The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

This paper first discusses a fractional-order Liu system of order as low as 2.7 and shows its chaotic characteristics by carrying out numerical simulations such as Lyapunov exponents, bifurcation diagrams and phase portraits. Then, by using the topological horseshoe theory and computer-assisted proof, the existence of chaos in the system is verified theoretically. Finally, the fractional-order system is implemented on a Field Programmable Gate Array (FPGA) and the results obtained show that the fractional-order Liu system is indeed chaotic.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

The statistical technique, the multiple regression model, is employed to analyze the relationship between the dependent variable and several independent variables. The multicollinearity problem is one of the assumptions in the multiple regression model that occurred in the relationship among independent variables. The ordinal least square is the standard method to evaluate parameters in the regression model, but the multicollinearity problem affects the unstable estimator. The Liu regression is proposed to approximate the Liu estimators based on the Liu parameter to overcome multicollinearity. For this paper, we have proposed the modified Liu parameter to estimate the biasing parameter in scaling options to compare the ordinal least square estimator with two modified Liu parameters and six standard Liu parameters. The performance of the modified Liu parameter is considered with the generating independent variables from the multivariate normal distribution in the Toeplitz correlation pattern as the multicollinearity data, where the dependent variable is obtained from the independent variable multiplied with a coefficient of regression and with the error from the normal distribution. The mean absolute percentage error is computed as an evaluation criterion of estimation. For application, the Hepatitis C patients dataset is a real dataset to investigate the benefit of the modified Liu parameter. Through the simulation and real dataset, it can be seen from the results that the modified Liu parameter outperforms the other Liu parameters and the ordinal least square estimator. It can recommend the user for estimating parameters by using the modified Liu parameter when the independent variable exits the multicollinearity problem.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Staphylococcus aureus(S. aureus) is associated with mastitis in dairy cows, this study investigates the therapeutic effect of maggot antimicrobial peptides on S. aureus induced mastitis in mice. The maggot AMP was isolated and purified, tested for antimicrobial activity, and used to treat a pathological model of rat mastitis. The concentration of 1.5mg/（Kg. BW）AMP was selected as intramammary treatment in S. aureus-induced mastitis in mice. The mice were divided into four groups of 30 mice each: group I (healthy control), group II (disease control), group III (AMP), and group IV (ciprofloxacin). To evaluate the therapeutic efficacy of maggot AMP in mastitis induced by S. aureus based on clinical presentation, mammary gland structure, bacterial load, histopathology, and cure. During the 7-day treatment period, all the mice in Group II died in the afternoon of the fifth day, and the clinical signs of the mice in Group III began to improve on the third day, as evidenced by the gradual recovery of the mice's mental status, dietary intake, and water intake. During the treatment period, the bacterial load count of Group III was significantly lower than that of Group II but higher than that of Group IV, while the bacterial load count of Group III gradually decreased and approached that of Group IV from the fifth to the seventh day. The levels of TNF-α in groups III and IV were significantly lower than those in group II, suggesting that maggot AMP has a certain inhibitory effect on TNF-α. Treatment with AMP@ 1.5 mg/(Kg. BW) showed restoration of clinical signs, reduced bacterial load, and lower TNF-α levels in mice, leading to significant improvement in histopathological changes as compared to disease controls. The final cure rate was 40% for mice in Group III compared to 70% for mice in Group IV, compared to all mice in Group II that died. From this study, it can be concluded that maggot AMP can be used as a potential alternative treatment option to antibiotics for the treatment of bovine mastitis.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

In terahertz communication systems, lens antennas used in transceivers are basically plano-convex dielectric lenses. As the aperture increases and the focal length decreases, the thickness and mass of the plano-convex lens increase rapidly. Through theory and simulation, we designed a Fresnel lens suitable for the terahertz band to meet the requirements of large aperture and short focal length, and simulated the performance, advantages and disadvantages of the terahertz Fresnel lens. A 300GHz terahertz wireless communication system was built to verify the gain effect of the Fresnel lens antenna. The experimental results show that the Fresnel lens can amplify the signal in the terahertz band. The theoretical gain of a 30 cm Fresnel lens is 48.83dB, while the actual measured gain is approximately 45dB.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

In an effort to enhance the efficiency and safety of open-pit mines, this study explores the optimization of end slope road parameters and slope structures, specifically focusing on unmanned driving lanes.A significant aspect of the study is the development of a truck trajectory offset model, which considers the different reaction times between automated sensors and human drivers in adapting to environmental changes. To test these concepts, the study uses numerical simulations to confirm the stability of the proposed end slope designs. Using Victory West Mine No. 1 as a case study, the research determines the optimized width for unmanned driving lanes and the maximum angle for safe steepening of end slopes. The findings indicate that the optimized unmanned lane width for NTE240 mining dump trucks is 1743 mm, allowing for a 2-degree increase in the slope angle at the south end slope. This optimization leads to a steep mining stripping volume of 3.2735 million m³ and a coal output of 2.49628 million tons, maintaining a stripping ratio of 1.31m³/t. These results demonstrate that the unmanned driving road width optimization not only ensures slope safety but also significantly boosts the economic benefits of steep mining in open-pit mines.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

Clarifying the distribution of temperature and pressure in the wellbore and cavern during hydrogen injection and extraction is crucial for quantitatively assessing cavern stability and wellbore integrity. This paper establishes an integrated flow and heat transfer model for the cavern and wellbore during hydrogen injection and production, analyzing the variations in temperature and pressure in both the wellbore and the cavern. The specific conclusions are as follows. (1) The temperature and pressure parameters of hydrogen and natural gas within the chamber and wellbore were compared. Under identical injection and production conditions, the temperature of hydrogen in the chamber was 10°C higher than that of natural gas, and 16°C higher in the wellbore. The pressure of hydrogen in the chamber was 2.9 MPa greater than that of natural gas, and 2.6 MPa higher in the wellbore. (2) A comparative analysis was conducted on the impact of surrounding rock’s horizontal and numerical distance on temperature during hydrogen and natural gas injection processes. As the distance from the cavity increases, from 5 to 15 meters, the temperature fluctuation in the surrounding rock diminishes progressively, with the temperature effect in the hydrogen storage chamber extending at least 10 meters. (3) The influence of rock thermal conductivity parameters on temperature during the processes of hydrogen injection and natural gas extraction is compared. The better the thermal conductivity, the deeper the thermal effects penetrate the rock layers, with the specific heat capacity having the most significant impact.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

It is imperative to conduct experimental studies on the seepage behavior of gas-bearing coal under cyclic dynamic loading conditions. This paper focuses on the evolution of coal permeability under the combined effects of dynamic loading, static loading, and gas adsorption. The principal conclusions are as follows. (1) As the frequency and amplitude of dynamic loading increase, the development of pore and fissure structures within the coal body becomes increasingly pronounced during dynamic loading cycles, resulting in a gradual rise in permeability. Notably, as the coal approaches its yielding stage, the permeability can increase by up to 47%. (2) The permeability curve is divided into four regions: the compaction reduction zone, the oscillation zone, the gradual recovery zone, and the abrupt increase zone of failure. Ultimately, in the failure phase, the permeability surges dramatically, potentially reaching 4 to 5 times the initial permeability. (3) When the static load stage is constant, the rate of change in permeability of the coal under dynamic loading decreases with increasing adsorption amount. When the adsorption amount is constant, the rate of change in permeability of the coal under dynamic loading increases with the increase in static load stress stage, with the maximum increase reaching 75.2%. It can be concluded from the rate of change in permeability and the dynamic loading sensitivity coefficient that the permeability of the coal is highly sensitive to cyclic dynamic loading, with increased sensitivity associated with larger static load stages and decreased sensitivity with greater adsorption amounts.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

In this paper, a novel permanent magnet-assisted synchronous reluctance machine (PMASynRM) with rare-earth PMs and ferrite magnets is proposed. The performance of PMASynRM is discussed with respected to the different magnet ratio of rare-earth PMs and ferrite magnets. Some characteristics including the flux density, output torque, cogging torque, output power, power factor, torque ripple, loss, efficiency, and demagnetization are calculated by 2-D finite element analysis (FEA). The analysis results show that the excellent performance can be obtained by using hybrid magnet of rare-earth PMs and ferrite magnets with the suitable magnet ratio, and provide some desirable cost-performance trade-off.

