Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Direct laryngoscope and videolaryngoscope are the dominant endotracheal intubation tools. Styletubation technique (using a video-assisted intubating stylet) has shown its advantages regarding in short intubation time, high success rate, less stimulation, and operator’s satisfaction. The learning curve can be steep but easy to overcome if the technical pitfalls could be avoided. Conditions make styletubation challenging include secretions/blood, short/stiff neck, restricted mouth opening and cervical spine mobility, anatomical abnormalities over head and neck regions, and obesity, etc. In this clinical report, we present the effectiveness and efficiency of routine use of the styletubation for tracheal intubation in a super-super obese patient (BMI 103 kg/m2) undergoing bariatric surgery with laparoscopic sleeve gastrectomy.

This investigation aimed to knowledge of the presence of Brucella spp .in the samples from Babylon province and the relationship with environmental factors. The seasonal collection of animal soil samples for various villages in the middle, south, and north of Babylon province, Hilla City, Iraq, with physicochemical parameters (air and soil temperature, pH, EC, TDS, salinity, TOC), as well as heavy metals (Fe, Cu, Cd, and Pb). The results showed the presence of Brucella species in some of soil samples and its percentage varies according to the four seasons, where the highest percentage of Brucella spp. was in summer season and the lowest in winter season and these percentages were related to seasonal environmental indicators. After sending the positive bacterial samples isolated from the soil for sequencing analysis, it was found that the bacterial samples isolated from the soil have new strains recorded in Genbank as following: five strains for Brucella intermedia and one strain for Brucella rhizosphaerae, Also, phylogenetic analysis was for the drawing of phylogenetic tree and the determination of phylogenetic relationship for Knowledge the degree of convergence between species and their source. Through our research, we concluded that proportion of Brucella spp. presence in summer was high and also environmental factors which included (Air and Soil temperature, pH, EC, TDS and Salinity) were high, except TOC was lower in summer season whereas heavy metals for Cu, Fe, Cd were lower in summer except Pb was high. This indicated that differences of seasons affect to Brucella ratio in soil. The findings of sequencing for the bacterial samples from soil demonstrated that B. intermedia was found in both the spring and fall seasons while B.rhizosphaerae found in the spring season , These types of Brucella had genetic variations. Also concluded that during phylogenetic analysis of the 16S rRNA sequences indicated that B.intermedia was nearest to Pakistan and other strain of B.intermedia was nearest to Russia while B.rhizosphaerae was nearest to Ukraine and Pakistan.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

The aim of this case-series report article is to provide a new topical view of the styletubation (video intubating stylet technique) in obese patients undergoing bariatric surgeries. In contrast to various conventional direct laryngoscopes (DLs), videolaryngoscopes (VLs) have been applied in such obese population with potentially difficult airway populations. The safety and effectiveness of VLs have been repeatedly studied and the superiority of VLs then has been observed and is advocated as a routine use. In this article, among our vast use experiences of the styletubation (more than 54,998 patients since 2016) for routine tracheal intubation, we present such unique experience to apply such intubating technique in obese patient undergoing bariatric surgery. Consistent with the experiences applied in other patient populations, we found the styletubation technique to be swift (the time to intubate from 5 s to 24 s), smooth (first-attempt success rate: 100%), safe (no airway complications), and easy (high subjective satisfaction). The learning curve can be steep but is easily overcome if technical pitfalls are avoided. We, therefore, propose that the styletubation technique can be feasibly applied for tracheal intubation in obese patients undergoing bariatric surgery.

This study examines the association between dietary saturated fatty acid (SFA) intake and leukocyte telomere length (LTL) using data from the National Health and Nutrition Examination Survey (NHANES) 1999-2002. Telomeres, protective repeats of DNA at the ends of chromosomes, play a crucial role in cellular aging. Their length is shortened over time and is influenced by various factors, one of which is diet. The present study's objective was to evaluate whether increased SFA consumption is associated with shorter LTL. The analysis, conducted on a large, nationally representative sample of 6646 adults, revealed an inverse association between dietary SFAs and LTL. When examined further, this association was found to be significant in women, but not in men. Serum C-reactive protein (CRP) levels were tested as a potential mediator in this relationship, but no such mediation was found. These findings support the role of dietary factors in modulating cellular aging. However, further research is warranted to elucidate the underlying mechanisms driving the overall association, as well as the gender-specific effects observed.

In order to better understand the extent to which global climate variability is linked to the frequency and intensity of heat waves and overall changes in temperature throughout the United States (US), correlations between long-term monthly mean, minimum, and maximum temperatures measured at sites throughout the contiguous US and low-frequency variability of multiple climate indices (CIs) are analyzed over the period 1948 to 2018 using correlation analysis. The Pearson’s correlation coefficient is used to assess correlation strength, while Leave-One-Out Cross-Validation and a bootstrapping technique (p-value) are used to address potential serial and spurious correlation and assess the significance of each correlation. Three parameters defined the sliding windows over which surface temperature and CI values were averaged: window size, lag time between the temperature and CI windows, and the beginning month of the temperature window. A 60-month sliding window size and 0 lag time resulted in the strongest correlations overall; beginning months were optimized on an individual site basis. Strong (r >= 0.60) and significant (p-value <= 0.05) correlations were identified. The Western Hemisphere Warm Pool (WHWP) and El Niño/Southern Oscillation (ENSO) exhibited the strongest links to temperatures in the western US, tropical Atlantic sea surface temperatures to temperatures in the central US, the WHWP to temperatures throughout much of the eastern US, and atmospheric patterns over the northern Atlantic to temperatures in the Northeast and Southeast. The final results were compared to results from previous studies focused on precipitation and coastal sea levels. Regional consistency was found regarding links between the northern Atlantic and overall weather and coastal sea levels in the Northeast and Southeast as well as on weather in the upper Midwest. Though the MJO and WHWP revealed dominant links with precipitation and temperature, respectively, throughout the West, ENSO revealed consistent links to sea levels and surface temperatures along the West Coast. These results help focus future research regarding specific mechanisms of climate variability that appear the exhibit strong links to US regional weather and sea level variability and prediction.

While a raft of existing Chinese literature examines the associations between the outbreak of the pandemic and students’ mental health, rarely do Chinese studies assess the nuanced relationships between digital learning, parenting, and students’ mental health since the coronavirus (COVID-19) outbreak. Such a rarely discussed topic has substantial scholarly value as mismanagement of digital learning and parenting, such as the exposure to cyberbullying and negative parenting during the public health crisis, could add substantial, unforeseeable psychological burdens for Chinese students. In this article, the author applied a systematic review to find all relevant Chinese literature that contains the words “digital learning”, “children/adolescents”, “mental health”, and “parenting” published since January 2020. As such a complex topic has rarely been addressed in Chinese contexts, the author was only able to find four related scholarly articles. The author summarises the arguments and empirical findings to explore the nuanced relationships between a) digitalisation, isolation, parenting, and children’s mental health, b) parenting, teacher-student relationships, and students’ mental health, and c) maternal and paternal parenting styles.

The international literature shows a polarised debate on the impacts of climate change on migration. Some studies find a positive linkage, whereas others find a negative one. It is, without a doubt, a complex process better considered case-specific. There is no available information on the relationship between climate change and migration in Colombia, despite past research exploring each of these subjects independently. This study intends explicitly to investigate this linkage gap. Consequently, this paper's essential contribution is that it builds a bridge between climate change scenarios and migratory science for the first time in Colombia. Despite their limitations, the theoretical and methodological framework suggested by IOM (2009b pp. 86, Section B, Chapter II) is demonstrated in this study to be very valid since it provides a methodology to predict where future flows will occur (based on past evidence). The methodological approaches of SLA and NELM explained in section A in the IV Chapter are also valuable for analysing and approaching this study's conclusions. The primary conclusions of this study indicate that the "Coffee Region," Valle, and Atlantic (or Caribbean Coast) provinces that mainly send emigrants to Spain and the US are the key internal regions responsible for most of the international migration from Colombians. The same areas are especially vulnerable to the impacts of upcoming climate change in the A1B scenario produced by the IDEAM (2010) for 2040 and 2100. Thus, future flows of migrants are expected from these regions (2040-2100). However, issues such as visa requirements or the costs associated with migration constitute international barriers to this flow. The sensitivity of these regions can also be associated with internal migration flows, more armed conflict, and forced displacement in a cyclical process. Theoretically, a resurgence of Colombia's armed conflict and displacement due to climate change can be expected. However, the need for empirical studies in Colombia to support this analysis is imperative and is the most crucial recommendation arising from this study.

