Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&amp;LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&amp;LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

This paper aims to quantify the influence of hydrogen embrittlement on Wierzbicki and Xue (W-X) model parameters. This model has 4 parameters which have been obtained by tensile tests on smooth specimens, tensile notch specimens, single notch tensile specimens (SENT) and pure shear specimens. Hydrogen embrittlement has been obtained by electrolytic method. Application of the (W-X) model has been done to get the local resistance used to predict failure by the Volumetric Method (VM). An example is given for the case of an embedded pipe submitted to service pressure and lateral seismic displacement. The effect of this displacement is then assimilated to the shearing of the straight section of the pipe. The pipe shows a corrosion defect considered a semi-elliptical crack. The influence of hydrogen embrittlement on local strain resistance and safety factors is discussed.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

Two interesting compounds such as quaternary ammonium lignin(QAL) and 2-ethylhexyl phosphoric acid mono-2-ethylhexyl ester (P507) were synthesized as ionic liquids(QP-ILs) for the extraction of metal ions. The extraction behavior of Co(II) and Ni(II) from chloride solution was compared between QP-ILs and P507. The results showed that the extraction rates of Co(II) and Ni(II) in the two solutions varied with the extraction conditions, but QP-ILs has stronger extractability for cobalt than P507, while Ni is on the contrary. Under the same conditions, the Co/Ni separation performance(βCo/Ni) in QP-ILs is superior to that in p507. At pH4.0, 55℃, concentration of 20%, extraction time of 10 minutes, the βCo/Ni of QP-ILs reached to 2703, while that of P507 was only 164. In conclusion, QP-ILs was more efficient than P507 for separating Co from mixed solutions.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Climate change poses a significant threat to global food security, necessitating a thorough examination across multiple dimensions. Establishing appropriate food security evaluation indicators that align with the evolving concept of food security is imperative. This study enhances food security evaluation by refining a multi-dimensional framework and analyzing the impact of climate change across various regions from 2002 to 2021. By constructing an Food Security Index system composed of a three-tier indicator system and employing the entropy method for weighting, we assess the impacts of climate change on food security using a climate-economic model. Regression analysis reveals a negative linear relationship between mean temperatures and food security (p&lt;0.01), while precipitation impacts food security non-linearly, particularly exhibiting inverse U-shaped patterns in major grain-producing and grain-consuming areas. Extreme high temperatures consistently reduce food security, whereas extreme precipitation displays a complex, statistically significant inverse U-shaped association. In regions where production and consumption are balanced, mean temperatures have a negative effect on food security, while precipitation exhibits a positive correlation, but excessive precipitation can have adverse effects. These findings highlight the intricate interplay between climate change, regional disparities, and food security in China, emphasizing the need to consider multi-dimensional factors and regional variations in addressing food security challenges. These insights are invaluable for policy-making and planning aimed at enhancing food security in China.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

Amid escalating urbanization, devising rational commercial space layouts is a critical challenge. Leveraging machine learning, this study uses a Back-propagation (BP) neural network to optimize commercial spaces in Weinan City's central urban area. The results indicate an increased number of commercial facilities with a trend of multi-centered agglomeration and outward expansion. Based on these findings, we propose a strategic framework for rational commercial space development emphasizing aggregation centers, development axes, and spatial guidelines. This strategy provides valuable insights for urban planners in small and medium-sized cities in the Yellow River Basin and metropolitan areas, ultimately showcasing the power of machine learning in enhancing urban planning.

This paper proposed an optimal tracking control scheme through adaptive dynamic programming(ADP) for a class of partially unknown discrete-time nonlinear systems based on radial basis function neural network(RBF-NN). In order to acquire the unknown system dynamics, we use two RBF-NNs, the one is used to construct the identifier, and the another is used to directly approximate the steady-state control input, where a novel adaptive law is proposed to update neural network weights. While the optimal feedback control and the cost function are derived via feedforward neural networks approximating, it is proposed to regulate the tracking error, the critic network and the actor network are then trained online to obtain the solution of the associated Hamilton–Jacobi–Bellman (HJB) equation being built under the ADP framework. Simulations verify the effectiveness of the optimal tracking control technique using the neural networks.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

We study a two-echelon supply chain made up of a supplier and a manufacturer, both of which can reduce their component/product carbon emissions. With the vertical technology spillovers, we explore the optimal decisions of centralized and decentralized supply chains with price dependent demand and propose coordination strategy for the decentralized supply chain. Considering the cost contraction effectiveness of the technology spillovers, the centralized and decentralized game theoretic models of a two-echelon supply chain are developed to investigate optimal decisions of pricing and carbon emissions reduction. Through a systematic comparison and numerical analysis, we show that the profits of both players and the entire supply chain improve with the effect of technology spillovers increasing. Carbon emissions reduction will be taken by various protective measures so that the supplier and the manufacturer who do not innovate can hardly share the results of innovating via the “free-riding” methods when the technology spillover is relatively small. We also propose a revenue-cost sharing contract through bargaining to enhance the performance of the decentralized supply chain.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

The development of computational acoustics allows simulation of sound generation and propagation in complex environment. In particular, meshfree methods are widely used to solve acoustics problems through arbitrarily distributed field points and approximation smoothness flexibility. As a Lagrangian meshfree method, smoothed particle hydrodynamics (SPH) method reduce the difficulty in solving problems with deformable boundaries, complex topologies, or multiphase medium. The traditional SPH method has been applied in acoustic simulation. This study presents the corrective smoothed particle method (CSPM), which is a combination of SPH kernel estimate and Taylor series expansion. The CSPM is introduced as a Lagrangian approach to improve accuracy in solving acoustic wave equations in the time domain. Moreover, a boundary treatment technique based on the hybrid meshfree and finite difference time domain (FDTD) method is proposed to represent different acoustic boundaries with particles. To model sound propagation in pipes with different boundaries, soft, rigid, and absorbing boundary conditions are built with this technique. Numerical results show that the CSPM algorithm is consistent and demonstrates convergence with exact solutions. Main computational parameters are discussed, and different boundary conditions are validated to be effective for benchmark problems in computational acoustics.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

This paper presents a piezoresistive pressure sensor with a shield layer for improved stability. Compared with the conventional piezoresistive pressure sensors, p-type piezoresistors are covered by an n-type shield layer, which is formed by ion implantation. The proposed pressure sensors have been successfully fabricated by bulk micromachining techniques. The impact of electrical field on piezoresistors is studied by simulation. The temperature drift of the pressure sensor has been investigated by both simulation and experimental measurement. Characteristics of developed pressure sensors are tested from -40 C to 125 C. A sensitivity of 0.022 mV/V/KPa and a maximum non-linearity of 0.085% FS are measured for the fabricated sensor in a pressure range of 1 MPa. The temperature coefficients of resistance of shielded piezoresistors are found to be smaller than those of un-shielded ones. It is demonstrated that the shield layer is able to reduce the drift caused by electrical field and ambient temperature variation.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

Few-shot object detection (FSOD) aims to address the challenge of requiring a substantial amount of annotations for training in conventional object detection, which is very labor-intensive. However, existing few-shot methods achieve high precision with the sacrifice of time-consuming for exhaustive fine-tuning, or take poor performance in novel-class adaptation. We presume the major reason is that the valuable correlation feature among different categories is insufficiently exploited, hindering the generalization of knowledge from base to novel categories for object detection. In this paper, we propose Few-Shot object detection via Correlation-RPN and Transformer Encoder-Decoder (CRTED), a novel training network to learn object-relevant features of inter-class correlation and intra-class compactness while suppressing object-agnostic features in the background with limited annotated samples. And we also introduce a 4-way tuple-contrast training strategy to positively activate the training progress of our object detector. Experiments over two few-shot benchmarks (Pascal VOC, MS-COCO) demonstrate that, our proposed CRTED without further fine-tuning can achieve comparable performance with current state-of-the-art fine-tuned works. The codes and pre-trained models will be released.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

In order to study the effects of irradiation on the physicochemical properties and digestion behavior of chickpea protein, chickpea protein concentrate (CPC) was treated with electron beam irradiation (EBI) at doses of 5, 10, 15 and 20 kGy, respectively. After irradiation, protein solubility first increased at 10 kGy and 15 kGy, and then decreased at higher dose of 20 kGy. This was supported by SDS-PAGE where the intensity of major protein bands first increased and then decreased. Increased does of EBI generally led to greater oxidative modification of proteins in CPC, indicated by reduced sulfhydryls and increased carbonyls. In addition, protein structure was modified by EBI shown by Fourier transform infrared spectroscopy analysis where α-helix generally decreased and β-sheet increased. Although the protein digestibility was not significantly affected by EBI, the peptidomic analysis of the digests revealed significant difference among CPC irradiated with varying doses. A total of 337 peptides were identified from CPC irradiated with 0 kGy, 10 kGy and 20 kGy, respectively, with 18 overlapping peptides and 60, 29 and 40 peptides specific to the groups of 0, 10 and 20 kGy respectively. Theoretical calculation showed that the distribution of peptide length, hydrophobicity, net charge, and C-terminal residues were affected by irradiation. The 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging activity showed a marginal decrease with increasing dose of irradiation. In conclusion, EBI led to oxidative modification and structural changes of the chickpea protein, which subsequently affected the physicochemical properties of peptides obtained from in-vitro digestion of CPC despite of similar digestibility.

