Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

Multicellular organisms organize themselves according to two principles; first, the equilibrium between the driving force of unstable state cells and apoptosis or senescence; and second, the mutual equilibrium between the functional requirements of different types of cells. For the first principle, we deduce that stem cells at different levels have their own growth limits, which are determined by two factors: the ability of the stem cells to enter an unstable state (specifically, the ability of cells to divide and differentiate); and the rate of cellular senescence, loss of function, and finally, apoptosis. The superposition of stem cell limits at different levels over each other can amplify small differences at the genetic level. Moreover, the growth limits of different organs are different, which lead to different individuals having completely different appearances. The second principle is that the sum of the specific output functions of an organ must be equal to the overall demand for the function to be provided by the organ. If negative entropy input can meet this equilibrium, defects in certain genes will cause these defective individuals to become larger or develop other morphology.

In this paper, we investigate a class of hierarchical variational inequalities (HVIPs, i.e., strongly monotone variational inequality problems defined on the solution set of multiple-set split common fixed point problems) with quasi-pseudocontractive mappings in real Hilbert spaces, which special cases can be found in many important engineering practical applications such as image recognizing, signal processing and machine learning. In order to solve HVIPs of potential application value, inspired by the primal-dual algorithm, we propose a novel accelerated cyclic iterative algorithm that combines the inertial method with a correction term and a self-adaptive step-size technique. Our approach eliminates the need for prior knowledge of the bounded linear operator norm. Under appropriate assumptions, we establish strong convergence of the algorithm. Finally, we apply our novel iterative approximation to solve multiple-set split feasibility problems and verify the effectiveness of the proposed iterative algorithm through numerical results.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

In terahertz communication systems, lens antennas used in transceivers are basically plano-convex dielectric lenses. As the aperture increases and the focal length decreases, the thickness and mass of the plano-convex lens increase rapidly. Through theory and simulation, we designed a Fresnel lens suitable for the terahertz band to meet the requirements of large aperture and short focal length, and simulated the performance, advantages and disadvantages of the terahertz Fresnel lens. A 300GHz terahertz wireless communication system was built to verify the gain effect of the Fresnel lens antenna. The experimental results show that the Fresnel lens can amplify the signal in the terahertz band. The theoretical gain of a 30 cm Fresnel lens is 48.83dB, while the actual measured gain is approximately 45dB.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

(1) Background: in the context of sustainable development goals (SDGs), this work explores the repair direction of future cultivated land protection policies based on the Smith policy implementation model from the historical evolution to ensure that the cultivated land protection policy does not deviate during the implementation process. (2) Methods: this paper uses literature research and inductive deduction methods to sort out the evolution process of Chinese cultivated land protection policy, summarize the successful experience of transferring the focus of cultivated land protection in chronological order, and conclude the repair direction of Chinese cultivated land protection. (3) Results: although the Chinese cultivated land protection policy in the historical evolution has through three significant phases, there are still certain issues in the development trend of Chinese cultivated land protection policy based on regional division of labor for grain transportation and sales. (4) Conclusion: directly utilizing feedback from farmers as stakeholders will contribute to the maturity and improvement of cultivated land protection policies in the specific implementation of cultivated land protection policies.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

A real-time two-way direct load control (TWDLC) of central air-conditioning chillers in wide area is proposed to provide demand response. The proposed TWDLC scheme is designed to optimize the load shedding ratio of every customer under control to ensure the target load to be shed is met at every scheduling period. In order to overcome the load reduction uncertainties of TWDLC, an innovative solution is proposed by applying a certain degree of loosening on the constraint of the actual shed load. Fuzzy linear programming is utilized to solve the optimization problem with fuzzy constraints. The proposed fuzzy linear programming problem is solved by delicately transforming it into a regular liner programming problem. A selection scheme used to obtain the feasible candidates set for load shedding at every sampling interval of TWDLC is also designed along with the fuzzy linear programming.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

Reconstructing 3D indoor scenes from 2D images has always been an important task in computer vision and graphics applications. For indoor scenes, traditional 3D reconstruction methods suffer from the lack of surface details, poor reconstruction of large flat surface textures and areas with uneven lighting, and many falsely reconstructed floating debris noises in the reconstructed models. We add adaptive normal priors to the neural implicit reconstruction process to optimize the network, and improve the accuracy of volume density prediction by adding regularization terms to the neural radiation field to constrain the volume density obtained by weight distribution, and learn a smooth SDF surface from the network to obtain an explicit mesh model. Experiments show that the method proposed in this paper outperforms the state-of-the-art methods on ScanNet, Hypersim, and Replica datasets.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

Multi-wire saw machining (MWSM) used for slicing hard-brittle materials in semiconductor, is an important material removal process that uses free abrasives. Cutting model of single-wire saw machining (SWSM) is the basis of MWSM, and the material removal mechanism of SWSM can better understand than MWSM. Mathematical model (includes brittle fracture and plastic deformation) is presented in this paper for SWSM ceramic with abrasives. This paper determines the effect of various machining parameters on the removal of hard-brittle materials. For brittle fracture of SWSM ceramics, the minimum of the strain energy density is used as a fracture criterion. The material removed of SWSM ceramics due to plastic deformation is calculated using the equations of motion. Actual wire-sawing experiments are conducted to verify the results from the developed mathematical model. Theoretical results agree with experimental data and practical experience. The developed mathematical model shows that brittle fracture plays a major concern role in material removed of SWSM ceramics. Wire speed and working load have positively correlated with material removed of SWSM ceramics. The coefficient of friction is low, a lateral crack, which propagates almost parallel to the working surface, leads to more brittle fracture and material removed is increased on SWSM ceramics.

