineering application indicate that such deck system presents good bending behavior and high fatigue performance. The failure mode of shear studs in UHPC layer is dominated by shear fractures. The cracking of UHPC layer shall consider the superposition effect of stress from both the whole bridge structure and local decks. While some reasonable structural details in the traditional OSD may not work for the orthotropic steel-UHPC composite deck. It is recommended to evaluate the stress behavior and structural parameters, as well as fatigue life by conducting the field test under in-service traffic conditions.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

It is extremely fascinating and astonishing that the gravitational field on the surface of a neutron star is with a relativistic mass density of 2.65*10¹⁶~5.87*10¹⁸kgm^-3 which can be larger than the mass density of the neutron star (~10¹⁷kgm^-3).Therefore, it is the author’s first intuitional imagining that this field could directly convert into mass. In so strong a gravitational field, electron and proton could be produced directly from graviton–photon collision. The gravitational field exists in everywhere in our universe. No vacuum that the region of a space is “empty” does exist. A particle is clearly always being acted on by the gravitational field. The quantum vacuum fluctuation and vacuum polarization need be re-understood with the interaction between photon and gravitational field. Therefore, the gravitational field is naturally one of the foundations of modern physics.

The Mara River basin (MRB) has a world-famous ecosystem, but the vegetation has been damaged due to economic development in recent years, and there is little known about the area that will experience severe vegetation damage in the future. Based on the vegetation vulnerability system, principal component analysis, and three CMIP6 scenarios (SSP1-2.6, SSP2-4.5, SSP5-8.5), vegetation vulnerability was calculated in the base period (2010-2019), near-term period (2020-2059) and long-term period (2060-2099) in the MRB. The spatial cluster of vegetation vulnerability was revealed by spatial correlation analysis, and the transition of vegetation vulnerability of different periods was analyzed by stochastic matrix. The results showed that in all periods, the vulnerability showed a high-high cluster in the east, and a low-low cluster midstream and downstream. From the stochastic matrix, the area of high vulnerability increased the least under the SSP1-2.6, while it increased the most under the SSP5-8.5. The vegetation vulnerability upstream increased the most from the base period to the near-term period and long-term period in the MRB. By comparing the vegetation vulnerability under different scenarios, and pointing out the areas with the highest vulnerability increase, this study can better provide comprehensive decision-making for vegetation protection in the MRB.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

In contemporary society, an increasing number of individuals are identified as the "Indoor Generation". Prolonged periods spent indoors can have detrimental effects on our overall well-being. Consequently, the examination of biophilic indoor environments and their impact on occupant well-being and comfort has emerged as a significant area of study. Besides the construction of new biophilic buildings, numerous existing building stocks retain substantial social, economic, and environmental value. The need for stock renovation is considerable, revitalizing existing structures rather than embarking on new constructions. Swift feedback is crucial during the initial stages of renovation design, fostering consensus among all stakeholders. A comprehensive understanding of proposed renovation plans contributes to improved indoor environment design. Initially, generative adversarial networks (GANs) produce interior renovation drawings based on user preferences and designer styles. Subsequently, the implementation of Mixed Reality (MR) and Diminished Reality (DR) provides users with an immersive perspective, transforming 2D drawings into interactive MR experiences, and facilitating the presentation of interior renovation proposals. This paper outlines the development of a real-time system for architectural designers that seamlessly integrates MR, DR, and GANs results, with the aim of enhancing feedback efficiency during the renovation design process, enabling stakeholders to evaluate and understand renovation proposals more comprehensively. Furthermore, we incorporate several full-reference image quality assessment (FR-IQA) methods to evaluate the quality of the GANs-generated images. The evaluation results indicate that the majority of images fall within the moderate range of quality.

To solve two key problems in the identification of people who are infected with COVID-19: the first problem is that the identification accuracy is not high enough. The second problem is that present identification method such as nucleic acid testing is expensive in many countries. Methods: So, I decided to design a fast identification method for COVID-19 patients which is based on deep learning. After the model (CoughNet) learns more than 6,000 cough spectrograms of both COVID-19 patients and normal people, the accuracy rate of identification of COVID-19 patients and normal people is higher than 99% in the test set. Structure: This paper is mainly divided into three parts: the first part introduces the main background and research status of the research; The second part introduces the research methods; The third part introduces the specific process of the experiment.

There are gravitational field and baryonic matter (star, planet, gases etc.) in our world; gravitational field is much more fundamental for that the relativistic mass of the gravitational field of a neutron star is almost 10²¹ times the mass of the neutron star. And, it is astonishing that the relativistic mass density of the gravitational field on the surface of a neutron star can be larger than the mass density of the neutron star. It is well known that, in the weak gravitational field a light line appears a straight line while in the strong field it is a curved line. It is stressed that the result measured in the strong field is more fundamental for that in a galaxy the measurable object is generally with strong field. It results in that the way that the result measured on the Earth with weak field is used as the universal standard need be revised as gravity is studied in the scale of a galaxy. It seems that a new theory of gravity need be developed for the new observations.

Linear mixed models are frequently used for analysing heterogeneous data in a broad range of applications. The restricted maximum likelihood method is often preferred to estimate co-variance parameters in such models due to its unbiased estimation of the underlying variance parameters. The restricted log-likelihood function involves log determinants of a complicated co-variance matrix. An efficient statistical estimate of the underlying model parameters and quantifying the accuracy of the estimation requires the first derivatives and the second derivatives of the restricted log-likelihood function, i.e., the observed information. Standard approaches to compute the observed information and its expectation, the Fisher information, is computationally prohibitive for linear mixed models with thousands random and fixed effects. Customized algorithms are of highly demand to keep mixed models analysis scalable for increasing high-throughput heterogeneous data sets. In this paper, we explore how to leverage an averaged information splitting technique and dedicate matrix transform to significantly reduce computations and to accelerate computing. Together with a fill-in reducing multi-frontal sparse direct solver, the averaged information splitting approach improves the performance of the computation process.