In the field of Natural Language Processing (NLP), Large Language Models (LLMs) have shown great potential in document-level event extraction tasks, but existing methods face challenges in the design of prompts. To address this issue, we propose an optimization strategy called "Definition-driven Document-level Event Extraction (DDEE)." By adjusting the length of the prompt and enhancing the clarity of heuristics, we have significantly improved the event extraction performance of LLMs. We used data balancing techniques to solve the long-tail effect problem, enhancing the model's generalization ability for event types. At the same time, we refined the prompt to ensure it is both concise and comprehensive, adapting to the sensitivity of LLMs to the style of prompts. In addition, the introduction of structured heuristic methods and strict limiting conditions has improved the precision of event and argument role extraction. These strategies not only solve the prompt engineering problems of LLMs in document-level event extraction but also promote the development of event extraction technology, providing new research perspectives for other tasks in the NLP field.

Rapid and accurate detection of road cracks is of great significance for road health monitoring, but currently this work is mainly completed through manual site surveys. Low-altitude UAV remote sensing can obtain images with centimeter or even subcentimeter ground resolution, which provides a new efficient and economical approach for rapid crack detection. Nevertheless, crack detection networks face challenges such as edge blurring and misidentification due to the heterogeneity of road cracks and the complexity of the background. To address these issues, we propose a real-time edge reconstruction crack detection network (ERNet) which adopts multi-level information aggregation to reconstruct crack edges and improve the accuracy of segmentation between the target and background. To capture global dependencies across spatial and channel levels, we propose an efficient bilateral decomposed convolutional attention module (BDAM) that combines depth separable convolution and dilated convolution to capture global dependencies across spatial and channel levels. To enhance the accuracy of crack detection, we use a coordinate-based fusion module that integrates spatial, semantic, and edge reconstruction information. In addition, we propose an automatic measurement of crack information for extracting the crack trunk and its corresponding length and width. Experimental results demonstrate that our network achieves the best balance between accuracy and inference speed.

Practical applications of CsPbX3 nanocrystals (NCs) are limited by their poor stability. The formation of heterojunction between CsPbX3 NCs and oxides is an effective means to protect perovskite from polar solvents and other external factors. Significantly improving the stability and photocatalytic properties of the core/shell perovskite is very important for its application in photoelectric and photocatalytic technology. Here, we report the synthesis of asymmetrical CsPbBr3/TiO2 core-shell heterostructure NCs at single particle level by hot injection liquid phase synthesis and sol-gel method, where each CsPbBr3 NCs is partially covered by titanium dioxide. It is shown that the type II arrangement is generated at the heterogeneous interface, which greatly facilitates the separation of electron-hole pairs and increases the carrier transport efficiency. More crucial, due to the protection of titanium dioxide shell, the product has higher long-term stability in humid air compared with bare CsPbBr3 NCs. The asymmetrical core-shell heterostructure prepared in this study not only improves the stability of CsPbX3 NCs, but also provides some ideas for optoelectronic device applications and TiO2-based photocatalysts.

Short video addiction refers to a psychological dependency on short video applications, characterized by an intense attachment and an inability to control usage, leading to typical addiction symptoms. While its definition bears similarities to substance addiction, significant differences also exist. According to the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5), published in 2013, short video addiction has not yet been officially classified as an addiction disorder. To facilitate more in-depth and standardized research on short video addiction, it is essential to synthesize and organize existing studies on its theoretical foundations and mechanisms.

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

Determining the general-name-derived semantic relationships between geographic names often requires consulting many geographic name documents for verification. In geographic name translation and geographic name knowledge graphs, this method cannot meet the needs of large-scale extraction of general-name-derived semantic relationships between geographic entities. To solve this problem, this paper proposes a general-name derivation relation recognition method based on Prompt learning and Semantic Spatiotemporal Distribution Attention Feature Fusion (SSD-AFF). This method adopts a pipe-based relationship recognition strategy. First, the Prompt learning method is adopted to form a general-name derivation pattern with the general-name-derived geographical name category and the original geographical name category as the prompt word, and then the derivation pattern is combined with the geographical name as the input of the model so that the recognition problem of the general-name derivation of the geographical name can be transformed into a classification problem using the bidirectional language model. Then, by analyzing the characteristics of the semantic association and geographical spatio-temporal distribution between the general-name-derived geographical name and the original geographical name, the semantic spatio-temporal distribution characteristics of the general-name-derived geographical name are constructed. Finally, the network model based on the semantic spatio-temporal distribution Attention Feature Fusion (SSD-AFF) is used to distinguish the general-name-derived semantic relationships. The experimental results show that the proposed method has good performance. It can effectively mine the general-name-derived semantic relations between the vector data of geographical entities and has important application value in geographical name translation and geographical name knowledge maps.

Quadruped robots possess significant mobility in complex and uneven terrains due to their outstanding stability and flexibility, making them highly suitable in rescue missions, environmental monitoring, and smart agriculture. With the increasing use of quadruped robots in more demanding scenarios, ensuring accurate and stable state estimation in complex environments has become particularly important. Existing state estimation algorithms relying on multi-sensor fusion, such as those using IMU, LiDAR, and visual data, often face challenges on non-stationary terrains due to issues like foot-end slippage or unstable contact, leading to significant state drift. To tackle this problem, this paper introduces a state estimation algorithm that integrates an Invariant Extended Kalman Filter (InEKF) with a disturbance observer, aiming at estimating the motion state of quadruped robots on non-stationary terrains. Firstly, foot-end slippage is modeled as a deviation in body velocity and explicitly included in the state equations, allowing for a more precise representation of how slippage affects the state. Secondly, the state update process integrates both foot-end velocity and position observations to improve the overall accuracy and comprehensiveness of the estimation. Lastly, a foot-end contact probability model, coupled with an adaptive covariance adjustment strategy, is employed to dynamically modulate the influence of the observations. These enhancements significantly improve the filter's robustness and the accuracy of state estimation in non-stationary terrain scenarios. Experiments conducted with the Jueying Mini quadruped robot on various non-stationary terrains show that the enhanced InEKF method offers notable advantages over traditional filters in compensating for foot-end slippage and adapting to different terrains.

Edvard Munch, a founder of Expressionism was pre-occupied with depicting his subjective experience and the most prolific painter of self-portraits since Rembrandt. Based on evidence that faces and self-related images are more salient than other objects it is plausible that self-portraits, in which the subject and object are the same, reflect the artist’s state of mind. Although he suffered from a variety of physical and psychological illness Munch was not diagnosed with any specificity in his lifetime. Posthumous diagnoses include schizophrenia, anxiety, bipolar and other disorders. Recent research has revealed altered visual perception in such patients. The present study empirically analysed three stylistic elements of Munch’s painted self-portraits and portraits: contrast, colour and fractal dimension and his painted productivity, to determine if variations correlate with critical life events and if so whether they indicate states of mind. It found significant increases in contrast and colour brightness and persistent high complexity during critical periods supporting the conclusion that Munch is diagnostically best described as suffering from early onset schizophrenia and comorbid social anxiety disorder.