Exisitng studies argue life chances are, in part, vertically reproduced. Such a statement is applicable to the Chinese contexts as, but not limited to, parental hukou status, to some extent, determines the life chances their children receive. In this essay, the author would like to introduce human capital theory (HCT) and educational signalling theory (EST), and assess how the applications of each of these two models can enrich the understanding of vertical reproduction of individuals’ social mobility opportunities. The author would also present the limitations of each of these two models when addressing relevant Chinese contexts.

Abstract: Laryngoscopy for tracheal intubation has been developed for many decades. Among various conventional laryngoscopes, videolaryngoscopes (VL) have been applied in different patient populations, including difficult airways. The safety and effectiveness of VL have been repeatedly studied in both normal and difficult airways. The superiority of VL then has been observed and is advocated as the standard of care. In contrast to laryngoscopy, the development of video-assisted intubating stylet (VS, also named as styletubation) has been noticed two dec-ades ago. Since then, sporadic clinical experiences of use have appeared in literature. In this re-view article, we presented our vast use experiences of the styletubation (more than 55,000 pa-tients since 2016). We found this technique is swift (the time to intubate: from 3 s to 10 s), smooth (first-attempt success rate: 100%), safe (no airway complications), and easy (high subjective satis-faction and fast learning curve for the novice trainees) in both normal and difficult airway sce-narios. We therefore propose styletubation technique can be feasibly applied as universal rou-tine use for tracheal intubation.

Improving access to sexual health services is critical in light of rising sexually transmitted infections (STIs). We evaluated a Hub and Spoke model for improving access to sexual health services in three general practices in Victoria, Australia. The primary outcome was the impact on HIV and STI (chlamydia, gonorrhoea, syphilis) testing. Segmented linear regression analysis was conducted to examine the trends in the total HIV/STI tests before (from January 2019 to June 2020) and post-implementation (from July 2020 to July 2021). We evaluated the feasibility and acceptability of integrating this model into the general practices using semi-structured individual interviews. There was a statistically significant rise in testing for HIV and STIs in all general practices: post-implementation, there was an increase of an average of 11.2 chlamydia tests per month (p=0.026), 10.5 gonorrhoea tests per month (p=0.001), 4.3 syphilis tests per month (p=0.010), and 5.6 HIV tests per month (p=0.010). Participants reported increases in knowledge level and confidence in offering STI testing and managing more variety of sexual health cases. This study demonstrated the feasibility of implementing a hub and spoke model to enable GPs to deliver sexual health care with support from a sexual health specialist service.

Abstract: Safety issues related to the electrification of more electric aircraft (MEA) need to be addressed because of the increasing complexity of aircraft electrical power systems and the growing number of safety-critical sub-systems that need to be powered. Managing the energy storage systems and the flexibility in the load-side plays an important role in preserving the system’s safety when facing an energy shortage. This paper presents a system-level centralized operation management strategy based on model predictive control (MPC) for MEA to schedule battery systems and exploit flexibility in the demand-side while satisfying time-varying operational requirements. The proposed online control strategy aims to maintain energy storage (ES) and prolong the battery life cycle, while minimizing load shedding, with fewer switching activities to improve devices lifetime and to avoid unnecessary transients. Using a mixed-integer linear programming (MILP) formulation, different objective functions are proposed to realize the control targets, with soft constraints improving the robustness of the model. Besides, an evaluation framework is proposed to analyze the effects of various objective functions and the prediction horizon on system performance, which provides the designers and users of MEA and other complex systems with new insights into operation management problem formulation.

An oceanic radar altimeter such as TOPEX/Poseidon (T/P) is typically for observing elevation changes over the open oceans or large inland lakes/rivers, with limited applications over solid earth due to its large footprint and susceptibility to waveform contamination and slope effect. Here we demonstrate that it is possible to construct a long-term time series of glacier elevation change from T/P-series radar altimeters over two flat surfaces near a glacier terminus and an icefield (Sites A and B, with slopes of 2° and 0.8°) in Mt. Tanggula, Tibet, at elevations over 5400 m. We retracked radar waveforms using the subwaveform threshold algorithm, selected quality altimeter data (1/4 of the original) with nearly the same slope and adjusted the original elevations by fitting with a time-varying, 2nd order surface. The glacier elevation changes at the two sites from T/P (1993–2002) show seasonal elevation oscillations with linear rates at about −3 m/year and abnormal seasonal changes around the 1997–98 El Niño. Site A is over a deep valley in southern Tanggula. Its elevation dropped about 30 m over 1993–2002 (from T/P) and the glacier almost disappeared by 2016 (from altimeters and satellite images). Despite the sporadic Jason-2 and Jason-3 altimeter data, we also derived long-term rates of glacier elevation change over 1993–2017. Landsat-derived glacier area and elevation changes near the two sites confirm the rapid glacier thinning from the altimeters. The glacier meltwater near Site A supplied increasing source water to Chibuzhang Co west of Mt. Tanggula, contributing partially to its accelerated rising lake level. The glacier thinning at Site B (icefield) was correlated with the increased discharge of the Tuotuo River in eastern Mt. Tanggula, a source region of the Yangtze River. The successful detection of glacier thinning at the two sites shows that T/P-series altimeters can serve as a virtual station at a flat glacier spot to monitor long-term glacier elevation changes in connection to climate change. This virtual station concept is particularly useful for inaccessible glaciers, but its implementation faces two challenging issues: increasing the volume of quality altimeter data and improving the ranging accuracy over a targeted mountain glacier spot.

Minimal access cardiac surgery appears to be the future. It is increasingly desired by cardiologists and demanded by patients who perceive superiority. Minimal access coronary artery revascularisation has been increasingly adopted throughout the world. Here we review the history of minimal access coronary revascularization and see that it is almost as old as the history of cardiac surgery. Modern minimal access coronary revascularization takes a variety of forms – namely minimal access direct coronary artery bypass grafting (MIDCAB), hybrid coronary revascularisation (HCR) and totally Endoscopic Coronary Artery Bypass Grafting (TECAB). It is noteworthy that there is significant variation in nomenclature and approaches for minimal access coronary surgery and this truly presents a challenge to comparing the different methods. However, these approaches are increasing in frequency and proponents demonstrate clear advantages for their patients. The challenge that remains, as for all areas of surgery, is demonstrating superiority of these techniques over tried and tested open techniques which is very difficult. There is a paucity of randomized controlled trials to help answer this question, and the future of minimal access coronary revascularisation to some extent is dependent on such trials. Thankfully some are underway and the results eagerly anticipated.

Climate change-induced events amplify existing social, political, economic, infrastructural and environmental concerns in many Global South cities, and perhaps no city is more vulnerable than Bangladesh’s capital of Dhaka. Climate-induced rural-urban migration is a profound concern, and Dhaka’s political leaders have embraced technology-based innovation as a solution pathway. This article explores the societal impact of Dhaka’s innovation environment strategies for climate change adaptation and mitigation. Employing a case study qualitative methodology, our three findings expand knowledge about innovation-urban climate mitigation as understood by Dhaka-based entrepreneurs: First, the most effective innovations were not the most technologically advanced, but those with the highest degree of participant ownership. Second, gaps between recipient, corporate and governmental understandings of effective mitigation and adaptation harmed projects, and were driven by different definitions of risk and competing understandings of vulnerability. Third, even the most technical climate adaptation measures were inherently political in their application. We discuss how to better position urban climate innovation infrastructures in Bangladesh and beyond, including developing a better recognition of innovation lifecycles for urban climate adaptation and widening our definitions of ‘innovation’ to better incorporate more effective and inclusive climate adaptation solutions.

Poso regency, Central Sulawesi, Indonesia, has a coastal area that has marine tourism potential to be developed. It is expected that marine tourism can bring socio-economic impact to the com-munity. This research was conducted with the objective of assessing the suitability of the area to be developed as a marine and coastal tourism site to provide benefits to the coastal community. Hydrodynamic model will be used in this research as coastal area mapping. As an approach, Analysis Hierarchy Process (AHP) is utilized whose parameters consist of depth, coast type, coast width, brightness, current speed, water base materials, observation of dangerous biota and availability of fresh water. Based on the overall mapping area of 98,644 ha, the research results show that the area that can be utilized is 7,979 ha with a very suitable category, while there is an area of 1,045 ha which can still be classified in the appropriate category.