Appling the controlling relative permittivity and permeability in the equations for the gravitational-magnetic-electric field interaction, a very large variation of the gravitational acceleration of the Earth by electric/magnetic field could be arrived at. This conclusion may be supported by some of the experiments for the gravitational effect of superconductivity.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

Studying the two famous old problems that why the moon can move around the Sun and why the orbit of the Moon around the Earth cannot be broken off by the Sun under the condition that calculating with F=GMm/R^2, the attractive force of the Sun on the Moon is almost 2.2 times that of the Earth. We found that the planet and moon are unified as one single gravitational unit which results in that the Sun cannot have the force of F=GMm/R^2 on the moon. The moon is moved by the gravitational unit orbiting around the Sun. It could indicate that the gravitational field of the moon is limited inside the unit and the gravitational fields of both the planet and moon is unified as one single field interacting with the Sun. The findings are further clarified by reestablishing Newton’s repulsive gravity.

Mathematics first is a logical system. But, the Mathematics Crisis showed that we cannot have a logical self-consistent mathematics system. Physics is a kind of applied science. It first need be valid to invent new production and understand new observation. In one theory of physics, the studied object is usually defined as an abstract concept. For example, the Sun is defined as a point particle in the Newtonian theory of gravity. In different theories of physics, the abstract concept for a same object is different. It determines that logical self-consistent is not needed for different theories of physics. Physics only can be developed from observation and experiment. But, in the past a century, physicists’ main attempt is to have a standard model, such as the Grand Unification or the Theory for Everything, from mathematics derivation. Therefore, the current attempt to develop new physics is questioned. In recent, the strong gravitational field was studied. It is found that the fundamental physical constants which are measured in the weak field shall be varied in a super strong field. For the two reasons, modern physics need be advanced greatly.

Multi-rotor drones, a kind of unmanned equipment which is widely used in military, commercial consumption and other fields, has been developed very rapidly in recent years. However, their short flight time has hindered the expansion of their application range. This can be addressed by utilizing hydrogen fuel cells, which exhibit high energy density, strong adaptability to ambient temperature, and no pollution emissions, as the power source. Accordingly, the application of hydrogen fuel cells as the power source in multi-rotor drones is a promising technology that has attracted significant research attention. This paper summarizes the development process of hydrogen fuel cell mul-ti-rotor drones and analyzes the key obstacles that need to be addressed for the further development of hydrogen fuel cell multi-rotor drones, including structural lightweight, hydrogen storage methods, energy management strategies. Additionally, prospects for the future development of hydrogen fuel cell multi-rotor drones are presented.

In this paper, we tackle air quality forecasting by using machine learning approaches to predict the hourly concentration of air pollutants (e.g., Ozone, PM_2.5 and Sulfur Dioxide). Machine learning, as one of the most popular techniques, is able to efficiently train a model on big data by using large-scale optimization algorithms. Although there exists some works applying machine learning to air quality prediction, most of the prior studies are restricted to small scale data and simply train standard regression models (linear or non-linear) to predict the hourly air pollution concentration. In this work, we propose refined models to predict the hourly air pollution concentration based on meteorological data of previous days by formulating the prediction of 24 hours as a multi-task learning problem. It enables us to select a good model with different regularization techniques. We propose a useful regularization by enforcing the prediction models of consecutive hours to be close to each other, and compare with several typical regularizations for multi-task learning including standard Frobenius norm regularization, nuclear norm regularization, ℓ_2,1 norm regularization. Our experiments show the proposed formulations and regularization achieve better performance than existing standard regression models and existing regularizations.

Contrafreeloading (CFL) refers to animals' tendency to prefer obtaining food through effort rather than free access to food. Researchers have proposed various hypotheses to explain this intriguing phenomenon, but few studies have comprehensively analyzed its influencing factors. In this study, we observed the choice of alternative food containers in budgerigars to investigate their CFL tendencies and the effects of pre-training, food deprivation, and effort required on the CFL levels. The results show that, like most captive animals, budgerigars without food deprivation tend to choose challenging food containers. Additionally, the study finds that pre-trained budgerigars prefer to choose highly challenging food containers, while food-deprived budgerigars tend to choose Easy food containers. Moreover, budgerigars showed more selection time proportion on moderate challenging than high challenging food containers. In conclusion, budgerigars exhibit CFL tendencies, and pre-training enhances their CFL levels, while high challenge and deprivation of food decrease their contrafreeloading level. Studying animal contrafreeloading can help understand why animals choose to expend effort to obtain food rather than accessing it for free, and it also has implications for setting feeding environments to enhance the animal welfare of captive and domesticated animals.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

The application of artificial intelligence to point-of-care testing (POCT) disease detection has become a hot research field, in which breath detection which detects the patient's exhaled VOCs combined with sensor arrays of Convolutional Neural Network (CNN) algorithms as a new lung cancer detection is attracting more researchers' attention. However, due to low accuracy, high complexity computation and large number of parameters make the CNN algorithms difficult transplant to the embedded system of POCT devices. A lightweight neural network (LTNet) in this work is proposed to deal with this problem, and meanwhile, achieve high-precision classification of acetone and ethanol gases, which are respiratory markers for lung cancer patients. Compared to currently popular lightweight CNN models such as EfficientNet, LTNet has fewer parameters (32K) and its training weight size is only 0.155 MB. LTNet achieved an overall classification accuracy of 99.06% and 99.14% in the own mixed gas dataset and the University of California (UCI) dataset, which are both higher than that of the five existing models’, and it also offers the shortest training (844.38s and 584.67s) and inference time (23s and 14s) in the same validation set. Compared to the existing CNN models, LTNet is more suitable for resource-limited POCT devices.

Perceived peer support is a critical factor in the academic adjustment of higher vocational college students. While previous studies have explored this relationship, few studies have delved into the underlying mechanisms. This study surveyed 9782 students from 35 higher vocational colleges in 13 provinces and cities in China to explore the relationship and mechanisms between perceived peer support and academic adjustment. Drawing on Conservation of Resources theory and Social Support Resource theory, the findings revealed that perceived peer support not only directly predicted the academic adjustment of higher vocational college students, but also indirectly through the independent mediating effect of academic hope and professional identity, as well as the chain-mediating effect of academic hope to professional identity. Additionally, students from vocational high schools showed a more significant increase in academic hope due to perceived peer support compared to those from general high schools, highlighting the moderating effect of educational background. The study provided a new theoretical perspective for understanding the complex mechanisms of academic adjustment in students and offers valuable guidance for educational practice, emphasizing the importance of fostering perceived peer support, academic hope, and professional identity in higher vocational education.