IoT is a computational perception that defines a situation, where smart objects are interconnected to the internet/ network. In the last few years, IoT objects have increased in all sectors/ fields and use in all domains of our lives. As the number of devices increases, the privacy of data becomes an important issue. To deal with this issue different techniques have been used by researchers in this field. Unfortunately, these methods have less traceability, privacy of data, and accountability. This paper aims to design a blockchain-based network architecture for Traceability, Data privacy, and Accountability (TDA). Technologies of blockchain are known as a distributed ledger of transactions record, which record the life span information with a timestamp. The major features of blockchain are persistency, decentralization, and audibility. These features help to decrease the budget and increase efficiency. Moreover, to strengthen the TDA architecture, this paper also discusses the performance of the proposed architecture.

Thyroid nodules (TNs) are common thyroid lesions in older population. Few studies focused on the prevalence of TNs and its relationship to lifestyle characteristics and dietary habits in centenarians. The current study aimed to determine the prevalence of TNs in Chinese centenarians using high-resolution ultrasound equipment and investigate its relationship to lifestyles and dietary habits. The current study was part of China Hainan Centenarian Cohort Study (CHCCS) which conducted in Hainan, an iodine sufficient region in China. A total of 874 permanent residents aged 100 years or older (mean age, 102.8 ± 2.8 years) without any missing data were included in the analysis. Among the participants, 649 of them were detected at least one thyroid nodule under the ultrasound examinations. The overall prevalence rate of TNs was 74.3%. The prevalence of TNs was higher in participants who were females, hypertension, diabetes, and underweight than their counterparts. Multivariate logistic regression analyses showed that being female, hypertension, diabetes, betel quid consumption, red meat consumption were independent risk factors, while being underweight, and nut consumption were independent protective factors for TNs. Our findings indicate that the presence of thyroid nodules was highly prevalent in Chinese centenarians, particularly in females. In addition to gender, hypertension, diabetes, and underweight, the presence of TNs was independently associated with betel quid, red meat, and nut consumptions. Further prospective studies are warranted to verify these associations in population from different age strata, races, cultures, and iodine backgrounds.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

The theory of the continuous two-dimensional (2D) Fourier Transform in polar coordinates has been recently developed but no discrete counterpart exists to date. In the first part of this two-paper series, we proposed and evaluated the theory of the 2D discrete Fourier Transform (DFT) in polar coordinates. The theory of the actual manipulated quantities was shown, including the standard set of shift, modulation, multiplication, and convolution rules. In this second part of the series, we address the computational aspects of the 2D DFT in polar coordinates. Specifically, we demonstrate how the decomposition of the 2D DFT as a DFT, Discrete Hankel Transform (DHT) and inverse DFT sequence can be exploited for efficient code. We also demonstrate how the proposed 2D DFT can be used to approximate the continuous forward and inverse Fourier transform in polar coordinates in the same manner that the 1D DFT can be used to approximate its continuous counterpart.

This manuscript proposes a novel tangent-graph-based method that provides all distinctive topology paths, as a set of trajectories that can not be transformed into each other by gradual bending and stretching without colliding with obstacles. As the global optimal trajectory (limited by dynamic constraints) may not correspond to the shortest path (almost without dynamic constraints), it is important to provide all distinctive topology paths rather than just the globally shortest one. One of the application is provide initial paths for trajectory planning methods, such as time elastic band (TEB) and dynamic window approach (DWA). Considering that a mobile platform is always working in a dynamic changing environment and that update the whole graph is time consuming, a dynamic rectify method is proposed to update tangents according to local map provided by sensor reading. Finally, results under real grid maps are presented.

Path planning in 3D environment is a fundamental research area for robots and autonomous vehicles. Based on the principle ``the shortest path consists of tangents'', RimJump* is proposed as a tangent-based path planning method suitable for finding the shortest path (both off-ground and on-ground) in 3D space (e.g., octomap and point cloud) for mobile platform to follow. RimJump* searches the tangent graph in the form of a path tree and considers the geometrical properties of the locally shortest path. Therefore, the method can provide all of the locally shortest paths that connect the starting point and the target, including the globally shortest path. And the time cost of RimJump* is insensitive to map scale increases in comparison to methods that search the whole passable space rather than the surface of the obstacle, e.g., Dijkstra and A*. In the Results, RimJump* is compared with other methods in terms of path length and time cost.

The rapid advancement of technology has led to increased electronic consumption and a corresponding rise in e-waste generation. To address this issue, this study develops a low-carbon e-commerce closed-loop supply chain (LCE-CLSC) system with remanufacturer, platform, and the government as key stakeholders. An evolutionary game approach is employed to investigate the system's dynamics, analyzing the impact of stakeholder strategies on system equilibrium. Numerical simulations reveal important findings: Firstly, government initiatives promoting recycling, carbon taxes on traditional products, can incentivize remanufacturers to produce low-carbon items and encourage platform investment in recycling services. Secondly, higher sales revenues motivate remanufacturers to produce low-carbon products. Thirdly, consumer sensitivity to recycling services strengthens waste recovery when platforms increase investments in these services, leading to remanufacturers choosing low-carbon production. Lastly, government subsidies may become ineffective if the cost of remanufacturers' carbon reduction and platforms' recycling services exceeds their affordability. These findings offer insights for the sustainable development of obsolete electronic product recycling systems.