The past few decades have been characterized by a growing body of profit-seeking public service areas with the understanding that profit-seeking organizations will deliver public services more efficiently than government can. These sectors include, but are not limited to, health care, corrections and education. Governments have created quasi markets to attract private providers of services in these sectors, with varying results. Organizational economics has provided the primary explanation for quasi markets, but questions about the sought-for efficiencies actually realized through these markets persist. We integrate resource dependence theory and organizational economics to provide a more comprehensive explanation of the persistence of quasi markets.

Significance: Cellular redox processes are highly interconnected, yet not in equilibrium, and governed by a wide range of biochemical parameters. Technological advances continue refining how specific redox processes are regulated, but broad understanding of the dynamic interconnectivity between cellular redox modules remains limited. Systems biology investigates multiple components in complex environments and can provide integrative insights into the multi-faceted cellular redox state. This review describes the state of the art in redox systems biology as well as provides an updated perspective and practical guide for harnessing thousands of cysteine sensors in the redoxome for multi-parameter characterization of cellular redox networks. Recent Advances: Redox systems biology has been applied to genome-scale models and large public datasets, challenged common conceptions and provided new insights that complement reductionist approaches. Advances in public knowledge and user-friendly tools for proteome-wide annotation of cysteine sentinels can now leverage cysteine redox proteomics datasets to provide spatial, functional, and protein structural information. Critical Issues: Careful consideration of the analytical approaches is needed to broadly characterize the systems level properties of redox signaling networks and be experimentally feasible. The cysteine redoxome is an informative focal point since it integrates many aspects of redox biology. The mechanisms and redox modules governing cysteine redox regulation, cysteine oxidation assays, proteome-wide annotation of the biophysical and biochemical properties of individual cysteines, and their clinical application are discussed. Future Directions: Investigating the cysteine redoxome at a systems level will uncover new insights into the mechanisms of selectivity and context-dependence of redox signaling networks.

p53 is among the most frequently mutated tumor suppressor genes given its prevalence in >50% of all human cancers, including high grade serous endometrial cancers and ovarian cancers. In addition to loss of tumor suppression function, many mutated p53 (Mutp53) proteins acquire gain-of-function (GOF) activities as oncogenes to promote cancer progression, which manifest through aberrant expression of p53. As we have come to see, statins induce CHIP-mediated degradation of mutp53 by blocking the interaction between mutp53 and DNAJA1. Therefore, targeting critical downstream pathways of mutp53 provides an alternative strategy for treating cancers expressing mutp53. In this review, we summarize recent advances with Wee1 inhibitors and mevalonate pathway inhibitors, particularly statins, regarding their use in gynecological cancers with p53 mutations.

Accurate measurement of solid precipitation (S) has a critical importance for proper understanding of the Earth’s hydrological cycle, validation of emerging technologies and weather prediction models, and developing parameterizations of severe weather elements such as visibility (Vis). However, measuring S is still a challenging problem mainly because of wind effects. The wind effects are normally mitigated by using a Double-Fence Automated Reference (DFAR) system to reduce the wind speed (Ug). To contribute towards addressing some of these issues we have analyzed data sets collected at a site located in Southern Ontario, Canada using several instruments. The instruments include two Geonor gauges, one placed inside a DFAR (SDFAR) and the other inside a double Alter shield (DASG), a Pluvio2 gauge inside a single Alter shield (SASP), a HotPlate, a PARSIVEL2 Disdrometer that measures S and fall velocity (V), and a FD12P senor that measures S and type and Vis. The results show that for the Ug observed in this study (Ug < 6 ms-1), both DASG and SASP have similar collection efficiency (CE) of near 70%. The transfer functions (TF) for DASG and SASP as a function of Ug and also Ug, and V have been derived. The TF for the DASG that includes both Ug and V showed better agreement with observation than just Ug alone. The S measured using all the other instruments were correlated well with SDFAR, but the PARSIVEL2 and FD12P overestimated and underestimated the snow amount respectively as compared the SDFAR. However, the HotPlate captured similar amount of S as the SDFAR. According to this study, the SDFAR showed good correlation with Vis.

Tick-borne tularemia was first described in 1924. Nearly 100 years later, questions remain about the tick vector(s) that pose(s) the greatest risk for transmitting Francisella tularensis (Ft), the causative agent of tularemia. Additionally, few studies have identified genes/proteins required for Ft to infect, persist, and replicate in ticks. To answer questions about vector competence and Ft transmission by ticks, we infected Dermacentor variabilis (Dv), Amblyomma americanum (Aa), and Haemaphysalis longicornis (Hl; invasive species from Asia) ticks with Ft, finding that although Aa ticks initially become infected with 1-log higher Ft, Ft replicated more robustly in Dv ticks, and did not persist in Hl ticks. In transmission studies, both Dv and Aa ticks efficiently infected naïve mice, causing disease in 57% and 46% of those mice, respectively. We identified a putative Ft chitinase, FTL1793, generated a FTL1793 mutant, and found that FTL1793 was deficient in tick infection, persistence, and replication in ticks. Recombinant FTL1793 exhibited chitinase activity in vitro, suggesting that this chitinase may provide an alternative energy source for Ft in ticks. Taken together, Dv ticks appear to pose a greater risk for harboring and transmitting tularemia and FTL1793 plays a major role in promoting tick infections by Ft.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The introduction of tenofovir-derived prodrugs has revolutionised the prevention and management of HIV, which has coincided with 23% reduction in new HIV incidences globally. To date, there are two formulations of tenofovir-derived nucleoside reverse transcriptase inhibitor (NRTI): tenofovir disoproxil fumarate/emtricitabine (TDF/FTC) and tenofovir alafenamide fumarate/emtricitabine (TAF/FTC). Although these prodrugs have shown favourable safety profile, their effects on cardiovascular health are differ from one another: TDF/FTC exhibits potential lipid-lowering effect, TAF/FTC demonstrates potential lipid-inducing effect, which is a major risk factor for cardiovascular diseases. However, this issue has not been previously elucidated, especially among the marginalised populations [lesbian, gay, bisexual and transgender (LGBT) and men who have sex with men (MSM)] who are likely be the main users of these prodrugs. This is of clinically significance as the cardiovascular health in these populations is often overlooked, in addition to a lack of appropriate cardiovascular risk prediction algorithm. Therefore, this review aims to (1) highlight the cardiovascular risks of tenofovir-derived prodrugs in the marginalized populations, and also to (2) establish the importance of having a cardiovascular risk prediction model that is specific to this particular populations so that their health management could be more comprehensive.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Complete digraphs are referred to in the combinatorics literature as tournaments. We consider a family of semi-simplicial complexes, that we refer to as ``tournaplexes'', whose simplices are tournaments. In particular, given a digraph G, we associate with it a ``flag tournaplex'' which is a tournaplex containing the directed flag complex of G, but also the geometric realisation of cliques that are not directed. We define several types of filtrations on tournaplexes, and exploiting persistent homology, we observe that flag tournaplexes provide finer means of distinguishing graph dynamics than the directed flag complex. We then demonstrate the power of these ideas by applying them to graph data arising from the Blue Brain Project's digital reconstruction of a rat's neocortex.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

The aim of this research was to test recent developments in the use of Remotely Piloted Aircraft Systems or Unmanned Aerial Vehicles (UAV) to map pasture biomass yield and nutrient status, across a selected range of field sites throughout the rangelands of Queensland. Improved pasture management begins with an understanding of the state of the resource base, UAV based methods can potentially achieve this at improved spatial and temporal scales. This study developed predictive models of both pasture yield and pasture nutrient status. An automated pasture height surface modelling technique was developed, tested and used along with field site measurements of pasture yields, to predict further estimates across each field site. Both prior knowledge and automated predictive modelling techniques were employed to predict pasture yield and nutrition. Pasture height surface modelling was assessed against field measurements using a rising plate meter, results reported correlation coefficients (R2) ranging from 0.2 to 0.4 for both woodland and grassland field sites. Accuracy of the predictive modelling was determined from further field measurements of pasture yield and on average indicated an error of 0.8 t ha-1 in grasslands and 1.3 t ha-1 in mixed woodlands across both modelling approaches. Correlation analyses between measures of pasture quality, acid detergent fibre and crude protein (ADF, CP), and spectral reflectance data indicated the visible red (651 nm) and red-edge (759 nm) regions were highly correlated (ADF R2 = 0.9 and CP R2 = 0.5 mean values). These findings agreed with previous studies linking specific absorption features with grass chemical composition. These results conclude that the practical application of such techniques, to efficiently and accurately map pasture yield and quality, is possible at the field site scale, however further research is needed, in particular further field sampling of both yield and nutrient elements across such a diverse landscape, with the potential to scale up to a satellite platform for broader scale monitoring.