Carbon dots are carbon based nanoparticles, which have the characteristics of simple preparation process, photoluminescence, biocompatibility, adjustable surface function, water solubility, and low toxicity. They are widely used in biological applications such as imaging, biosensing, photocatalysis, and molecular transfer. It has also aroused great interest among researchers in agriculture and has made significant progress in improving crop growth and production. This review presents the physiological functions of carbon dots for crop growth and development, photosynthesis, water and nutrient absorption, and abiotic stress resistance and their applications in improving ecological environment and agriculture as biosensors, and the future application prospects and research directions of carbon dots in agriculture were prospected.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Lily tepals have a short lifespan. Once the tepals senesce, the ornamental value of the flower is lost. Some cultivars have attractive purple ovaries and fruits which greatly enhance the ornamental value of Asiatic hybrid lilies. However, little is known about the molecular mechanisms of anthocyanin biosynthesis in Asiatic hybrid lily ovaries. To investigate the transcriptional network that governs purple ovary coloration in Asiatic hybrid lilies, we obtained transcriptome data from green ovaries (S1) and purple ovaries (S2) of Asiatic ‘Tiny Padhye’. Comparative transcriptome analysis revealed 4228 differentially expressed genes. Differential expression analysis revealed that nine unigenes including four CHS genes, one CHI gene, one F3H gene, one F3′H gene, one DFR gene, and one UFGT gene were significantly up-regulated in purple ovaries. One MYB gene, LhMYB12-Lat, was identified as a key transcription factor determining the distribution of anthocyanins in Asiatic hybrid lily ovaries. Further qPCR results showed unigenes related to anthocyanin biosynthesis were highly expressed in purple ovaries of Asiatic ‘Tiny Padhye’ at stages 2 and 3, while they showed an extremely low level of expression in ovaries of Asiatic ‘Yellow Pixels’ during all developmental stages. In addition, shading treatment significantly decreased pigment accumulation by suppressing the expression of several unigenes related to anthocyanin biosynthesis in ovaries of Asiatic ‘Tiny Padhye’. These results could further our understanding of the molecular mechanisms of anthocyanin biosynthesis in Asiatic hybrid lily ovaries.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

This work investigated the isothermal holding time dependence of the densification, microstructure, weight loss and tensile properties of Fe-Mn-Si powder compacts. Elemental Fe, Mn and Si powder mixtures with a nominal composition of Fe-28Mn-3Si (in weight percent) were ball milled for 5h and subsequently pressed under a uniaxial pressure of 400 MPa. The compacted Fe-Mn-Si powder mixtures were sintered at 1200 ℃ for 0, 1, 2 and 3 h, respectively. In general, the density, weight loss and tensile properties increased with the increase of isothermal holding time. A significant increase in density, weight loss and tensile properties occurred in the compacts isothermally holding for 1 h, as compared to those with no isothermal holding. However, further extension of isothermal holding time (2 and 3 h) only played a limited role in promoting the density and tensile properties. The weight loss of the sintered compacts was mianly caused by the sublimation of Mn in Mn depletion region on the surface layer of the sintered Fe-Mn-Si compacts. The length of the Mn depletion region increased as isothermal holding time increased. A single α-Fe phase was detected on the surface of all the sintered compacts, and the locations beyond the Mn depletion region were comprised of a dual dominant γ-austenite and minor ε-martensite.

Multi-rotor drones, a kind of unmanned equipment which is widely used in military, commercial consumption and other fields, has been developed very rapidly in recent years. However, their short flight time has hindered the expansion of their application range. This can be addressed by utilizing hydrogen fuel cells, which exhibit high energy density, strong adaptability to ambient temperature, and no pollution emissions, as the power source. Accordingly, the application of hydrogen fuel cells as the power source in multi-rotor drones is a promising technology that has attracted significant research attention. This paper summarizes the development process of hydrogen fuel cell mul-ti-rotor drones and analyzes the key obstacles that need to be addressed for the further development of hydrogen fuel cell multi-rotor drones, including structural lightweight, hydrogen storage methods, energy management strategies. Additionally, prospects for the future development of hydrogen fuel cell multi-rotor drones are presented.

Water resources provided by alpine glaciers are an important pillar for people living in the arid regions in the west of China. In this study, the HBV (Hydrologiska Byrans Vattenavdelning) light model was applied to simulate glacier mass balance and runoff in the Koxkar River Basin (KRB) on the south slope of Mt. Tumur, western Tianshan Mts.. Daily temperature and precipitation were calculated by multiple linear regressions and gradient-inverse distance weighting, respectively, based on in-situ observed data by automatic weather stations (AWSs) in the basin (2007–2009) and at four meteorological stations neighbering the basin (1959–2009). Observed daily air temperature and precipitation were taken as input data for the HBV model, which was calibrated using runoff in 2007/08 and 2009/10, and validated in 2008/09 and 2010/11. Generally, the model could simulate runoff very well. The annual glacier mass balance and runoff were calculated using the HBV model driven by interpolated meteorological data for the period of 1959–2009. The simulated glacier mass balance were reasonable when compared with those observed values at nearby glaciers, indicating a decrease trend of mass balance in the basin with an average value of –370.4 mm a^-1 since 1959. The annual runoff showed a slight increase trend (5.51 mm a^-1). Futher analysis indicated that the runoff is more sensitive to temperature than precipitation amuont in the Koxkar river basin.

Tellurium exhibits exceptional intrinsic electronic properties. However, investigations into the modulation of tellurium's electronic properties through physical modification are notably scarce. Here, we present a comprehensive study focused on the evolution of the electronic properties of tellurium crystal flakes under plasma irradiation treatment by employing conductive atomic force microscopy and Raman spectroscopy. The plasma-treated tellurium experienced a process of defect generation through lattice broken. Prior to the degradation of electronic transport performance due to plasma irradiation treatment, a remarkable observation emerged: in the low-energy region of hydrogen plasma-treated tellurium, a notable enhancement in conductivity was unexpectedly detected. The mechanism underlying this enhancement in electronic transport performance was thoroughly elucidated by comparing it with the electronic structure induced by argon plasma irradiation. This study not only fundamentally uncovers the effects of plasma irradiation on tellurium crystal flakes, but also unearths an unprecedented trend of enhanced electronic transport performance at low irradiation energies when utilizing hydrogen plasma. This abnormal trend bears significant implications for guiding the prospective application of tellurium-based 2D materials in the realm of electronic devices.

The eddy current loss should be optimized to be as less as possible for the stability of permanent magnet in high speed permanent magnet synchronous motor (HSPMSM) rotor and ensure the high efficiency and low temperature of the motor. This paper analyzes the eddy current distribution in rotor, with consideration of the conflict of the thickness of sleeve and diameter of the rotor, calculating the eddy current loss (ECL) and the thermal distribution via Separation of variables method for solving Maxwell's equations with analytical hieratical model of ECL constructed. The optimization result of ECL of the HSPMSM whose power and rated speed is 30kw 48000r/min can be got by multi-objective optimization method, combined weighting coefficient method and traversal algorithm based on chaotic local search particle swarm optimization (CLSPSO), utilizing ECL analytical model and other analytical constraints. Related experiment and measurement has been implemented with new approach of loss separation.

Motion related human activity recognition using wearable sensors can potentially enable various useful daily applications. So far, most studies view it as a stand-alone mathematical classification problem without considering the physical nature of human motions. Consequently, they suffer from data dependencies and encounter the dimension disaster problem and the over-fitting issue, and their models are never human-readable. In this study, we start from a deep analysis on natural physical properties of human motions, and then propose a useful feature selection method to quantify each feature's classification contribution capability. On one hand, the "dimension disaster" problem can be avoid to some extent, due to the affined dimension of key features; On the other hand, over-fitting issue can be depressed since the knowledge implied in human motions are nearly invariant, which compensates the possible data inadequacy. The experiment results indicate that the proposed method performs superior to those adopted in related works, such as decision tree, k-NN, SVM, neural networks.