This study aims to exploit the distinctive properties of carbon nanotube materials, which are particularly pronounced at the microscopic scale, by deploying fabrication techniques that allow their features to be observed macroscopically. Specifically, we aim to create a semiconductor device that exhibits flexibility and the ability to modulate its electromagnetic wave absorption frequency by means of biasing. Initially, we fabricate a sheet of carbon nanotubes through a vacuum filtration process. Subsequently, phosphorus and boron elements are separately doped into the nanotube sheet, enabling it to embody the characteristics of a PN diode. Measurements indicate that, in addition to the fundamental diode's current-voltage relationship, the device also demonstrates intriguing transmission properties under the TEM mode of electromagnetic waves. It exhibits a frequency shift of approximately 2.3125 GHz for each volt of bias change. The final result is a lightweight and flexible carbon-based semiconductor microwave filter, which can conform to curved surfaces. This feat underscores the potential of such materials for innovative and effective electromagnetic wave manipulation.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

In this study, the apparent variation range of acoustical parameters were investigated in a concert hall. The initial time delay gap (ITDG) was evaluated in terms of its just noticeable difference (JND) through two instruments, the cello and the trumpet. Even though the IDTG values were prolonged over the measurements and were not significantly varied, an ITDG range of 22 - 220 ms in increments of 91 steps was produced electro-acoustically in an anechoic chamber with a loudspeaker. The result of JNDc ((delta gap/gap) was rated 0.059 and 0.081 at 50% “different” judgement ranges for the cello and trumpet tracks, respectively. The effective duration of the autocorrection function (ACF) of the continuous brainwaves (CBWs) within the alpha (8-13 Hz) frequency range on the left hemisphere responding to 91-step ITDG increments revealed that the continuous ratio minimum Tauee e of CBW was approximately equal to 0.28 s on the trumpet. The continuous ratios of Tauee e_min ((Tauee e_min_rear - Tauee e_min_front)/ Tauee e_min_front) of CBWs were constantly at 0.4. Furthermore, a homologous period of resonance between the subjective JNDc and Tauee e values of the ACF of CBWs in the alpha range allowed us to conclude that the subjective JND of the ITDG in a room is related to the W_IACC value of the interaural cross-correlation function, which reflect the characteristics of source signal themselves and arouse the activities of brain on the right hemisphere (p < 0.01).

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

This study uses a mass-spring-damping system to simulate the repeated strain of liquefaction cyclic triaxial tests. The two results are compared in this paper to understand the feasibility of the mass-spring-damping system developed in this paper and the feasibility of future research on this related topic and development potential. The main factors affecting this mode's repeated strain are the spring coefficient k and the external force Q0. The spring coefficient has an inverse relationship but does not increase in multiples. The external force has a direct proportional relationship but does not increase the result- a non-multiple increase. When the pore water pressure of the liquefied cyclic triaxial test specimen rises, it will cause the specimen to liquefy, decreasing effective stress, shear modulus G, and damping ratio D, causing an increase in strain. The shear modulus and damping ratio are related to the spring coefficients k and c. Both are variables that change with time. This article takes an original thin-tube specimen at point A in the Yunlin area in Taiwan as a testing example. Through Mathematica software, it can be obtained that the mass m=1kg, the spring coefficient k=244e-0.1t kgf/cm, and the damping coefficient c=0.739e-0.257t kgf-s/cm and external force Q0=10.1sin2πt kg; Finally, this study selected the original thin-tube specimens from four locations in the Yunlin area, and simulated the repeated strain amount of the cyclic triaxial test specimens through a spring-damping system. The results show that the spring-damping system is feasible for simulated cyclic triaxial tests because the model is simple and the parameters are easy to understand and obtain, which also shows the extensibility of this model. Preliminary results of the research show that this model can further simulate the repeated strain obtained by cyclic triaxial tests without considering the increased trend in pore water pressure and the decrease in effective stress during cyclic loading.

In order to cope with the challenges of physical and psychological aging in the indigenous people in Taiwan, most of the tribes in Taiwan set up cultural health stations for indigenous elderly. These community care facilities have practiced many health promotion activities, such as the reminiscence, life review, and arts activity. However, there was little exploration into the benefit of indigenous people’s practice the life review activity in Taiwan—the gap this study aimed to fill. This study adopts life review therapy through a set of innovative life review activity designs in indigenous older adults, including activity planning, and indigenous cultural elements. A qualitative study design using semi-structured interviews was used to obtain data from a purposive sample. Ten participants who assessed to the cultural health stations services and participated in the life review activities of the indigenous older adults in southern Taiwan were interviewed individually. The data were analyzed using Graneheim and Lundman’s qualitative content analysis. The theme—“experiences and benefits of participating”—and two categories with six subcategories emerged. The results demonstrated that the participation of the indigenous elderly in life review activities with cultural elements had obvious benefits for their mental health. Life review therapy can be incorporated as a supplementary LTC treatment for the indigenous people, thereby, promoting the positive emotions of the indigenous elderly.