In this study, a three-dimensional bioelectrochemical reactor system (3D-BERs) with granular activated carbon (GAC) epitomizes a novel treatment technology for treating nitrate-polluted water. The conventional denitrification process faces many challenges, including the huge demand for organic carbon, long-term accumulation of intermediate products, and the adaptation period. Results shown that under the optimal conditions of the COD/NO3--N ratio was 1.5, the denitrification efficiency reached 98.62%, when compared to 81.12% at COD/ NO3--N ratio of 3.5, and the initial pH of 7.5 ± 0.5, NO3--N was entirely removed at 2.2 h without accumulation of nitrite. The high initial ratio of NO2--N/NO3--N is mainly to accelerate the denitrification rate by accelerating the reduction of nitrite. Denitrification process followed by zero-order kinetics linear model for at different concentrations of inlet NO3--N, and achieved higher denitrification rate at greater inlet NO3--N concentration. High-throughput sequencing shows that the community structure and relative abundance of bacteria changed significantly, especially at the genes and the phyla level in immobilized GAC particles. Microbial composition enhanced the removal of nitrogen at the inner surface (IS) and bottom surface (BS) of immobilized GAC carriers. Therefore, this system is expected to be a more efficient and useful supplement or a cost-effective alternative compared to the traditional low carbon to nitrogen wastewater treatment system.

Currently, the number of lightning casualties and casualty rates have significantly reduced in developed countries, but there has been no significant reduction in developing countries. On the one hand, this is due to the high frequency of lightning; on the other hand, the vulnerability of people in developing countries is also an influencing factor. Through case analysis and summary, this paper expounds on lightning injury’s mechanism and clinical manifestations. It points out that lightning injury is mainly related to heart problems and the impact on the nervous system, rather than burns, which usually cause fewer consequences. Medical treatment needs to pay attention to the order and principles of treatment. Implementing CPR and auxiliary AED is the most effective way to save lives. Attention should be paid to the practical and effective treatment and nursing of lightning stroke sequelae. Finally, combined with the situation of lightning casualties in china, the existing problems are put forward during the process of early treatment, post-hospital treatment, and nursing observation, which provides an objective basis for the cognition of the scientific nature of the lightning injury.

The essence of cross-modal generation and retrieval modeling for image-text interactions lies in semantic consistency. Among these, cross-modal representation alignment serves as the foundational requirement for achieving cross-modal semantic consistency. The crux of our proposed method entails the collaborative training of an image captioning model(referred to as the ’captioner’) and a pair of contrastive encoders for image-text matching(referred to as the ’concoder’). This synergistic approach yields concurrent enhancements in concoder’s performance, captioner’s proficiency, and cross-modal semantic coherence. We coin the proposed method as ‘ReCap’. To begin, we initialize the concoder through knowledge distillation from a pre-trained model. During the training process, we use the output of the initialized concoder as input to a residual attention network, jointly training it with the captioner to achieve semantic consistency. Subsequently, we iteratively update the concoder during the image-text momentum encoding phase using the residual attention network, creating a closed-loop for semantic consistency resolution. Upon completion of training, the concoder and captioner modules can be used independently to perform tasks related to cross-modal retrieval and cross-modal generation of text and images. In order to substantiate the efficacy of our proposed method, we initially conducted empirical experiments encompassing image-text retrieval and image captioning tasks, employing a widely recognized benchmark dataset, MSCOCO. Subsequently, we assessed the fine-grained cross-modal alignment performance of the concoder through an image classification task on the iNaturalist 2018 dataset. The achieved performance metrics notably surpassed those achieved by several incumbent state-of-the-art models, thus validating the proficiency of our method. Finally, motivated by the practical requirements of handling the nature conservation image data, we performed caption annotation for the iNaturalist 2018 dataset. Subsequently, we trained the ReCap on this annotated data. Experimental results demonstrate that our proposed method can maintain semantic consistency between cross-modal retrieval and image caption generation for species with similar visual features but distinct semantics. This achievement signifies a meaningful exploration in the field of cross-modal semantic consistency representation, holding significant practical value in the domain of biological research.

In this paper, an adaptive proportional and integral (PI) controller for speed control of electric drives is developed. The adaptive PI controller is designed based on model reference adaptive identification and the Lyapunov function so that the system stability can be proved. To identify the inertia, the viscous friction torque coefficient, and the load torque simultaneously and smoothly, sinusoidal speed reference is usually employed. A modified motion equation considering the low-pass filter for feedback speed and the Coulomb friction torque is introduced and the relationship between the identified parameters and their actual values are clarified. A high-precision digital simulation model is built based on MATLAB/Simulink. The effectiveness of the proposed method is verified by simulations under various conditions.

Splines and quasi-interpolation operators are important both in approximation theory and applications. In this paper, we construct a family of quasi-interpolation operators for the bivariate quintic spline spaces S₅³ (∆_mn⁽²⁾). Moreover, the properties of the proposed quasi-interpolation operators are studied, as well as its applications for solving two-dimensional Burgers’ equation and image reconstruction. Some numerical examples show that these methods, which are easy to implement, provide accurate results.

The weight coefficients of the diaphragm spring depend on experiences in the traditional optimization. However, this method not only cannot guarantee the optimal solution but it is also not universal. Therefore, a new optimization target function is proposed. The new function takes the minimum of average compress force changing of the spring and the minimum force of the separation as total objectives. Based on the optimization function, the result of the clutch diaphragm spring in a car is analyzed by the non-dominated sorting genetic algorithm (NSGA-II) and the solution set of Pareto is obtained. The results show that the pressing force of the diaphragm spring is improved by 4.09%by the new algorithmand the steering separation force is improved by 6.55%, which has better stability and steering portability. The problem of the weight coefficient in the traditional empirical design is solved. The pressing force of the optimized diaphragm spring varied slightly during the abrasion range of the friction film, and the manipulation became remarkably light.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

The new observations, including the fastest star, the circular velocity curve of the Milky Way and the fast galaxy bar, should imply that the mass of the center of the Milky Way is almost 10¹¹ times the mass of the Sun.