Many have speculated that events of personal and financial loss in Rembrandt’s life caused depression and that this is revealed by examination of his self-portraits particularly those painted in old age. Some report detecting various physiological diseases associated with aging, including vision impairment, which may have affected his mood and work. Aging and neurodegenerative disease which often accompanies it, are both associated with depression. Recent advances in imaging and computer technology make it possible to empirically examine changes in artistic style which can contribute to understanding artists’ physical and mental health. In the current study changes in contrast, colour and fractal dimension were measured in the entire corpus of Rembrandt’s painted self-portraits and portraits to determine whether changes in style indicate depression or disease. Productivity was also examined as an indirect indicator. Given the high salience attributed to self-images, it also examined whether differences in style could be detected between self-portraits and portraits of related and unrelated others. The results indicate that it is unlikely that Rembrandt suffered from unipolar or bipolar depression, age-related cognitive decline, or neurodegenerative disease. The data are consistent with someone experiencing episodes of low mood consistent with normal grieving and adversity followed by resilient recovery. There is evidence of a gradient in saliency and complexity between self-portraits and related and unrelated portraits, of a less formal style in portraits of related others and of a ‘late’ style identified by leading art historians consistent with macular degeneration. The results are also consistent with an association of aesthetic preference with mid-level fractal values tending towards the Golden Mean long associated with beauty in nature and in art.

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

Researches on the runoff and sediment reduction effects of soil and water conservation measures are being on the rise, which is of great significance for carrying out strategic on soil and water conservation in the Yellow River Basin. Through the analysis of various soil and water conserva-tion measures, runoff, sediment, and rainfall datas in the Sanchuan River Basin from 1960 to 2019, we use the lagrange multiplier method to determining the threshold year of soil and water con-servation measures on runoff and sediment processes. The preliminary conclusion is as follows: The trend of flood season rainfall and annual rainfall in the Sanchuan River Basin is consistent. The 10-year average rainfall in each periods indicates that before 2000, it gradually decreased and then significantly increased. The 10-year average runoff showed a gradual decrease before 2010, followed by a sudden increase, while the 10-year average sediment has shown a decreasing trend years by years, especially after the centralized treatment period. Terrace and dam measures show a trend of first decreasing, then increasing, and then approaching stability during different treat-ment periods, while the trend of forest and grass measures is slightly decreasing and then in-creasing rapidly. The runoff and sediment reduction effects of various soil and water conservation measures during different treatment periods indicate that the runoff reduction effect reached its peak in 2005, while the sediment reduction benefit reached its best in 2015. Based on the compre-hensive benefits of runoff and sediment regulation, 2015 are considered as the threshold year for various soil and water conservation measures, with each measure areas being 4.86 × 104, 17.91 × 104, 1.20 × 104, and 0.83 × 104hm2, respectively. The research results will have certain reference significance for the high-quality development of soil and water conservation in the Yellow River Basin.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

The task of weakly supervised point cloud semantic segmentation has received widespread attention and also has been widely used in autonomous driving, robotics, and modern industries. Due to the high dimensionality and large volume of point cloud data, many technical difficulties appeal to weakly supervised semantic processing, especially segmentation. However, weakly-supervised schemes usually provide only partial labelling information of the underlying point cloud data and thus need to effectively extract local features, geometric information, and contextual relationships only using these limited labelled data for supervised learning. To improve weakly-supervised semantic segmentation, we propose a novel segmentation network through the boundary-based feature aggregation based on a K-NN algorithm with down-sampling operation, and also introduce the smoothness loss and Siamese loss for effective segmentation. The experiments on public datasets demonstrate that our presented segmentation method exceeds most of the existing fully supervised and weakly-supervised methods in terms of mIoU. Specifically, our network has high segmentation accuracy on the labels of objects with similar geometrical structures, such as ceiling, wall, floor, chair and table, reaching 91.2%, 98.8%, 83.3%, 75.3% and 80.2%, respectively. Extensive experiments also illustrate its robustness, effectiveness, and generalization of the proposed weakly supervised segmentation network.

The majority of existing numerical simulations of the effect of bridge piers on water movement are based on a limited number of bridge piers at a laboratory scale. Furthermore, some 2D numerical simulations for actual bridge projects have deficiencies, including the use of overly large mesh sizes and an inadequate treatment of bridge piers. In this study, we compare three methods of structural mesh encryption, suspension mesh, and nonstructural mesh based on Delft3D, and apply the optimization scheme to a real bridge project. It is demonstrated that optimal results can be achieved by utilising a grid size comparable to the pier diameter (Dp) in the region away from the piers. In the vicinity of the piers, the grid cell size should be no larger than 1/9 Dp. The suspended grid technique (DD Boundary) can yield results consistent with those obtained using a full-area high-resolution grid, provided that the total number of grids can be reduced and the computational time is considerably reduced. In this study, the unstructured mesh (Deflt3D Flexible Mesh) scheme was unable to capture the oscillations of the wake flow behind the bridge piers. However, the application of the optimized scheme in bridge engineering has demonstrated its practical value. The findings of this study on mesh resolution and suspension mesh scheme can be applied to the Delft3D software and are also useful for other numerical simulation work.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&amp;LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&amp;LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

This paper addresses the input coupling problem for the shape memory alloy (SMA) actuated parallel platform with completely unknown nonlinear dynamics. The problem means that in a parallel platform with multiple SMA actuators acting together, the displacement of one of the actuators will simultaneously affect the remaining actuators to change. Due to the coupling problem and nonlinear characteristics of the SMA actuators, it is not easy to control the platform to achieve bi-directional swing with completely unknown nonlinear dynamics. Therefore, a model-free adaptive sliding mode control method is proposed to improve the control accuracy of the complex motion of the platform, avoiding the complex modeling process of the SMA actuated parallel platform. Based on the model-free adaptive control (MFAC) theory, a multiple input and multiple output (MIMO) dynamic linearized mathematical model of the parallel platform is established using the online input and output data of the system. Then, a sliding mode controller is designed based on the dynamic model. A rigorous theoretical analysis proves that the proposed model-free adaptive sliding mode controller is able to stably control the SMA actuated parallel platform, and its tracking error is uniformly ultimately bounded (UUB). Finally, experiments are conducted on the established SMA actuated parallel platform. The results show that the proposed model-free controller is feasible and effective, and can control the system well to achieve the complex motion of bi-directional swing.

In aerospace, robotics, network engineering and mechanical engineering, there exist complex and urgent challenges that can be abstracted into mathematical optimization problems. Therefore, exploring solutions to these optimization problems is a crucial task. Metaheuristic algorithms have been applied across various fields.The Snake Optimization Algorithm (SO) is an innovative metaheuristic method recognized for its efficient solving capabilities.However, this algorithm encounters challenges such as diminished search efficiency in the later stages and a propensity to become ensnared in local optima. To mitigate these issues, this paper introduces an enhanced Snake Optimization Algorithm (ISO). ISO integrates the RIME Algorithm(RIME)and introduces two effective enhancement strategies to improve its capability to evade local optima.To assess the effectiveness of ISO,the population distribution state was first measured using three algorithms, including Star Discrepancy, and the exploration and exploitation performance was analyzed using the CEC2017 test functions. Subsequently, utilized 23 benchmark functions for testing.The evaluation outcomes indicate that ISO exhibits outstanding performance in terms of convergence velocity and robustness.Additionally, it was applied to engineering fields including UAV path planning,Robot path planning, Wireless sensor network node deployment and Pressure vessel design.In comparison to the SO algorithm, the ISO algorithm demonstrates superior stability, converges earlier, and improves its ability to solve for optimal .These findings highlight the significant potential of the ISO algorithm in diverse test functions and a wide range of interdisciplinary problems.