Developing and utilising of underground space is an vital direction for urban growth. Underground commercial streets, as a significant component of underground space accommodating extensive human social activities, and consequently necessitate the creation of human-scale spaces. In the evolution of urban design development towards greater refinement, applying architectural theories and excessively subjective designs has resulted in a deficiency of human-centered design and a disordered spatial environment. This study merges environmental psychology and architectural theory to determine the appropriate length of spatial scale. Two experiments focusing on spatial perception evaluation were conducted using a virtual experimental platform that featured varying dimensions of spatial scale combinations. These quantified combinations were correlated with perception evaluation, and regression analysis was employed to identify appropriate scale ranges, which were superimposed on the range of length selection. Finally, the optimal length and scale combination for underground commercial street spaces were established, providing a reference for the human-centered design of these environments.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

A fluorescent probe, N'-((3-methyl-5-oxo-1-phenyl-4, 5-dihydro-1H-pyrazol-4-yl) methylene)-2-oxo-2H-chromene-3-carbohydrazide (MPMC), was synthesized and characterized. Characterizations of the synthetic MPMC were conducted by proton nuclear magnetic resonance (1HNMR) spectroscopy and carbon-13 nuclear magnetic resonance spectroscopy (13C NMR). The fluorescence emission behaviors of probe MPMC towards diverse metal ions were detected and the probe exhibited high sensitivity and selectivity towards Cu2+ over other metal ions via quenching of its fluorescence. Furthermore, the existence of other metal actions made no difference on the fluorescence intensity of the MPMC-Cu2+ system apparently, that is, MPMC displayed a good anti-interference ability. Job’s plot of MPMC and copper ions indicated the detection limit was 15.16 nM (R2=0.9612) for the assayed actions, with a stoichiometric ratio of 1:1 for MPMC and Cu2+. Additionally, the color of MPMC probe solution changed from nearly colorless to yellow in the presence of Cu2+ in visible light, which the color change could be observed by the naked eye. Similarly, the color resolved bright yellow into blue in ultraviolet light. Also reusability studies indicated that MPMC probe was reusable. The pH effect of probe MPMC to Cu2+ had a broad range of pH detection 4.0 to 11.0. The response time of MPMC probe for determining Cu2+ was within 1 min. The recognition of Cu2+ by MPMC performed on pre-treated paper under sunlight and UV light both had a distinct colour change. Thus, the solid-state method for detecting Cu2+ with the naked-eye, was both economical and convenient.

Estimating the ocean’s subsurface thermohaline information from satellite measurements is essential for understanding ocean dynamics and El Niño phenomenon. This paper proposes an improved double-output Residual Neural Network (DO-ResNet) model to concurrently estimate the ocean subsurface temperature (OST) and ocean subsurface salinity (OSS) in the tropical Western Pacific using multi-source remote sensing data, including sea surface temperature (SST), sea surface salinity (SSS), sea surface height anomaly(SSHA), sea surface wind (SSW), and geographical information (including longitude (LON) and latitude (LAT)). In the model experiment, Argo data were used to train and validate the model, and the root mean square error (RMSE), normalized root mean square error (NRMSE) and coefficient of determination (R²) were employed to evaluate the model's performance. The results showed that the sea surface parameters selected in this study have a positive effect on the estimation process, and the average RMSE and R² values for estimating OST (OSS) by the proposed model are 0.34 °C (0.05 psu) and 0.91 (0.95), respectively. Under the data conditions considered in this study, DO-ResNet demonstrates superior performance relative to the extreme gradient boosting model, random forest model, and artificial neural network model. Additionally, this study evaluates the model’s accuracy by comparing its estimations of OST and OSS across different depths with Argo-derived data, demonstrating the model's ability to effectively capture the most spatial features, and by comparing NRMSE across different depths and seasons, the model displays strong seasonal adaptability. In conclusion, this research introduces a novel artificial intelligence technique for estimating OST and OSS in the tropical Western Pacific Ocean.

Reasonable allocation of production plans and saving the overall electricity cost are crucial for large manufacturing conglomerates, which is an effective way for conglomerates to realize open-source and cost-saving. This paper develops an optimization model of off-site industrial production scheduling for enterprises in response to the problems of high electricity costs due to the irrational allocation of production schedules on the demand side of China's electric power and the difficulty of promoting industrial and commercial distributed photovoltaic (PV) projects in China. The model makes full use of the conditions of different PV resources and different electricity prices in different places to optimize the scheduling of industrial production in different places. The model is embedded with two sub-models of the electricity price prediction model and distributed photovoltaic kWh cost model to complete the model parameters, in which the electricity price prediction model utilizes the LSTM neural network. The integrated model is then solved by the particle swarm algorithm. To verify the effectiveness of the model in solving the problem of off-site production scheduling on the demand side of electricity, the research team researched two off-site pharmaceutical factories belonging to the same large pharmaceutical company. Finally, the research data were substituted into the model for solving, and it was concluded that the optimization model could significantly reduce the cost of electricity consumption of the enterprise by about 7.9 %.