Surface initiated atom transfer radical polymerization (SI-ATRP) is one of the most versatile technique to modify the surface properties of material. Recent developed metal free SI-ATRP makes such technique more widely applicable. Herein photo-induced metal-free SI-ATRP of methacrylates, such as methyl methacrylate, N-isopropanyl acrylamide, and N,N- dimethylaminoethyl methacrylate, on the surface of SBA-15 was reported to fabricate organic-inorganic hybrid materials. SBA-15 based polymeric composite with adjustable graft ratio was obtained. The structure evolution during the SI-ATRP modification of SBA-15 was monitored and verified by FT-IR, XPS, TGA, BET, and TEM. The obtained polymeric composite showed enhanced adsorption ability for the model compound toluene in aqueous. This procedure provides a low cost, ready availability, and facile modification way to synthesize the polymeric composites without the contamination of metal.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

The development of mobile internet technology has enabled companies to use social media for E-commerce. Some companies use personified images and languages to communicate with consumers in this context. How does personified communication affect consumer behavior in social commerce? Are consumers willing to accept this new form of communication under social commerce? To answer these questions, this paper explores consumers' willingness to take per-sonified communication in the context of social commerce. It investigates the role of cognitive needs in regulating the internal mechanism and proposes some suggestions for enterprises to improve social media communication. Specifically, this paper presents an improved model based on the TAM model. In our model, perceived interaction is introduced as a new independent variable, and cognitive need is added as a regulatory variable, which is more suitable for social commerce. We conduct a questionnaire survey on the Internet and analyze data using AMOS and SPSS. The results show that perceived usefulness and perceived interaction positively im-pact attitude, which influences consumers' willingness to purchase. Furthermore, the cognitive need as the regulatory variable significantly affects the influencing path from perceived use-fulness to attitude and purchase intention.

As traditional supply chains face increasingly severe environmental issues and countries promote green development and sustainable development policy concepts, cultivating green supply chain operation models is gradually being highly valued by current governments and enterprises. Generally speaking, the production of green products incurs higher additional costs and thus their total production costs also increase. In this work, the product green level is related to the random demand. Under the green supply chain buy-back contract with the green product R&amp;D cost sharing between the manufacturer and the retailer, both the product green level and the order quantity need to be decided to maximize the channel profit. In order to coordinate the green supply chain, the manufacturer needs to share both the risk of good salvage and the green product R&amp;D cost with the retailer. We find that both the wholesale price and buy-back price increase in the manufacturer’s proposition of the green product R&amp;D cost, but decrease in emission reduction efficiency coefficient or carbon trading price. In addition, the product green level, the optimal order quantity and the channel profit increase in emission reduction efficiency coefficient, but decrease in the R&amp;D cost coefficient of the product green level. Interestingly, we find that if the carbon trading price is low, the manufacturer will set a low product green level and the product carbon emission trading is a cost for the supply chain. The increment of the carbon trading price leads to a higher cost such that the channel profit is decreased. However, if the carbon trading price is high, the manufacturer will set a high product green level and the product carbon emission trading is a revenue for the supply chain. The increment of the carbon trading price leads to a higher revenue such that the channel profit is increased.

This paper mainly used database technology, machine learning, thermodynamic calculation, experimental verification, etc., on integrated computational materials engineering. The interaction between different alloying elements and the strengthening effect of precipitated phases are investigated mainly for martensitic ageing steels. Modelling and parameter optimization were performed by machine learning, and the highest prediction accuracy was 98.58%. Investigated the influence of composition fluctuation on performance and correlation tests to analyze the influence of elements from multiple perspectives. Furthermore, screen out the three-component composition process parameters with composition and performance with high contrast. Thermodynamic calculations studied the effect of alloying element content on the nano-precipitation phase, Laves phase, and austenite in the material. The heat treatment process parameters of the new steel grade were also developed based on the phase diagram. A new type of martensitic ageing steel was prepared by selected vacuum arc melting. The sample with the highest overall mechanical properties had a yield strength of 1887 MPa, a tensile strength of 1907 MPa, and a hardness of 58 HRC. The sample with the highest plasticity had an elongation of 7.8%. The machine learning process for the accelerated design of new ultra-high tensile steels was found to be generalizable and reliable.

To evaluate the efficacy of fish oil for protection against coronary heart disease (CHD), we conducted a systematic review and meta-analysis of randomized controlled trials (RCTs) evaluating the use of fish oil for protection against CHD. We retrieved relevant articles published from January 1966 to January 2020 by searching the PubMed, EMBASE, Cochrane CENTRAL, and Web of Science databases. RCTs of fish oil in preventing CHD were selected. The study quality was evaluated using the Cochrane Risk of Bias tool with RevMan 5.3 software. The first selection involved 350 citations. After screening and evaluation of suitability, 19 RCTs adjusted for clustering were included in the meta-analysis. All selected manuscripts considered that fish oil was effective in preventing CHD, secondary outcome measures included angina, sepsis and death. Compared with the control group, fish oil may confer significant protection against CHD (odds ratio = 0.84; 95% confidence interval: 0.72–0.98). There was no significant difference in the incidence of secondary outcomes between the observation group and the control group (P > 0.05). The above results show that fish oil plays an important role in reducing CHD and cardiovascular events. However, because of the suboptimal quality of the studies included into the meta-analysis, these results do not justify adding fish oils systematically to the heavy pharmaceutical assortment already recommended in CHD patients.

Chemical flooding methods are used to recover the remaining oil after water flooding, and surfactant-polymer (SP) flooding is an important chemical flooding technology. It is of great significance to design and screen high-performance oil displacement agents in order to overcome the increasingly challenging high temperature (&gt;70 ℃) and high salinity (>10,000 mg/L) reservoirs. Based on the characteristics of high temperature (70 ℃) and high salinity (151,000 mg/L) in the Qinghai Gasi reservoir, the performance of the SP flooding system was studied. This study considered interfacial tension, emulsification, viscosity, compatibility, and oil displacement efficiency. The selected formula demonstrated high resistance to both salinity (151,000 mg/L) and temperature (70 ℃), characterized by a low oil-water interfacial tension (10-2 mN/m) and high viscosity (18.13 mPa.s). After water flooding achieved an oil recovery rate of 64.64%, the subsequent replacement rate of crude oil increased by 26.95%, confirming that SP flooding can be used as a technology for enhancing oil recovery in high-temperature, high-salinity reservoirs represented by Qinghai Gasi reservoirs.