Concrete is more stable than filler as a false roof in a downward approach type infill quarry, but the mechanical model of a concrete false roof is not clear. As a result, there has been limited application. Therefore, it is necessary to establish the mechanical model of a concrete artificial false roof to enhance the stability of the downward approach infill quarry. This paper combines theoretical analysis, model derivation, finite element analysis and field application methods. Firstly, the basic assumptions of thin plate theory and elasticity mechanics are used as the premise to establish the differential equations of the deflection curve of the concrete thin plate false roof. Then, the three types of bending moment generation of the concrete thin plate false roof are explored. Secondly, the relationship between the location of dangerous surface and dangerous point in hard-supported weak-slab structure and soft-supported weak-slab structure is analyzed, and the type of uniform load and calculation model of concrete thin-slab false roof are improved. Finally, according to the established mechanical model of thin slab false roof, finite element analysis and field application were carried out. The results show that there are three types of deflection curve differential equations in the concrete thin slab false roof perpendicular to the strike, and three extreme points exist in the middle section of the thin slab and on both sides of the surrounding rock. The hazardous surface of the hard-supported weak-slab structure is present at the intersection of the encircling rock and the thin-slab fake ceiling, with the perilous point situated on the top of this surface. The hazardous surface of the soft-supported weak-slab structure can be found in the centre section of the thin-slab fake ceiling, with the perilous point being located at the bottom of this surface. Moreover, the damage mode for both structures is that of maximum tensile stress damage. Upon conducting a finite element analysis, the results indicate that the concrete's maximum tensile stress is significantly high.

In this paper, we study the well-posedness and asymptotics of a one-dimensional thermoelastic laminated beam system either with or without structural damping, where the heat conduction is given by Fourier's law effective in the rotation angle displacements. We show that the system is well-posed by using Lumer-Philips theorem, and prove that the system is exponentially stable if and only if the wave speeds are equal, by using the perturbed energy method and Gearhart-Herbst-Prüss-Huang theorem. Furthermore, we show that the system with structural damping is polynomially stable provided that the wave speeds are not equal, by using the second-order energy method.

In this study, based on a new quantum integral identity, the authors establish some quantum estimates of Hermite-Hadamard type inequalities for convex functions. These results generalize and improve some known results given in literatures.

The teaching and learning environment have changed significantly over the last decade with the integration of an increasing amount of information and communication technologies, especially in distance education due to global pandemics, total lockdowns, isolation, and quarantine periods. The number of numerous virtual and non-virtual tools involved in educational processes is growing day by day. In terms of technological innovations used in learning environments, many researchers and educators are trying their best to bring more creative ideas into the technology- based learning environments. Although higher educational institutions have greatly benefited from the growing number of hardware and software resources in the educational process, they have also faced some setbacks that have harmed the learning processes. These technologies have in turn complicated some of the processes in the learning atmosphere. Therefore, we take Spanish teaching course as an example to present the challenging smarter teaching and learning systems that higher educational institutions face today.

Aiming at the problems of inaccurate segmentation of long object and information loss of small object in real-time semantic segmentation algorithm, this paper proposes a lightweight multi-branch real-time semantic segmentation network based on BiseNetV2. The new auxiliary branch makes full use of spatial details and context information to cover the long object in the field of view. Meanwhile, in order to ensure the inference speed of the model, the asymmetric convolution is used in each stage of the auxiliary branch to design a structure with low computational complexity. In the multi-branch fusion stage, the alignment and fusion module is designed to provide guidance information for deep and shallow feature mapping, so as to make up for the problem of feature misalignment in the fusion of information at different scales, and thus reduce the loss of small target information. In order to further improve the model’s awareness of key information, a global context module is designed to capture the most important features in the input data. The proposed network uses NVIDIA GeForce RTX 3080 Laptop GPU experiment, on the road street view data set Cityscapes and CamVid average occurring simultaneously ratio reached 77.1% and 78.4% respectively, with running speed of 127 frames/s respectively and 112 frames/s. The experimental results show that the proposed algorithm can achieve real-time segmentation and improve the accuracy significantly, showing good semantic segmentation performance

Currently, in some domestic and foreign mines, the backfill drilling pipeline experience a rupture phenomenon even when the wear degree is low. This results in a delay in production due to the filling becoming 'sick'. This paper presents, for the first time, the damage mechanism from a mechanical perspective and re-derives the anti-extrusion strength model of the backfill drilling pipeline. We investigate the influence of law on the anti-extrusion strength of pipelines from the perspective of stratum and cement ring. We then verify the theoretical and simulation results through engineering examples. The results demonstrate that the Mises stress criterion is a suitable modification principle for the anti-extrusion strength model of the backfill drilling pipeline. The anti-extrusion strength of the pipeline is related to the elastic modulus and Poisson's ratio of the stratum, and the thickness of the cement ring. It is negatively affected by the depth of the stratum. For hard strata, a cement ring with a smaller elastic modulus is suitable, while for soft stratum, a cement ring with a larger elastic modulus is recommended. When the missing angle of the cement ring is less than 60°, the stress concentration factor increases up to 2.2. The stress unloading capacity of the cement ring ranges from 32.7% to 37.8%, and optimal performance of the cement ring is achieved when it has high strength and low rigidity. The backfill filling pipeline of a copper mine abroad was destroyed due to external extrusion force exceeding its anti-extrusion strength value. The modified pipeline anti-extrusion strength model is 18.2% higher than the casing API strength value. This finding can inform the design of the backfill filling pipeline for China's kilometer-deep wells in the future.

Molten salt electrolysis stands as an indispensable technique for the production of rare earth metals, where the judicious distribution of the electric field within the electrolytic cell is paramount for ensuring the seamless operation of the electrolysis process. This study introduces a pioneering approach by integrating the Nernst-Planck equation with the Butler-Volmer equation, thereby devising a holographic electric field model tailored for the electrolysis of the NdF3-LiF molten salt system. The paper presents pioneering experimental measurements concerning the potential distribution and voltage drop characteristics within a 6kA rare earth electrolytic cell, elucidating the interplay between decomposition voltage and current density, which substantiates the model's precision. Our findings unveil that, under operational conditions of 4010 amperes, the 6kA electrolytic cell incurs a total voltage drop of 6.3 volts, delineating a melt voltage drop of 4.43 volts, an ohmic voltage drop of 0.248 volts, and an interfacial voltage drop of 1.622 volts at the electrode-electrolyte junction. The discrepancy in error is confined to within 0.3% of the actual measured voltage of 6.28 volts.The simulation outcomes from the holographic electric field model have been confirmed to precisely and comprehensively reflect the characteristics of the electric field distribution during the rare earth molten salt electrolysis process, offering valuable theoretical insights for practical manufacturing applications.

The geological and hydrological conditions of tunnels near reservoirs are complex, and the impact of water level changes on the stability and leakage assessment of the lining structure is not considered in the current leakage evaluation. In order to construct an evaluation model for leakage level of tunnels near reservoirs, the influence of water level changes on tunnel stability and changes in environmental conditions on the leakage of tunnels were researched. Based on the AHP and extensibility theory, a hierarchical system for leakage assessment, incorporating values from nine indexes representing three aspects: geological conditions, hydrological conditions, and tunnel engineering. Numerical simulation was used to analyze the influence of water level changes. It was found that the water level change index greatly influences the displacement and stress distribution inside the tunnel structure. The leakage evaluation model was applied to the Tiebeishan Tunnel, resulting in a rating of 3, indicating medium-level leakage. Attention should be paid to water leakage in tunnels with changes in reservoir water levels. The leakage evaluation model for tunnels near reservoirs can effectively assess leakage levels under various conditions, providing a reference for safety assessments of tunnel leakage near reservoirs.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

To analyze the impact of weather factors on the resilience of airport flight operations, particularly on flight operation, economic performance, and transportation capacity, Kolmogorov-Arnold Network (KAN) model was used to identify key weather features and establish the mapping relationship between weather factors and airport operational resilience. Taking Xi'an Xianyang International Airport as an example, the weights of each route were determined using the Grey Relational Analysis method considering average daily flight volume, flight distance, and airport flow stability indicators. Flight operation records and weather data were utilized to calculate the importance of key weather factors on the resilience of critical flight operation indicators. The results indicate significant differences in average daily flight volume, flight distance, and airport flow stability across different routes, with routes in economically developed areas having a greater impact on airport flow stability. Temperature and wind speed changes are the key factors affecting flight operation and economic indicators, with importance values of 0.35 and 0.32 respectively. Wind direction change and wind speed change have the greatest impact on flight transportation capacity, with importance values of 0.7 and 0.65 respectively. Therefore, when conducting flight scheduling and risk assessment, special attention should be paid to key weather factors such as temperature and wind speed, while also considering the weight of each route to ensure flight safety, efficiency, and economic benefits.