This document describes the theoretical basis of the algorithms used to determine properties of snow and ice from the measurements of the Ocean and Land Color Instrument (OLCI) onboard Sentinel-3 satellites within the Pre-operational Sentinel-3 snow and ice products (SICE) project: http://snow.geus.dk/. The code used for the SICE retrieval and its documentation can be found at https://github.com/GEUS-SICE/pySICE. The algorithms were developed after the work from Kokhanovsky et al. (2018, 2019, 2020).

Rare diseases are characterized by a wide diversity of signs and symptoms and vary not only from disease to disease, but also from person to person, and living with a disease leads patients to peculiar experiences and treatments, without limits of time and space, as they extend to various environments and relationships of their lives. The objective of this study is the theoretical interaction between Value Co-creation (VC) and the Stakeholder Theory (ST) with the Shared Decision Making (SDM) health care theory. It is configured as a multiparadigmatic proposal by enabling the analysis of multiple perspectives of different stakeholders in health care. Thus, Co-created Decision Making (CDM) emerges in a logic dominated by service, with emphasis on intangible aspects and the interactivity of the relationships. It goes beyond the clinical office and the doctor-patient relationships, as studied in SDM, extending to all environments and interactions that add value to the patient's treatment. It was concluded that the essence of this new theory proposed here is neither in patient-centered care nor in patient self-care, but in co-created relationships with and between stakeholders in both directions, including non-health care environments that are important to the patient, such as relationships with friends, family, other patients with the same disease, social media, public policies, and the practice of pleasurable activities.

Streptococcus pneumoniae is the causative agent of a multitude of diseases and further study into its pathogenies is vital. The pneumococcus is genetically malleable and several tools are available to manipulate this pathogen. In this study, we attempted to utilize one such tool, the Sweet Janus cassette, to replace the capsule locus with other capsule loci in our strain background and found that the efficiency of allelic replacement was low and the number of revertant false-positive colonies was high. We determined that the capacity to recombine capsule varied by the initial isolated colony, suggesting that frequency of reversion is dependent on the bacterial cell line. Alternative selection markers may further expand the application of Sweet Janus. We created novel cassettes that utilized chlorinated phenylalanine as an alternative counter-selection agent in conjunction with the Janus or Sweet Janus cassette, providing a new dual or triple selection marker. Moreover, we created cassettes that do not require engineered resistance in the background strain, including both single and dual selection markers. We were able to utilize all constructs in allelic replacement of the capsule loci. These novel constructs provide a new means for generating gene deletions in S. pneumoniae that expand experimental applications.

We use a regional scale photochemical transport model to investigate the surface concentrations and column integrated amounts of ozone (O3) and nitrogen dioxide (NO2) during a pollution event that occurred in the St. Louis metropolitan region in 2012. These trace gases will be two of the primary constituents that will be measured by TEMPO (Tropospheric Emissions: Monitoring of Pollution), an instrument on a geostationary platform, which will result in a dataset that has hourly temporal resolution during the daytime and ~4 km spatial resolution. Although air quality managers are most concerned with surface concentrations, satellite measurements provide a quantity that reflects a column amount, which may or may not be directly relatable to what is measured at the surface. Our model results provide reasonably good agreement with observed surface O3 concentrations (correlation coefficients ranging from 0.69 to 0.87 at each of the nine monitoring stations in the St. Louis region), which is the only trace gas dataset that can be used for verification. The model shows that a plume of O3 extends downwind from St. Louis and contains an integrated amount of ozone of ~ 16 Dobson Units (DU; 1 DU = 2.69 x 1016 molecules cm-2), an amount lower than what was observed during two massive pollution episodes in the 1980s. Based on the smaller isolatable emissions coming from St. Louis, this quantity is not unreasonable, but may also reflect the reduction of photochemical ozone production due to the implementation of emission controls that have gone into effect since the 1980s.

Multicomponent reactions (MCRs) have been used for more than a century; since their discovery in 1850 by Strecker. To date, MCRs route is regarded as a beneficial strategy due to its capacity to quickly produce molecular diversity and structural complexity of interest for a variety of applications. Despite having famous MRCs such as the Ugi, Passerini, Biginelli, and Hantzsch, this re-view portrays the importance of MCRs in the synthesis of desired products towards applications such as medicinal purposes, sustainable chemistry, and polymerisation. MCRs provide ad-vantages such as reducing the number of sequential multiple reactions to one step, atom economy, recyclable catalysts, mild conditions, preventing waste and reduce solvent use.

The dorsal column nuclei complex (DCN-complex) includes the dorsal column nuclei (DCN, referring to the gracile and cuneate nuclei collectively), external cuneate, X, and Z nuclei, and the median accessory nucleus. The DCN are organised by both somatotopy and modality, and have a diverse range of afferent inputs and projection targets. The functional organisation and connectivity of the DCN implicate them in a variety of sensorimotor functions, beyond their commonly accepted role in processing and transmitting somatosensory information to the thalamus, yet this is largely underappreciated in the literature. To consolidate insights into their sensorimotor functions, this review examines the morphology, organisation, and connectivity of the DCN and their associated nuclei. First, we briefly discuss the receptors, afferent fibres, and pathways involved in conveying tactile and proprioceptive information to the DCN. Next, we review the modality and somatotopic arrangements of the remaining constituents of the DCN-complex. Finally, we examine and discuss the functional implications of the myriad of DCN-complex projection targets throughout the diencephalon, midbrain, and hindbrain, in addition to their modulatory inputs from the cortex. The organisation and connectivity of the DCN-complex suggest that these nuclei should be considered a complex integration and distribution hub for sensorimotor information.

Pulmonary hypertension (PH) is a severe and chronic disease characterized by increased pulmonary vascular resistance and remodeling often precipitating right-sided heart dysfunction and death. Although the condition is progressive and incurable, current therapies for the disease focus on multiple different drugs and general supportive therapies to manage symptoms and prolong survival, ranging from medications more specific to pulmonary arterial hypertension (PAH) to exercise training. Moreover, there are multiple studies exploring novel experimental drugs and therapies including unique neurostimulation, to help better manage the disease. Here we provide a narrative review focusing on current PH treatments that target multiple underlying biochemical mechanisms, including but not limited to imbalances in vasoconstrictor-vasodilator and autonomic nervous system function, inflammation, and bone morphogenic protein (BMP) signaling. We also focus on the potential of novel therapies for managing PH, focusing on multiple types of neu-rostimulation including acupuncture. Lastly, we also touch upon the disease’s different subgroups, clinical presentations and prognosis, diagnostics, demographics, and cost.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Long-term, multi-decade research on planted tree survival in urban settings is sparse. One understudied urban environment is highway rights-of-way (ROW), lands adjacent to high-speed, unsignalized roadways. We conducted a re-inventory of tree planting cohort in northern Illinois, U.S. on a 48 km-long highway near Chicago which were 10-, 21-, and 30-years old to evaluate long-term patterns of survival and diversity. Using each randomly selected planting site along the highway as a unit of observation and analysis, we compared the number of trees documented in record drawing to the number of trees currently alive to determine percent survival. We evaluated 224 planting sites which originally contained 2,944 trees and collected data about the planting site location. For the oldest cohort, 26% of trees were still alive in 2018 (median survival by species = 16%, Q1 = 0%, Q3 = 48%), while 31% of the 21-year-old cohort (med. = 6%, Q1 = 0%, Q3 = 47%) and 86% of the 10-year-old cohort were still alive (med. = 85%, Q1 = 74%, Q3 = 96%). The survival of the 21- and 30-year-old cohort matches urban tree survival estimates by other researchers, while the 10-year-old survival is higher than expected. The only planting location characteristic that significantly affected survival was traffic islands (areas between the highway and entrance/exit ramps). Species with low drought tolerance were less likely to be alive for the 10-year-old cohort. Waterlogging tolerant species were more likely to be alive in the 10-year-old cohort. Since some species in the 21- and 30-year-old cohorts had very low survival, the tree species richness and diversity s in study areas declined between the initial record drawings and reinventory. This study demonstrates the challenges of maintaining long-term survival and diversity in the highway ROW and emphasizes the importance of species selection.