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

In recent years, graph neural networks (GNNs) have become a promising method for analyzing data structured in graph format. By considering connections between entities in a graph, GNNs are able to extract valuable insights. One notable variation of GNN is the graph attention network (GAT), which employs the attention mechanism and has demonstrated promising performance in various applications. However, its ability to incorporate feature information from nodes beyond the immediate neighborhood is limited, leading to degraded performance on heterophilic data. To address this limitation, this thesis proposes a novel attention-based model, namely the Directional Graph Attention Network (DGAT). This model combines the feature-based attention with the global directional information extracted from the graph topology, as inspired by the Directional Graph Network (DGN). A new class of Laplacian matrices is proposed and an existing theoretical result on DGN is extended. This extension bridges a gap in the literature. The experimental results presented in the thesis, based on nine real-world benchmarks and ten synthetic data sets, demonstrate the superiority of the proposed DGAT model compared to the GAT baseline model. Particularly on heterophilic data sets, DGAT showed a notable average increase of approximately 35% in node classification tasks across all heterophilic real-world data sets. In addition, DGAT outperforms GAT by an average margin of around 51% in all ten synthetic data sets with various levels of heterophily

With the development of data science, more and more machine learning technologies have been designed to solve complicated and challenging real-world tasks containing a large volume of data. And many significant real-world datasets contain data in the form of networks or graphs. Graph Neural Networks is one of the powerful machine learning tools, which could provide a perfect solution to processing a large amount of non-Euclidean data. And because most bio information data in bioinformatics is in the non-Euclidean domain, Graph Neural Networks could then directly be applied to solve problems in bioinformatics. Much research has been done in the field of GNN, and there are also some surveys related to GNN and its applications. However, there has been little research focusing on GNN in bioinformatics, and we think in the future we could better utilize GNN in the field of biology, so we would like to write a literature review to help take a comprehensive look at GNN and their applications in the field of bioinformatics. In this paper, we would first introduce SOTA models in Graph Neural Networks, and second, introduce their applications in bio information. And then we would provide future directions of Graph Neural Networks in bioinformatics.

Pre-trained Language Models (PTLM) have remarkable and successful performance in solving lots of NLP tasks nowadays. And previous researchers have created many SOTA models and these models are included in many long surveys(Qiu et al., 2020). So, we would like to conduct a simple and short survey on this topic to help researchers understand the sketch of PTLM more quickly and comprehensively. In this short survey, we would provide a simple but comprehensive review of techniques, benchmarks, and methodologies in PTLM. And we would also introduce the applications evaluation of PTLM in this simple survey.

The anomaly detection task is very important in computer science. And there are a lot of anomaly detection methods. Different from some thresholding methods, some unsupervised methods could make us get more accurate and faster result, which is the object of the project. In this paper, I tried to use EWMA and some other methods in two datasets: Webank time consuming indicators dataset and AIOps Challenge dataset. The paper consists nine parts: background of the project, related work, description of algorithms, implementation details, experimental setup and data sets used, experimental results and discussion, future directions, reference and meeting notes.

Enhancing underwater images in epicontinental sea is a challenging problem owing to the influence of ocean currents, the refraction, absorption and scattering of light by suspended particles, and the weak illumination intensity. Recently, different methods have relied on the underwater image formation model and deep learning techniques to restore the underwater image, but they tend to degrade underwater image, interference of background clutter and miss boundary details of blue regions. Improved image fusion and enhancement algorithm based on a priori dark channel is proposed in this paper. Image edge features sharpening and dark detail enhancement by homomorphism filtering in CIELab color space is realized. In RGB color space, the multi-scale retinal with color restoration (MSRCR) algorithm is used to improve color deviation and enhance color saturation, and the contrast-limited adaptive histogram equalization (CLAHE) algorithm is used to de fog and enhance image contrast. Finally, according to the dark channel images of the three processing results, the final enhanced image is obtained by linear fusion of multiple images and multiple channels. Experimental results demonstrate the effectiveness and practicality of the proposed method on various datasets.

The microspheres constituted by proteinoids synthesized from Fox’s simulation experiments. They had peptide bond structure and weak catalysis, as well as proliferated themselves. Such microspheres were believed the models for primitive life. Due to lack of metabolism and self-reproduction, the microspheres could not meet requirements of life. Thus, how microspheres could evolved into primitive life remain unsolved mysteries. The microspheres were supposed a dissipative structure and the processes of absorption and hydrolysis could be balanced to maintain their stability by consuming proteinoid. Proteinoid molecules differed in their life spans, which were mainly determined by their multi-space structures. Consequently, molecule selection and retention could occur spontaneously in microspheres and lead to a more organized and stabilized structure of the whole microsphere with time through dissipative process. More complex chain network of chemical reactions could happen in microspheres because the proteinoid with complex, ordered multi-space structure and relatively high catalytic activity would retain. In such microspheres, nucleotides could produce and further aggregate into RNA. The synthesis of real proteins could take place with RNA as the template catalyzed by proteinoids or RNA inside microspheres. When template-based protein molecules replaced the proteinoid inside the microspheres, a protein-based self-catalyzed network of chemical reactions could take place. It is plausible if Fox’s proteinoids microspheres is to dawn on a dissipative structure, then molecule selection could occur spontaneously by “dissipative” proteinoids, and the microspheres would acquire catalytic activity due to preserved the proteinoid with a large molecular weight and relatively complex and ordered multi-space structure, and relatively high catalytic activity. Thus the microspheres would spontaneously go to self-organizing, and evolve into primitive life.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

The influence of polysialic acid (PSA) and sialic acid (SA) on the gut microbial community composition and metabolites in healthy human was investigated using a bionic gastrointestinal reactor. The results indicated that PSA and SA significantly changed the gut microbiota and metabolites in different degrees. PSA can increase the relative abundances of Faecalibacterium and Allisonella, whereas SA can increase those of Bifidobacterium and Megamonas. Both can significantly increase the content of short-chain fatty acids. The results of metabolome analysis showed that PSA can upregulate ergosterol peroxide and gallic acid and downregulate the harmful metabolite N-acetylputrescine. SA can upregulate 4-pyridoxic acid and lipoic acid. PSA and SA affect gut microbiota and metabolites in different ways and have positive effects on human health. These results will provide reference for the further development of PSA- and SA-related functional foods and health products.

