Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

Polygonatum cyrtonema Hua. is an important medicinal and edible food in China and the traditional processing method of nine-steaming and nine-drying has been used to process its rhizome. However, the global dynamic changes in secondary metabolites during the processing and whether this method could enhance the accumulation of functional components remain unclear. This study aimed to explore the processing-induced mechanisms involved in the accumulation of secondary metabolites and provide theoretical support for the pharmacological study on P. cyrtonema. Results showed the first 6 processing cycles induced drastic changes in the accumulation of secondary metabolites, while the last 3 did not induce further changes. The accumulation of most secondary metabolites significantly increased after the first 3 cycles and stabilized after 6 cycles. The first 3 cycles led to numerous newly added metabolites while the last 6–9 cycles led to a small number of disappeared metabolites. Processing enhanced the biosynthesis of various secondary metabolites and significantly affected the metabolisms of amino acids. Together, a short period of processing was helpful for enhancing the biosynthesis of secondary metabolites. However, the enhancing effects will be reversed or weakened under continuous processing. The processing cycles should be reduced to 3–6 to maintain the enhancing effects.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

Extracorporeal membrane oxygenation (ECMO) is increasingly used in intensive care units; however, ECMO can modify drug pharmacokinetics (PK), leading to underexposure and associated treatment failure. The aim of the present study was to determine the effect of ECMO on the PK of dexmedetomidine (DEX). In vivo rat models were developed, both of which involved a bolus injection of DEX and concentration monitoring. In the in vivo model experiment, rats which underwent ECMO were compared with a control group. PK analysis of in vivo data (noncompartmental analysis and nonlinear mixed-effects modelling) was carried out to determine the effect of ECMO. In vivo PK exploration showed that ECMO induced a decrease in DEX clearance. Because the effect of ECMO on the PK of DEX is not clinically significant, normal DEX dosing for critically ill patients should be effective for patients undergoing ECMO.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

Utilization of wasted heat instead of fuel combustion is effective to reduce primary energy consumption for mitigating global warming problem. Because wasted heat sources are not necessarily located close to areas of heat demand, one of the difficulties is that wasted heat has to be transferred from heat source side to heat demand side, which may require heat transportation over long distance. From this point we proposed and have examined new idea of heat transportation using ammonia-water as the working fluid which system is named Solution Transportation Absorption chiller, in short STA. Our previous studies of STA were mainly the experimental investigation with STA facility which cooling power was 25RT (90kW). As a result, the COP of STA was found almost same value 0.65 with the conventional absorption chiller without depending on the transportation distances. The simulation using AspenHYSYS also examined with same experimental condition. The experimental data showed good agreement with the simulation calculation. In this study, we examined the large-scale cooling power STA on simulation. The examination cooling powers were from 90 kW(25RT) to 3517 kW(1000RT). All cooling power achieved around COP 0.64 including pump power consumptions. In addition, we performed the dynamic simulation. As the results, there was no effect of pipeline size on the cooling capacities and mass flow rates. Furthermore, the stability time of the cooling capacities and mass flow rates were almost same regardless of the pipeline size and cooling capacity. In other words, STA may be achieved the same COP even though having various complex conditions compared with the conventional absorption chiller.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

The early 2-factor (E2F) family of transcription factors, including E2F1-8, plays a critical role in apoptosis, metabolism, proliferation, and angiogenesis within glioblastoma (GBM). However, the specific functions of E2F transcription factors (E2Fs) and their impact on the malignancy of Bevacizumab (BVZ)-responsive GBM subtypes remain unclear. This study used data from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) to explore the impact of eight E2F family members on the clinical characteristics of BVZ-responsive GBM subtypes and possible mechanisms of recurrence after BVZ treatment.To predict the possibility of GBM patient survival and progression, we classified and comparedthe expression of E2Fs according to BVZ-responsive subtypes and employed a machine learning method-TreeBagger, one random forest algorithm. Multiple bioinformatics analyses have shown that the significant increased E2F8 post BVZ treatment may enhance the function of angiogenesis and stem cell proliferation, indicating one of the mechanisms of GBM recurrence after treatment. In addition, BVZ treatment in unresponsive GBM patients may potentially worsen disease progression. Our findings suggest that E2F family members play important roles in GBM malignancy and BVZ treatment response, highlighting their potential as prognostic biomarkers and therapeutic targets and recommending precise BVZ treatment for GBM patients.

In terahertz communication systems, lens antennas used in transceivers are basically plano-convex dielectric lenses. As the aperture increases and the focal length decreases, the thickness and mass of the plano-convex lens increase rapidly. Through theory and simulation, we designed a Fresnel lens suitable for the terahertz band to meet the requirements of large aperture and short focal length, and simulated the performance, advantages and disadvantages of the terahertz Fresnel lens. A 300GHz terahertz wireless communication system was built to verify the gain effect of the Fresnel lens antenna. The experimental results show that the Fresnel lens can amplify the signal in the terahertz band. The theoretical gain of a 30 cm Fresnel lens is 48.83dB, while the actual measured gain is approximately 45dB.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

Comprehensively understanding the spatial ecology and habitat preferences of endangered species is essential for population restoration and conservation. We investigated the home range and movement of the endangered Amur soft-shell turtle (Pelodiscus maackii) in the Ussuri River, Heilongjiang Province, Northeastern China. The study involved tracking 19 Amur soft-shell turtles from late June to mid-October, 2022, resulting in complete and partial home range size data for eight subadults and two adults, respectively. The primary analysis focused on eight subadults, and the models that best described daily movement were identified. We also explored the potential factors influencing home range size. Mean movement rate ranged from 39.18 ± 20.04 m to 72.45 ± 29.36 m and was positively correlated with the linear home range and water temperature. The most insightful home range estimate was a 95% kernel density estimate, employing likelihood cross-validation smoothing with constraints set to the river boundaries. The mean home range size was 1.02 ha and was not correlated with body size. Subadults tended to establish well-defined home ranges over time; whereas, defining home ranges for adults proved challenging. This research addresses a gap regarding the ecology of the Amur soft-shell turtle and provides a foundation for future conservation plans.

Urbanization-induced land use transition results in a decline in ecosystem services, which has implications for regional ecological security. In order to explore the relationship between ecosystem services and land use transition, this paper utilizes the InVEST model, geographically weighted regression model to examine the impact of land use transition on ecosystem services in the Dongting Lake area (DLA). The results showed that (1) During the period 2000-2020, the intensity and motivation of land-use transition showed obvious spatial and temporal heterogeneity with the variation of urbanization development. (2) Habitat quality and Carbon sequestrations showed a downward trend. In contrast, food supply followed an upward trend; soil conservation and water yield services initially increased and dropped later. The overall spatial changes in habitat quality and Carbon sequestration appear to be insignificant. Food supply shows significant differences in the plains compared to other areas; while soil conservation and water yield service shows significant changes in places other than the DLA. (3) From 2000 to 2020, land use transition dynamics, population density, GDP density, night lighting and transition intensity had mainly negative effects on ecosystem services. Only the Normalized Vegetation Index (NDVI) showed a positive effect on ecosystem services. The results of the research will provide valuable references for the development and implementation of spatial ecological restoration planning and land use policies in the national territory.

The 2020 Tokyo Olympics has been postponed due to the novel coronavirus (COVID-19) pandemic. The implications for industries related to the Olympics—tourism, hotels and restaurants, and others—are expected to be affected by reduced demand. Japanese workers in these industries were prepared to offer their hospitality to visitors from around the world. They would be satisfied from not only an increase in income but also in offering visitors a taste of Tokyo’s great hospitality if the Olympics had been held in 2020. However, postponement of the sporting event is likely to have a significant impact on their happiness level. We independently collected individual-level panel data from March to April 2020. Based on this, we found that the happiness level of workers in the tourism and restaurant sectors declined drastically after the announcement of the postponement. Only two weeks later, their happiness level did not alter from the pre-announcement level. This tendency was strongly observed in Tokyo and the surrounding prefectures, but not in other prefectures. However, workers engaged in the tourism and restaurant sectors did not predict a decrease in their income even after the postponement. Combined, these findings indicate that loss of extending hospitality, rather than reduction in income, temporarily reduces the happiness level of workers.

With the rise of serious problems of urbanization and climate change, the call for intelligent and sustainable urban development is increasing nowadays. Therefore, smart cities have become a hot topic in academia, industry, and politics, resulting in the emergency of numerous smart city programs and projects. This study selected 26 evaluation frameworks proposed in recent years or large-scale research projects that have lasted for many years and analyzed and compared them from the 7 aspects of generalizability, comprehensiveness, availability, flexibility, scientific, transparency, and interpretability. The result indicates that the current smart city evaluation framework still needs to be upgraded and updated. These standards can not only guide the development direction and hotspot of the future smart city evaluation model but also serve as a guide for model demanders to test results and an effective tool to verify the framework designed by themselves.