The aim of this research is to expand recent developments in the mapping of pasture yield with remotely piloted aircraft systems to that of satellite-borne imagery. Up to date, spatially explicit and accurate information of the pasture resource base is needed for improved climate-adapted livestock rangeland grazing. This study developed deep learning predictive models of pasture yield, as total standing dry matter in tonnes per hectare (TSDM(tha−1)), from field measurements and both remotely piloted aircraft systems and satellite imagery. Repeated remotely piloted aircraft system structure measurements derived from structure from motion photogrammetry, provided measures of pasture biomass from many overlapping high-resolution images. Repeated remotely piloted aircraft system measures throughout a growing season, were modelled with persistent photosynthetic pasture responses from various Planet Dove high spatial resolution satellite image-derived vegetation indices. Pasture height modelling as an input to the modelling of yield was assessed against terrestrial laser scanning and reported correlation coefficients (R2) from 0.3 to 0.8 for both a coastal grassland and inland woodland pasture. Accuracy of the predictive modelling from both the remotely piloted aircraft system and the Planet Dove satellite image estimates of pasture yield ranged from 0.8 to 1.8 TSDM(tha−1). These results indicated that the practical application of repeated remotely piloted aircraft system derived measures of pasture yield can, with some limitations, be scaled-up to satellite-borne imagery to provide more temporally and spatially explicit measures of the pasture resource base.

Metal powder bed fusion (PBF) additive manufacturing (AM) builds metal parts layer by layer upon a substrate material. The strength of this interface between substrate and printed material is important to characterize, especially in applications where the substrate is retained and included in the finished part. This paper studied the tensile and torsional strengths of wrought and additively manufactured (through PBF) SS316L and compared them to specimens composed of half wrought material and half PBF material. The PBF specimens consistently exhibited higher strength and lower ductility than the wrought specimens. The hybrid PBF/wrought specimens performed similarly to the wrought material. In no specimens did any failure appear to occur at or near the interface between wrought substrate and PBF material. In addition, most of the deformation in the PBF/wrought specimens appeared to be limited to the wrought portion of the specimens. These results are consistent with microscopy showing smaller grain size in the PBF material, which often leads to increased strength in SS316L due to the Hall-Petch relationship.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

The Lagrangian and Eulerian structure and dynamics of a strong wind event in the Tokar Gap region are described using a WRF model hindcast for 2008. Winds in the Tokar Gap reach 25 m s-1 and remain coherent as a jet far out over the Red Sea, whereas equally strong wind jets occurring in neighboring gaps are attenuated abruptly by a jump-like hydraulic transition that occur just offshore of the Sudan coast. The transition is made possible by the supercritical nature of the jets, which are fed by air that spills down from passes at relatively high elevation. By contrast, the spilling flow in the ravine-like Tokar Gap does not become substantially supercritical and therefore does not undergo a jump, and also carries more total horizontal momentum. The Tokar Wind Jet carries some air parcels across the Red Sea and into Saudi Arabia, whereas air parcel trajectories in the neighboring jets ascend as they cross through the jumps, then veer sharply to the southeast and do not cross the Red Sea. The mountain parameter Nh/U is estimated to lie in the rage 1.0-4.0 for the general region, a result roughly consistent with a primary gap jet having a long extension, and supercritical jets spilling down from higher elevation passes. The strong event is marked by the formation of a cyclonic cell near the upstream entrance to the Tokar Gap, a feature absent from the more moderate events that occur throughout the summer. The cell contains descending air parcels that are fed into the primary and secondary jets. An analysis of the Bernoulli function along air parcel trajectories reveals an approximate balance between the loss of potential energy and gain of internal energy and pressure, with surprisingly little contribution from kinetic energy, along the path of the descending flow. All jets attain the critical wind speed nominally required to loft dust into the atmosphere, though only the Tokar Gap has a broad, delta region with plentiful deposits of silt.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

The purpose of this study was to identify potential causes of violence and crime in informal settlements and residents’ strategies for response and prevention to these issues, as perceived by women living in Mathare informal settlement in Nairobi, Kenya. A total of 55 in-depth interviews were conducted with women living in the informal settlement in 2015-2016. A modified grounded theory approach was used to guide data collection and analysis. The most common contributor to violence and crime identified by women in Mathare informal settlement was idle youth, but leadership and government challenges, corruption and/or inadequacy of police, community barriers, tribalism, and lack of protective infrastructure also emerged as contributing factors. Despite facing many economic, environmental, and day-to-day challenges, women in Mathare identified violence and crime as predominant issues; thus, developing effective response and prevention strategies to these issues in informal settlements is paramount. Women suggest there are many strategies and initiatives to reduce and prevent violence and crime in informal settlements, but also identified barriers to implementing them. Findings suggest there is a need for trust-building between formal and informal organizations and institutions, systems of accountability, and long-term investment to foster sustainable and effective violence and crime response and interventions in these settlements.

Background: As long-lived organisms, urban trees often encounter development and redevelopment activities in close proximity during their lifespans. These activities can damage tree roots, often through methods like root severing during trenching or excavation. Methods: In 2017, we simulated trenching damage on mature Quercus virginiana Mill. trees at three different distances from the base (3x, 6x, and 12x the stem diameter). After five years, we revisited these trees to assess root regrowth based on the cut root's cross-sectional area (CSA) and distance from the base. Results: We observed regrowth in all but 38 (6.7%) of the 557 cut roots revisited. The lack of regrowth in some roots was not associated with our original treatments, the CSA of the roots at the time of trenching, or distance between the cut root end and the trunk (minimum P-value = 0.841). On average, the observed CSA of the regrowth was 22.2% of the original root's CSA. Only our original trenching treatments significantly predicted the level of regrowth observed five years after pruning (P-value = 0.024). Discoloration due to root pruning was minimal. Conclusion: In summary, our findings indicate that root systems require many years to recover from trenching damage. Increasing the distance between trenching activities and trees may have a minor effect on root regrowth but primarily helps reduce initial stress on the tree.

Polycystic ovary syndrome (PCOS) is increasingly recognized as a complex metabolic disorder that manifests in genetically susceptible women following a range of negative exposures to nutritional and environmental factors related to contemporary lifestyle. The hypothesis that PCOS phenotypes are derived from a mismatch between ancient genetic survival mechanisms and modern lifestyle practices is supported by a diversity of research findings. The proposed evolutionary model of the pathogenesis of PCOS incorporates evidence related to evolutionary theory, genetic studies, in-utero developmental epigenetic programming, transgenerational inheritance, metabolic features including insulin resistance, obesity and the apparent paradox of lean phenotypes, reproductive effects and subfertility, the impact of the microbiome and dysbiosis, endocrine disrupting chemical exposure, and the influence of lifestyle factors such as poor quality diet and physical inactivity. Based on these premises, the diverse lines of research are synthesized into a composite evolutionary model of the pathogenesis of PCOS. It is hoped that this model will assist clinicians and patients to understand the importance of lifestyle interventions in the prevention and management of PCOS and provide a conceptual framework for future research. It is appreciated that this theory represents a synthesis of the current evidence and that it is expected to evolve and change over time.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Fruit and vegetable (FV) consumption benefits the health of populations, particularly those in East and Southeast Asian countries, which have undergone an unprecedented change in their food environments in the last decade. This current systematic review is the first to study determinants—facilitators, barriers, and moderators—associated with FV consumption in East and Southeast Asia. In a search of the literature, we consulted five electronic academic databases of English peer-reviewed papers published between 2010 and 2020 and found 31 studies. Results of these studies show that individuals strongly perceive FVs as being higher quality and safe and trust in their benefits, and food businesses with modernized systems have significantly fostered the consumption of FVs. A main barrier to FV consumption, however, is financial concerns, exacerbated by food businesses with FV unavailability and urbanization-induced FV price inflation and dietary patterns. Further hindering FV consumption are demographics and shopping patterns. The fragmented and conditionalized findings of the 31 studies require standardized FV consumption measurements. Unlike the impact of FV consumption determinants and their interactions in Western countries, those in Asia, particularly countries other than China, have been substantially understudied. Therefore, as the research gaps in studies of food environments and FV consumption in East and Southeast Asia urgently demand scholarly attention, this paper proposes recommendations that favour the consumption of FVs.

Background: Smoking is disproportionately prevalent among Aboriginal and Torres Strait Islander Australian peoples, with 39% of Indigenous Australians aged over 15 years smoking daily. Efforts to reduce this high prevalence include culturally focused media campaigns, designed using community consultation, highlighting the need to determine how such health messaging is received by smokers. This study aimed to examine Indigenous Australian smokers’ reactions to a culturally focused anti-smoking mass media campaign—'Give up Smokes’. Methods: Intercept surveying across health services and events used recorded demographics, smoking status, quit attempts, smoking health effects, anti-smoking campaign recall, social support, and campaign reactions. Participants rated campaign images in five domains: 1) whether it made them stop and think; 2) personal relevance; 3) believability of design and message; 4) prompting concern about smoking; and 5) motivation towards quitting. Cluster analysis was used to segment smoker types. Results: Smoking health effects knowledge was high, and did not differ by quit readiness, attempts, or social support. Cessation support access was higher among those with greater readiness to quit. Social smoking behaviour and confidence to support others quitting did not significantly differ between participants, however importance of others quitting did. Quit readiness, attempts, and social support were associated with reaction to campaign design, but not message recall. Four types of smokers were described, using smoking characteristics, who differed in campaign message reactions. Conclusions: Strategies using campaign-exposed smoker characteristics to inform culturally focused health promotion are discussed in relation to four identified types of smokers.