Using coherent optical detection and digital signal processing, laser phase noise and equalization enhanced phase noise can be effectively mitigated using the feed-forward and feed-back carrier phase recovery approaches. In this paper, theoretical analyses of feed-back and feed-forward carrier phase recovery methods have been carried out in the long-haul high-speed n-level phase shift keying (n-PSK) optical fiber communication systems, involving a one-tap normalized least-mean-square (LMS) algorithm, a block-wise average algorithm, and a Viterbi-Viterbi algorithm. The analytical expressions for evaluating the estimated carrier phase and for predicting the bit-error-rate (BER) performance (such as the BER floors) have been presented and discussed in the n-PSK coherent optical transmission systems by considering both the laser phase noise and the equalization enhanced phase noise. The results indicate that the Viterbi-Viterbi carrier phase recovery algorithm outperforms the one-tap normalized LMS and the block-wise average algorithms for small phase noise variance (or effective phase noise variance), while the one-tap normalized LMS algorithm shows a better performance than the other two algorithms for large phase noise variance (or effective phase noise variance). In addition, the one-tap normalized LMS algorithm is more sensitive to the level of modulation formats.

Although several carbon sequestration methods have been proposed according to theories from various disciplines, it is not known which method is the best. This study evaluated and summarized the advantage and disadvantages of several major carbon sequestration methods, including carbon capture and sequestration, ocean alkalinization, algal cultivation, and wood burial, based on the first principles, namely, sequestration scale and time, elemental stoichiometry, and energy use efficiency. This study suggested that, at present, wood burial may be a leading candidate for carbon sequestration because it can be implemented immediately on a large scale, is cost-effective and efficient, has a long sequestration time, has low technical requirements, and has a relatively low impact on agriculture. This study also discussed the implementation of wood burial from the perspective of nutrient requirements. To achieve carbon neutrality by 2050, the present study proposed a 25-year project starting in 2025 with an average sequestration rate of 3 Pg C per year, which includes burying 1.5 Pg of dead wood carbon and the creation of 9.7 × 10⁶ ha woodland.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

The massive use of electronic equipment has raised concerns about electromagnetic (EM) pollution, leading to increased attention to EM shielding in both civil and military applications. EM absorption materials play a crucial role in reducing the energy of microwaves projected onto their surface. In this work, we propose a novel OTA (over-the-air) antenna test method to evaluate and analyze the functionality of EM absorption materials. This method offers a new and practical way to assess the effectiveness of these materials. Measured results indicate that the presence of the EM absorption material led to a decrease in antenna gain of approximately 2-3 dB, a reduction in efficiency of more than 10-15%, and a smaller radiation pattern during the actual testing process. These findings highlight the impact of EM absorption materials on antenna performance. Compared to the traditional S-parameter testing method, the gain comparison testing method exhibits the advantages of higher accuracy and simpler operation in the lower frequency experiment.

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

This paper aims at tackling with the task of fusion feature from images and its corresponding point clouds for 3D object detection in autonomous driving scenarios basing on AVOD, an Aggregate View Object Detection network. The proposed fusion algorithms fuse features targeted from Bird’s Eye View (BEV) LIDAR point clouds and its corresponding RGB images. Differs in existing fusion methods, which are simply the adoptions of concatenation module, element-wise sum module or element-wise mean module, our proposed fusion algorithms enhance the interaction between BEV feature maps and its corresponding images feature maps by designing a novel structure, where single level feature maps and another utilizes multilevel feature maps. Experiments show that our proposed fusion algorithm produces better results on 3D mAP and AHS with less speed loss comparing to existing fusion method used on the KITTI 3D object detection benchmark.

In offshore drilling, accidents such as gas invasion, overflow, and kicks are inevitable, and they can escalate into blowouts and other catastrophic events that result in casualties and substantial economic losses. Therefore, maintaining drilling safety requires accurate monitoring of gas invasion and overflow. The majority of overflow monitoring methods currently utilized at drilling sites are threshold-based. However, monitoring parameters acquired during actual drilling operations frequently contain noise signals, making it difficult for threshold-based methods to strike a balance between improving accuracy and minimizing false positives. In this paper, Pattern Recognition-based Kick Detection (PRKD) is proposed as a novel method for diagnosing overflow in offshore drilling. This method utilizes the overflow evolution process by integrating multi-phase flow calculations, data filtering theory, pattern recognition theory, the Bayesian framework, and other theoretical models. The PRKD effectively detects and monitors gas intrusion and overflow based on single parameters by analyzing the shape and wave characteristics of the curves. The case analysis demonstrates that the proposed method for monitoring drilling overflow achieves high precision while maintaining a low false positive rate. By combining advanced computational techniques with pattern recognition algorithms, the PRKD improves the accuracy and reliability of kick detection, enabling proactive responses to potential risks, protecting the environment and human lives, and optimizing drilling operations.

This study presents a novel approach for quantifying the dynamics of monthly hydraulic geometry relationships in the Jingjiang reach of the Yangtze River by integrating leaf area index (LAI) data as an indicator of riparian vegetation. A comprehensive system of ordinary differential equations (ODEs) couples traditional power-law hydraulic geometry equations with LAI, capturing the influence of erosion control on channel morphology. The periodic delayed response theory and automatic differentiation techniques are employed to enhance the modeling framework's capabilities. Calibration and verification demonstrate the models' effectiveness in capturing overall trends in discharge, width, and depth dynamics, outperforming traditional constant-parameter approaches. However, model predictive abilities are limited under extreme climate conditions due to training on normal climate data. Key assumptions, including the periodic delayed response theory's neglect of peak discharges, simplified representation of artificial cut-offs, and reliance on remotely sensed data with limited local validation, introduce uncertainties. The proposed modeling framework shows potential for broader application to other river systems with appropriate adjustments. Future research could incorporate additional environmental factors, integrate models across scales, couple with advanced simulation techniques, and expand stability assessments beyond the riverbed index. By addressing related challenges, this integrated approach lays a foundation for enhancing understanding of river morphodynamics and channel stability.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

In this paper, the distributed formation tracking control problem of quadrotor unmanned aerial vehicles (UAVs) is considered. Adaptive backstepping technology is used to design flight control schemes for quadrotor UAVs. For the position subsystem, a distributed robust formation tracking control scheme is developed to achieve formation flight of quadrotor UAVs and track the desired flight trajectory. For the attitude subsystem, an adaptive disturbance rejection control scheme is proposed to achieve attitude stabilization during UAV flight under uncertain disturbances. Compared with the existing results, the novelty of this paper is that the proposed formation control scheme does not require the use of the quadrotor model parameters. Finally, a quadrotor UAV swarm system is used to verify the effectiveness of the proposed control scheme.

Based on PVDF (piezoelectric sensing techniques), this paper attempts to study the propagation law of shock waves in brittle materials during the process of three-wavelength laser irradiation of polysilicon, and discusses the formation mechanism of thermal shock failure. The experimental results show that the vapor pressure effect and the plasma pressure effect in the process of pulsed laser irradiation lead to the splashing of high temperature and high density melt. With the decrease of the laser wavelength, the laser breakdown threshold decreases and the shock wave is weakened. Because of pressure effect of the laser shock, the brittle fracture zone is at the edge of the irradiated area. The surface tension gradient and surface shear wave caused by the surface wave are the result of coherent coupling between optical and thermodynamics. The average propagation velocity of laser shock wave in polysilicon is 8.47×103m/s, and the experiment has reached the conclusion that the laser shock wave pressure peak exponentially distributes attenuation in the polysilicon.

The branch prediction units (BPUs) generally have security vulnerabilities, which can be used by attackers to obtain the execution status, jump directions, and jump address of conditional branches, and the existing protection methods cannot defend against these attacks. Therefore, this article proposes a hardware security protection method for conditional branches of embedded systems. This method calculates the number of updates to the branch target buffer (BTB). When it exceeds the threshold, BTB is locked to prevent attackers from analyzing the execution status of branches based on the time difference of whether BTB is updated. Moreover, the hybrid physical unclonable function (PUF) circuit is designed to provide confidentiality protection for the jump directions, jump addresses, and their indexes, preventing attackers from stealing these critical data. If these mechanism fails and attackers successfully tamper with conditional branches, this paper proposes a control flow integrity (CFI) protection mechanism based on branch labels to timely detect tampering with instruction codes, jump addresses, and jump directions. The proposed method is implemented and tested on FPGA. The experimental results show that this method can achieve fine-grained security protection for conditional branches, with about 5.4% resource overhead and less than 5.5% performance overhead.