This study examines the differential impact of proactive and reactive job crafting behaviors on job well-being, drawing from the perspective of boundary theory. The increasing popularity of work connectivity behavior after-hours (WCBA) after work has attracted widespread attention from scholars on the relationship between WCBA and employee well-being. One view suggests that the impact of WCBA is negative, while another view suggests it is positive. Obviously, the impact of (WCBA) on well-being at work is still contradictory. To clarify the complexity of the impact of WCBA on well-being at work, based on boundary theory, we divided WCBA into proactive WCBA (PC) and reactive WCBA (RC), and examined the double-edged sword effect of WCBA on well-being at work, as well as the mediating mechanisms of job control and work-to-home conflict, and the moderated effects of boundary segmentation preferences. This study uses empirical sampling method to collect data from 125 employees for a period of five days for quantitative research. The results show that, first, PC has an inverted U-shaped effect on job control, and job control is negatively related to well-being at work. Thus the mediating effect of job control is significant. Second, RC has a negative impact on job control, and there is also a negative relationship between job control and well-being at work. Therefore, the mediating effect of job control is significant. Third, PC and RC are positively correlated with work-to-home conflict, and work-to-home conflict has a significant positive impact on well-being at work. Therefore, the mediating effect of work-family conflict is significant. Fourth, the study also found that integration preference moderates the relationship between work-to-home conflict and PC on well-being at work, that is, the mediating effect of work-to-home conflict is stronger for employees with low integration preference. This study enriches our understanding of WCBA, PC and RC from the perspective of proactive and passive employee behaviors. The study also provides a new interpretation of the impact of WCBA on well-being at work and offers valuable insights for the sustainable development in digital social transformation and the application of boundary theory and the theory of empowerment-subjugation in achieving the United Nations Sustainable Development Goals. In addition, the study deepens our understanding of the heterogeneous regulatory role played by work-family integration preferences in influencing well-being at work under different types of WCBA.

The escalation of mining activities in the karst regions of Guizhou Province has heightened the occurrence of water-inrush incidents in deep coal mines. This study focused on water-inrush phenomena within the Xinhua mining area of Jinsha County, Guizhou Province, aiming to investigate the sources of these incidents. The findings indicated that the overlying limestone of the Changxing Formation in the coal seam served as a vulnerable aquifer under certain conditions, leading to water inrushes. The analysis of the spatiotemporal distribution patterns of water-inrush incidents at the working face indicated that previous mining operations damaged the shallow Changxing Formation limestone, resulting in the accumulation of goaf water and the formation of numerous mining-induced fractures. These fractures served as rapid conduits for water inrushes from both atmospheric precipitation and underground sources at the deep working face. The examination of surface water and mine water quality demonstrated that both exhibited similar characteristics, predominantly featuring bicarbonate, sulfate, and sodium compositions. Investigation into the relationship between mine water inflow and atmospheric precipitation established that atmospheric precipitation influenced the mine water supply cycle, with a replenishment period of ~10 months during the operational phase of the Jinyuan Coal Mine and about one month post-closure. The fractures induced by mining activities within the Changxing Formation limestone facilitated water flow, with atmospheric precipitation serving as the primary water source for the mine. This study offered a valuable scientific foundation for addressing water-related damage resulting from atmospheric precipitation in mines susceptible to water inrushes under analogous hydrogeological conditions.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

Three cases of Day-Night Band (DNB) observations of the Visible Infrared Imaging Radiometer Suite (VIIRS) onboard the Suomi National Polar-orbiting Partnership (SNPP) are explored for applications to assess the ocean environment and monitor ocean dynamics. An approach to use the DNB radiance ratio was developed in order to better continuously assess the ocean diurnal and short-term environmental changes with VIIRS DNB observations. In the La Plata River Estuary, the sediment fronts showed 20–25 km diurnal inshore-offshore movements on March 13, 2017. In the waters off the Argentina coast in the South Atlantic, VIIRS DNB measurements provided continuous observations and monitoring of the algae bloom development and migration between 24–26 March 2016. This algae bloom generally kept the same spatial patterns, but moved nearly 20 km eastward in the three-day period. In the Yangtze River Estuary and Hangzhou Bay region in China’s east coast, VIIRS DNB observations also revealed the complicated coastal dynamic changes between 12–14 April 2017. Even though there are still some challenges and limitations for monitoring the ocean environment with VIIRS DNB observations, this study shows that satellite DNB observations can provide additional data sources for ocean observations, especially observations during the nighttime.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

Theoretical physics addresses the fundamental principles of nature and the mysteries of the universe. In the last century, the theory of relativity challenged people's understanding of time and space, while quantum mechanics revealed various forms of energy. However, the concept of gravity remains elusive. All matter in the universe is composed of energy that can be converted into other forms, yet it is always conserved. However, achieving a state of equilibrium, represented by the equal sign, can be challenging to achieve on both macro and quantum scales. A phenomenon that can transition from one state to infinity is called collision and is essential for understanding natural phenomena and physical processes throughout the universe. In the study of general relativity cannot be three-dimensional problems to gain mathematical inspiration, understand the application of new dimensions. Here, we elucidate the nature of gravity, which inspires the solution of the Riemann hypothesis. Our results show that the conduction mode of dimensional energy is defined by Euler's formula. And a special mode of collision is derived which translates into vibration.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

ESG (Environmental, Social, and Governance) responsibility fulfillment increasingly affects enterprise valuation. Although researchers debate about the precise effects, the prevailing view suggests a linear relationship between ESG performance and enterprise value. This study introduces a novel ESG responsibility performance metric through the Regulated Intermediary Model to delve into this relationship within the Chinese context. Our findings reveal an inverted U-shaped relationship between ESG performance and enterprise value, with financing constraints having a significant moderating effect. These findings remain robust after employing instrumental variables to mitigate potential endogeneity. Heterogeneity analysis demonstrates that this inverted U-shaped relationship is particularly pronounced in non-polluting and non-state-owned enterprises. Moreover, a comparison between equity and debt financing mechanisms underscores that improved ESG performance is associated with lower cost of equity financing, thereby enhancing enterprise value. Financial institutions are encouraged to leverage innovative financial instruments to diversify enterprise financing channels and alleviate financing constraints of enterprises that fulfill their ESG responsibilities.

With worsening environmental degradation and increasing international demand for human health, plant cell based technology will be more important. The aim of this review is to give an overview regarding key points of current progress and development trend of nature medical and edible plants from the framework of whole plant cell engineering including cell cultures, cell fusion and cell splitting derived biotechnology. Here we sum up three main application trends of medical plants cell cultures covering industrial output, technology upgrading and potential resource development. We also provide classification and typification insights to summarize the development of somatic hybridization in cereal, vegetables crops and other medicinal and edible plants as well as application of artificial polyploidy induction in major medicinal herbs. Development medicinal and edible homologous plants based on modern plant cell engineering will bring us a promising future.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Tack is one of the most important factors affecting the operability of prepregs, but it is still very difficult to obtain the change of prepreg tack with time at different temperatures. In this paper, a newly designed T-peel device is used to test the tack decay rate of prepregs at different temperatures. The obtained decay rate deviates less than 8.9% from the manufacturer's data. The maximum deviation of the ratio of tack decay speeds calculated by the Arrhenius equation from the experiments is not higher than -9.7%. It is proved that the present method can obtain the decay rate of tack of prepregs at different temperatures. This method is also applicable to the other two types of prepregs. The article proposes the handling life unit, an operational life measurement unit for prepregs, and establishes that the relationship between tack and remaining shelf life reduces prepreg management costs.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

The properties of the annual, semiannual and triennial oscillations (AO, SAO and TO) in the middle atmosphere have been investigated using the TIMED/SABER temperature data. The Lomb-Scargle and wavelet spectra were used to determine the dominant oscillations in the background temperature field. The AO is prominent at the mid-latitudes. The AO amplitudes present an asymmetry between the two Hemispheres, being larger in the mesosphere than in the stratosphere. The SAO dominates the tropical regions, with three amplitude maxima at altitudes of 45, 75, and 85 km. The SAOs in the upper mesosphere (75 km) are out of phase with those in the mesopause (85 km) in the tropical regions, which can generate an enhancement of 11 K at each equinox, contributing to the lower mesospheric inversion layer. The TO is significant in the tropical region, with amplitude being maximum at 35, 45 and 85 km. Result shows that there may be potential interaction by the TO with SAO at 85km at the equator. The relation between ENSO and TO has also been discussed. The ENSO signal may modulate the amplitude of the TO, mainly in the lower stratosphere. The real origin of the TO may lie in the wave-mean-flow interaction.