Agriculture is an industry that heavily relies on the environment. The increasing frequency of ex-treme disasters attributable to climate change has adversely affected agricultural land and dis-rupted the stability of the supply of agricultural products. Therefore, we implemented a research program focused on current strategies for adapting to agricultural meteorological disasters. The primary goal was to actively promote disaster prevention information and techniques through information platforms and applications and to provide refined forecasting and an early warning system to enhance preparedness for and recovery from agricultural disasters. This initiative can transform passive mitigation into dynamic action by disseminating crucial information to farmers. We integrated meteorological data and crop characteristics to develop disaster prevention strate-gies for the predisaster, during-disaster, and postdisaster stages to empower farmers to implement autonomous disaster prevention, ensuring their profitability and minimizing the impact of disas-ters. This paper presents an agricultural disaster prevention system involving cross-disciplinary collaboration to establish an early warning system for crop disasters. However, the effectiveness of the early warning system relies on the availability of complete meteorological and crop infor-mation, necessitating high-density agricultural meteorological stations, refined weather forecast services, historical crop damage data, and ongoing research and development on disaster preven-tion technology. In the system, a diversified social media interface is used to provide local farmers with weather forecast information. When impending disasters are identified, the platform acti-vates disaster prevention measures to reduce agricultural losses. This article paper introduces Taiwan’s agricultural disaster prevention system as a complete disaster prevention strategy.

Taiwan's bed and breakfast (B&B) development has been more than 25 years ago, from the first generation of retirement to the B&B industry, serving tourists from all over the world accom-modation, providing breakfast and accommodation mode to the present, after the change of employees from the second generation, more and more attention is paid to the cultivation and cultivation of business ability. With the advent of the era of AI technology networking, the ca-pabilities required for B&B operation are more focused on all aspects of service, and the good marketing ability of B&B can promote a green chimney-free tourism economy, which is also a favorite industry of various governments and the public. This study explores the basic vocational competency indicators required for running a B&B, with (1)EQ emotion management skills, (2)Financial management ability, (3)(SK) technical skills, and (4)Marketing and promotion management capabilities. Through the study method, the K-S Z test was determined by the con-sensus conclusion of expert reliability and validity p value

Probiotics, known for regulating gut microbiota, may aid those with overweight or obesity, but their mechanisms require more research. This study involved 75 overweight or obese young adults, randomly assigned to either a Bifidobacterium brevis BBr60 group or a placebo group. Both groups received diet guidance and took either BBr60 (1×1010 CFU/day) or a placebo for 12 weeks. Re-searchers analyzed body composition, serum glucose, lipids, liver and kidney function, comprehensive metabolome, and intestinal homeostasis before and after the intervention. After 12 weeks, BBr60 significantly reduced weight and BMI compared to pre-treatment levels and outperformed the placebo. The BBr60 group also showed improved blood biochemistry, with notably lower fasting blood glucose (FBG) levels than the placebo group (p < 0.05). Additionally, BBr60 influenced vital serum and fecal metabolites related to three amino acid metabolic pathways and regulated the bacteria Dialister, Klebsiella, and Bacteroides, which correlated strongly with serum metabolites. These findings indicate that BBr60 can safely and effectively regulating BMI, body weight, serum glucose, lipids, and liver function markers, which may involve BBr60's impact on key gut bacteria, which influence metabolites related to the valine, leucine, and isoleucine biosynthesis; glycine, serine, and threonine metabolism; and alanine, aspartate, and glutamate metabolism.

YOLOv8, as an efficient object detection method, can swiftly and precisely identify objects within images. However, traditional algorithms encounter difficulties when detecting small targets in remote sensing images, such as missing information, background noise, and interactions among multiple objects in complex scenes, which may affect performance. To tackle these challenges, we propose an enhanced algorithm optimized for detecting small objects in remote sensing images, named HP-YOLOv8. Firstly, we design the C2f-D-Mixer (C2f-DM) module as a replacement for the original C2f module. This module integrates both local and global information, significantly improving the ability to detect features of small objects. Secondly, we introduce a feature fusion technique based on attention mechanisms, named Bi-Level Routing Attention in Gated Feature Pyramid Network (BGFPN). This technique utilizes an efficient feature aggregation network and reparameterization technology to optimize information interaction between different scale feature maps, and through the Bi-level Routing Attention (BRA) mechanism, it effectively captures critical feature information of small target objects. Finally, we propose the Smooth Mean Perpendicular Distance Intersection over Union (SMPDIoU) loss function. The method comprehensively considers the shape and size of detection boxes, enhances the model's focus on the attributes of detection boxes and provides a more accurate bounding box regression loss calculation method. To demonstrate our approach's efficacy, we conduct comprehensive experiments across the RSOD, NWPU VHR-10, and VisDrone2019 datasets. The experimental results show that the HP-YOLOv8 achieves 95.11%, 93.05%, and 53.49% in the [email protected] metric, and 72.03%, 65.37%, and 38.91% in the more stringent [email protected]:0.95 metric, respectively.

In order to reduce the silique shattering loss of rapeseed mechanical harvesting process, based on the state of force on the silique during rapeseed harvesting reel branch, Ningza 1810, Zhenyou 8 and Fengyou 306 were used as research objects, and the experimental research on the factors affecting rapeseed siliques shattering was carried out using the swing impact method. The experimental analysis showed that: rapeseed varieties, silique moisture content, silique growth position, collision material, impact speed, force position and other factors had significant effects on silique shattering. The impact velocity was less than 1.5m·s-1, the difference on the effect of each factor on pod-shattering was not significant, it was not easy to shatter when the moisture content of rapeseed silique was higher. The impact resistance of the front side of rapeseed was 2 to 4 times that of the bonding surface of rapeseed petals, the shattering rate of the top rapeseed silique was twice that of the bottom siliques, when siliques were supported, they were more likely to shatter under external forces than when they were unsupported. The experimental study of the mechanical properties of rapeseed siliques was carried out using the impending fracture method, the experimental analyses showed that the support position and force position of the silique, the loading speed and the growth position of the silique had a significant effect on the mechanical properties of the silique. The maximum cracking force was higher and bending strength was stronger when the body of the silique was supported, which the range of the maximum cracking force were 3.05N to 4.16N, and the bending strength range were 8.48 MPa to 11.57 MPa. The maximum cracking force and bending strength of the silique was stronger when the front side of the silique petal was pressurized than when the bonding surface of the petal was pressurized. Based on Pearson's correlation and grey correlation analysis, the morphological characteristics of rapeseed siliques were ranked in order of their influence on the performance of siliques in terms of the angle between silique and stalk, stalk diameter, petal thickness, beak length, silique thickness, silique width and silique length. This study can be used as a reference for the design and optimization of the rapeseed harvesting reel branch mechanism and the selection of machine harvestable rapeseed varieties.