In this paper, a semi-empirical model of air waves induced by falling rock is described. The model is composed of a uniform motion phase (velocity close to 0 m·s^-1) and an acceleration movement phase. The uniform motion phase was determined based on experimentally and the acceleration movement phase was derived by theoretical analysis. A series of experiments were performed to verify the semi-empirical model and elucidated the law of the uniform motion phase. The acceleration movement phase accounted for a larger portion with a greater height of the falling rock. Experimental results of different falling heights of the goaf showed close agreement with theoretical analysis values. The semi-empirical model could accurately and conveniently estimate the velocity of air wave induced by falling rock. Thus, the semi-empirical model can provide a reference and basis for estimating the speed of air waves and designing protective measures in mines.

We report neutralization titer data against contemporary SARS-CoV-2 sublineages from an ongoing, open-label, phase 2/3 trial of a single 30-μg dose of monovalent Omicron XBB.1.5-adapted BNT162b2 vaccine. Healthy participants had previously received ≥3 doses of a US-authorized mRNA vaccine, with the most recent being a bivalent Omicron BA.4/BA.5-adapted vaccine administered ≥150 days before study vaccination. In this analysis, Omicron XBB.1.5, BA.2.86, and JN.1 serum neutralizing titers were assessed at baseline and 1 month after vaccination in a subset of ≥18-year-olds (N = 40) with evidence of previous SARS-CoV-2 infection. Immunogenicity was also evaluated in a demographically matched group of participants who received bivalent BA.4/BA.5-adapted BNT162b2 in another study (ClinicalTrials.gov Identifier: NCT05472038). The XBB.1.5-adapted BNT162b2 vaccine elicited higher XBB.1.5, BA.2.86, and JN.1 neutralizing titers than those elicited by bivalent BA.4/BA.5-adapted BNT162b2. Overall geometric mean fold rises in neutralizing titers from baseline to 1 month after vaccination were higher among participants who received XBB.1.5-adapted BNT162b2 than those who received bivalent BA.4/BA.5-adapted BNT162b2 for XBB.1.5 (7.6 vs 5.6), slightly higher for JN.1 (3.9 vs 3.5), and similar for BA.2.86 (4.8 vs 4.9). ClinicalTrials.gov Identifier: NCT05997290.

Distributed/semi-distributed models are considered to be sensitive to the spatial resolution of the data input. In this paper, we take a small catchment in high urbanized Yangtze River Delta, Qinhuai catchment as study area, to analyze the impact of spatial resolution of precipitation and the potential evapotranspiration (PET) on the long-term runoff and flood runoff process. The data source includes the TRMM precipitation data, FEWS download PET data, and the interpolated metrological station data. GIS/RS technique was used to collect and pre-process the geographical, precipitation and PET series, which were then served as the input of CREST (Coupled Routing and Excess Storage) model to simulate the runoff process. The results clearly showed that, the CREST model is applicable to the Qinhuai catchment; the spatial resolution of precipitation had strong influence on the modelled runoff results and the metrological precipitation data cannot be substituted by the TRMM data in small catchment; the CREST model was not sensitive to the spatial resolution of the PET data, while the estimation fourmula of the PET data was correlated with the model quality. This paper focused on the small urbanized catchment, suggesting the influential explanatory variables for the model performance, and providing reliable reference for the study in similar area.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In this study, we evaluated how gut microbes associated with hepatopancreatic and gonadal expression genes impact on growth traits in different sex of M. rosenbergii. By comparing the relative abundance of gut microbes between the male (high weight gain, HiWG) and female (low weight gain, LoWG) animals, we have shown that at the phyla, family and genera level, the abundance of microbes existed significantly difference between both group. At the genera level, the abundance of Candidatus Hepatoplasma and unidentified Chloroplast lower in the LoWG animals than in the HiWG animals, and Lactobacillus and Ligilactobacillus have opposed trend. The abundance of Candidatus Hepatoplasma and unclassfied Chloroplast was associated with the growth traits in the HiWG group. The Lolium perenne microbial species belong to unclassfied Chloroplast genera have tight association with Ralstonia pickettii, both might association on Geobacter anodirecteducens abundance, which correlation with the expression of glutathione peroxidase and collagen, which were highly expressed in the hepatopancreas and gonads of HiWG group animals of M. rosenbergii and might promote growth and development. These associations were not detected in the female LoWG group.

Rhododendron chrysanthum Pall., live in Changbai Mountain being exposed to chilling temperature, high light intensities and water scarcity condition. To adapt to the harsh environment, the cold resistance mechanisms of R. chrysanthum have been successfully evolved in the long-term adaptive process. In our present work, the methods of proteomics combined with physiological and biochemical analyses were used to investigate the effects of cold stress on the photosynthesis and antioxidant system of Rhododendron chrysanthum Pall. and the molecular mechanisms involved in cold resistance of plants. A total of 153 photosynthesis related proteins were identified in present work, of which 7 proteins including Rubisco large subunit (rbcL) were up-regulated in experiment group (EG) compared with control group (CG). Simultaneously, four chlorophyll fluorescence parameters were measured in present study. The results showed that the maximum photochemical efficiency of photosystem II (Fv/Fm), actual quantum yield of PSII (Y(II)) and photochemical quenching (qP) were significantly higher in EG, whereas the non-photochemical quenching (NPQ) was notably decreased. Cold stress could lead to a significant reduction in electron transport rate (ETR) accompanied with an increase in excitation pressure (1-qP). The abundance of PetE which involved in the plants photosynthetic electron transfer was also significantly influenced by cold stress. Moreover, the up-regulated expressions and higher levels of enzymatic activities of Glutathione peroxidase (GPX) and Ascorbate peroxidases (APXs) were detected in EG. All these changes which can help plants to survive in low temperature are considered as the crucial parts of cold tolerance mechanisms. These results revealed that photosynthesis and redox adjustment play significant roles in the defense of cold-induced damage.

This paper analyzed the main diseases of the friction high-strength bolt (FHSB) joints in order to study the characteristics of the corrosion products of the joints in steel bridge and the influence factors. Seven representative FHSB connection pairs and eight steel plate samples were selected from the Dongying Shengli Yellow River Bridge, which has been in operation for 33 years. Then Scanning Electron Microscope (SEM), Energy Dispersive Spectroscopy (EDS) and X-Ray Diffraction (XRD) were used to analyze the microscopic morphology and chemical composition of the corroded surface of the samples. Finally, this paper discussed the relationship between the corroded sample surface and the environmental corrosion. The research results showed that construction quality problems, such as non-standard hole expansion, segmental slab joint dislocation and contact surface pollution, accelerated corrosion of the contact surface. With the increase of corrosion degree of joints, the contact surface of aluminum spraying layer gradually changed from a rugged and dense state to a smooth and porous powder state. With the corrosion of the steel plate substrate, the contact surface gradually changed from a fluffy stratified state to a surface bonding state. It was inferred that the friction coefficient of the FHSB connection node on the corroded aluminum sprayed contact surface first decreased and then increased. The corroded node samples detected not only a large number of S and Cl elements, but also the oxides of Mn, Si and other elements as well as FeS. It was speculated that node corrosion was also related to atmospheric (acid rain) and industrial dust and other corrosive environments. Almost all samples detected the component SiO2 of the Yellow River soil, as well as Mg, Ca, K, Na and other elements at the same time, which is basically consistent with the component elements of the Yellow River soil. Therefore, it was inferred that it was related to the inclusion of the Yellow River soil.

Background: The COVID-19 outbreak has accelerated the huge difference between medical care and disease prevention in Chinese medical institutions. This study aimed to investigated the relationship between the symbiotic units, environments, models, and effects of the integration of medical and disease prevention. Methods: This cross-sectional study involved 762 employees of public hospitals in 11 cities in Zhejiang Province by random stratified sampling. We analyzed the influence paths of elements in the mechanism of integration of medical and disease prevention and the mediating effect of symbiotic models among symbiotic units, symbiotic environments, and effects for on this integration. Results: The path coefficient of symbiotic unit on the symbiosis model was 0.46 (p&lt;.001), the path coefficient of symbiotic environment on symbiosis model was 0.52 (p&lt;.001). The path coefficient of the symbiotic unit and environment was 0.91 (p&lt;.001). The symbiotic models exhibited a partial mediation effect between symbiotic units and the effect of this integration. Sobel test = 3.27, β = 0.152, and the mediating effect accounted for 34.6%. Conclusions: It is suggested that Health policy-makers and public hospital managers should provide sufficient symbiotic units, establish collaborative symbiotic models, and improve the effects of integration of medical and disease prevention in public hospitals.