To better understand the shape memory materials and self-healing materials, a new series of liquid-crystalline shape memory polyurethane (LC-SMPU) composites, named SMPU-OOBAm, were successfully prepared by incorporating 4-octyldecyloxybenzoic acid (OOBA) into the PEG-based SMPU. The effect of OOBA on the structure, morphology and properties has been carefully investigated. The results demonstrate that SMPU-OOBAm have liquid crystalline properties, triple-shape memory properties and self-healing properties. The incorporated OOBA promotes the crystallizability of both soft and hard segments of SMPU, and the crystallization rate of the hard segment of SMPU decreases when the OOBA-content increases. Additionally, the SMPU-OOBAm forms a two-phase separated structure (SMPU phase and OOBA phase), and it shows two-step modulus changes upon heating. Therefore, the SMPU-OOBAm shows triple-shape memory behavior, and the shape recovery ratio decreases with an increase in the OOBA content. Finally, SMPU-OOBAm shows self-healing properties. The new mechanism can be ascribed to the heating-induced “bleeding” of OOBA in the liquid crystalline state and the subsequent re-crystallization upon cooling. This successful combination of liquid crystalline properties, triple-shape memory properties and self-healing properties make the SMPU-OOBAm composites with many promise applications in smart optical devices, smart electronic devices and smart sensors.

In recent, Chae found that, at weak gravitational acceleration g_N≲10⁻⁹ms⁻², the observed orbit of the wide binary stars is not accordant with current theory of binary star. Here, we present, this finding should be an observational evidence for that Newtonian theory of orbit perturbation is still valid in galactic scale.

In any region of a space, the gravitational field cannot be eliminated. The speed of light in a vacuum has never been observed and cannot be observed with current technology. Till now, only the speed of light in a gravitational field has been observed. It results in that all the observed speed of light are always being varied by the gravity. Here, it is presented that light could be dispersion in a gravitational field analogous to the dispersion of light in the Newtonian prism experiment. The relativistic mass density on the surface of a neutron star is on the level of 10¹⁷kg/m³ while on the surface of the Earth is only 10^-7kg/m³, the effect of the gravitational field acting on the speed of light by a neutron star is much larger than that by the Earth. Therefore, the dispersion of light in strong gravitational field could be generally observed from the image of a star and it should have been observed through the double-image gravitational lensing and the spectroscopic binary system. And, it should affect the observed numbers, spectrogram, size and distance of the celestial objects.

It is discovered that the gravitational field on the surface of a neutron star is with a relativistic mass density of 2.65*10¹⁶~5.87*10¹⁸kgm^-3 which can be larger than the mass density of the neutron star (~10¹⁷kgm^-3). And, the total relativistic mass of the gravitational field of the Sun is ~10⁷ times the mass of the Sun. For different stars, the relativistic mass of the gravitational field is larger as the mass density of the star is larger. In the Milky Way, the total relativistic mass of the gravitational fields is much larger than the total mass of the stars, planets and gas. And, the relativistic mass density of the observed strongest magnetic field is 2.17*10⁸kgm^-3. This discovery should be a new frame to understand the fundamental problem of physics.

In this paper, we study the constrained minimization problem for an energy functional which is related to the following Kirchhoff type equation \begin{equation*} -\Big(\eta+b\big(\int_{\R^{3}}|\nabla u|^{2}dx\big)^{s}\Big)\Delta u+V(x)u=\mu u +\lambda|u|^{p}u,\end{equation*} where $b$ is a positive constant, parameters $\eta\geq0, \lambda>0$, exponents $s>0$, $0

It is important for food recognition to separate each ingredient within a food image at the pixel level. In this paper, we propose a new approach to segment ingredients by utilizing a CNN-based Single-Ingredient Classification Model. In detail, we firstly introduce a standardized biological-based hierarchical ingredient structure and construct a single-ingredient image dataset based on this structure. Then, we build a single-ingredient classification model based on a novel convolutional neural network (CNN) architecture that utilizes an attention mechanism. Afterwards, we propose a new framework for segmentation using the above single-ingredient classification model as the backbone. In this framework, two methods are involved in segmenting ingredients in the food images. We introduce five evaluation metrics (IoU, Dice, Purity, Entirety, Loss of GTs) to assess the performance of ingredient segmentation in terms of ingredient classification. Extensive experiments demonstrate the effectiveness of the proposed method, achieving an maximal mIoU of 0.65, mDice of 0.77, mPurity of 0.83, mEntirety of 0.80, and mLoGTs of 0.06 on the FoodSeg103 dataset. The results confirm that our CNN-based architecture achieves higher segmentation performance compared to ResNet18 and EfficientNet-B0 when used as the backbone for ingredient segmentation. We believe that our ingredient segmentation approach lays the foundation for subsequent ingredient recognition.

Indigenous trees have great economic potential and ecological benefits for enhancing environmental prosperity, mostly in forestry and the forest products sector in the developing countries of Sub-Sahara Africa. The baobab (Adansonia Digitata L.) is known as the African green jewel in both fruit production and medicinal benefits also remarkable for so many forest products exported across the world. Research conducted in the different Sub-Saharan African sub-regions has shown this iconic tree with a majestic outlook has a priority tree species for local and foreign use and conservation. However, data on the benefits and conservation of baobab trees in Africa, especially the Sub-Saharan countries is limited. This study aimed to assess the predominant geo-graphical distribution of the tree, the indigenous (cultural, socio-economic, ecological, and medical/health) benefits, and the conservation strategies of the baobab resources in Sub-Saharan Africa. The baobab tree's succulent roots, bulbs, branches, fruit, pods, foliage, and petals are all nourishing. Baobab parts have been used for diverse reasons in Africa, some countries of Asia, and Europe for the past two centuries due to their medicinal well-being properties. In addition, the medicinal applications of the plant parts are discussed. Many authors have highlighted the baobab tree as one of the most important trees to be saved and localized in Africa because of its high indigenous usage and commercial worth. Anthropogenic global warming may induce a drop in baobab species, which could inflict negative impacts on African economies. As a result, it's critical to research the species' likely future distribution and develop conservation policies. Literature was consulted for records and availability of this tree in the Western, Central, Eastern, and Southern African species records and it was also analyzed what percentage of the current environment would be appropriate in the future. Recent studies suggested that farmers and the locals be provided free seeds and seedlings to encourage biological rejuvenation to maximize the plant's potential, people should be informed about the additional uses of baobab that have been discovered. Individuals must also be educated on simple sustainable agroforestry activities that can be performed in plant and forest management.