High-rise building fires pose a serious threat to the lives and property safety of the people. The lack of reliable and accurate positioning means is one of the main difficulties faced by rescue. In the absence of prior knowledge of the high-rise building fire environment, the coverage deployment of mobile base stations is a challenging problem that has not received much attention in the literature. This paper studies the problem of autonomous optimal deployment of base stations in high-rise building fire environment based on UAV group. A novel problem formulation is proposed that solves the non line of sight (NLOS) positioning problem in complex unknown environment. The purpose of this paper is to realize the coverage and deployment of mobile base stations in complex and unknown fire environment. The NLOS positioning problem in the fire field environment is turned into the line of sight (LOS) positioning problem through the optimization algorithm. And there are more than three LOS base stations nearby any point in the fire field. A control law which is formulated in a mathematically precise problem statement is developed that guarantees to meet mobile base stations deployment goal and to avoid collision. Finally, positioning accuracy of our method and that of common method were compared. The simulation result showed that the positioning accuracy of simulated firefighter in the fire field environment was improved greatly.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

Quantifying the landscape pattern change can effectively demonstrate the ecological progresses and the consequences of urbanization. Based on remotely sensed land cover data in 1994, 2000, 2006 and a gradient analysis with landscape metrics at landscape- and class- level, we attempted to characterize the individual and entire landscape patterns of Shanghai metropolitan during the rapid urbanization. We highlighted that a roadscape transect approach that combined the buffer zone method and the transect-based approach was introduced to describe the urban-rural patterns of agricultural, residential, green, industrial, and public facilities land along the railway route. Our results of landscape metrics showed significant spatiotemporal patterns and gradient variations along the transect. The urban growth pattern in two time spans conform to the hypothesis for diffusion–coalescence processes, implying that the railway is adaptive as a gradient element to analyze the landscape patterns with urbanization. As the natural landscape was replaced by urban landscape gradually, the urban fringe expanded radically. The results also showed that the desakota region expanded its extent widely. Satellite towns witnessed the continual transformation from the predominantly rural landscape to peri-urban landscape. Furthermore, the gap between urban and rural areas remained large especially in public service. More reasonable urban plans and land use policies should push to make more of an effort to transition from the urban-rural separation to coordinated urban-rural development. This study is a meaningful trial in demonstrating a new form of urban–rural transects to study the landscape change of large cities from a strategic viewpoint. By combining gradient analysis with landscape metrics, we addressed the process of urbanization both spatially and temporally, and provided a more quantitative approach to urban studies.

The potential effect of implementing environmental regulations on economic growth is a controversial issue for a long time. As portrayed by Porter hypothesis, environmental regulations may impact on economic growth by reconstructing the economic structure. A number of previous literature proved the connections between the above three parties. With the intention of exploring the nature of this mechanism, it is important to understand the internal inter-relation of the three parties, requiring data from a large economy experiencing the transition in economic structure. By constructing a panel containing data from 30 Chinese provinces over 10 years (2008-2019), this paper investigate the dynamic inter-relation of the three parties by introducing PVAR model with Granger Test. Results reveal that environmental regulations give a “U” shaped impact to economic growth. In return, economic growth promotes the development of economy with a weakening strength. In addition, results also support the hypothesis that economic structure is the intermediate of economic growth and environmental regulations. There is a rooftop for the effect of economic structure to environmental regulations. The rooftop may signify the best optimization of primary structure.

Epigallocatechin-3-gallate (EGCG) is the most abundant polyphenol in green tea. In this study, the effects of dietary EGCG on oxidative stress and the metabolism and toxicity of acetaminophen in liver were investigated. Rats were fed the diets with (0.54 %) or without EGCG supplementation for four weeks and were then intraperitoneally injected with acetaminophen (1g/kg). Results showed EGCG lowered hepatic oxidative stress and cytochrome P450 (CYP) 1A2, 2E1, and 3A, and UDP-glucurosyltransferase activities prior to acetaminophen injection. After acetaminophen challenge, the elevations in plasma alanine aminotransferase activity and histological changes in liver were ameliorated by EGCG treatment. EGCG reduced acetaminophen-induced apoptosis by increasing the Bax/Bcl2 ratio in liver. EGCG mildly increased autophagy by increasing the LC3B II/I ratio. Lower hepatic acetaminophen-glutathione and acetaminophen-protein adducts contents were observed after EGCG treatment. EGCG increased glutathione peroxidase and NAD(P)H quinone 1 oxidoreductase activities and reduced organic anion-transporting polypeptides 1a1 expression in liver after acetaminophen treatment. Our results indicate that EGCG may lower oxidative stress and reduce the metabolism and toxicity of acetaminophen. The reductions in CYP-mediated acetaminophen bioactivation and uptake transporter, as well as enhanced antioxidant enzyme activity, may limit the accumulation of toxic products in liver and thus lower hepatotoxicity