Traffic anomaly detection is crucial for urban management, yet current research is often confined to small-scale endeavors. This study collected nine months of real-time Wuhan traffic monitoring data from Amap. We proposed Traffic-ConvLSTM, a multi-scale spatial-temporal technique based on long and short-term memory networks (LSTM) and convolutional neural networks (CNN) to effectively achieve long-term anomaly detection at the city level. First, we convert the traffic flow data into image representation, which enables the capture of the spatial correlation between traffic flow and roads and the correlation between traffic flow and roads, as well as the surrounding environment. Second, The model utilizes convolution kernels of different sizes to extract spatial features at road-level, regional-level, and city-level scales, while incorporating temporal features of different time steps to capture hourly, daily, and weekly dynamics. Additionally, varying weights are assigned to the convolution kernels and temporal features of varying spatio-temporal scales to capture the heterogeneous strengths of spatio-temporal correlations within patterns of traffic anomalies. The proposed Traffic-ConvLSTM model exhibits improved performance over existing techniques in the task of identifying long-term and large-scale traffic anomaly occurrences. Furthermore, the analysis reveals significant traffic anomalies during holidays and urban sporting events. The diverse travel patterns observed in response to various activities offer insights for large-scale urban traffic anomaly management, providing recommendations for city-level traffic control strategies.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

Polycyclic aromatic hydrocarbons (PAHs) have emerged as promising materials for organic electronics, including organic photovoltaics (OPVs), organic field-effect transistors (OFETs), and organic light-emitting diodes (OLEDs). Particularly, non-hexagonal ring-fused PAHs are highly desirable due to their unique optoelectronic properties. Herein, a new redox-active azulene-perylene diimide triad 1 and its ring-fused counterpart, diazulenocoronene diimide 2, were synthesized and fully characterized by a combination of NMR, cyclic voltammetry, spectroelectrochemistry, and UV-visible absorption spectroscopy. Density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed to gain further insight into various electronic transitions. Interestingly, we found that the adaptive response to acids and bases manifests itself in a reversible two-color-change that can be attributed to changes in the chemical structures.

With the rapid development in Beijing, there is a critical need to explore the circumstance and reveal the mechanisms of precious urban natural resources. In this context, urban blue space has attracted more and more attention by driving microcirculation, cooling heat islands, and relaxing residential. We extracted the UBS at Beijing using remote sensing, explored the spatial and temporal development in the last two decades via USDA methods, uncovered the full spectrum of landscape patterns from an ecological perspective, and simulated the mechanisms of the UBS area and the landscape quantitatively. We found that: (1) The UBS area in Beijing increased with fluctuation from 2000 to 2020. (2) The spatial clustering has distributed stable with some subtle changes. (3)The ecological circumstance has improved in the last 21 years in Beijing, with the increasing habitat diversity and richness, while the inferior landscape fragmentation has indicated some severe challenges. (4) Natural factors impact urban blue space areas more than social ones, while both similarly influence the UBS landscape. (5) Vegetation circumstances and precipitation are the most important natural factors on both area and landscape of UBS, and population and artificial surface are the most important social factors.

African swine fever has damaged the foundation of China’s hog industry, caused a serious decline in hog production, highlighted the contradiction between supply and demand in the pork market, and led to major economic and social impacts. This study measured the industrial resilience of 31 Chinese provinces which faced the African swine fever shock and its spatial and temporal differentiation characteristics from 2018-2021 in terms of the two dimensions of resistance and recoverability. Using Geodetector, the study explored the key factors influencing the resilience of China’s hog industry. The results showed that 2018-2019 and 2020-2021 were the resistance and recovery periods of the hog industry under the African swine fever shock, respectively, with poor resilience characterizing the resistance period and improved resilience exemplifying the recovery period. At the early stage of the African swine fever outbreak, Tianjin, Shanxi, Guangxi and Yunnan had robust resistance in the hog industry, and the slaughter rate, economic level, mortality rate, carcass weight and culling rate showed the highest explanation for the resistance. At the most severe stage of the outbreak, the resistance of the hog industry in all provinces was generally poor, and the slaughter rate, per capita consumption and scale level showed the highest explanation for the resistance. In the period of rapid recovery of hog production, the recoverability of each province was very strong, and the industrial structure, culling rate, economic level and resource carrying capacity showed the highest explanation for the recoverability. In the reasonable adjustment period of hog production capacity, the recoverability based on the breeding sow inventory in 13 provinces, including Henan, Shandong and other large hog breeding provinces, was negative, and the scale level, slaughter rate, per capita consumption and resource carrying showed the highest explanation for the recoverability. It is recommended to take measures to enhance the resilience of the hog industry, strengthen the prevention and control of hog epidemics, improve the monitoring and early warning mechanism, and strive to enhance the ability of the hog industry to cope with major animal epidemics.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Planar catechin (PCat), a natural antioxidant with a fixed 3D catechin structure on a plane, exhibits radical-scavenging activity approximately five times stronger than the conventional catechin. We synthesized a compound, PCat–TrOH, by binding Trolox (TrOH), an α-tocopherol analog, to PCat to enhance its antioxidant effect against oxidative stress, such as lipid peroxidation. TrOH shows radical-scavenging activity about 6.5 times greater than PCat, and PCat–TrOH exhibited a similar level of radical-scavenging activity to TrOH. Additionally, PCat–TrOH demonstrated twice the radical-scavenging activity against reactive oxygen species compared to PCat or TrOH. This compound is also expected to exhibit an excellent antioxidant effect against lipid peroxidation caused by radical chain reactions, through interactions with vitamin C, similar to that in the case of α-tocopherol.

Deep learning methods have been widely used in PolSAR image classification. To learn the polarimetric information, many deep learning methods expect to learn high-level semantic features from original PolSAR data. However, only original data cannot learn multiple scattering features and complex structures for extremely heterogeneous terrain objects. In addition, deep learning methods always cause edge confusion due to the high-level features. To overcome these shortages, we propose a double-channel CNN network combined with an edge-preserving MRF model(DCCNN-MRF) for PolSAR image classification. Firstly, to combine complex matrix data and multiple scattering features together, a double-channel convolution network(DCCNN) is developed, which consists of a Wishart-based complex matrix and multi-feature subnetworks. The Wishart-based complex matrix network can learn the statistical characteristics and channel correlation well, and the multi-feature network can learn high-level semantic features well. Then, a unified network framework is designed to fuse two kinds of features to enhance advantageous features and reduce redundant ones. Finally, an edge preserving MRF model is designed to combine with the DCCNN network. In the MRF model, a sketch map-based edge energy function is designed by defining adaptive weighted neighborhood for edge pixels. Experiments are conducted on four real PolSAR data sets with different sensors and bands. Experimental results demonstrate the effectiveness of the proposed DCCNN-MRF method.

Background: People with Down syndrome (DS) have a trisomy of chromosome 21 and marked deficits in verbal memory but relatively preserved visuospatial perception. Verbal memories are related to semantic knowledge. Little is known about the organization of semantic knowledge in people with DS, which was the aim of this study. Aims: The extent of false memory in people with DS was examined. Possible differences in the number of false memories induced by nominal and verbal themes were examined. Methods and Procedures: In the study phase, ten word lists with semantically related associates were presented. In the recognition phase, participants made judgments on whether each word had been represented previously as semantically related lures, old words, and semantically unrelated new words. Outcomes and Results: Differences in the processing of nominal and verbal theme-related lures were observed among people with DS. When processing nominal theme-related lures, people with DS showed delayed false positives. When processing verbal theme-related lures, people with DS showed no differences compared to controls. Similar patterns have been observed in people with DS when processing nominal theme-related associates and verbal theme-related associates. People with DS have delayed recognition of associates. When processing unrelated words, they showed significantly higher false positives than controls for both nominal and verbal eliciting themes. Further analyses of the themes revealed differences in false positives across syntactic categories among groups. Conclusions and Implications: People with DS showed a delayed recognition of associates and deviance in recognizing unrelated words in the nominal and verbal theme categories. People with DS were delayed in terms of nouns, but deviated with verbs in associated and unrelated words. Additionally, people with DS showed distinct patterns in processing five nominal lures and three verbal lures, suggesting that they formed false memories differently based on distinct syntactic categories. Thus, it was concluded that people with DS develop a deviant semantic structure. Category-based interventions for people with DS should be implemented in order to improve their semantic knowledge through lexical connections.