Alcohol abuse can lead to alcoholic liver disease, becoming a major global burden. Hovenia dulcis fruit peduncle polysaccharides (HDPs) has the potential to alleviate alcoholic liver injury may play essential roles in treating for alcohol-exposed liver disease, however, the hepatoprotective effects and mechanisms remain unclear. In this study, the hepatoprotective effects of HDPs and its potential mechanisms were investigated in alcohol-exposed mice by liver metabolomics and gut microbiome. The results found that HDPs reduced medium-dose alcohol-caused dyslipidemia (significantly elevated T-CHO, TG, LDL-C), elevated liver glycogen levels and inhibited intestinal-hepatic inflammation (significantly decreased IL-4, IFN-γ and TNF-α), consequently reversing hepatic pathological changes. By applying gut microbiome analysis, HDPs showed significant decreases in Proteobacteria while significant increases in Firmicutes at the phylum level, and increased Lactobacillus abundance while decreased Enterobacteria abundance, maintaining the composition of gut microbiota. Further hepatic metabolomics analysis revealed that HDPs had a regulatory effect on hepatic fatty acid metabolism, by increasing the major metabolic pathways including arachidonic acid metabolism and glycerophospholipid metabolism and identified two important metabolites C00157 and C04230 involved in the above metabolism. Overall, HDPs reduced intestinal dysbiosis and hepatic fatty acid metabolism disorders in alcohol-exposed mice, suggesting that HDPs has a beneficial effect on alleviating alcohol-induced hepatic metabolic disorders.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&amp;LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&amp;LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

The advancement in science and technology has led to luffa sponge (LS) being widely used as a natural material in industrial application as its polyporous structure and light texture. In order to enhance the utility of LS fibers as the reinforcement of lightweight composite materials, this study investigate its water absorption, mechanical properties, anatomical characteristic and thermal performance. Hence, moisture regain, tensile properties of LS fiber bundles were measured in accordance with standards and the structural characteristics were investigated via microscopic observation. Scanning electron microscopy (SEM) was used to observe the surface morphology and fracture surface of fiber bundles. Test results shows that the special structure where the phloem tissues degenerate to cavities had a significant influence on the mechanical properties of LS fiber bundles. Additionally, the transverse sectional area occupied by fibers in a fiber bundle (SF), wall thickness and ratio of wall to lumen of fiber cell, and crystallinity of cellulose had an impact on the mechanical properties of LS fiber bundles. Furthermore, the fiber bundles density of LS varies range of 385.46-468.70 kg/m³, much less than that of jute (1360.40 kg/m³) and Arenga engleri (950.20 kg/m³) while LS fiber bundles has superior specific modulus.

In Lubumbashi, the capital of Haut Katanga in the Democratic Republic of the Congo (DR Congo), diesel power plants are a common source of electricity. The need to utilise local renewable energy sources in DR Congo has increased due to the unreliability of the state grid and the rising cost of running Diesel generators. Solar photovoltaic (PV) panels and batteries, in particular, have recently seen significant price drops. Therefore, it is important for operators and suppliers to choose optimal generators together with a renewable energy system to lessen the energy deficit. Diesel generators are still widely used in DRC, but their efficiency pales in contrast to that of more recent power facilities. Consuming fossil fuels results in high expenses for upkeep and operation, in addition to severe environmental damage. This study assessed the feasibility of using local weather and technical data to evaluate the efficiency of a diesel power plant hybridized with a PV system. Hybrid Optimization Model for Electric Renewable (HOMER) simulations suggest that the hybrid system schedule is preferable due to its many economic and environmental advantages for the local community and its inhabitants. The promotion of such a hybrid system, then, may encourage the sustainable economic development of a stable source of electricity for the Congo Region.

Cloud-induced atmospheric extinction and occlusion have a major effect on the effectiveness and quality of telescope observations. Real-time cloud cover distribution and long-term statistical data are essential for astronomical siting and telescope operations. At ground-based astronomical telescope sites, cloud cover distribution is currently analyzed using manual observation methods. However, the main disadvantages of manual observation methods are human subjective, heavy workloads and poor real-time performance. Therefore, a real-time automatic cloud images classification method is desperately needed. This paper presents a new cloud identification method, which is named PSO+XGBoost model by combining eXtreme Gradient Boosting (XGBoost) and Particle Swarm Optimization (PSO). The entire cloud image is divided into 37 sub-regions in order to more precisely identify the distribution of the clouds. 19 features are then extracted, including the sky background, star density, lighting conditions, and subregion grayscale values. The experimental results have shown that the overall classification accuracy of 96.91% and our model is able to outperform several state-of-the-art baseline methods. Our approach achieves high accuracy in comparison with the manual observation methods. Moreover, this method meets telescope real-time scheduling requirements.

This paper presents an optimized energy management strategy for Li-ion power batteries used on electric vehicles (EVs) at low temperatures. Under low-temperature environments, EVs suffer a sharp driving range loss resulted from the energy and power capability reduction of the battery. Simultaneously, because of Li plating, battery degradation becomes an increasing concern as temperature drops. All these factors could greatly increase the total vehicle operation cost. Prior to battery charging and vehicle operating, preheating battery to a battery-friendly temperature is an approach to promote energy utilization and reduce total cost. Based on the proposed LiFePO4 battery model, the total vehicle operation cost under certain driving cycles is quantified in the present paper. Then given a certain ambient temperature, a target temperature of preheating is optimized under the principle of minimizing total cost. As for the preheating method, a liquid heating system is also implemented on an electric bus. Simulation results show that the preheating process becomes increasingly necessary with a decreasing ambient temperature; however, the preheating demand declines as driving range grows. Vehicle tests verify that the preheating management strategy proposed in this paper is able to save total vehicle operation cost.

According to this study, approximately half of Africa's forests are utilized primarily or partially for the production of wood and non-wood commodities. Aims to evaluate Africa's forestry and forest products, namely Wood Forest Products (WFPs) and Non-wood Forest Products (NWFPs) in the sixteen (16) West African countries. While adhering to the following guidelines: wood extraction and preparation, analyzing wood primarily used as an energy source in Africa, identifying non-wood forest products in Africa, the state of export, trade, and customs procedures in West Africa, and examining the role of forests and forest stakeholders in Africa's low-carbon economy transition. An exploratory literature review of selected wood forest products and non-wood forest products (plants and animals) in West Africa identifying the country, the natural land area with the natural habitat issues of the forest, the species most harvested and traded in the West African sub-region. The study reemphasized some government legislation, policies, and market trade failures and limitations while also stating that trees may help in the low-carbon revolution through interventions aimed at maintaining, improving, and restoring natural capital have demonstrated that high environmental requirements of sustainable forest management (SFM) may be met in both natural and planted forests. The study identified a systematic assessment of the most common forest products (wood and non-wood forest products) considering the available data on the national forest reserves of the selected countries in West Africa. The study also revealed the need for biodiversity conservation of the available forest reserves to help mitigate the impact of global warming targeting the United Nation’s Sustainable Development Goal 13- Climate Action. Which is focused on integrating climate change mitigation, adaptation, impact reduction, and early warning signs into the national policies, improving forest planning and management education, awareness-raising, and institutional capacity within the sub-region.