The common dry bean (Phaseolus vulgaris L.) is a nutrient dense food produced globally as a major pulse crop for direct human consumption, and is an important source of protein and micronutrients for hundreds of millions of people across Latin America, the Caribbean and Sub-Saharan Africa. Beans require large amounts of heat energy and time to cook, deterring consumers worldwide from purchasing beans. In regions where consumers rely on expensive fuelwood for food preparation, the yellow bean is often marketed as fast cooking. A Yellow Bean Panel (YBP) was assembled to explore the cooking time and health benefits of the five major seed types within the yellow bean market class (Amarillo, Canary, Manteca, Mayocoba, Njano) over two field seasons. This study shows how the Manteca yellow bean possess a fast cooking phenotype, which could serve a genetic resource for introducing fast cooking properties into a new generation of dry beans with cooking times < 20 minutes when pre-soaked and < 80 minutes unsoaked. Nutritional evaluation revealed fast cooking yellow beans have high iron retention (>80%) after boiling. An in vitro digestion/Caco-2 cell culture bioassay revealed a strong negative association between cooking time and iron bioavailability in the YBP (r values > -0.73). When either pre-soaked or left unsoaked the highest iron bioavailability scores were measured in the fast cooking Manteca genotypes providing evidence that this yellow market class is worthy of germplasm enhancement through the added benefit of improved iron quality after cooking.

Miscanthus holds a great potential in the frame of the bioeconomy and yield prediction can help improving Miscanthus logistic supply chain. Breeding programs in several countries are attempting to produce high-yielding Miscanthus hybrids better adapted to different climates and end-uses. Multispectral images acquired from unmanned aerial vehicles (UAVs) in Italy and in the UK in 2021 and 2022 were used to investigate the feasibility of high-throughput phenotyping (HTP) of novel Miscanthus hybrids for yield prediction and crop traits estimation. An intercalibration procedure was performed using simulated data from the PROSAIL model to link vegetation indices (VIs) derived from two different multispectral sensors. Random forest algorithm estimated with good accuracy yield traits (light interception, plant height, green leaf biomass and standing biomass) using VIs time series and predicted yield using peak descriptor derived from VIs time series with 2.3 Mg DM ha-1 of RMSE. The study demonstrates the potential of UAVs multispectral in HTP applications and in yield prediction for providing important information needed to increase sustainable biomass production.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

The Simplified Spherical Harmonic (SPN) approximation was first introduced as a three-dimensional (3-D) extension of the plane-geometry Spherical Harmonic (PN) equations. A third order SPN (SP3) solver, recently implemented in the Nodal Expansion Method (NEM), has shown promising performance in the reactor core neutronics simulations. This work is focused on the development and implementation of the transport corrected interface and boundary conditions in NEM SP3 solver, following recent published work on the rigorous SPN theory for piecewise homogeneous regions. A streamlined procedure has been developed to generate the flux zero and second order/moment discontinuity factors (DFs) of the generalized equivalence theory to eliminate the error introduced by pin-wise homogenization. Moreover, several color set models with varying size and configuration are later explored for their capability of generating DFs that can produce results equivalent to that using the whole-core homogenization model for more practical implementations. The new developments are tested and demonstrated on the C5G7 benchmark. The results show that the transport corrected SP3 solver shows general improvements to power distribution prediction compared to the basic SP3 solver with no DFs or only zero order/moment DFs. The complete equivalent calculations using the DFs can almost reproduce transport solutions with high accuracy. The use of equivalent parameters from larger size color set models show better prediction in the whole-core calculations. By coupling different color set models DFs can offer the best accuracy at both eigenvalues and power distributions.

We present a robust, fresh-frozen approach to immunohistochemistry (IHC), without committing the tissue to IHC via fixation and cryopreservation while maintaining long-term storage, using LiCor-based infrared (IR) quantification for sensitive assessment of TH in immunoreacted mid-brain sections for quantitative comparison across studies. In fresh-frozen tissue stored up to 1 year prior to IHC reaction, we found our method to be highly sensitive to rotenone treatment in 3-month-old Sprague-Dawley rats, and correlated with a significant decline in rotarod laten-cy-to-fall measurement by approximately 2.5 fold. The measured midbrain region revealed a 31% lower TH signal when compared to control (p<0.01 by t test, n=5). Bivariate analysis of in-tegrated TH counts versus rotarod latency-to-fall indicates a positive slope and modest but sig-nificant correlation of R2=0.68 (p<0.05, n=10). These results indicate this rapid, instrument-based quantification method by IR detection successfully quantifies TH levels in rat brain tissue, while taking only 5 days from euthanasia to data output. This approach also allows for the identifica-tion of multiple targets by IHC with the simultaneous performance of downstream molecular analysis within the same animal tissue, allowing for the use of fewer animals per study.

Targeted enrichment of ultraconserved elements (UCE) has emerged as a promising tool for inferring evolutionary history in many taxa, with utility ranging from phylogenetic and phylogeographic questions at deep time scales to population level studies at shallow time scales. However, the methodology can be daunting for beginners. Our goal is to introduce UCE phylogenomics to a wider audience by summarizing recent advances in arthropod research, and to familiarize readers with background theory and steps involved. We define terminology used in association with the UCE approach, evaluate current laboratory and bioinformatic methods and limitations, and, finally, provide a roadmap of steps in the UCE pipeline to assist phylogeneticists in making informed decisions as they employ this powerful tool. By facilitating increased adoption of UCE in phylogenomics studies that deepen our comprehension of the function of these markers across widely divergent taxa, we aim to ultimately improve understanding of the arthropod tree of life.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

The number of animals bred, raised, and slaughtered each year is on the rise, resulting in increasing impacts to welfare. Farmed animals are also becoming more diverse, ranging from pigs to bees. The diversity and number of species farmed invites questions about how best to allocate currently limited resources towards safeguarding and improving welfare. This is of the utmost concern to animal welfare funders and effective altruism advocates, who are responsible for targeting the areas most likely to cause harm. For example, is tail docking worse for pigs than beak trimming is for chickens in terms of their pain, suffering, and general experience? Or are the welfare impacts equal? Answering these questions requires making an interspecies welfare comparison; a judgment about how good or bad different species fare relative to one another. Here, we outline and discuss an empirically-based methodology that aims to improve our ability to make interspecies welfare comparisons by investigating welfare range, which refers to how good or bad animals can fare. We begin our proposal with a theory of welfare. We operationalize that theory of welfare by identifying metrics that are defensible proxies for measuring welfare, including cognitive, affective, behavioral, and neuro-biological measures. We assign differential weights to those proxies that reflect their evidential value for the determinants of welfare, such as the “Delphi'' structured deliberation method with a panel of experts. Then we review the evidence and score its quality to ascertain whether a particular taxa may possess the proxies in question to construct a taxa-level welfare range profile. Finally, we use a Monte Carlo simulation to generate an overall estimate of comparative welfare range relative to our hypothetical index species - humans. Interspecies welfare comparisons will help facilitate empirically informed decision-making to streamline the allocation of resources and to ultimately better prioritize and improve animal welfare.

Yerba maté, an herbal tea derived from Ilex paraguariensis, has previously been reported to be protective against obesity-related and other cardiometabolic disorders. Using high-resolution respirometry and reverse-phase high-performance liquid chromatography, the effects of four weeks of yerba maté consumption on mitochondrial efficiency and cellular redox status in skeletal muscle, adipose, and liver, tissues highly relevant to whole body metabolism, were explored in healthy adult mice. Yerba maté treatment increased mitochondrial oxygen consumption in adipose, but not in other tissues examined. Yerba maté increased ATP concentration in skeletal muscle and decreased ATP concentration in adipose. Combined with observed changes in oxygen consumption, these data yielded a significantly higher ATP:O2, a measure of mitochondrial efficiency, in muscle and a significantly lower ATP:O2 in adipose, which were consistent with yerba maté-induced weight loss. Yerba maté treatment also altered the hepatic glutathione (GSH)/glutathione disulfide (GSSG) redox potential to a more reduced redox state, suggesting potential protective effects against oxidative stress and preservation of cellular function. Together, these data indicate beneficial, tissue-specific effects of yerba maté supplementation on mitochondrial bioenergetics and redox states in healthy mice that are protective against obesity.