As the natural resources are getting exhausted, the concept of sustainable development of region has received increasing attentions, especially for resource-dependent cities. In this paper an innovative method that emergy analysis and IPAT (Human Impact Population Affluence Technology) model were combined in order to analyze the quantitative relationship of economic growth and energy consumption and further to evaluate its overall sustainability level. Taiyuan, a traditional, resource-dependent city in China, is selected as the case study region. The main results show that total emergy of Taiyuan increased from 9.023× 1023 sej in 2007 to 9.116× 1023sej in 2014, with 38% reduction on non-renewable emergy and 125% growth on imported emergy. Regional emergy money ratio (RMB) was reduced by 48% from 5.31× 1013sej/$ in 2007 to 2.74× 1013sej/$ in 2014, indicating that the increasing speed of consuming resources and energy was faster than the increase of GDP, and that Taiyuan’s money purchasing power declined. The lower emergy sustainability index (ESI) indicates that Taiyuan was explored and produced large quantities of mineral resources, which puts more stress on the environment as a consequence, and that this is not sustainable in the long run. The IPAT analysis demonstrates that Taiyuan sticks to the efforts of energy conservation and environmental protection, in order to promote regional sustainable development, it is necessary to take an integrated effort. Policy insights suggest that resourceful regions should improve include energy and resource efficiency, optimizing energy and resourceful structure.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

Prediction of protein-ligand binding affinities is crucial for computational drug discovery. A number of deep learning approaches have been developed in recent years to improve the accuracy of such affinity prediction. While the predicting power of these systems have advanced to some degrees depending on the dataset used for model training and testing, the effects of the quality and quantity of the underlying data have not been thoroughly examined. In this study, we employed erroneous datasets and data subsets of different sizes, created from one of the largest databases of experimental binding affinities, to train and evaluate a deep learning system based on convolutional neural networks. Our results show that data quality and quantity do have significant impacts on the prediction performance of trained models. Depending on the variations in data quality and quantity, the performance discrepancies could be comparable to or even larger than those observed among different deep learning approaches. In particular, the presence of proteins during model training leads to a dramatic increase in prediction accuracy. This implies that continued accumulation of high-quality affinity data, especially for new protein targets, is indispensable for improving deep learning models to better predict protein-ligand binding affinities.

The sPHENIX experiment is a state-of-the-art jet and heavy flavor physics detector which successfully recorded its first Au + Au collision data at 200 GeV at RHIC. sPHENIX will provide heavy flavor physics measurements covering an unexplored kinematic region and unprecedented precision at RHIC to probe the parton energy loss mechanism, parton transport coefficients in quark-gluon plasma, and the hadronization process under various medium conditions. At the center of sPHENIX, the Monolithic-Active-Pixel-Sensor (MAPS) based VerTeX detector (MVTX) is a high-precision silicon pixel detector. The MVTX provides excellent position resolution and the capability of operating in continuous streaming readout mode, allowing precise vertex determination and recording a large data sample, both of which are particularly crucial for heavy flavor physics measurements. In this work, we will show the general performance of heavy-flavor hadron reconstruction. In addition, we will discuss the commissioning experience with sPHENIX. Finally, we will provide the projection of b-hadron and jet observables and discuss the estimated constraints on theoretical models.

J/ψ, a charmonium bound state made of a charm and an anti-charm quark, has been discovered in the 1970s and confirmed the quark model. Because the mass of charms quarks is significantly above the Quantum Chromodynamics (QCD) scale ΛQCD, charmonia are considered as excellent probes to test perturbative Quantum Chromodynamics (pQCD) calculations. Over the past decades, they have been studied extensively at different high energy colliders. However, their production mechanisms, which involves multiple scales, are still not very well understood. Recently, in high multiplicity p+p collisions at RHIC and at the LHC, a significant enhancement of J/ψ production yield has been observed, which suggests a strong contribution from the Multi-Parton Interaction (MPI). This is different from the traditional pQCD picture where charm quark pairs are produced from a single hard scattering between partons in p+p collisions. In this work, we will report the J/ψ normalized production yield as a function of normalized charged particle multiplicity over a board range of rapidity and event multiplicity in the J/ψ→μ+μ− channel with PHENIX Run 15 p+p data at \sqrt{s}=200 GeV. The results are compared with PYTHIA 8 simulations with the MPI option on and off. Finally, the outlooks of J/ψ in p+Au and Au+p collisions along with Color Glass Condensate (CGC) predictions and of multiplicity dependent ψ(2S)/J/ψ ratio in p+p data will be briefly discussed.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

(1) Background: Bacterial reinfection and root fracture are the main culprits related to root canal treatment failure. This study aimed to assess the utility of quercetin solution as an adjunctive endodontic irrigant that strengthen root canal dentin with commitment anti-biofilm activity and bio-safety. (2) Methods: Based on a noninvasive dentin infection model, dentin tubules infected with Enterococcus faecalis (E. faecalis) were irrigated with sterile water (control group), and 0, 1, 2, 4 wt% quercetin-containing ethanol solutions. The live and dead bacteria proportions within E. fae-calis biofilms were analyzed using confocal laser scanning microscopy (CLSM). Elastic modulus and hydroxyproline release and X-ray photoelectron spectroscopy (XPS) characterization was tested on irrigant-treated demineralized dentin to evaluate irrigants’ biostability. The cytotoxicity of irrigants was tested by CCK-8 assay. (3) Results: Quercetin increased the proportion of dead bacteria volumes within E. faecalis, and improved the flexural strength of dentin collagen com-pared to control group. The XPS characterization revealed an increase in C-O peak area under both C1s and O1s narrow-scan spectra. The CCK-8 assay confirmed no cytotoxicity of quercetin solutions. (4) Conclusions: Quercetin exhibited anti-biofilm activity, collagen-stabilizing effect as well as cytocompatibility, supporting quercetin as a potential candidate for endodontic irrigant.

Unmanned delivery technology using unmanned aerial vehicles (UAVs) has the potential to solve issues such as traffic congestion and labor shortages. We investigated a method to construct a route between the source and destination nodes in a wireless multi-hop network by installing a radio terminal in each house. If the relay functions of all nodes in the network are in operation, the number of control messages for route construction increases, and the message relay forwarding load of each node increases. Keeping all node pairs multi-hop connectivity, we establish a method to operate the relay function with as few nodes as possible. End nodes that have not activated the relay function connect to the relay node with the closest physical distance. In this paper, we propose methods for selecting nodes to operate the relay function. Specifically, one method is based on random selection, another method is based on the number of adjacent nodes, and a third method is based on the Multipoint Relay (MPR) of the Optimized Link State Routing Protocol (OLSR). For each method, we evaluate whether the route construction is available, the number of relay nodes, the total distance of constructed routes, and the distance in population-dense regions. We clarify the characteristics of each method, and the method based on MPR is the best for constructing a network suitable for UAV navigation routes. In addition, the smaller the number of relay nodes, the more unexpected collisions on the links due to route conflicts. We clarify the minimum node density required to apply the MPR method which reduces the number of relay nodes suppressing route conflicts.

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

This study presented a novel and sustainable method for producing chitin nanocrystals (PA-ChNCs) using phosphoric acid hydrolysis. The produced PA-ChNCs were used as stabilizers for Pickering emulsions and their physicochemical properties as well as stabilization mechanisms were systematically investigated. The PA-ChNCs exhibited small particle sizes and high surface areas, enabling an effective adsorption at the oil/water interface, which prevented coalescence in Pickering emulsions. The particle size and surface charge PA-ChNCs were strongly pH-dependent, which were critical factors for stabilizing Pickering emulsions. The study showed that emulsions with higher O:W ratios (50%) exhibited larger droplets but greater viscosity, forming a stable gel-like matrix that was more stable than emulsions with other O:W ratios after storage for 30 days. Emulsions with higher PA-ChNCs concentrations (2.0 wt%) and higher pH values (pH 10) showed small droplets and high viscosity, leading to stable emulsions. This research contributes to the development of sustainable and effective emulsifiers for use in the food industry, making utilization of seafood waste in an eco-friendly manner possible. Overall, this study highlights the potential of using newly developed PA-ChNCs as stabilizers for Pickering emulsions in food products.