There are rich proper noun derivative semantic relationships in geographic entity vector data. The identification of traditional proper noun derivative semantic relationships usually requires toponym researchers to examine the source of derived toponyms by consulting a large number of toponym documents. This method cannot adapt to the mining of proper noun derivative semantic relationships for large-scale geographical entity. In this regard, this paper proposes a method of identifying the proper noun derivative semantic relationships for geographical entity by combining prompt learning and XGBoost model. This method transforms the extraction problem of proper noun derivative semantic relationships into a binary classification problem by analyzing the characteristics of the derivation relationship of toponyms in the form of toponyms and the spatial and temporal distribution of geography. Firstly, prompt learning and gaussian mixture model are used to extract and cluster the derivation words of toponyms, so as to realize the recognition of derived toponyms collections. Then, enumerate the possible proper noun derivations in the toponym set, and then the XGBoost model is used to identify the semantic relations derived from the proper noun of geographical entities. In the experiment, the recognition method of proper noun derivative semantic relationships based on prompt learning and XGBoost proposed in this paper has achieved good relationship recognition effect in the experiment. This method has certain practical value in the fields of toponym management and toponym translation.

In this paper, we consider a fourth-order suspension bridge equation with nonlinear damping term |u_t|^m-2u_t and source term |u|^p-2u. We give necessary and sufficient condition for global existence and energy decay results without considering the relation between m and p. Moreover, when p>m, we give sufficient condition for finite time blow-up of solutions. The lower bound of the blow-up time T_max is also established. It worth to mention that our obtained results extend the recent results of Wang (J. Math. Anal. Appl., 2014) to the nonlinear damping case.

It has been empirically observed that the upper tail of the firm size distribution follows either the Pareto distribution or the Zipf distribution, with both patterns being explained by Gibrat’s law (Gabaix, 1999). This article analyzed firm revenue data from China, spanning from 2005 to 2013, to examine the whole range of the firm size distribution. Our empirical analysis revealed that firm revenue data over these years is well fitted by a three-parameter generalized Pareto distribution, with the fitted parameters indicating a dichotomy: The size distribution of large-sized firms, namely the upper tail, is asymptotically characterized by a Pareto distribution or a Zipf distribution, whereas the size distribution of smaller and medium-sized firms is approximated by an exponential distribution. This finding suggests that Gibrat’s law should be extended to account for the emergence of a generalized Pareto distribution.

To realize the utilization of peanut shell, this study investigates the combustion behavior, chemical kinetics, and thermodynamic parameters of peanut shell using TGA under atmospheric air. Results indicate that increasing the heating rate leads to higher ignition, burnout, and peak temperatures, as observed in the TG/DTG curves shifting to the right. Analysis of combustion performance parameters suggest that higher heating rates can enhance combustion performances. Kinetic analysis using two model-free methods, KAS and FWO, shows that the activation energy (Eα) ranges from 93.30 to 109.65 kJ/mol for FWO and 89.72 to 103.88 kJ/mol for KAS. The data fit well with coefficient of determination values (R2) close to 1. Pre-exponential factors using FWO range from 2.19×106 to 8.06×107 s–1, and for KAS range from9.72×105 to 2.25×107 s–1. Thermodynamic analysis indicates a low-energy barrier (≤ ±6 kJ/mol) between activation energy and enthalpy changes, suggesting easy reaction initiation. Furthermore, variations in enthalpy (ΔH), Gibbs free energy (ΔG), and entropy (ΔS) upon conversion (α) suggest that peanut shell combustion is endothermic and non-spontaneous, with the generation of more homogeneous or well-ordered products as combustion progresses. These findings offer a theoretical basis and data support for the further utilization of agricultural biomass.

Agricultural activities are the second largest source of greenhouse gas emissions, and carbon emissions from agricultural land use (CEALU) have become a hot issue across the world. However, few scholars explored the impact of agricultural land policies on carbon emissions, such as the High-standard farmland construction(HSFC) in China.Thus，by relying on provincial panel data for China for the period 2005-2017, the effect of the high-standard basic farmland construction policy on carbon emissions from agricultural land use per unit area and its regional differences were quantitatively analyzed using the difference-in-difference (DID) model. The results showed that: 1) China's CEALU per unit area presented a fluctuating upward trend during the period 2005-2017, from 392.58 kg/ha to 457.72 kg/ha, with an average annual growth rate of 1.31%. 2) The high-standard farmland construction(HSFC) policy produced a significant carbon emission reduction effect in agricultural land use, and reduced the CEALU per unit area by 10.80% on average. With the promotion of this policy, its carbon emission reduction effect in agricultural land use presented an overall increasing trend. 3) The carbon emission reduction effect of the high-standard farmland construction policy in agricultural land use was significant in central China, but non-significant in eastern China and western China.

Polygonatum cyrtonema Hua. is an important medicinal and edible food in China and the traditional processing method of nine-steaming and nine-drying has been used to process its rhizome. However, the global dynamic changes in secondary metabolites during the processing and whether this method could enhance the accumulation of functional components remain unclear. This study aimed to explore the processing-induced mechanisms involved in the accumulation of secondary metabolites and provide theoretical support for the pharmacological study on P. cyrtonema. Results showed the first 6 processing cycles induced drastic changes in the accumulation of secondary metabolites, while the last 3 did not induce further changes. The accumulation of most secondary metabolites significantly increased after the first 3 cycles and stabilized after 6 cycles. The first 3 cycles led to numerous newly added metabolites while the last 6–9 cycles led to a small number of disappeared metabolites. Processing enhanced the biosynthesis of various secondary metabolites and significantly affected the metabolisms of amino acids. Together, a short period of processing was helpful for enhancing the biosynthesis of secondary metabolites. However, the enhancing effects will be reversed or weakened under continuous processing. The processing cycles should be reduced to 3–6 to maintain the enhancing effects.

To increase the calculation speed of the computational fluid dynamics (CFD) based simulation for the gas-solid flow in fluidized beds, a Markov chain model (MCM) is developed to simulate the particle movement in a two-dimensional (2D) circulating fluidized bed (CFB) riser. As a statistic model, the MCM takes the CFD-discrete element method (DEM) results as samples to calculate the transition probability matrix of particles, which can describe the macroscopic regularities of the particle movement and guide the numerical simulation of the particle motion based on the Monte Carlo method. The particle distribution snapshots, residence time distribution (RTD) and mixing obtained from both the CFD-DEM and the MCM are compared. Results show that the computational speed of the MCM is faster than that of the CFD-DEM by about 2 orders of magnitude, and the difference of the mean particle residence time calculated by the two models is less than 2%. Besides, the MCM can well describe the time-averaged particle mixing compared to the CFD-DEM.