To characterize the fecal microbiota of lactating Bactrian camels, this study employed a random selection of camels, assigning them to three groups: the first parity group, the third parity group, and the fifth parity group. The fecal microbial community of lactating camels was assessed using 16S rRNA amplicon sequencing, and the resulting library was sequenced on an Illumina NovaSeq platform. The first parity group was characterized by Verrucomicrobiaceae as a distinctive bi-omarker, whereas Clostridiaceae exhibited a similar role to the third parity group. In terms of functional analysis, the relative abundance of the Steroid biosynthesis pathway was highest in the first parity group, whereas the fifth parity group demonstrated a higher relative abundance of the Tuberculosis pathway compared to the other groups. The first parity group exhibited the greatest presence of seven types of enzymes, whereas the fifth parity group displayed the highest levels of two specific enzymes. Additionally, a positive association was observed between the relative abundance of the Steroid biosynthesis pathway and Verrucomicrobiaceae. Furthermore, the relative abundance of the Tuberculosis pathway displayed positive correlations with 14 enzymes. In conclusion, this study revealed that different parity was associated with distinct fecal microbial ecologies in lactating Bactrian camels.

Soil extracellular enzyme activity (EEAs) and enzymatic stoichiometry (ES) can provide a crucial indication of changes in soil ecosystem's nutrient availability and the microbial resource limitations. However, the changing characteristics of soil EEAs and ES at different stages of the native succession process and their key drivers are unclear. In order to investigate the soil EEAs, ES and driving factors of soil under vegetation at different succession stages, we adopted the "spatio-temporal substitution" method to collect the surface soil of bryophyte community, herbaceous community, shrub community and tree community in the new volcanic lava platform of Wudalianchi Volcanic Nature Reserve. We measured seven soil EEA, including carbon(C)-acquiring enzyme (β-1,4-glucosidase (BG)), N-acquiring enzymes (β-N-acetyl-glucosaminidase (NAG) and leucine aminopeptidase (LAP)) and phosphorus (P)-acquiring enzyme (acid phosphatase (AP)) activities. The length and angle of vectors defined by ratios of enzyme activities (BG/(NAG + LAP) vs. BG/AP) were used to indicate relative microbial investments in C- (length), and N- and P- (angle) acquiring enzymes. Our results showed that the contents of TC, TN, TP, MBC, DOC and NO3-N in shrub community soil were significantly higher than those in bryophyte, herb and tree communities, and increased by 441%, 246%, 137%, 5570%, 12% and 484%, respectively. The highest soil EEA of C-, N- and P-acquiring were found in shrub community, and the soil EEAs/MBC of C-, N- and P-acquiring were the highest in bryophyte community. Enzyme C:N, C:P and N:P ratios increased progressively in the order of bryophyte, herb and shrub community, but the enzyme C:N, C:P and N:P ratios of tree community were both far less than shrub community. Vector lengths increased progressively in the order of bryophyte (1.16), herb (1.27), tree (1.29) and shrub (1.40), and Vector angles decreased progressively in the order of bryophyte (49.15°), herb (45.65°), Tree (45.31°) and shurb (44.54°), suggested that as succession progresses, soil microbial nutrients transforms from P limitation (angle＞45°) to N limitation (angle＜45°). Redundancy analysis showed that TC, TN, EC and C:N were important drivers of variation in soil EEAs and ES in vegetation at different succession stages. Our findings highlight that the primary succession process cause nutrient limitation transformation. Soil ES might be a sensitive indicator mediated by soil microorganisms to the relative resource limitation at different stages of the primary succession process.

Cloud-induced atmospheric extinction and occlusion have a major effect on the effectiveness and quality of telescope observations. Real-time cloud cover distribution and long-term statistical data are essential for astronomical siting and telescope operations. At ground-based astronomical telescope sites, cloud cover distribution is currently analyzed using manual observation methods. However, the main disadvantages of manual observation methods are human subjective, heavy workloads and poor real-time performance. Therefore, a real-time automatic cloud images classification method is desperately needed. This paper presents a new cloud identification method, which is named PSO+XGBoost model by combining eXtreme Gradient Boosting (XGBoost) and Particle Swarm Optimization (PSO). The entire cloud image is divided into 37 sub-regions in order to more precisely identify the distribution of the clouds. 19 features are then extracted, including the sky background, star density, lighting conditions, and subregion grayscale values. The experimental results have shown that the overall classification accuracy of 96.91% and our model is able to outperform several state-of-the-art baseline methods. Our approach achieves high accuracy in comparison with the manual observation methods. Moreover, this method meets telescope real-time scheduling requirements.

Many types of banana (Musa spp.)—one of the most economically important horticultural crops—exist, and their ploidy (diploid, triploid, and tetraploid, usually) and genome types (containing A or/and B genome in most cases) differ. At present, observation and genome type detection are commonly used to identify banana germplasm resources. However, the former is tedious, while the latter cannot distinguish categories below genome types. It is therefore urgent that a simple and effective method for identifying banana germplasm resources is established. We sequenced and analyzed the ribosomal DNA internal transcribed spacer (ITS) sequences of 62 banana germplasm and found that the sequencing peaks, especially the 20 bp region near the 420 bp position (referred to as the “420 bp region”), exhibited relatively recognizable and repeatable polymorphism characteristics. Using the “420 bp region” as a marker, we were able to quickly distinguish bananas belonging to different genome type groups (comprising the AA, AB, AAA, ABB, AAB, ABBB, AAAB, and AAAA groups) or different subgroups in the same genome type group (for example, the Cavendish, Gros Michel, Red, Lakatan, and Ibota Bota subgroups in the AAA group; and the Pisang Raja, Plantain, Pome and Silk subgroups in the AAB group). Moreover, it appeared that Sanger sequencing of ITS could be used for identifying banana hybrid offspring. These results demonstrated that the banana ITS region contains rich genetic information that is useful for genotyping. In general, ITS sequencing simplifies the classification of banana germplasm resources and has potential application in several areas of Musa improvement.

Channel bends are one of the most important characteristic features of natural streams. These bends often create the conditions for a hyporheic zone, which has been recognized as a critical component of stream ecosystems. The streambed vertical hydraulic conductivity (K_v), vertical hydraulic gradient (VHG) and Darcian flux (DF) in the hyporheic zone were estimated at 61 locations along a channel bend of the Beiluo River during July 2015 and January 2016. All the streambed attributes showed great spatial variability along the channel bend. Both upward fluxes and downward fluxes occurred during the two test periods, most of studied stream sections were controlled by downwelling, indicating stream water discharge into the subsurface. The average downward flux was higher at the downstream side than at the upstream side of the channel bend, especially in July 2015. The distribution of streambed sediment grain size has a significant influence on the variability of K_v; high percentages of silt and clay sediments generally lead to low K_v values. Higher K_v at the depositional left bank at the upstream site shifted toward the erosional right bank at the downstream site, with K_v values positively correlated with the water depth. This study suggested that the variabilities of K_v and VHG were influenced by the stream geomorphology and that the distribution of K_v was inversely related, to a certain extent, to the distribution of VHG across the channel bend. K_v and VHG were found to have opposite effects on the DF, and the close relationship between K_v and DF indicated that the water fluxes were mainly controlled by K_v.

This paper presents an optimized energy management strategy for Li-ion power batteries used on electric vehicles (EVs) at low temperatures. Under low-temperature environments, EVs suffer a sharp driving range loss resulted from the energy and power capability reduction of the battery. Simultaneously, because of Li plating, battery degradation becomes an increasing concern as temperature drops. All these factors could greatly increase the total vehicle operation cost. Prior to battery charging and vehicle operating, preheating battery to a battery-friendly temperature is an approach to promote energy utilization and reduce total cost. Based on the proposed LiFePO4 battery model, the total vehicle operation cost under certain driving cycles is quantified in the present paper. Then given a certain ambient temperature, a target temperature of preheating is optimized under the principle of minimizing total cost. As for the preheating method, a liquid heating system is also implemented on an electric bus. Simulation results show that the preheating process becomes increasingly necessary with a decreasing ambient temperature; however, the preheating demand declines as driving range grows. Vehicle tests verify that the preheating management strategy proposed in this paper is able to save total vehicle operation cost.