In order to improve the charge collection efficiency, we simulated and experimentally tested the doping structure of the electron multiplication layer in EBCMOS. In this paper, we simulate the charge collection efficiency of EBCMOS under different doping methods by modeling the collisional scattering of electrons with solid atoms in semiconductor materials and combining the transport trajectories of electrons in the electron multiplication layer, the simulation results indicate that using a layered doping structure to reduce the thickness of the index heavily doped layer can effectively optimize the electric field distribution in the electron multiplier layer and reduce the recombination rate of electrons. The optimized doping structure has a significant effect on improving charge collection efficiency. Based on the simulation results, doped samples were prepared and tested. The test results showed that the charge collection efficiency obtained under the condition of a P-type silicon substrate thickness of 7μm and an index heavily doped layer thickness of 1μm was 72.65%, reducing the thickness of the index heavily doped layer to 0.1μm, the charge collection efficiency obtained can reach 86.27%, which proves that reducing the thickness of the index heavily doped layer can effectively improve the charge collection efficiency of EBCMOS devices.

Grapes are a globally popular fruit, with grape cultivation worldwide being second only to citrus. This article focuses on the low efficiency and accuracy of traditional manual grading of red grape external appearance and proposes a small-sample red grape external appearance grading model based on transfer learning with convolutional neural networks (CNNs). Initially, the CNN transfer learning method was used to transfer the pre-trained AlexNet, VGG16, GoogleNet, InceptionV3, and ResNet50 network models on the ImageNet image dataset to the red grape image grading task. By comparing the classification performance of the CNN models of these five different network depths with fine-tuning, ResNet50 with a learning rate of 0.001 and a loop number of 10 was determined to be the best feature extractor for red grape images. Moreover, given the small number of red grape image samples in this study, different convolutional layer features output by the ResNet50 feature extractor were analyzed layer by layer to determine the effect of deep features extracted by each convolutional layer on SVM classification performance. This analysis helped to obtain a ResNet50+SVM red grape external appearance grading model based on the optimal ResNet50 feature extraction strategy. Experimental data showed that the classification model constructed using the feature parameters extracted from the 10th node of the ResNet50 network achieved an accuracy rate of 95.08% for red grape grading. These research results provide a reference for the online grading of red grape clusters based on external appearance quality and have certain guiding significance for the quality and efficiency of grape industry circulation and production.

Public safety and intelligent surveillance systems critically depend on anomaly behavior detection for effective monitoring. In real-world pedestrian detection scenarios, prevalent challenges such as missed detections, complex background interference, and small target sizes hinder accurate anomaly identification. To address these issues, this study introduces YOLO-ABD, a lightweight method for anomaly behavior detection that integrates small target detection and channel shuffling. This method employs YOLOv8n as the baseline model, incorporating a small target detection mechanism in the Head part and utilizing GSConv convolution in the Backbone to enhance perceptual capability. Additionally, the SimAM attention mechanism is integrated to mitigate complex background interference, thereby improving target detection performance. Evaluation on the IITB-Corridor dataset demonstrated mAP50 and mAP50-95 scores of 89.3% and 60.6%, respectively. Generalization testing on the street-view-gdogo dataset further highlighted the superiority of YOLO-ABD over advanced detection algorithms, underscoring its effectiveness and generalizability. With a relatively small parameter count, YOLO-ABD presents an excellent lightweight solution for pedestrian anomaly behavior detection.

Objective To observe the effect of roxadustat on blood pressure and micro-inflammatory response in patients with hemodialysis anemia, and to provide a viable technique for the treatment of hemodialysis anemia patients. Methods A total of 100 hemodialysis anemia patients admitted to the Nephrology Department of our hospital from July 2020 to July 2021 were enrolled and randomly divided into an observation group (roxadustat) and a control group (human recombinant erythropoietin (rhEPO). The clinical efficacy, blood lipid metabolism, inflammatory factor levels, iron metabolism-related indicators, blood biochemical indicators, anemia indicators, adverse reactions and blood pressure were recorded and compared. Results There was no significant difference in baseline data and serum indicators (P>0.05). The study group demonstrated superior performance to the control group in terms of clinical efficacy, blood lipid metabolism, inflammatory factor levels, iron metabolism-related indicators, blood biochemical indicators, anemia indicators, adverse reactions and blood pressure (all P<0.05). Conclusion Compared with rhEPO treatment, roxadustat exhibits a promising outcome in treating anemia and has slight impact on blood pressure of patients.

Virus infection is one of the most common etiologies of hearing loss. Hearing loss associated with viral infection can be unilateral or bilateral, mild or severe, sudden or progressive, and permanent or recoverable. Many viruses cause hearing loss in adults and children; however, the pathogenesis of hearing loss caused by viral infection is not fully understood. This review describes cytomegalovirus, the most common virus causing hearing loss, and other reported hearing loss-related viruses, along with their pathogenic characteristics and research progress on their pathology, hearing phenotypes, possible associated mechanisms, treatment and prevention measures, aiming to provide diagnostic and treatment assistance to clinical workers.

Despite the considerable focus on job characteristics and individual differences in job crafting research, the influence of social factors on job crafting has not been well-acknowledged. This meta-analysis estimates the associations between social factors and job crafting, and how social factors contribute to employee outcomes through their job crafting. Based on a sample of 51 empirical studies that included 54 independent effect sizes (N = 17,863), we found that social factors of positive leadership styles (e.g., empowering and transformational) and coworker support were positively related to employee job crafting. Further, our study showed that employee job crafting positively mediate the relationships between social factors and work outcomes (e.g., job performance and well-being). Our study contributes to job crafting literature by integrating social factors into the job crafting model and demonstrating that the social context of work (in particular organizational-insiders) play a crucial role in shaping employees’ job crafting behavior. We also emphasize the critical role that job crafting plays in transmitting valuable social resources into improved work outcomes. Building on our results, we provide future direction for job crafting research and discuss how our results can imply practice in terms of job crafting training.

Strengthening the analysis and risk assessment of the pig epidemic will help to better prevent and mitigate epidemic risks and promote high-quality development of the pig industry. Based on the systematic grasp of the situation of live pig epidemics, a risk assessment index system was constructed, and the spatial and temporal variation characteristics of the risk of pig epidemics in China were explored by the entropy method. In recent years, the overall trend in pig epidemics in time first increased and then decreased, and in space, the trend in the acceleration of the spread across the country continued to weaken. China still faces challenges, such as many types and a wide range of diseases, large total livestock breeding and weak epidemic prevention and control capacity, and a large risk of introduction of foreign animal epidemics. The spatial and temporal variation in the pig epidemic risk was obvious; there was one high-risk area, two higher-risk areas and 10 medium-risk areas in recent years, and the epidemic risk was highest in Beijing, Hainan, Liaoning, Tibet and Zhejiang. However, there were significant differences in the regional distribution of the risk of pig epidemics in different years. To further build a secure “defense system” for the high-quality development of the pig industry, it is recommended to improve the monitoring and early warning system of pig epidemic risk, perfect the pig epidemic prevention and control system, and strengthen the regional collaboration mechanism of epidemic prevention and control.

Fe-(9, 19, 28, 37)wt.% Cr alloys were corroded at 700 and 800 ^oC for 70 h under 1 atm of N₂, 1 atm of N₂/3.2%H₂O-mixed gas, and 1 atm of N₂/3.1%H₂O/2.42%H₂S-mixed gas. The corrosion rate of Fe-9Cr alloy increased with the addition of H₂O, and furthermore with the addition of H₂S in N₂ gas. Fe-9Cr alloy was always nonprotective. In contrast, Fe-(19, 28, 37) wt.%Cr alloys were protective in N₂ and N₂/H₂O-mixed gas because of formation of the Cr₂O₃ layer. They were, however, nonprotective in N₂/H₂O/H₂S-mixed gas because sulfidation dominated to form the outer FeS layer and the inner Cr₂S₃ layer containing some FeCr₂S₄.

RM (red mud) was acidified with sulphuric acid and the acidified ARM (acidified red mud) was utilized as an innovative adsorption material for treating antibiotic-contained wastewater. The adsorption conditions, kinetics, isotherms, thermodynamics, and mechanism of ARM for CIP (ciprofloxacin) were investigated. Characterization of the ARM involved techniques such as scanning electron microscopy(SEM), transmission electron microscope(TEM), brunauer- emmett-teller (BET), X-ray diffraction (XRD), X-ray fluorescence (XRF), thermogravimetric analysis (TGA) and NH3-TPD analysis. Adsorption studies were conducted employing response surface methodology (RSM) for experimental design. The results showed that ARM can absorb CIP effectively. The RSM optimal experiment indicated that the most significant model terms influencing adsorption capacity were solution pH, CIP initial concentration and ARM dosage, under which the predicted maximum adsorption capacity achieved 7.30 mg/g. The adsorption kinetics adhered to a pseudo-second-order model, while equilibrium data fitted the Langmuir-Freundlich isotherm, yielding maximum capacity values of 7.35 mg/g. The adsorption process occurred non-spontaneously and absorbed heat, evidenced by ΔG0 values between 2.06 and 0.87 kJ/mol, ΔS0 at 39.41 J/mol/K, and ΔH0 at 13.8 kJ/mol. Analysis using attenuated total reflection Fourier-transform infrared spectroscopy (ATR-FTIR) indicated there existed complex reaction between Al-O in ARM and the ester group –COO in CIP. The C=O bond in CIP was likely to undergo a slight electrostatic interaction or be bound to the internal spherical surface of ARM. The findings indicate that ARM is a promising and efficient adsorbent for CIP removal from wastewater.