Mulberry leaves, when infected by pathogens, can suffer significant yield loss or even death if early disease detection and timely spraying are not performed. To enhance the detection performance of mulberry leaf diseases in natural environments and to precisely locate early small lesions, we propose a high-precision, high-efficiency disease detection algorithm named YOLOv8-RFMD. Based on improvements to You Only Look Once version 8 (YOLOv8), we first proposed the Multi Dimension Feature Attention (MDFA) module, which integrates important features at the pixel-level, spatial and channel dimensions. Building on this, we designed the RFMD Module, which consists of the Conv-BatchNomalization-SiLU (CBS) module, Receptive-Field Coordinated Attention (RFCA) Conv, and MDFA, replacing the Bottleneck in the model’s Residual block. We then employed Adown down sampling structure to reduce the model size and computational complexity. Finally, to improve the detection precision of small lesion features, we replaced the complete intersection over union (CIOU) loss function with the Normalized Wasserstein Distance (NWD) loss function. Results show that the YOLOv8-RFMD model achieves an mAP50 of 94.3% and an mAP50:95 of 67.8% on experimental data, representing increases of 2.9% and 4.3% respectively compared to the original model. The model size is reduced by 0.53 MB to just 5.45 MB, and the number of floating-point operations is reduced by 0.3 G to only 7.8 G. The improved model meets the deployment requirements of mobile embedded devices and can provide a theoretical reference for the automated spraying operations of mulberry leaves.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

Taiwan’s auditors have suffered from processing excessive audit data, including drawing audit evidence. This study advances sampling techniques by integrating machine learning with sampling. This machine learning integration helps avoid sampling bias, keep randomness and variability, and target the risker samples. We first apply a Naive Bayes classifier to classify data into some classes. Next, a user-based, item-based, or hybrid approach is employed to draw audit evidence. The representativeness index is the primary metric for measuring the representativeness of audit evidence. The user-based approach denotes the selection of samples between two percentiles in a class as audit evidence. It may be equivalent to a combination of monetary and variable sampling methods. The item-based approach represents the choice of risky samples as audit evidence. It may be identical to a combination of non-statistical and monetary sampling methods. Auditors can hybridize those user-based and item-based approaches to balance representativeness and riskiness in selecting audit evidence. Three experiments show that sampling using machine learning integration has the benefits of drawing unbiased samples, handling complex patterns, correlations, and unstructured data, and improving efficiency in sampling big data. However, the limitations are the classification accuracy output by machine learning algorithms and the range of prior probabilities.

Lentiviral vectors (LVs) are a powerful tool for gene and cell therapy and human embryonic kidney cells (HEK293) have been extensively used as a platform for production of these vectors. Like most cells and cellular tissues, HEK293 cells release extracellular vesicles (EVs). EVs released by cells share similar size, biophysical characteristics and even a biogenesis pathway with cell-produced enveloped viruses, making it a challenge to efficiently separate EVs from LVs. Thus, EVs co-purify with LVs during downstream processing, becoming “impurities” in the context of cell therapy. To characterize EVs from an inducible lentivirus producing cell line, two conditions were studied: non-induced and induced. EVs’ identity was confirmed by transmission electron microscopy and western blot. Seven proteins were identified by mass spectrometry as potential EV markers. Lipid composition of EVs and LVs showed similar enrichment in phosphatidylserine. RNA cargos in EVs showed enrichment in genes involved in viral processes and binding functions. Flow virometry, GTA and ddPCR results also confirmed the heterogenic nature of EVs and LVs populations. These findings provide insights on the product profile of lentiviral preparation and could help develop separation strategies of co-produced EVs.

Promoting the sustainable development of resource-based cities is of great significance to the ecological protection and high-quality development of the Yellow River Basin. Combining the environmental status and economic development, we objectively evaluate the ecological safety level of resource-based cities in the Yellow River Basin, compare and analysis the main factors affecting the ecological safety of different resource-based cities, and formulate precise and differentiated ecological safety protection measures in river basins to achieve high-quality development. Taking the Yellow River Basin as an example, this paper analyses the ecological level of the Yellow River Basin based on the theory of sustainable development, calculates the ecological safety level of 30 resource-based cities in the Yellow River Basin from 2006 to 2020 by TOPSIS model, and makes convergence analysis by classification. Through the DID empirical test of sustainable development planning policy on ecological safety factors, distinguish the development characteristics of different resource-based cities. The results show that: (1) the ecological safety level of resource-based cities in the Yellow River Basin is generally developing well, and there are differences among different types of resource-based cities; (2) the kinetic energy of sustainable development of resource-based cities in the Yellow River Basin is mainly industrial transformation, and the power of science and technology is insufficient; (3) local governments pay limited attention to environmental protection, and the sustainable development planning of resource-based cities in 2013 mainly promotes the adjustment of industrial structure of resource-based cities.

This paper seeks to model the crack propagation in of AAs (aluminum-alloys) 2524-T3 and 7050-T7452 subjected to fatigue loading at low temperature. Fatigue crack growth tests were performed on AAs 2524-T3 and 7050-T7452 subjected to constant-amplitude and actual random-spectra loading histories at room temperature of about 25 °C and at cryogenic temperature of -70 °C, respectively, to determine their crack growth properties and residual lives. The interaction mechanisms between cryogenic temperature and the fatigue load were deduced on the basis of the results of fractographic analysis. Temperature-dependent residual lives under actual random-spectrum load history were modeled based on a modified accumulation damage rule by accounting for the load interaction. Good correlation was achieved between the predictions and actual experiments, demonstrating the practical and effective use of the proposed method.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The utilization of electroporation for delivering the CRISPR/Cas9 system components has enabled efficient gene editing in mammalian zygotes, facilitating the development of genome-edited animals. In our study，This research focused on targeting the ACTG1 and MSTN genes in sheep, revealing a threshold phenomenon in electroporation with a voltage tolerance in sheep in vitro fertilization (IVF) zygotes. Various poring voltages near 40V and pulse durations were examined for electroporating sheep zygotes. The study concluded that stronger electric fields required shorter pulse durations to achieve the optimal conditions for high gene mutation rates and reasonable blastocyst development. The investigation also assessed the quality of Cas9/sgRNA ribonucleoprotein complexes (Cas9 RNPs) and their influence on genome editing efficiency in sheep early embryos. It was highlighted that pre-complexation of Cas9 proteins with single-guide RNA (sgRNA) before electroporation was essential for achieving a high mutation rate. The use of suitable electroporation parameters for sheep IVF zygotes led to significantly high mutation rates and heterozygote ratios. By delivering Cas9 RNPs and single-stranded oligodeoxynucleotides (ssODNs) to zygotes through electroporation, targeting the MSTN (Myostatin) gene, a knock-in efficiency of 26% was achieved. The successful generation of MSTN-modified lambs was demonstrated by delivering Cas9 RNPs into IVF zygotes via electroporation.

In this paper, we study the semilinear pseudo-parabolic equations $\displaystyle u_{t} - \triangle_{\mathbb{B}}u - \triangle_{\mathbb{B}}u_{t} = \left|u\right|^{p-1}u$ on a manifold with conical singularity, where $\triangle _{\mathbb{B}}$ is Fuchsian type Laplace operator investigated with totally characteristic degeneracy on the boundary $x_{1} = 0$. Firstly, we discuss the invariant sets and the vacuum isolating behavior of solutions with the help of a family of potential wells. Then, we derive a threshold result of existence and nonexistence of global weak solution: for the low initial energy $J(u_{0})<d$, the solution is global in time with $I(u_{0}) >0$ or $\displaystyle\Vert \nabla_{\mathbb{B}}u_{0}\Vert_{L_{2}^{\frac{n}{2}}(\mathbb{B})} = 0$ and blows up in finite time with $I(u_{0}) < 0$; for the critical initial energy $J(u_{0}) = d$, the solution is global in time with $I(u_{0}) \geq0$ and blows up in finite time with $I(u_{0}) < 0$. The decay estimate of the energy functional for the global solution and the estimates of the lifespan of local solution are also given.