In recent years, cerium dioxide (CeO2) has attracted considerable attention owing to its remarkable performance in various applications, including photocatalysis, fuel cells, and catalysis. This study explores the effect of nickel (Ni) doping on the structural, thermal, and chemical properties of CeO2 nanorods, particularly focusing on oxygen vacancy-related phenomena. Utilizing X-ray powder diffraction (XRD), alterations in crystal structure and peak shifts were observed, indicating successful Ni doping and the formation of Ni2O3 at higher doping levels, likely due to non-equilibrium reactions. Thermal gravimetric analysis (TGA) revealed changes in oxygen release mechanisms, with increasing Ni doping resulting in the release of lattice oxygen at lower temperatures. Raman spectroscopy corroborated these findings by identifying characteristic peaks associated with oxygen vacancies, facilitating the assessment of Ni doping levels. Overall, this study underscores the substantial impact of Ni doping on CeO2 nanorods, shedding light on tailored catalytic applications through modulation of oxygen vacancies while preserving the nanorod morphology.

Semenov-Tian-Shansky has introduced the modified classical Yang-Baxter equation, which is called the modified $r$-matrix. Relevant studies have been extensive in recent times. This paper is devoted to study cohomology theory of modified Rota-Baxter pre-Lie algebras and its applications. First we introduce the concept and representations of modified Rota-Baxter pre-Lie algebras. We then develop the cohomology of modified Rota-Baxter pre-Lie algebras with coefficients in a suitable representation. As applications, we consider the infinitesimal deformations, abelian extensions and skeletal modified Rota-Baxter pre-Lie 2-algebra in terms of lower degree cohomology groups.

The escalation of mining activities in the karst regions of Guizhou Province has heightened the occurrence of water-inrush incidents in deep coal mines. This study focused on water-inrush phenomena within the Xinhua mining area of Jinsha County, Guizhou Province, aiming to investigate the sources of these incidents. The findings indicated that the overlying limestone of the Changxing Formation in the coal seam served as a vulnerable aquifer under certain conditions, leading to water inrushes. The analysis of the spatiotemporal distribution patterns of water-inrush incidents at the working face indicated that previous mining operations damaged the shallow Changxing Formation limestone, resulting in the accumulation of goaf water and the formation of numerous mining-induced fractures. These fractures served as rapid conduits for water inrushes from both atmospheric precipitation and underground sources at the deep working face. The examination of surface water and mine water quality demonstrated that both exhibited similar characteristics, predominantly featuring bicarbonate, sulfate, and sodium compositions. Investigation into the relationship between mine water inflow and atmospheric precipitation established that atmospheric precipitation influenced the mine water supply cycle, with a replenishment period of ~10 months during the operational phase of the Jinyuan Coal Mine and about one month post-closure. The fractures induced by mining activities within the Changxing Formation limestone facilitated water flow, with atmospheric precipitation serving as the primary water source for the mine. This study offered a valuable scientific foundation for addressing water-related damage resulting from atmospheric precipitation in mines susceptible to water inrushes under analogous hydrogeological conditions.

A general method is presented that permits enantiomers, originally present in a low enantiomeric excess (%ee1), to accumulate in a high %ee (%ee2) without a chiral source present. An equation was derived that demonstrates the final %ee2 of any unreacted chiral starting material will become higher when that starting material has reacted to generate an additional chiral center, hence forming two sets of diastereomeric enantiomeric products. Importantly, chiral amplification factor (multiples), %ee2/%ee1, depends on the yield of this reaction (p), which exhibits a nonlinear increase in amplification as p approaches 100%. This process is inevitable. It represents a possible route by which small initial %ee1 values of prebiotic molecules could have been raised to high %ee2 contents during the pre-evolution of life period on Earth, without the need for an added chiral source to be present. This predicted behavior was then experimentally verified in Pictet-Spengler reactions of L-tryptophane methyl ester (L-TME) samples present in low enantiomeric excess (%ee1) with biacetyl or oxaldehyde (model reactions) run to various yields. Each reaction generates stereoisomer products, and chiral amplification of the L-TME’s initial %ee1 values to higher %ee2 values occurs in the unreacted (recovered) L-TME. Repeated cycles of these reactions create very high L-TME %ee values. Self-cyclodimerization of low %ee1 L-amino acids with their D-enantiomers to generate L,L-, D,D- and L,D-cyclic products were computationally studied, leading to the same conclusion. Small %ee1 values are enhanced to larger %ee2 in the unreacted starting materials.

In this paper, we define the cohomology of a modified $\lambda$-differential left-symmetric algebra with coefficients in a suitable representation. We also introduce the notion of modified $\lambda$-differential left-symmetric 2-algebra. We classify linear deformations and abelian extensions of modified $\lambda$-differential left-symmetric algebras using the second cohomology group and classify skeletal modified $\lambda$-differential left-symmetric 2-algebra using the third cohomology group as our propose cohomology applications. Moreover, we prove that strict modified $\lambda$-differential left-symmetric 2-algebras are equivalent to crossed modules of modified $\lambda$-differential left-symmetric algebras.

Generally, stochastic functional differential equations (SFDEs) pose a challenge as they often lack explicit exact solutions. Consequently, it becomes necessary to seek certain favorable conditions under which numerical solutions can converge towards the exact solutions. This article aims to delve into the convergence analysis of solutions for stochastic functional differential equations by employing the framework of G-Brownian motion. To establish the goal, we find a set of useful monotone type conditions and work within the space Cr((−∞,0];Rn). The investigation conducted in this article confirms the mean square boundedness of solutions. Furthermore, this study enables us to compute both LG2 and exponential estimates.