The rapid development of specific-purpose Large Language Models (LLMs), such as Med-PaLM, MEDITRON-70B, and Med-Gemini, has significantly impacted healthcare, offering unprecedented capabilities in clinical decision support, diagnostics, and personalized health monitoring. This paper reviews the advancements in medicine-specific LLMs, the integration of Retrieval-Augmented Generation (RAG) and prompt engineering, and their applications in improving diagnostic accuracy and educational utility. Despite the potential, these technologies present challenges, including bias, hallucinations, and the need for robust safety protocols. The paper also discusses the regulatory and ethical considerations necessary for integrating these models into mainstream healthcare. By examining current studies and developments, this paper aims to provide a comprehensive overview of the state of LLMs in medicine and highlight the future directions for research and application. The study concludes that while LLMs hold immense potential, their safe and effective integration into clinical practice requires rigorous testing, ongoing evaluation, and continuous collaboration among stakeholders.

The sustainable development of mines has been the focus of attention in recent years, in China, there are a large number of untreated mined-out areas, and a series of disasters caused by instability of the goaf will bring heavy blows to people’s safety and financial resources. Mined-out areas management is an important part that cannot be ignored in mine sustainable development, and filling management is one of the most effective ways to solve the hidden danger of mined-out areas. Among them, cemented filling with tailings and the ultra-high-water backfilling are commonly used in mining enterprises. However, filling treatment will lead to increasing cost and the decreasing profits, which seriously depresses the motivation of mining enterprises and even leads to mor-al hazard. Therefore, the analysis of the economic benefits of goaf control plays a vital role in the sustainable construction and long-term development of mines. This paper proposed the mine-out area treatment economic model, the proposed method employs the guiding philosophy of news-boy model to create a mathematical economy model that provides the basis of goaf management mode for mine. The following research results are achieved: (1) The economic model of mined-out area backfilling treatment is constructed, and which is classified three different modes. (2) Com-bined with mathematical derivation and simulation, the influence of relevant variable parameters on each type of filling mode is discussed. (3) Various types of goaf filling treatment mode are com-pared with non-filling scheme (benchmark mode), so as to provide theoretical support for mining enterprises to choose the appropriate filling scheme. The results shows that the economic model of mined-out area management provides the optimal mode for mined-out area filling, the balance of tailings and ultra-high water filling materials procurement is realized, to making maximum profits. In this paper, the use of economic thinking has an important impact on the sustainable development of safety goaf management. To evaluate the sustainable development of goaf management by building economic models. It has important theoretical basis and practical guiding significance for the development and exploration of mined-out area management by combining economy with sustainable development.

Intestinal commensal microbes, called the gut microbiota, play a critical role in host immune homeostasis through active microbial metabolites and innate and adaptive immune responses. Dysbiosis or imbalance of the gut microbiota composition is associated with inflammatory bowel disease (IBD) which includes Crohn’s disease and ulcerative colitis. The incidence and prevalence rates of IBD have been increasing worldwide. It is well recognized that butyrate, a microbial metabolite of diet fibers, is a major energy source for colonocytes and plays a crucial role in regulating immune function and maintaining epithelial barrier function and intestinal homeostasis. Emerging evidence suggests that butyrate might be a potential therapeutic agent to treat IBD. In this review, we discuss about gut microbial metabolites, particularly butyrate, the synthesis and metabolism of butyrate, mechanisms of butyrate in immune and epithelial barrier function. Furthermore, we review the current research on various therapeutic implications of butyrate in IBD.

Partially stabilized zirconia (PSZ) is a promising material with superior combination properties in a wide range of industries. In this study, the effect of grain size on the mechanical properties such as hardness, bending strength and fracture toughness (named as ‘indentation toughness’ in this study) was investigated. The multi-doped zirconia ceramics were prepared by powder processing and pressure-less sintered following four sintering schedules. The measured mechanical properties results show that the polymorph structure sintered at a higher temperature has a lower bending strength and hardness. But 300% more indentation toughness (30.54 Kg/mm) of samples sintered at 1600 °C +1150 °C relative to others was estimated due to the grain size effect by our suggested equation. By contrast, the fracture toughness was calculated with an existing method. The results showed that similar trends were obtained. It appeared to be a novel method for evaluating the toughness of partially stabilized zirconia ceramics with micron grains based on the size effect.

Accelerating the construction of livestock powerhouses is of great significance to better enhance the ability to guarantee the supply of livestock products and improve the quality, efficiency and competitiveness of the livestock industry. This study constructed an evaluation index system to assess the level of China’s livestock powerhouse and then performed an in-depth analysis of the issues and challenges facing the construction of livestock powerhouses. The research results showed that the level of China’s livestock powerhouse ranked 5th in the world, and the livestock industry was transitioning from being a large livestock country to a powerhouse, while there was still a large gap in terms of reaching the goal of constructing livestock powerhouses. There were significant differences in the level of livestock powerhouses across different livestock industries; the layer industry was the world leader in China, whereas the pig, sheep and goat, and broiler industries were stronger, while the beef cattle and dairy industries were weaker. There are still many challenges to accelerating the construction of livestock powerhouses in terms of supply security, scientific and technological support, operation systems, industry and supply chain resilience, international trade, policy support, etc. It is recommended to improve the institutional mechanism for the construction of livestock powerhouses, promote a high level of self-reliance and self-improvement in livestock science and technology, build a modern livestock operation system, enhance the resilience and security level of the industrial and supply chain, and consolidate and expand international trade and cooperation.

The phase composition design principle is introduced to obtain balanced properties of ionic conductivity and thermo-tolerant for zirconia solid electrolytes used in solid oxide fuel cells (SOFCs). The zirconia ceramic solid electrolytes are fabricated by two-step free sintering. With increasing Y/Mg ionic ratio from 1.78:1 to 1.88:1, the content of monoclinic phase fluctuates little (±3%). The ionic conductivity, including the total electrical resistance; grain electrical resistance and grain boundary electrical resistance at 1223K, are all gradually declining with the increasing of Y/Mg ionic ratio. Furthermore, the enrichment of Mg ion in grain boundary acts as a disincentive to grain boundary ionic conductivity. In addition, the maximum total equivalent conductivity at 1223K in this study reaches to 0.143 Scm-1 which can compare with that of certain YSZ. It will be beneficial to SOFCs application profited from increasing ionic conductivity of ceramic solid electrolytes.

With the rapid development of network science, Turing pattern on complex networks has attracted extensive attention from researchers. In this paper, we focus on spatial patterns in multiplex ER (Erdös-Rényi) random networks, taking the predator-prey model with Allee effect and hyperbolic mortality as an example. In theory, the threshold condition for generating Turing pattern is given using the Turing instability theory of multiplex networks. Numerically, we design relevant experiments to explore the impact of network topology on Turing pattern. The factors considered include model parameters, diffusion rate, average degree of the network, and differences in the average degree of different layers. The results indicate that the importance of diffusion rate and network average degree for Turing pattern is affirmed on the single-layer network. For multiplex networks, the differentiation of average degrees in different layers controls the generation of Turing pattern, which is not affected by the diffusion rates of the two populations. More interestingly, we observe the switching of Turing pattern and spatiotemporal pattern. We believe that these findings contribute to a better understanding of self-organization on complex networks.

The unsteady flow around the monopile under the influence of wave and vibration is studied by numerical method. Based on VOF model and SST Turbulence model, combined with Intermittent Transition model and dynamic mesh method, wave generation and pile vibration in numerical flume are simulated. The flow field around vibrating monopile in a calm water flume and a wave flume is simulated and the simulation results are compared. The calculation results show that the monopile vibration has a great disturbance to the unsteady flow around the pile, and the disturbance degree intensifies with the increase of the vibration amplitude of the monopile: Under the action of inertia, the vibration of the monopile leads to the reattachment of the shedding vortices; Under the influence of the reattachment vortices, the asymmetry of the vorticity on the side wall of the monopile intensifies; The intensification of the disturbance causes the reduction of the phase lead angle of the bed shear stress on the side of the single pile, and an additional high bed shear stress appears on the side of the monopile. In addition, the vortex structure formed alternately around the monopile during the vibration process leads to the periodic change of the high bed shear stress.