The emerging working mode of coordinated trucks and drones has demonstrated significant practical potential in various fields, including logistics and delivery, intelligence surveillance reconnaissance, area monitoring, and patrol. The seamless collaboration between trucks and drones is garnering widespread attention in academia and has emerged as a key technology for achieving efficient and secure transportation. This paper provides a comprehensive and in-depth review of the research status on the routing problem for coordinated trucks and drones, covering aspects such as application background, cooperative modes, configurations, issues have been taken into consideration, and solution methodologies.

Fungi inhabiting deep subseafloor sediments have been shown to possess anaerobic methane (CH₄) production capabilities under atmospheric conditions. However, their ability to produce CH₄ under in situ conditions with high hydrostatic pressure (HHP) remains unclear. Here, Schizophyllum commune 20R-7-F01, isolated from ~ 2 km below the seafloor, was cultured in Seawater Medium (SM) in culture bottles fitted with sterile syringes for pressure equilibration. Subsequently, these culture bottles were transferred into 1-liter stainless steel pressure vessels at 30 °C for 5 days to simulate in situ HHP and anaerobic environments. Our comprehensive analysis of bioactivity, biomass, transcriptomics revealed that S. commune not only survived but significantly enhanced CH₄ production, reaching approximately 2.5 times higher levels under 35 MPa HHP compared to 0.1 MPa standard atmospheric pressure. Pathways associated with carbohydrate metabolism, methylation, hydrolase activity, cysteine and methionine metabolism, and oxidoreductase activity were notably activated under HHP. Specifically, key genes involved in fungal anaerobic CH₄ synthesis, including methyltransferase mct1 and dehalogenase dh3, were upregulated 7.9- and 12.5-fold, respectively, under HHP. Enhanced CH₄ production under HHP was primarily attributed to oxidative stress induced by pressure, supported by intracellular Reactive Oxygen Species (ROS) levels and comparative treatments with cadmium chloride and hydrogen peroxide. These findings suggest that fungi persisting in deep-sea sediments over millions of years have the potential to significantly contribute to global CH₄ flux.

Due to the significant price difference, expensive oils like olive oil are often blended with cheaper edible oils. This practice of adulteration in edible oils, aimed at increasing profits for producers, poses a major concern for consumers. Furthermore, adulteration in edible oils can lead to various health issues impacting consumer well-being. In order to meet the requirements of fast, non-destructive, universal, accurate and reliable quality testing for edible oil, the oblique-incidence reflectivity difference (OIRD) method combined with machine learning algorithms was introduced to detect a variety of edible oils. The prediction accuracy of Gradient Boosting, K-Nearest Neighbor, and Random Forest models exceeded 95%. Experimental results indicate that the OIRD method can serve as a powerful tool for detecting edible oils.

Forest fires can occur suddenly and have significant environmental, economic, and social consequences. Timely and accurate evaluation and prediction of their progression, particularly the spread speed in difficult-to-access areas, are essential for emergency management departments to proactively implement prevention strategies and scientifically extinguish fires. This paper provides a comprehensive analysis of advanced technologies for predicting forest fire spread in China and globally. Incorporating remote sensing (RS) technology and forest fire science as the theoretical foundation, and utilizing the Wang Zhengfei forest fire spread model as the technical framework, this study constructs a forest fire spread model based on remote sensing interpretation. The model optimizes the method for acquiring parameters and enhances algorithm accuracy. By considering regional landforms (ridge lines, valley lines, slopes) and vegetation coverage, this paper establishes visual interpretation markers for identifying hotspots within the spread model. Utilizing statistical data from pixels within the fire line zone transforms the methodology for predicting forest fire spread speed, resulting in greater accuracy compared to conventional fixed-point predictions. Finally, the model was applied to the case of a forest fire in Mianning County, Sichuan Province, China and verified using high-time resolution mid-infrared image data and previous research findings. The results demonstrate that the predicted fire spread area from this RS-enabled model is consistent with both high-time resolution geostationary satellite data and previous research outcomes, indicating high reliability. This model can provide crucial fire spread information to relevant emergency departments, enabling effective preemptive measures and scientific firefighting strategies.

Let G[F,Vk, Huv] be the graph with k pockets, where F is a simple graph of order n ≥ 1,Vk= {v1,v2,··· ,vk} is a subset of the vertex set of F and Hvis a simple graph of order m ≥ 2,v is a specified vertex of Hv. Also let G[F,Ek, Huv] be the graph with k edge pockets, where F is a simple graph of order n ≥ 2, Ek= {e1,e2,···ek} is a subset of the edge set of F and Huvis a simple graph of order m ≥ 3, uv is a specified edge of Huvsuch that Huv− u is isomorphic to Huv− v. In this paper, we derive closed-form formulas for resistance distance and Kirchhoff index of G[F,Vk, Hv] and G[F,Ek, Huv] in terms of the resistance distance and Kirchhoff index F, Hv and F, Huv, respectively.

Aspergillus montevidensis is an important domesticated fungus that has been applied to produce many traditional fermented foods under high osmotic conditions. However, the detailed mechanisms of tolerance to osmotic stress remain largely unknown. Here, we construct a target-deleted strain (ΔLeuRS) of A. montevidensis and found that the ΔLeuRS mutants grew slowly and suppressed the development of the cleistothecium compared to the wide-type strains (WT) under salt-stressed conditions. Furthermore, differentially expressed genes (P<0.0001) governed by LeuRS were involved in salt tolerance, ABC transporter, amino acid metabolism, sugar metabolism, and reproduction process. The ΔLeuRS strains compared to WT strains under short- and long-term salinity stress especially altered accumulation levels of metabolites, such as amino acids and derivatives, carbohydrates, organic acids, and fatty acids. The study provides new insights into the underlying mechanisms of salinity tolerance and lays a foundation for favor improvement of foods fermented with A. montevidensis.

Coarse-grained molecular dynamics simulations are employed to investigate the spatiotemporal evolution of vesicles (polymersomes) by the self-assembly of randomly distributed amphiphilic BAB triblock copolymers with hydrophilic A and hydrophobic B blocks in an aqueous solution. The vesiculation pathway consists of several intermediate structures, such as an interconnected network of copolymer aggregates, a cage of cylindrical micelles and a lamellar cage. The cage-to-vesicle transition occurs at a constant aggregation number and practically eliminates the hydrophobic interfacial area between the B block and solvent. Molecular reorganization under-lying the sequence of morphology transitions from a cage-like aggregate to a vesicle is nearly isentropic. The end-to-end distances of isolated copolymer chains in solution and those within a vesicular assembly follow log normal probability distributions. This is attributed to the pre-ponderance of folded chain configurations in which the two hydrophobic end groups of a given chain stay close to each other. However, the probability distribution of end-to-end distances is broader for chains within the vesicle as compared to that of a single chain. This is due to the swelling of the folded configurations within the hydrophobic bilayer. Increasing the hydropho-bicity of the B block reduces the vesiculation time without qualitatively altering the self-assembly pathway.

In this paper, we study the global existence and exponential decay for a dynamic contact problem between a Timoshenko beam with second sound and two rigid obstacles, of which the heat flux is given by Cattaneo's law instead of the usual Fourier's law. The main difficulties arise from the irregular boundary terms, from the low regularity of the weak solution and from the weaker dissipative effects of heat conduction induced by Cattaneo's law. By considering related penalized problems, proving some a priori estimates and passing to the limit, we prove the global existence of the solutions. By considering the approximate framework, constructing some new functionals and applying the perturbed energy method, we obtain the exponential decay result for the approximate solution, and then prove the exponential decay rate to the original problem by utilizing the weak lower semicontinuity arguments.