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

Like traditional single label learning, multi-label learning is also faced with the problem of dimensional disaster.Feature selection is an effective technique for dimensionality reduction and learning efficiency improvement of high-dimensional data. In this paper, Logistic regression, manifold learning and sparse regularization were combined to construct a joint framework for multi-label feature selection (LMFS). Firstly, the sparsity of the eigenweight matrix is constrained by the $L_{2,1}$-norm. Secondly, the feature manifold and label manifold can constrain the feature weight matrix to make it fit the data information and label information better. An iterative updating algorithm is designed and the convergence of the algorithm is proved.Finally, the LMFS algorithm is compared with DRMFS, SCLS and other algorithms on eight classical multi-label data sets. The experimental results show the effectiveness of LMFS algorithm.

Variable flow emitters are a new type of emitter for underground drip irrigation that are used in locations where soil moisture is difficult to transport to the surface, which leads to crop emer-gence difficulties. The flow channel structure parameters of emitters affect the hydraulic per-formance of the emitter and its anticlogging ability. In this study, the variable flow emitter at the conventional low–flow water supply stage is taken as the research object. A combination of CFD numerical simulation of a two–phase flow of water and sand and clear water testing of test samples is applied to study the influence laws of 10 groups of variable flow emitter structural combinations on the effluent flow rate (q), flow index (x), particle passage rate and flow field inside the flow channel. The results show that the Realizable k–ε turbulence model can be used to simulate the flow field inside the variable flow emitter flow channel. The nRMSE between the measured and simulated values of q is 11.23%, and the relative error between the measured and simulated values of x is 4.66%, which gives a high simulation accuracy. The polar analysis shows that the tooth angle A has the smallest effect on the effluent flow rate q0.1 under 0.1 MPa, x, and particle passage rate of the variable flow emitter. The depth of the flow channel D, the spacing of the teeth B, and the height of the teeth E have a different order of precedence in the influence of the three indices, which are D > B > E > A, B > E > D > A, and E > B > D > A, respectively. The value of particle passage rate is positively correlated with the mean flow velocity (v) and the mean turbulent kinetic energy (k) in the flow channel, and particle passage rate tends to increase and then decrease with the increase of x. The retention time (t) of the particles in the flow channel is closely related to the magnitude of v and k. Three multivariate linear regression equations (R2 = 0.883 ~ 0.995) were constructed for q0.1, x, and particle passage rate versus the flow channel structural parameters. Using the scipy.optimize.minimize function in Python, we de-termined the three optimal combinations of flow channel structural parameters corresponding to better hydraulic performance: q0.1 is 1.5 or 2 L/h (objective function y = min x), better clogging resistance (y = max particle passage rate), and both (y = min (0.5 x - 0.5 particle passage rate)). The research results can provide a ref-erence for the optimal design of variable flow emitters.

In the context of global climate change, the frequency of sudden natural disasters is increasing. Assessing traffic road damage post-disaster is crucial for emergency decision-making and disaster management. Traditional ground observation methods for evaluating traffic road damage are limited by the timeliness and coverage of data updates. Relying solely on these methods does not adequately support rapid assessment and emergency management during extreme natural disasters. Social media, a major source of big data, can effectively address these limitations by providing more timely and comprehensive disaster information. Motivated by this, we utilized multi-source heterogeneous data to assess the damage to traffic roads under extreme conditions and established a new framework for evaluating traffic roads in cities prone to flood disasters caused by rainstorms. The approach involves several steps: First, extracting the surface area affected by precipitation using a threshold method constrained by confidence intervals derived from microwave remote sensing images; Second, collecting disaster information from the Sina Weibo platform, where social media information is screened and cleaned. A quantification table for road traffic loss assessment was defined, and a social media disaster information classification model combining text convolutional neural networks and attention mechanisms was proposed (TextCNN-Attention Disaster Classification); Finally, matching traffic road information on social media with basic geographic data, visualizing the classification of traffic road disaster risk levels, and completing the assessment of traffic road disaster levels based on multi-source heterogeneous data. Using the "7.20" rainstorm event in Henan Province as an example, this study categorizes the disaster impact on traffic roads into five levels: particularly severe, severe, moderate, mild, and affected, as interpreted from remote sensing images. The evaluation framework for flood disaster traffic roads based on multi-source heterogeneous data provides important data support and methodological support for enhancing disaster management capabilities and systems.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

This paper presents a compact wideband circularly polarized cross dipole antenna with low-pass filter response. It consists of two pairs of folded crossed dipole arms printed separately on both sides of the top substrate, and the two dipole arms on the same surface are connected by an annular phase-shifting delay line to generate circular polarization. A bent metal square ring and four small metal square rings around the cross dipoles are employed to introduce new resonant frequencies, effectively extending the impedance and axial ratio bandwidth. Four square patches printed on the middle substrate are connected to the ground plane by the vertical metal plates, in order to reduce the antenna height. Thus, a compact wideband circularly polarized antenna is realized. In addition, a transmission zero can be introduced at the upper frequency stopband by the bent metal square rings, without using extra filter circuits. For verification, the proposed model is implemented and tested. The overall size of the model is 90mm×90mm×33mm(0.37λ0×0.37λ0×0.14λ0, λ0 denotes the center operating frequency). The measured impedance bandwidth and 3 dB axial ratio bandwidth are 53.3% and 41%, respectively. More than 15 dB upper-band radiation suppression level is realized, indicating a good low-pass filter response.