Against the backdrop of the current carbon peaking and carbon neutrality policies, higher requirements have been put forward for the upgrading and construction of smart grids. Non-intrusive load monitoring (NILM) technology is a key technology for advanced measurement systems at the end of the power grid. It obtains detailed power information of the load, without the need for traditional hardware deployment. The key step to solve this problem is load decomposition and identification. This paper first utilized Long Short Term Memory-Denoising Autoencoder(LSTM-DAE) to decompose the mixed current signal on the household busbar and obtain the current signals of multiple independent loads that constituted the mixed current. Then, the obtained independent current signals were combined with voltage signals to generate multi-cycle colored Voltage-Current(VI) trajectories, which were color-coded according to the background. These colored VI trajectories with background colors formed a feature library. When the CNN network was used for load recognition, considering the influence of hyperparameters on recognition results, the BOA algorithm was used for optimization, and the optimized CNN network was employed for VI trajectory recognition. Finally, the proposed method was validated using the PLAID dataset. Experimental results showed that the proposed method exhibited better performance in load decomposition and identification.

Using DCC-GARCH and EGARCH model, this paper finds that since 1990, the relationship between crude oil prices and the US dollar index is time-varying, demonstrating a process of “very weak correlation—negative correlation—enhanced negative correlation—weakening negative correlation”, but the existing research does not provide enough reasonable explanation. Therefore, this paper proposed a “key mediating factors” hypothesis which points out that whether there is a common “key mediating factor” is important source of the time-varying relationship between two assets. We argue that market trend and financial market sentiment undertook the role of “key mediating factor” during the period of “2002 to the financial crisis” and “financial crisis to 2013”, while other periods lack the “key mediating factors”.

To analyze the impact of weather factors on the resilience of airport flight operations, particularly on flight operation, economic performance, and transportation capacity, Kolmogorov-Arnold Network (KAN) model was used to identify key weather features and establish the mapping relationship between weather factors and airport operational resilience. Taking Xi'an Xianyang International Airport as an example, the weights of each route were determined using the Grey Relational Analysis method considering average daily flight volume, flight distance, and airport flow stability indicators. Flight operation records and weather data were utilized to calculate the importance of key weather factors on the resilience of critical flight operation indicators. The results indicate significant differences in average daily flight volume, flight distance, and airport flow stability across different routes, with routes in economically developed areas having a greater impact on airport flow stability. Temperature and wind speed changes are the key factors affecting flight operation and economic indicators, with importance values of 0.35 and 0.32 respectively. Wind direction change and wind speed change have the greatest impact on flight transportation capacity, with importance values of 0.7 and 0.65 respectively. Therefore, when conducting flight scheduling and risk assessment, special attention should be paid to key weather factors such as temperature and wind speed, while also considering the weight of each route to ensure flight safety, efficiency, and economic benefits.

The advancement of autonomous driving technology is becoming increasingly vital in the modern technological landscape, promising notable enhancements in safety, efficiency, traffic management, and energy use. Despite these benefits, conventional deep reinforcement learning algorithms often struggle to navigate complex driving environments effectively. To tackle this challenge, we propose a novel network called DynamicNoise, designed to significantly boost algorithmic performance by introducing noise into the Deep Q-Network (DQN) and Double Deep Q-Network (DDQN). Drawing inspiration from the NoiseNet architecture, DynamicNoise uses stochastic perturbations to improve the exploration capabilities of these models, leading to more robust learning outcomes. Our experiments demonstrate a 57.25% improvement in navigation effectiveness within a 2D experimental setting. Moreover, by integrating noise into the action selection and fully connected layers of the Soft Actor-Critic (SAC) model in the more complex 3D CARLA simulation environment, our approach achieved an 18.9% performance gain, substantially surpassing traditional methods. These results confirm that the DynamicNoise network significantly enhances the performance of autonomous driving systems across various simulated environments, regardless of their dimensionality and complexity, by improving their exploration capabilities rather than just their efficiency.

The development of good conductivity p-type β-Ga2O3 is critical to realize its devices and applications. The nitrogen-doped p-type β-Ga2O3 films with enhanced conductivity characteristics were prepared through the thermal oxidation of GaN in the N2O atmosphere. Further measurements were performed on the oxidized films at 1000, 1050, and 1100 °C to have insight into the underlying mechanism of the thermally activated transformation process. The room temperature photoluminescence (PL) spectra demonstrated a moderate ultraviolet emission peak at 246 nm, confirming the generation of gallium oxide with a band gap of ~5.0 eV. The normalized X-ray diffraction (XRD), the high-resolution transmission electron microscopy (HRTEM), and the selected area electron diffraction (SAED) patterns were used to confirm the characteristic of polycrystalline and anisotropic growth. Then, the effects of the oxidation temperature on the amount of incorporated nitrogen were analyzed using secondary ion mass spectrometry (SIMS). Moreover, the ionization energy of the acceptor of films oxidized at 1000, 1050, and 1100 °C was calculated and analyzed using the temperature-dependent Hall test results. The results showed that nitrogen doping was the main contributor to p-type electrical properties. The activation energy of the polycrystalline β-Ga2O3 prepared through thermal oxidation of GaN in the N2O atmosphere was estimated to be 147.175 kJ·mol-1 using the Arrhenius plot, which was considerably lower than that of both dry and wet oxidations of GaN in O2 ambient, thus confirming the efficiency of thermal oxidation of GaN in N2O.

This study aims to test a model linking destination image, perceived value, tourist satisfaction, and tourist loyalty. Based on a sample of 300 tourists travelling by car from the World Natural Heritage Site of Tianchi, China, a new model of destination image was explored and data were analysed using partial least squares structural equation modelling (PLS-SEM). The results show that perceived value and satisfaction are direct antecedents of destination loyalty. Above all, perceived value and tourist satisfaction mediate the relationship between destination image and loyalty. Finally, this study discusses the theoretical and management implications of the findings in order to boost the tourism industry in the context of car trips.

With the long-term and large-scale use, herbicides have been well known to influence tritrophic interactions particularly natural enemies of pests in agro-ecosystems. On the other hand, herbivorous insects, especially the generalist pests, have developed antagonistic interaction to different insecticides, toxic plant secondary metabolites and even heavy metals. However, whether exposure to herbicides would affect resistance of insects against insecticides is largely unknown, especially in agricultural pests. Here, we first reported that pre-exposure to two widely used herbicides butachlor and haloxyfop-methyl for 48 h can prime resistance of a generalist agricultural pest Helicoverpa armigera Hübner against insecticide methomyl and fungal toxin aflatoxin B1. In addition, there were no significant differences between control and herbicides-treated caterpillars on weight gain, pupal weight and pupation rates, suggesting that exposure to herbicides induce resistance of H. armigera accompanied with no fitness cost. Moreover, by determining detoxifying enzyme activities and toxicity bioassay with additional inhibitor of cytochrome P450 piperonyl butoxide (PBO), we showed that exposure to herbicides might prime P450-mediated detoxification of H. armigera against insecticide. Based on these results, we propose that exposure to herbicides primes resistance of H. armigera against insecticide by eliciting a clear elevation of predominantly P450 monooxygenase activities in midgut and fat body.

In the recent past, China has experienced rapid urbanization as a result of diverse growth factors. In such a context, it is crucial to evaluate the expansion of urban entities in order to implement sustainable urban planning strategies in China. Since, urban entities are the spatial reflection of the concentration of human activities, the delineation of urban areas upon the boundaries of built-up surfaces has resulted from inconsistent understanding and identification of urban areas. The study has attempted to extract and evaluate the growth of urban entities in 336 prefecture cities in China mainland (2000-2020) upon a novel approach using consistent night light images. The urban entities were extracted using the light intensities of the SNPP-VIIRS-like data. After extracting urban entities, a rationality assessment was carried out comparing derived urban entities with the LandScan population product, Landsat, and road networks. Also, the results were compared with other physical extents products such as MODIS and the HE. According to the findings, urban entities are basically consistent with the LandScan, road networks, and those with the HE and MODIS. But, urban entities accurately reflect the concentration of human activities than impervious extents of MODIS and the HE. At the prefecture levels, urban entities elevated from 8082 km2 to 74,417 km2 between 2000 and 2020 showing a 10.8% growth rate. By providing a supplementary resource and guide for trustworthy urban mapping, the research will expand new research directions that address the issues of variations of NTL data brightness thresholds dynamics on regional, and global scales.