Ti-6Al-4V (TC4) titanium alloy parts were successfully fabricated by laser melting deposition (LMD)technology in this study. Proper normalizing temperatures were presented in detailed for bulk LMD specimens. Optical microscope, scanning electron microscopy, X-ray diffraction and electronic universal testing machine were used to characterize the microstructures, phase compositions, the tensile properties and hardness of the TC4 alloy parts treated using different normalizing temperature. The experimental results showed that the as-fabricated LMD speceimens microstructures mainly consisted of α-Ti phase with a small amount of β-Ti phase. After normalizing treatment, in the area of α-Ti phase, the recrystallized length and width of α-Ti phase both increased. When normalizing in the (α+β) phase field, the elongated primary α-Ti phase in the as-deposited state was truncated due to the precipitation of β-Ti phase and became a short rod-like primary α-Ti phase. In as-fabricated microstructure, the β-Ti phase was precipitated between different short rod-shaped α-Ti phases distributed as basketweave. After normalizing treatment at 990 for two hours with subsequent air cooling, the TC4 titanium alloy had significant different microstructures from original sample produced by LMD. Moreover, the mismatch of tensile and hardness property was mitigated in this heat treatment. So the normalizing treatment methods and temperature can be qualified as a prospective heat treatment of titanium alloy fabricating by laser melting deposition.

The combination of e-commerce and the green economy allows enterprises to distribute their green products directly to consumers through Internet channels. This paper investigates the impact of service spillovers on emission reduction and channel decisions in a two-echelon supply chain,in which the supplier is a Stackelberg leader and the retailer is a follower.By comparing the equilibrium outcomes of the single-channel and dual-channel supply chain in a setting with and without retail services, we observe that the supplier prefers to encroach on the market when services that retail locations provide largely spillover to and benefit the direct sales channel. Contrary to popular belief, a higher degree of service spillovers is beneficial for the retailer to get more returns under the dual-channel structure, whereas supplier encroachment will lead to a decline in the service level if the spillover degree is relatively low. In addition, the emission reduction level of products under supplier encroachment is always higher than that employed in the single-channel structure if consumers have both low-carbon preference and high degree of service sensitivity. Furthermore, we extend the equilibrium decisions under a carbon cap-and-trade (CCT) mechanism; the results fully verify the above conclusions. Interestingly, the implementation of a carbon price not only motivates carbon emission abatement and supplier encroachment, but also helps achieve a win-win outcome for supply chain members when service spillovers happen.

(1) Background: Most of the existing studies focus on the evaluation of technology finance; the relationship between technology finance and technology innovation. But there are few studies on the development of technology finance and the quality of economic development in our country; (2) Methods: Based on the panel data of 30 provinces in China, this paper constructs an index system to measure the development of technology finance through the improved entropy method, and tests the spatial correlation of the development of technology finance in China by Moran'I index. According to the test results, this paper constructs a spatial econometric model to empirically analyze the promoting effect of scientific, technological and financial development on high-quality economic development, and analyzes its promoting effect in different regions and different time periods; (3) Results: The results show that the quality of China's economic growth is spatially dependent, and the development of science, technology and finance can significantly promote the quality economic development in China. And the promotion coefficient of the central region is the largest, as well as the coefficient of the eastern region is the smallest. The promotion coefficient was small and not significant before 2015, and was significantly positive after 2015; (4) Conclusions: this paper puts forward the corresponding policy recommendations according to the research results.

The main purpose of this paper is to present a comprehensive view of the application mathematical models in the designing and implementing SSCM beside to solving problems and making decision. The research questions are: what mathematical models are used for designing and implementing sustainable supply chain management, how to use them, which industries implemented in, what modules of SSCM depth in and finally finding the gaps of researches. The methodology of research is Systematic Literature review through peer review papers which are published in high ranking journals. In this paper, First, we search all papers through scientific data bases like Scopus, science direct, MDPI, Springer, Google Scholar, then, screening papers based on the criteria such as subject of paper, journals impact factor which is published in-should be peer review journal- and relative content of the papers. Finally, we selected 245 papers with three steps screening through 2806 papers that they have enough quality and relative to our research goals for context analysis. Through context analysis, first we categorized the information of the papers and drew the current situation of researches in the framework of our topic. Then, we evaluate and compare the goals of sustainability and current situation and found the gapes, then, offered new suggestions like implementing SSCMs models in pollutant industries like casting industry, Heavy industry, coal Industry and so on. On the other hand, there are gaps in researches in some modules of SSCM such as packaging, designing products, etc.

The flowering of Amorphophallus bulbifer plays an important role in its reproduction. The flowers and leaves of A. bulbifer cannot grow at the same time. However, the physiological and molecular mechanisms involved in flower bud and leaf bud formation are still unclear. In this study, the flower buds and leaf buds of A. bulbifer in the early stage of growth were used as research materials, transcriptome and metabolome analyses were carried out, and the soluble sugar and starch contents of A. bulbifer corms were determined. Transcriptome analysis revealed 5 542 differentially expressed genes (DEG) between flower buds and leaf buds, 3 107 of which were upregulated and 2 435 of which were downregulated. Enrichment analysis of the KEGG pathway showed that these differential genes were enriched mainly in the plant hormone signal transduction, DNA replication and fatty acid elongation pathways. Plant hormone signal transduction, DNA replication and fatty acid elongation pathways. A total of 5 296 significant differentially abundant metabolites were screened out by nontargeted metabolomics analysis. The differentially abundant metabolites were functionally classified in the HMDB, and 118 were successfully matched, including 17 that were highly expressed in flower buds. The differentially abundant metabolites in the flower buds were mainly enriched in pathways such as amino acid metabolism, isoquinoline alkaloid biosynthesis and pyrimidine metabolism. Targeted metabolomics analysis revealed that the contents of ABA, ZT and iPA in flower buds were significantly greater than those in leaf buds, while the opposite trend was observed for IAA. The analysis of soluble sugar and starch contents showed that the starch and soluble sugar contents in flower buds were significantly greater than those in leaf buds. The results of this study showed that flower bud development in A. bulbifer was regulated by amino acids, starch, ABA, ZT, iPA, IAA and other hormones. These findings could lead to valuable genetic resources for further study of A. bulbifer flowering and provide a deeper understanding of the molecular basis of A. bulbifer flowering.

The vegetation types on the Qinghai-Tibet Plateau are complex and diverse, and the ecological environment is fragile and sensitive. It is very important to study the dynamic changes in vegetation and the main factors related to these changes to grasp the present state of the regional ecosystem, maintain the balance of the ecosystem and promote the sustainable development of the ecosystem. Therefore, this paper is based on SPOT/VEG NDVI (normalized difference vegetation index) data, land use data, topographic data and meteorological data from 1999 to 2019. The spatiotemporal variation in the NDVI over the Tibetan Plateau in the last 21 years and its response to different driving factors were investigated by using the Sen slope method, Mann–Kendall mutation test, partial correlation analysis and geographical detector method. The results showed that (1) the vegetation coverage on the Qinghai-Tibet Plateau showed an increasing trend from 1999 to 2019, with increases in approximately 67.00% of the plateau area. (2) The spatial differences in vegetation coverage were large; notably, low-density vegetation areas decreased obviously, moderate-density vegetation areas accounted for approximately 50% of the total area, high-density vegetation areas were the least common, and the overall growth rate was significant. (3) The NDVI was positively correlated with temperature and precipitation, and a positive correlation was observed in more than 66% of the region. (4) The order of the influence of single driving factors on the NDVI was as follows: precipitation > soil type > altitude > temperature > gradient > slope > population density > GDP. (5) The effect of multiple factors was significantly higher than that of single driving factors, with a notable nonlinear influence. The interactions between meteorological factors, such as precipitation, and topographic factors, such as altitude, were important, with a q value over 0.79.

The International tax regime (ITR) has been transformed after the Great Recession of 2008–2009. The G20/Organization for Economic Cooperation and Development (OECD)’s Base Erosion and Profit Shifting (BEPS) project (2013–2015) has fundamentally changed the ITR, giving new life to the single tax principle (income should be taxed once, i.e., no double taxation and no double non taxation). Reaction to BEPS has varied dramatically between the EU and the US, the two largest markets in the world. In the EU BEPS is taken very seriously, as shown for example by the new Anti-Tax Avoidance Directives that implement the single tax principle. In the US BEPS is almost invisible; while the US model tax treaty has been amended to incorporate it the US has refused to sign the Multilateral Instrument to implement BEPS in its treaties and the only other BEPS action that the US has taken is country by country reporting. It thus appears that the future of BEPS and the ITR depends on whether the EU or the US view prevails, i.e., whether multinationals can be forced to pay significant tax on the 160–240 billion that are currently not taxed annually because of BEPS. While US multinationals as well as EU multinationals are exposed to the EU ATAD and related measures while operating in Europe, they are less subject to EU anti BEPS measures elsewhere in the world. It therefore is crucial to assess the reaction to BEPS in the other large economy that was involved in its development, namely China. This article attempts to assess China’s reaction to BEPS based on Chinese sources. It shows that China takes BEPS seriously. Therefore, given the reactions of China (as well as India, which is even more aggressive than China for example in taxing the digital economy) it seems likely that eventually the EU view of BEPS will prevail and US based multinationals will eventually be forced to pay tax on the over 100 billion they shift offshore each year.