The purpose of this paper is to assess the differential impacts of transformational and transactional leadership styles on employee performance during change initiatives within commercial banks in Sierra Leone. The research study utilised a cross-sectional survey design, and data was collected from 903 participants employed in the banking industry. The study used the structural equation model as the investigative instrument to examine the hypotheses. The findings reveal that transformational and transactional leadership styles demonstrate a strong bearing on employee performance, with the latter having a bigger influence. Organisational citizenship behaviour has a mediating effect between leadership styles and employee performance, while employee commitment does not act as a mediator between transformational leadership and employee performance, but it acts as a mediator between transactional leadership and employee performance. Commercial banks need to devise training programmes that will advance both leadership styles to arouse, energise, or inspire followers to display favourable behaviour and commitment to attain organisational. The paper makes an insightful contribution to the existing leadership literature by ascertaining the significance of leadership styles on performance and the role of commitment and organisational citizenship behaviour as mediators of the nexus between leadership styles and performance in the Sierra Leone banking industry.

Since the 21st century, China's urbanization process has been rapid development, the concept and function of urban public space in the city has been gradually paid attention to. In order to guarantee life and water, most urban construction relies on rivers, and Bridges are the most important way to communicate between urban areas. The main functional part of the bridge is the span structure, that is, the bearing structure of the bridge, and the lower part of the "gray" space formed by the bridge structure. Considering the social level, with the economic growth and urbanization development, people have brought a better living environment and quality of life, and also improved the requirements for urban public environment. In the increasingly tense urban space, how to use and transform the space under the bridge is a problem that needs to be considered and solved. In view of this problem, in this study, we try to solve the micro-transformation of space under Bridges in cities through public art from the perspective of "regional culture" and "art for all". This paper analyzes the micro-transformation of space art under Bridges in two large cities of Shanghai and Foshan, namely, the space under Bridges under Songhong Road in Shanghai, the space under Bridges under Central Of Suzhou River and the space under Bridges under Pingsheng Bridge in Foshan. This paper discusses the cultural intervention of "regional culture" in the micro-transformation of the space under the bridge, and the influence and effect of "art for all" on the public art space under the bridge after the transformation to the community and the public.

The intestinal microbiota, comprised of bacteria, archaea, and phages, inhabits the gastrointestinal tract of the organism. Male reproductive sterility is currently a prominent topic in medical research. Increasing research suggests that gut microbiota dysbiosis can result in various reproductive health problems. This article specifically investigates the impact of gut microbiota dysbiosis on male reproductive infertility development. Gut microbiota imbalances can disrupt the immune system and immune cell metabolism, affecting testicular growth and sperm production. This dysfunction can compromise the levels of hormones produced and secreted by the endocrine glands, affecting male reproductive health. Furthermore, imbalance of the gut microbiota can disrupt the gut-brain-reproductive axis, resulting in male reproductive infertility. This article will explore how the imbalance of the gut microbiota impacts male reproductive infertility through immune regulation, endocrine regulation, and interactions of the gut-brain-reproductive axis, concluding with recommendations for prevention and treatment.

This study investigates the impact of specimen size on the mechanical properties of wood, specifically focusing on compression strength, elastic modulus, and Poisson's ratio. Compression tests were conducted using three different specimen sizes (20mm×20mm×30mm, 40mm×40mm×60mm, 60mm×90mm×90mm) in the longitudinal, radial, and tangential directions. Mechanical parameters, failure mechanisms, load-displacement curves, and stress-strain relationships were systematically analyzed for each size. The study also evaluated the influence of specimen size on the accuracy of finite element numerical simulations by utilizing the obtained mechanical parameters. The results reveal a significant correlation between compressive strength and specimen size, indicating a decrease in compressive strength with increasing specimen size. Conversely, elastic modulus and Poisson's ratio exhibit less sensitivity to variations in specimen size. Notably, parameters derived from small-sized specimens (20mm×20mm×30mm) exhibited substantial errors, while those obtained from medium-sized (40mm×40mm×60mm) and large-sized specimens (60mm×90mm×90mm) demonstrated greater reliability, providing precise results in finite element numerical simulations.

This paper mainly explores the feasibility of using desert sand (DS) and recycled aggregate in cement stabilized base. Recycled coarse aggregate (RCA) and DS serve as the substitutes of natural coarse and fine aggregates, respectively, in cement stabilized base. A four-factor and four-level orthogonal test is designed to analyze the unconfined compressive strength, splitting tensile strength, and compressive resilient modulus. Furthermore, this paper investigates the effects of cement content, fly ash (FA) replacement rate, RCA replacement rate, and DS replacement rate on the road performance of cement stabilized base composing of RCA and DS. The test results reveal that the performance of cement stabilized base with partial RCA instead of natural coarse aggregate (NCA) and partial DS instead of natural fine aggregate satisfy the road use. Meanwhile, DS is beneficial to improve the strength of cement stabilized base. The correlation and microscopic analyses of the test results imply the feasibility of applying DS and recycled aggregate to cement stabilized base. It is hoped that this paper can offer a solid theoretical foundation for promoting the application of DS and recycled aggregate in road engineering.

Domain generalization has led to remarkable achievements in Hyperspectral Image (HSI) classification. Inspired by contrastive language-image pre-training (CLIP), the language-aware domain generalization method has been explored to learn cross-domain-invariant representation. However, existing methods face some challenges: 1) The weak capacity to extract long-range contextual information and inter-class correlation. 2) Due to the inadequacies of the large-scale pre-training for HSI data, the spatial-spectral features of HSI and linguistic features can not be straightforwardly alignment. To address the above problems, a novel network has been proposed with a CLIP framework, which consists of an image encoder, based on an encoder-only transformer to obtain the global contextual information and inter-class correlation, a frozen text encoder, and a cross-attention mechanism, named Linguistic-Interact-with-Visual Engager (LIVE), enhances the interaction between two modalities. Extensive experiments demonstrating superior performance over state-of-the-art methods in HSI Domain Generalization with a CLIP framework.

Under the new pattern of "Double-Cycle" economy, how to restructure the domestic economic structure to cope with the continuous softening of the global economic structure is an urgent issue. This paper empirically examines the impact of digitalization level on the division of labor in National Value Chain (NVC) within cities using panel data from 263 cities between 2001 and 2016, employing a spatial Durbin model.The study demonstrates that the digitization level can enhance division of labor in NVC in neighboring regions through spatial spillovers. An increase in digitization not only positively deepens the construction of NVC but also contributes to the development of NVC in adjacent areas.The digitization level can deepen the division of labor in NVC through the impact of cost reduction, consumption upgrading, and market integration. This effect exhibits regional variations, with consumption upgrading playing a crucial role in expanding the division of labor in NVC in the eastern region through improving digitization levels, while cost reduction is a key factor in the central region. The research results of this paper provide some empirical evidence for further progress and transition of China's NVC developing mode from the perspective of digital level.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

Histone demethylases, enzymes responsible for removing methyl groups from histone proteins, have emerged as critical players in regulating gene expression and chromatin dynamics, thereby influencing various cellular processes. LSD2 and LSD1 have attracted considerable interest among these demethylases because of their associations with cancer. However, while LSD1 has received significant attention, LSD2 has not been recognized to the same extent. In this study, we conduct a comprehensive comparison between LSD2 and LSD1, with a focus on exploring LSD2's implications. While both share structural similarities, LSD2 possesses unique features. Functionally, LSD2 shows diverse roles, particularly in cancer, with tissue-dependent roles. Additionally, LSD2 extends beyond histone demethylation, impacting DNA methylation and DNA damage repair pathways. This study underscores the distinct roles of LSD2, providing insights into their contributions to cancer and other cellular processes.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

A non-Newtonian fluid model is used to investigate the two-dimensional pulsatile blood flow through a tapered artery with a stenosis. The mixed convection effects of heat and mass transfer are also taken into account. By applying non-dimensionalization and radial coordinate transformation, we simplify the system in a tube. Under the finite difference scheme, numerical solutions are calculated for velocity, temperature concentration, resistance, impedance, wall shear stress and shearing stress at the stenosis throat. Finally, Quantitative analysis is carried out.