To investigate effects of probiotics on cognitive function and regulation of cortisol and IL-1β in adolescents with depression. All 180 participants were randomly assigned into study group(treated by probiotics combined with sertraline hydrochloride) and control group(treated by sertraline hydrochloride). The repetitive Neuropsychological State Test (RBANS) and Hamilton Depression Scale (HAMD) were administered in MDD patients. The levels of serum cortisol and IL-1β were detected by ELISA kit. Except speech function, immediate memory, visual span, attention function, delayed memory and RBANS in the study group were significantly higher than those in the control group. The cortisol and interleukin1β in the study group were significantly downregulated than those in the control group. Except speech function, cortisol level was negatively correlated with RBANS total score and other factors in the study group. Interleukin-1β was negatively correlated with the total score of RBANS and each factor score. Cortisol and interleukin-1β were predictors of RBANS total score, which explained 46.80% of the variance. Cortisol had significant predictive effects on attention function and delayed memory, and interleukin-1β had significant predictive effects on visual span and speech function. It could concluded that probiotics can improve cognitive function in adolescents with depression by regulating cortisol and IL-1β levels.

The model internal year-to-year variability (hereafter, internal variability) is a significant source of uncertainty when estimating anthropogenic aerosol effective radiative forcing (ERF). In this study, we investigate the impact of internal variability using large ensemble simulations (600 years in total) with the same climate model under prescribed anthropogenic aerosol forcings. A comparison of the magnitudes (i.e., standard deviation, Std) of these influences confirms that internal variability has negligible impacts on the instantaneous radiative forcing (RF) diagnosed by double radiation calls but has considerable impacts on estimating ERF through rapid adjustments (ADJ). Approximately half of the model grids exhibit strong internal variability influence on ERF (Std &gt; 5 W m−2). These strong internal variabilities lead to a 50% probability that 30-year linear change can reach 2 W m−2, and 10-year linear change can reach 4 W m−2. A 50-year simulation can provide a relatively stable annual mean map of ERF (ERF = ADJ + RF), but it fails for ADJ. The statistically significant areas in the annual mean maps of both ERF and ADJ from a 10-year simulation exhibit instability with evident chaotic features. These analyses contribute to the setup of comparative experiments and a more comprehensive understanding of the modeled anthropogenic aerosol ERF.

Compared with the traditional bundle pricing strategy with fixed products, this paper proposes a more flexible interactive bundle pricing strategy (IBPS) for agricultural e-retailers. Since more and more consumers tend to buy more environmentally friendly and healthy organic agricultural products, we consider consumers' organic preferences and build a mixed bundle pricing model for organic and inorganic agricultural products. A free shipping strategy is introduced to maximize retailer profit and optimize consumer surplus. Through numerical analysis, we find: (1) Compared with the traditional online retailing method, IBPS can effectively stimulate consumption and higher retailer profit; (2) As the free shipping threshold increases, the total profit shows a trend of first increasing and then decreasing, indicating that a suitable free shipping threshold can optimize the retailer profit; (3) As the consumer green preference increases, the total sales of agricultural products decrease, but the organic sales improve, while total profit rises; (4) The higher the level of consumption, the higher the sales volume of organic products and there is an upward trend in the profits of e-retailers.

This study investigates the possible mechanisms related to the wide range of relative humidity in cirrus clouds (RHi). Under the closed adiabatic assumption, the impacts of vertical motion and ice crystal deposition/sublimation on RHi are investigated through in situ observations and parcel model simulations. Vertical motion is an active external force that changes the RHi, and ice crystal deposition/sublimation plays a role in mitigating the change in RHi. They are the two most important mechanisms involved in controlling the RHi fluctuation during cirrus evolution and could well explain the wide range of RHi in wave-related cirrus clouds. Furthermore, a comparison of cloud statistical characteristics from both observations and simulations shows that a very low value (e.g., 0.001) for the water vapor ice deposition coefficient is highly unlikely.

The multiple regression method is still an important tool for establishing precipitation forecast models with a lead time of one season. This study developed a flexible statistical forecast model for July precipitation over the middle-lower reaches of the Yangtze River (MLYR) based on the prophase winter sea surface temperature (SST). According to the characteristics of observed samples and related theoretical knowledge, some special treatments (i.e., more flexible and better–targeted methods) were introduced in the forecast model. These special treatments include a flexible MLYR domain definition, the extraction of indicative signals from the SST field, artificial samples, and the amplification of abnormal precipitation. Rolling forecast experiments show that the linear correlation between prediction and observation is around 0.5, more than half of the abnormal precipitation years can be successfully predicted, and there is no contradictory prediction of the abnormal years. These results indicate that the flexible statistical forecast model is valuable in real-life applications. Furthermore, sensitivity experiments show that forecast skills without these special treatments are obviously decreased. This suggests that forecast models can benefit from using statistical methods in a more flexible and better-targeted way.

This paper presents a novel method to extract local features, which instead of calculating local extrema computes global maxima in a discretized scale-space representation. To avoid obtaining precise scales by interpolation and to achieve perfect rotation invariance, two essential techniques, increasing the width of kernels in pixel and utilizing disk-shaped convolution template are adopted in this method. Since the size of a convolution template is finite and finite templates can introduce computational error into convolution, we sufficiently discuss this problem and work out an upper bound of the computational error. The upper bound is utilized in the method to ensure that all features obtained are computed under a given tolerance. Besides, the technique of relative threshold to determine features is adopted to reinforce the robustness for the scene of changing illumination. Simulations show that this new method attains high performance of repeatability in various situations including scale change, rotation, blur, JPEG compression, illumination change and even viewpoint change.

Unmanned Aerial Vehicles (UAVs) have become increasingly important in various applications, including environmental monitoring, disaster response, and surveillance, due to their flexibility, efficiency, and ability to access hard-to-reach areas. Effective path planning for multiple UAVs exploring a target area is crucial for maximizing coverage and operational efficiency. This study presents a novel approach to optimizing collaborative navigation for UAVs using Multi-Agent Reinforcement Learning (MARL). To enhance the efficiency of this process, we introduce the Adaptive Dimensionality Reduction (ADR) framework, which includes Autoencoders (AEs) and Principal Component Analysis (PCA) for dimensionality reduction and feature extraction. The ADR framework significantly reduces computational complexity by simplifying high-dimensional state spaces while preserving crucial information. Additionally, we incorporate communication modules to facilitate inter-UAV coordination, further improving path planning efficiency. Our experimental results demonstrate that the proposed approach significantly enhances exploration performance and reduces computational complexity, showcasing the potential of combining MARL with ADR techniques for advanced UAV navigation in complex environments.

Taiwan cobra (Naja atra) bites account for approximately 20% of all venomous snakebites in Taiwan. In Taiwan, the rates of wound necrosis and secondary infection from Taiwan cobra bites are higher than those associated with other venomous snakebites. Clinical tools to evaluate the infection risk after Taiwan cobra bites are lacking. Therefore, in this study, we developed a useful clinical tool to evaluate the infection risk after Taiwan cobra bites. Moreover, we investigated wound infection bacteriology. We analyzed the data of patients bitten by N. atra who had undergone freeze-dried neurotoxic antivenin treatment in emergency rooms of the Chang Gung Memorial Hospital network, which comprises seven hospitals and the largest medical system in Taiwan, from January 2001 to May 2017. Because patients with wound necrosis required antibiotics for infection treatment, we included only patients with wound infection but without tissue necrosis in the development of our Cobra Bacteriology of Infections in Taiwanese snake Envenomation (Cobra BITE) score by using univariate and multiple logistic regression. In total, 8,295,497 emergency department visits occurred from January 2001 to May 2017, and 195 patients were diagnosed has having cobra bites. Among them, 23 and 30 patients had wound necrosis and wound infection, respectively. The wound infection rate was 27.2% (53/195). Regardless of whether the patients had necrosis, Enterococcus faecalis and Morganella morganii were the main bacteria identified in the culture report. Gentamicin, ceftriaxone, ciprofloxacin, and levofloxacin are the ideal first-line antibiotics for treating N. atra bite wounds in Taiwan. As per our Cobra BITE score, the three factors predicting secondary wound infection after cobra bites are hospital admission, a white blood cell count (in 103/µL) × by neutrophil–lymphocyte ratio value of ≥114.23, and the use of antivenin medication. The area under the receiver operating characteristic curve for the Cobra BITE score system was 0.88. The ideal sensitivity and specificity were 0.89 and 0.76, respectively, and the optimal cutoff point for Cobra BITE score was 7. The Hosmer–Lemeshow p value was 0.4. In conclusion, our Cobra BITE study established a new practical clinical tool for clinicians to evaluate infection risk after N. atra bites. This score system enables the assessment of wound infections after N. atra bites, and it could be modified and improved in future for other Naja spp. bites.