Around one billion people live in informal settlements, globally, including over half of Nairobi, Kenya’s three million residents. The purpose of this study was to explore women’s fear of victimization within Mathare, an informal settlement in Nairobi, Kenya and how fear of victimization influences behavior. Fifty-five in-depth interviews were conducted with women in 2016. A modified grounded theory approach guided data collection and analysis. Findings suggest fear of victimization is a serious concern in informal settlements. Women have found ways to adopt their behaviors that allow them to continue to function and protect their children despite fearing victimization, but at a potential cost to their health and well-being. Thus, there is a critical need for more research focused on social, economic, structural, community, infrastructure, technological, and individual strategies to prevent violence, enhance residents’ sense of safety, and, subsequently, minimize women’s fear of victimization in informal settlements.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

Summary Genome assembly projects have grown exponentially due to breakthroughs in sequencing technologies and assembly algorithms. Evaluating the quality of genome assemblies is critical to ensure the reliability of downstream analysis and interpretation. To fulfil this task, we have developed the AssemblyQC pipeline that performs file-format validation, contaminant checking, contiguity measurement, gene- and repeat-space completeness quantification, telomere inspection, taxonomic assignment, synteny alignment, scaffold examination through Hi-C contact-map visualisation, and assessments of completeness, consensus quality and phasing through K-mer analysis. It produces a comprehensive HTML report with method descriptions, tables, and visualisations. Availability and Implementation The pipeline uses NextFlow for workflow orchestration and adheres to the best-practice established by the nf-core community. This pipeline offers a reproducible, scalable, and portable method to assess the quality of genome assemblies – the code is available online.GitHub: https://github.com/Plant-Food-Research-Open/assemblyqc Supplementary information Pipeline usage documentation, parameter descriptions and example outputs are available on GitHub: https://github.com/Plant-Food-Research-Open/assemblyqc/tree/main/docs. A preview report is also hosted online: https://plant-food-research-open.github.io/assemblyqc

Mushroom cultivation vastly improves the yield of mushrooms under optimized, controlled conditions, but may be susceptible to opportunistic colonization by pest species that can establish themselves, as well as the pathogens and pests they may transmit. Here we describe our investigation into the bacterial communities of adult Lycoriella ingenua (Diptera: Sciaridae) and Megaselia halterata (Diptera: Phoridae) collected from button mushroom (Agaricus bisporus) production houses in Pennsylvania. We collected adult flies and sequenced the hypervariable v4 region of the bacterial 16S rRNA using the Illumina MiSeq. The most abundant bacterial genus detected in both species was Wolbachia, but phylogenetic analysis revealed that the infections are from different clades. Future studies include the characterization of Wolbachia infections on fly behavior and biology, comparison of microbial diversity of fly species colonizing wild mushrooms, and other microbiota that may contribute to the success of certain pest fly species.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

In insects, Adipokinetic hormone is the primary hormone responsible for the mobilization of stored energy. While a growing body of evidence has solidified role of Adipokinetic hormone (AKH) in modulating the physiological and behavioral responses to metabolic stress, little is known about the upstream endocrine circuit that directly regulates AKH release. We evaluated the AKH-producing cell (APC) transcriptome to identify potential regulatory elements controlling APC activity, and found that a number of receptors show consistent expression levels, including all known dopamine receptors and the Pigment Dispersing Factor receptor (PDFR). We tested the consequences of targeted genetic knockdown and found that AKH expression of RNAi elements corresponding to each dopamine receptor caused a significant reduction in survival under starvation. In contrast, PDFR knockdown significantly extended lifespan under starvation whereas expression of a tethered PDF in APCs resulted in a significantly shorter lifespan. These manipulations caused various changes in locomotor activity under starvation. We used live-cell imaging to evaluate the acute effects of the ligands for these receptors on APC activation. Dopamine application led to a transient increase in intracellular calcium in a sugar-dependent manner. Furthermore, co-application of dopamine and ecdysone led to a complete loss of this response, suggesting that these two hormones act antagonistically. We also found that PDF application led to an increase in cAMP in APCs, and that this response was dependent on expression of the PDFR in APCs. Together these results suggest a complex circuit in which multiple hormones act on APCs to modulate metabolic state.

An open source computational fluid dynamics (CFD) solver has been incorporated into the WindNinja modeling framework widely used by wildland fire managers as well as researchers and practitioners in other fields, such as wind energy, wind erosion, and search and rescue. Here we describe incorporation of the CFD solver and evaluate its performance compared to the conservation of mass (COM) solver in WindNinja and previously published large-eddy simulations (LES) for three field campaigns conducted over isolated terrain obstacles of varying terrain complexity: Askervein Hill, Bolund Hill, and Big Southern Butte. We also compare the effects of two important model settings in the CFD solver and provide guidance on model sensitivity to these settings. Additionally, we investigate the computational mesh and difficulties regarding terrain representation. Two important findings from this work are: (1) the choice of discretization scheme for advection has a significantly larger effect on the simulated winds than the choice of turbulence model and (2) CFD solver predictions are significantly better than the COM solver predictions at windward and lee side observation locations, but no difference was found in predicted speed-up at ridgetop locations between the two solvers.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Limited observational studies have described the relationship between sleep duration and overall diet. The present study investigated the association between sleep duration at weekdays and empirically derived dietary patterns in a nationally representative sample of UK adults, aged 19-64 years old, participating in the 2008-2012 UK National Diet and Nutrition Survey Rolling Programme. Survey members completed between three to four days of dietary records. Sleep duration at weekdays was categorised into tertiles to reflect short, normal and long sleep duration. Social jetlag was calculated as the difference between sleep duration at weekends and weekdays. The association between sleep duration/ social jetlag and dietary patterns, derived by principal components analysis, was assessed regressing diet on sleep whilst accounting for the complex survey design and adjusting for relevant confounders. Survey members in the highest tertile of sleep duration had on average 0.45 (95% CI -0.78, -0.12) lower healthy dietary pattern score compared to middle tertile (p =0.007). There was an inverted u-shaped association between social jetlag and a healthy dietary pattern, such that when sleep at weekends exceeded weekday sleep by 1h 45min, scores for indicating a healthy dietary pattern declined (p =0.005). In conclusion, long sleep duration at weekdays and an increased social jetlag are associated with a lower healthy dietary pattern score. Further research is required to address factors influencing dietary patterns in long sleepers.

The study assessed the trapping efficacy of locally-modified 1) Gravid Aedes Trap(GAT) lined with insecticide-treated net (ITN) as a killing agent, 2) Autocidal Gravid Ovitrap(AGO) with sticky board in the semi-field system (SFS) and field setting. Fully-balanced Latin square experiments were conducted to compare GAT lined with ITN vs AGO, both with either yeast or grass infusion. Biogents-Sentinel (BGS) with BG-Lure and no CO2 was used as standard trap for Aedes mosquitoes. In the SFS, GAT outperformed AGO in collecting both nulliparous (65% vs 49%,OR=2.22,[95%CI:1.89-2.60],p

Surface finishing is challenging for additively manufactured components with complex geometries. Magnetic abrasive finishing (MAF) is a promising surface finishing technology that can refine the surface quality of components with complex shapes produced by additive manufacturing. However, there is insufficient study regarding the impact of MAF on microstructure-property relationships for additively manufactured builds, which is critical for evaluating the mechanical performance. Furthermore, although MAF is usually used as the final step of post-processing, it remains unclear whether adjusting the sequence between MAF and other processes, e.g., heat treatment, can potentially improve the mechanical performance. In this work, the effects of MAF on the microstructure and mechanical property evolution of Inconel 718 superalloys made by laser powder bed fusion (LPBF) were studied. The application of MAF was found to significantly reduce the surface roughness of alloys and refine the grain size of aged samples. Moreover, MAF is able to increase the elongation of materials, which can be further influenced by the sequence of MAF and different heat treatments. The highest elongation can be achieved when MAF is performed between homogenization and aging processes. This work demonstrated a promising solution to improving the performance of LPBF Inconel 718 by combining MAF and heat treatment, which provides new perspectives on the post-processing development of additively manufactured alloys for advanced mechanical properties.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Bamboo is the building material of the past and future. It offers numerous properties that make it versatile for various applications, including construction. Its impressive strength-to-weight ratio enables it to bear substantial loads and stresses, while its good elasticity allows efficient energy absorption. However, its mechanical properties can vary based on factors such as species, age, locations, methods, and treatment. Treating bamboo is essential to enhance its properties and durability. The literature provides various natural and chemical treatments which enhanced some of the properties but also reported a drawbacks on higher temperature, content and duration. This paper reviewed 57 articles from Scopus database, specifically focusing on article-document type publications from the years 2003 to 2023. Additional references were also incorporated to address concerns in properties, treatment and standards to provide systematic understanding. MATLAB was utilized for data text analytics. With extensive assessment on the articles, the following gaps and concerns were observed and recommends for further study and assessment such as for bamboo properties, the development of centralized guidelines and procedures for the preparation and processing; exploration of alternative materials to reinforce bamboo without compromising its ductility; development of joint connections, and testing of mechanical properties considering seismic, wind and vibration. For treatment methods, the standardization of procedures using natural, chemical or combination. Lastly, for bamboo codes and standards, assessment of existing codes and standards for testing the mechanical properties of bamboo highlighting the potential limitations and areas, uniformity, differences with all existing similar standards. By filling these gaps, it can support the reliability and robustness of bamboo as a sustainable material, fostering its promotion and adoption in construction industry.