Mass transfer is often the rate determining step for solid-liquid chemical reactions. Decrease of the concentration boundary layer thickness is essential to intensify the chemical reaction. Because the concentration boundary layer exists in the velocity boundary layer, force imposition in the concentration boundary layer by superimposing an electrical current and a magnetic field was proposed. Through, flow can be directly excited in the concentration boundary layer. The previous result indicates that by superimposing a DC current and a gradient magnetic field, the development of the concentration boundary layer was suppressed, because of a macro-scale flow excitation in the whole vessel. And by superimposing the gradient magnetic field with a modulate current, the development of the concentration boundary layer was further suppressed. This is because of the macro-scale flow enhancement and the excitation of a micro-scale flow near the solid-liquid interface. However, the mechanism for the micro-scale flow excitation has not been clarified. To clarify this, a uniform magnetic field was superimposed with the DC current or the modulate current. By this means, only the micro-scale flow was excited near the anode surface. The results found that the non-unform electromagnetic force distribution is the main reason for the micro-scale flow excitation.

Rural tourism plays an increasing role in maintaining sustainable rural development. In-11 tegrating culture into rural tourism is multifaceted. Local communities have often been regarded as 12 homogeneous, and different voices within them are selectively presented or re-interpreted by pow-13 ers. A better understanding of how and why cultures are integrated into rural tourism is urgently 14 needed. This paper aims to investigate (1) the aims and motives of tourism managers to integrate 15 cultural concepts into rural tourism; (2) who has participated in the cultural integration process; and 16 (3) how cultures have been integrated into rural tourism. Based on a scoping literature review, we 17 found that cultures could add more attractions, such as historical heritage, artwork, cultural land-18 scape, customs, food, and language, to the natural landscape and bring more tourists to rural areas. 19 However, integrating cultures into rural tourism is not always successful. Conflicts of interest 20 among different stakeholders are also often found. Some of the worst cases of cultural integration 21 have even destroyed the original natural landscape and local cultures. While cultural integration is 22 complicated, injustice and perverse effects do not have to be a consequence of integrating cultures 23 into rural tourism. Multi-way communication among tourism providers, managers, and consumers 24 can mitigate disruptive outcomes and unlock positive social outcomes.

A previous report showed that the urine output of HPLBII-P in patients with diabetes mellitus and SARS-Cov-2 infection was increased as a sign of glomerular dysfunction. . The aim of this report was to investigate the relation of urine output of HPLBII-P to diabetes mellitus in two large community-based elderly populations i.e. the ULSAM and PIVUS cohorts. Methods HPLBII-P was measured by ELISA in the urine of a community-based cohort of 839 men (ULSAM) collected at 77 years of age and in urine of a community-based cohort of 75-year-old men, n=387, and women, n=401 (PIVUS). KIM-1, NGAL and Albumin were measured in urine and Cathepsin S and Cystatin C in serum. Results HPLBII-P was significantly raised among males with diabetes in the ULSAM (p

The purpose of this study is to examine the relationship between the institutional investors which can affect financial performance for corporate sustainability on the income smoothing. Therefore, this study focus on the connection between the nature of stock rights and income smoothing in China. For this study, hypotheses were established on the relationship each state-controlled companies, income smoothing, and information equilibrium of individual investors, and empirical analysis was conducted through related variables. The analysis results are summarized in three categories as follows. First, this research finds that state-controlled firms (CONTs) prefer income smoothing activities compared to non-state-controlled firms for the long-term sustainable development of firms using data from 2011 to 2019. Second, this study found out that Institutional investors support the behavior of CONTs to smooth their earnings because this behavior is seen as an attempt by CONTs to convey valuable private information to other investors. Third, we was able to discover that institutional investors' monitoring effect is predominantly driven by pressure-resistant institutional investors. This research complements the lack of empirical research on income smoothing and enable to give a guideline that the type of stock rights is a critical key determinant of participation in income smoothing activities for stable growth and sustainability in the future.

Polygonatum cyrtonema Hua. is an important medicinal and edible food in China and the traditional processing method of nine-steaming and nine-drying has been used to process its rhizome. However, the global dynamic changes in secondary metabolites during the processing and whether this method could enhance the accumulation of functional components remain unclear. This study aimed to explore the processing-induced mechanisms involved in the accumulation of secondary metabolites and provide theoretical support for the pharmacological study on P. cyrtonema. Results showed the first 6 processing cycles induced drastic changes in the accumulation of secondary metabolites, while the last 3 did not induce further changes. The accumulation of most secondary metabolites significantly increased after the first 3 cycles and stabilized after 6 cycles. The first 3 cycles led to numerous newly added metabolites while the last 6–9 cycles led to a small number of disappeared metabolites. Processing enhanced the biosynthesis of various secondary metabolites and significantly affected the metabolisms of amino acids. Together, a short period of processing was helpful for enhancing the biosynthesis of secondary metabolites. However, the enhancing effects will be reversed or weakened under continuous processing. The processing cycles should be reduced to 3–6 to maintain the enhancing effects.

After reviewing the history of the struggle between human beings and plant diseases, insects and weeds, especially reviewing the thoughts of plant protection in ancient Chinese agricultural books, the target recognition of plant pests and the six types of plant protection methods and 36 subdi-vision measures were summarized. Then the development overview of pesticide application technology was focused and reviewed systematically by combining the development timeline of pesticide application and the key technologies including the performance measurement and the simulation and modeling of pesticide spraying system. And three suggestions for further research were proposed from the perspectives of human-being and environmental health, the sustainable and eco-friendly application medium, and the efficiently application equipment system in plant protection.

Plant-microbe interactions are essential for ecosystem health and agricultural productivity. Metabolomics has revolutionized our understanding of these interactions by providing powerful methods to decipher the complex chemical signals involved. This review highlights the various metabolomics techniques used to study plant-microbe interactions, such as mass spectrometry, nuclear magnetic resonance spectroscopy, and advanced imaging technologies. We also discuss the role of contemporary bioinformatics tools, extensive databases, and the increasing influence of artificial intelligence and machine learning in the analysis of metabolomics data. Integrating metabolomics with other omics fields, including transcriptomics, proteomics, and metagenomics, allows for a comprehensive understanding of the molecular mechanisms underlying plant-microbe interactions. The review emphasizes the significance of fluxomics in elucidating the dynamic nature of metabolic networks. While there are challenges in data analysis, integration, and interpretation, metabolomics has profoundly expanded our knowledge of the role metabolites play in shaping plant-microbe interactions. As metabolomics technologies advance and integrate further with other omics approaches, we anticipate groundbreaking discoveries that will provide deeper insights into these complex interactions, ultimately leading to innovative strategies for sustainable agriculture and biotechnology.

With continuous increase in integration of the semiconductor devices, the requirements on size accuracy and surface quality of the etched lead frame are higher. The etchant is a key factor on etching process and etched surface quality, while effects of the difference in etchants on microscopic etched surface morphology of the Cu alloy have not been directly studied. In this study, the aqua regia, acidic FeCl3 and CuCl2 solutions were used as etchants, and the CuCrSn alloy specimens with different microstructure were etched and characterized. The results show that the etching rate in aqua regia is high, and the grain orientation, grain boundary (GB) and dislocation have significant influence on the local etching rate. The preferential etching of some atomic planes forms steps between grains with different orientations, and the preferential etching around the GB and dislocation group forms grooves, resulting in high surface roughness. For etching of the FeCl3 and CuCl2 etchants, the steps and grooves become blurred, and almost invisible on the surface etched by the CuCl2 etchant, thus the surface roughness is much lower. The CuCrSn alloy surface etched by the aqua regia is clean, with little Cr-rich particles, while high density Cr-rich particles are remained on the surfaces etched with the FeCl3 and CuCl2 etchants. For the same kind of etchant, the ion concentration can affect the etching mechanism and etching surface morphology.

The COVID-19 pandemic halted progress in global vaccine coverage and disrupted routine childhood vaccination practices worldwide. While there is ample evidence of vaccination declines experienced during the pandemic, it is less clear how low-income countries were affected. We executed a systematic review to synthesize the current literature on impacts to routine childhood vaccinations in low-income countries from January 1, 2020 to February 8, 2023. We collected data using an extraction form on Covidence and assessed the quality of studies included in the review using the Risk of Bias in Non-Randomized Studies of Interventions (ROBINS-I) tool. Effect estimates for changes in vaccination during the pandemic were reported and summarized. Factors that influenced changes were grouped into descriptive themes. Thirteen studies, encompassing 18 low-income countries and evaluating 15 vaccines at varying doses, were included in the final review. We found that routine childhood vaccinations during the COVID-19 pandemic varied considerably by vaccine type, location, and phase of the pandemic. Nine different themes were identified as factors that influenced changes in vaccination. Documenting past experiences and lessons learned is crucial for informing preparedness efforts in anticipation of future public health emergencies. Failure to effectively address these things in the next public health emergency could result in a recurrence of declining routine childhood vaccinations.