The development of antimicrobial resistance to conventional antibiotics is a major global health challenge. Infections caused by multidrug-resistant gram-negative bacteria have been named one of the most urgent global health threats. Considerable efforts are devoted to developing new antibiotic drugs and investigating the mechanism of antibiotic resistance. Recently, Anti-Microbial Peptides (AMPs) have emerged as a new platform for the target and design of novel drug resistant anti-microbial agents promising a new therapeutic strategy. AMPs are rapid, potent, possess an unusually broad spectrum of activity, and have shown efficacy as topical agents. Unlike traditional therapeutics that interfere with essential bacterial enzymes, AMPs interact with microbial membranes through electrostatic interactions and physically damage cell integrity. However, naturally occurring AMPs have limited selectivity and modest efficacy. Therefore, recent efforts have focused on the development of synthetic AMP analogs as suitable drug targets. This work explores the development of novel antimicrobial agents which mimic the structure of graft-copolymers and mirror the mode of action of an AMP. Chitosan-graft-polypeptide side chains are synthesized by the ring-opening polymerization of N-carboxyanhydrides of L-lysine and L-leucine initiated from the functional groups of chitosan. The derivatives with random- and block-copolymer side chains are explored as drug targets. These graft copolymer systems exhibit activity against clinically significant pathogens and disrupt biofilm formation. This work highlights the potential of chitosan-graft-polypeptide structures in biomedical applications.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Digital technologies have changed the way supply chain operations are structured. In this article, we conduct systematic syntheses of literature on the impact of new technologies on supply chains and the related cyber risks. A taxonomic/cladistic approach is used for the evaluations of progress in the area of supply chain integration in the Industrial Internet of Things and Industry 4.0, with a specific focus on the mitigation of cyber risks. An analytical framework is presented, based on a critical assessment with respect to issues related to new types of cyber risk and the integration of supply chains with new technologies. This paper identifies a dynamic and self-adapting supply chain system supported with Artificial Intelligence and Machine Learning (AI/ML) and real-time intelligence for predictive cyber risk analytics. The system is integrated into a cognition engine that enables predictive cyber risk analytics with real-time intelligence from IoT networks at the edge. This enhances capacities and assist in the creation of a comprehensive understanding of the opportunities and threats that arise when edge computing nodes are deployed, and when AI/ML technologies are migrated to the periphery of IoT networks.

The resistance of cancer cell subpopulations, including cancer stem cell (CSC) populations, to apoptosis-inducing chemotherapeutic agents is a key barrier to improved outcomes for cancer patients. The cationic amphiphilic drug hexamethylene amiloride (HMA) has been previously demonstrated to efficiently kill bulk breast cancer cells independent of tumor subtype or species, but acts poorly toward non-transformed cells derived from multiple tissues. Here we demonstrate that HMA is similarly cytotoxic toward breast CSC-related subpopulations that are resistant to conventional chemotherapeutic agents, but poorly cytotoxic toward normal mammary stem cells. HMA inhibits the sphere-forming capacity of FACS-sorted human and mouse mammary CSC-related cells in vitro, specifically kills tumor but not normal mammary organoids ex vivo, and inhibits metastatic outgrowth in vivo, consistent with CSC suppression. Moreover, HMA inhibits viability and sphere formation by lung, colon, pancreatic, brain, liver, prostate and bladder tumor cell lines, suggesting that its effects may be applicable to multiple malignancies. Mechanistically, HMA elicits the permeabilization of the limiting lysosomal membrane, a hallmark feature of the lysosome-dependent cell death pathway. Our observations expose a key vulnerability intrinsic to cancer stem cells, and point to novel strategies for the exploitation of cationic amphiphilic drugs in cancer treatment.

This work studies a novel low voltage (<60 V) hybrid system that supports engine boosting and downsizing in addition to start-stop, regenerative braking, and constrained torque assist/regeneration. The hybrid power split supercharger (PSS) shares a 9 kW motor between supercharging the engine or providing hybrid functionalities through a planetary gear set, a brake and a bypass valve. The PSS operation is limited to only one of the parallel hybrid or boosting modes at a time, necessitating a highly optimized decision making algorithm to select the device mode and power split ratio. In this work an adaptive equivalent consumption minimization strategy (A-ECMS) is developed for energy management of the PSS. The A-ECMS effectiveness is compared against a dynamic programming (DP) solution with full drive cycle preview through hardware-in-the-loop experiments on an engine dynamometer testbed. The experiments show that the PSS with A-ECMS reduces a vehicle fuel consumption by 18.4% over standard FTP75 cycle compared to a baseline turbocharged engine, while global optimal DP solution decreases the fuel consumption by 22.8% compared to baseline.

Suitable measures of grazing impacts on ground cover, that enable separation of the effects of climatic variations, are needed to inform land managers and policy makers across the arid rangelands of the Northern Territory of Australia. This work developed and tested a time-series, change-point detection method for application to time series of vegetation fractional cover derived from Landsat data to identify irregular and episodic ground-cover growth cycles. These cycles were classified to distinguish grazing impacts from that of climate variability. A measure of grazing impact was developed using a multivariate technique to quantify the rate and degree of ground cover change. The method was successful in detecting both long term (> 3 years) and short term (< 3 years) growth cycles. Growth cycle detection was assessed against rainfall surplus measures indicating a relationship with high rainfall periods. Ground cover change associated with grazing impacts was also assessed against field measurements of ground cover indicating a relationship between both field and remotely sensed ground cover. Cause and effects between grazing practices and ground cover resilience can now be explored in isolation to climatic drivers. This is important to the long term balance between ground cover utilisation and overall landscape function and resilience.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

We present a new computing package Flagser, designed to construct the directed flag complex of a finite directed graph, and compute persistent homology for flexibly defined filtrations on the graph and the resulting complex. The persistent homology computation part of Flagser is based on the program Ripser [2], but is optimised specifically for large computations. The construction of the directed flag complex is done in a way that allows easy parallelisation by arbitrarily many cores. Flagser also has the option of working with undirected graphs. For homology computations Flagser has an Approximate option, which shortens compute time with remarkable accuracy. We demonstrate the power of Flagser by applying it to the construction of the directed flag complex of digital reconstructions of brain microcircuitry by the Blue Brain Project and several other examples. In some instances we perform computation of homology. For a more complete performance analysis, we also apply Flagser to some other data collections. In all cases the hardware used in the computation, the use of memory and the compute time are recorded.

Degussa P25 is a benchmark form of TiO₂ used worldwide in photocatalysis studies. Currently no such benchmark exists for co-catalysts, which are essential for many photocatalytic reactions. Here, we present the preparation of Pt nanocluster co-catalysts on TiO₂ using an unmodified commercial source and equipment that is commonly available. Transmission electron microscopy reveals that the procedure produces TiO₂ decorated with Pt atom and nanoclusters (1-5 atoms). Optical reflectance and X-ray diffraction measurements show that the procedure does not affect the TiO₂ polymorph or UV-Vis absorbance. Gas phase photocatalytic splitting of heavy water (D₂O) shows that the Pt nanocluster decorated TiO₂ outperforms Pt nanoparticle (produced by photodeposition) decorated TiO₂ in D₂ production. Pt nanoclusters, produced directly from a commercial source, with high co-catalyst activity are prime candidates to be used in benchmark photocatalytic reactions.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.