ABSTRACT Background It is important to be able to predict, for each individual patient, the likelihood of later metastatic occurrence, because the prediction can guide treatment plans tailored to a specific patient to prevent metastasis and to help avoid under- or over-treatment. Deep Neural Network (DNN) learning, commonly referred to as deep learning, has become popular due to its success in image detection and prediction, but questions such as whether deep learning outperforms other machine learning methods when using non-image clinical data remain unanswered. Grid search has been introduced to deep learning hyperparameter tunning for the purpose of improving its prediction performance, but the effect of grid search on other machine learning methods are under-studied. In this research, we take the empirical approach to study the performance of deep learning and other machine learning methods when using non-image clinical data to predict the occurrence of breast cancer metastasis (BCM) 5, 10, or 15-years after the initial treatment. We developed DNN models as well as models using 9 other machine learning methods including Naive Bayes (NB), Logistic Regression (LR), Support Vector Machine (SVM), LASSO, Decision Tree (DT), k-Nearest Neighbors (KNN), Random Forrest (RF), AdaBoost (ADB), and XGBoost (XGB). We used grid search to tune hyperparameters for all methods. We then compared the deep learning models to the models trained using the 9 other machine learning methods. Results Based on the mean test AUC results, DNN ranks 6th, 4th, and 3rd when predicting 5-year, 10-year, and 15-year BCM respectively, out of 10 machine learning methods. The top performing methods in predicting 5-year BCM are XGB(1^st), RF(2^nd), and KNN(3^rd). For predicting 10-year BCM the top performers are XGB (1^st), RF(2^nd), and NB(3^rd) . Finally, for 15-year BCM the top performers are SVM (1^st), LR and LASSO (tied for 2^nd), and DNN (3^rd). The ensemble methods RF and XGB outperform other methods when data are less balanced, while SVM, LR, LASSO, and DNN outperform other methods when data are more balanced. Our statistical testing results show that at a significance level of 0.05 DNN overall performs no worse than other machine learning methods when predicting 5-year, 10-year, and 15-year BCM. Conclusions Our results show that deep learning with grid search overall performs at least as well as other machine learning methods when using non-image clinical data. It is interesting to note that some of the other machine learning methods such as XGB, RF, and SVM are very strong competitors of DNN when incorporating grid search. It is also worth noting that the computation time required to do grid search with DNN is way more than that required to do grid search with the other 9 machine learning methods.

Based on panel data of 31 provincial-level administrative units (excluding Hong Kong, Macao and Taiwan) in China from 2015 to 2019, using fixed effect model and mediation effect model, this paper makes an empirical analysis on the interaction among digital economy, industrial structure upgrade and high-quality economic development. The results show that, from the overall effect, the digital economy can significantly promote the high-quality development of the economy, and there are regular regional differences, and the relationship between the promotion intensity and the development level of the digital economy is proportional. From the mediation effect, in the relationship between digital economy and high-quality economic development, the upgrade of industrial structure has played a significant part of the mediation effect, the proportion of mediation effect is 25.17% . In addition, the mediation effect of industrial structure upgrade has obvious regional difference, the western area is the strongest, the eastern area is the second, the central area is the weakest. Based on the above research,the concrete policy suggestions are given to promote the development of digital economy and upgrade the level of industrial structure to promote the high-quality development of economy.

Examining the similarity of event environments or surroundings, more precisely settings, provides additional insight in analyzing event sequences as it provides information about the context and potential common factors that may have influenced them. This article proposes a new similarity measure for event setting sequences, which involve the space and time in which events occur. While similarity measures for spatiotemporal event sequences have been studied, the settings and setting sequences have not yet been studied. While modeling event setting sequences we consider spatial and temporal scales to define the bounds of the setting and incorporates dynamic variables alongside static variables. Using a matrix-based representation and an extended Jaccard index we developed new similarity measures that allow for the use of all variable data types. We successfully used these similarity measures coupled with other multivariate statistical analysis approaches in a case study involving setting sequences and pollution event sequences associated with the same monitoring stations, which validate the hypothesis that more similar spatial-temporal settings or setting sequences may generate more similar events or event sequences. In conclusion, these similarity measures have many potential real-world applications, and offer researchers a powerful tool for understanding different factors and their dynamics corresponding to occurrences of spatiotemporal event sequences.

This study empirically examines the spatial spillover effect of various environmental regulations on green technology innovation using panel data from 284 county-level cities in China between 2007 and 2019. A geographical-economic spatial weight matrix is constructed, and the spatial Durbin model is employed to identify the specific characteristics of this spillover effect. The findings indicate that the spatial spillover effect of green technology innovation primarily occurs through geographical transmission. However, there is no significant spatial autocorrelation when using the economic distance weight matrix. Various types of environmental regulations influence the spatial spillover effect of green technology innovation in distinct ways. Specifically, Market-motivated environmental regulation exhibits a U-shaped relationship with the spatial spillover effect, while Command-controlled environmental regulation demonstrates an inverted U-shaped relationship, suggesting a complementary effect. Additional research shows that the upgrading of industrial structure acts as a mediator between command environmental regulation and the spatial spillover effect of green technology innovation. Government departments should comprehensively coordinate Market-motivated environmental regulation and Command-controlled environmental regulation, accurately assess the intensity of Command-controlled measures, and prevent the migration of green technology innovation elements caused by excessive regulatory measures within enterprises.

In this study, seventeen faceted gem-quality chrysoberyls exhibiting an attractive canary yellow color were investigated by a series of gemological, spectral, and chemical methods. Microscopic observation reveals distinct growth lines and inclusions, including CO2 fluids, carbon, and mineral crystals such as calcite, quartz, sillimanite, and mica, identified by the Raman spectrum. The FTIR spectrum exhibits the 2405 and 2160 cm-1 feature peaks and a 3223 cm-1 peak in all samples, which can be accompanied by the 3112 cm-1 shoulder, 3301, and 3412 and 3432 cm-1 peaks. The UV-Vis spectrum shows a Fe-related peak at 440 nm, along with the 650–660 nm band and the absorption band in the blue zone of the visible light. The chemical results of EDXRF reveal a V-poor, Cr-poor, and Fe-rich feature. The spectral and chemical results could contribute to explaining the origin of the canary yellow color, which originates from the abundant amount of Fe with very little influence from Cr or V.

The transportation of feed pellets via pneumatic conveying plays an improtant role in feed industry. In recent years, many efforts are made both exprimentally and numerically to gain a better understanding of the underlying mechanism for pneumatic conveying. Though few of those research is directly related to feed pellets, it can be beneficial to draw a full picture of rencent development in pneumatic conveying, with emphasis on aspects extendable to feed transportation. This paper reviews first the major factors concerning feed pellets pneumatic conveying, such as particle breakage, pipe wear and electrostatic. Building on that, new advancement including emerging new technologies in experiments and simulations are discussed, with a focus on the experimental measurements and mathematical models, repectively. The needs for future research and the analogy to feed pellets tranportation is given lastly.

Real-time object detection remains a pivotal topic in the realm of computer vision. Balancing the accuracy and speed of object detectors poses a formidable challenge for both academic researchers and industry practitioners. While recent transformer-based models have showncase the prowess of the attention mechanism, delivering remarkable performance improvements over CNNs, their computational demands can hinder their effectiveness in real-time detection tasks. In this paper, we elect to use YOLOX as our robust starting point and introduce a series of effective enhancements, culminating in a new high-performance detector named YOLOAX. To further exploit the power of the attention mechanism, we devise multi-dimensional attention-based modules that activate CNNs, emphasizing the most pertinent regions and bolstering the capacity to learn the most informative image representations from feature maps. Moreover, we introduce a novel leading label assignment strategy called STA, along with a groundbreaking loss function named GEIOU Loss, to further refine our detector's performance. We provide extensive ablation studies on the COCO and PASCAL VOC 2012 detection datasets to validate our proposed methods. Remarkably, our YOLOAX is trained solely on the MS-COCO dataset from scratch, without leveraging any prior knowledge, which achieves an impressive 54.2% AP on the COCO 2017 test set while maintaining a real-time speed of 72.3 fps, surpassing YOLOX by a significant margin of 3.0% AP. Our source code and pre-trained models are openly accessible at https://github.com/KejianXu/yoloax.