This study mainly experimentally investigates and explores the effects of local low-frequency vibrations on the starting-up and heat transfer characteristics of the pulsating heat pipe. A micro motors with the vibration frequency of 200 Hz were imposed on the external surface of evaporation, condensation and adiabatic section of the pulsating heat pipe, respectively, and the starting-up temperature and the average temperatures along the evaporation section as well as the thermal performances of the vibrating heat pipe were experimentally scrutinized under the local vibrations of different positions. The following important conclusions can be achieved by the experimental study: 1) The effect of vibrations at the evaporation section and at the adiabatic section on the starting-up time of pulsating heat pipe is more significant than that at the condensation section. 2) The vibrations at different positions can reduce the starting-up temperature of the pulsating heat pipe. The effect of the vibrations at the evaporation section is the best as the heating power is lower, and the effect of the vibration at the adiabatic section is the best as the heating power is higher. 3) The vibrations at the evaporation section and at the adiabatic section can reduce the thermal resistance of the pulsating heat pipe. However, the vibrations at the condensation section have little effect on the thermal resistance of the pulsating heat pipe. 4) The vibrations at the evaporation section and at the adiabatic section can effectively reduce the temperature of evaporation section of the pulsating heat pipe, but the vibrations at the condensation section have no effect on the temperature of evaporation section of the pulsating heat pipe.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

In the context of the coordinated development of digital economy and environmental protection, we take the strategy of "Broadband China" as a quasi-natural experiment, adopts the panel data of 284 cities from 2007 to 2020, and evaluates the policy effect of digital economy on total factor energy efficiency through the progressive DID model. The results show that: The construction of "Broadband China" demonstration city has significantly promoted the improvement of the total factor energy efficiency of the demonstration city, but there is also significant urban heterogeneity, which is manifested in the significant improvement of the total factor energy efficiency of the eastern city, the southern city, the big city and the non-resource-based city. It has no significant effect on the total factor energy efficiency of central and western cities, northern cities, small and medium-sized cities and resource-based cities. The construction of "Broadband China" demonstration cities can improve total factor energy efficiency by promoting technological progress and strengthening environmental regulations. Therefore, we should further strengthen the construction of digital infrastructure and give full play to its positive effects. Different cities should seek differentiated development paths based on their own resource endowments and development conditions, so that the digital economy can effectively improve the total factor energy efficiency.

. The impedance change of an induction coil surrounding a metal tube adapter is investigated by the truncated region eigenfunction expansion (TREE) method. Conventional TREE method is inapplicable to this problem as a consequence of the numerical overflow of eigenfunctions of the air-metal multi-subdomain regions. The difficulty is surmounted by a normalization procedure for the numerical eigenfunctions obtained from the finite element method (FEM). Efficient algorithm is devised by the Clenshaw-Curtis quadrature rule for integrals involving the numerical eigenfunctions. Numerical results of the TREE and FEM simulation coincide very well in all cases, and the efficiency of the proposed method is also confirmed.

Aiming at the problem of hypersonic morphing vehicle avoiding no-fly zones and reaching the target, an improved predictor-corrector guidance method is proposed. Firstly, the aircraft motion model and the constraint model are established. Then, the basic algorithm is given, the Q-learning method is used to design the attack angle and sweep angle scheme to ensure that the aircraft can fly over the low-altitude zones. The B-spline curve is used to design the location of flight path points and the bank angle scheme is designed according to the predictor-corrector method, so that the aircraft can fly around to avoid high-altitude zones. Next, Monte Carlo reinforcement learning(MCRL) method is used to improve predictor-corrector method and Deep Neural Network(DNN) is used to fit reward function. The improved method can generate trajectory with better performance. Simulation results verify the effectiveness of the proposed algorithm.

In the paper, by the Faά di Bruno formula, several identities for the Bell polynomials of the second kind, and an inversion theorem, the authors simplify coefficients of two families of nonlinear ordinary differential equations for the generating function of the Catalan numbers and discover inverses of fifteen closely related lower triangular integer matrices.

As the increase threat of flood risk and environmental safety due to the urbanization, Sponge city research has been attracting extensive attention both in practical and theoretical research field. To date, there are only scattered studies about Sponge city. Moreover, vary names of Sponge city prevalent in different countries, which leads to disconnection of literature in the same field of Sponge city. In this paper, a thorough systematic literature mining of Sponge city is presented. A literature analysis system is created, which includes literature export from Web of Sciences and systematic analysis via NoteExpress and CiteSpace. Some literature statistical results are derived. Challenges and opportunities for future research are anticipated. Our goals are to promote this promising thought, summarize past research, and identify issues for future research to create impacts on the practice of Sponge city.

The effects of climate change on yield and quality for different climate regions had high uncertainty. Risk assessment is an effective measure to assess the seriousness of the projected impacts for decision-makers. The modified quality model was used to simulate integrated impacts of climate change, environment and management on wheat yield and quality. Then, the Canadian Earth System Model (CanESM2) was used to forecast the daily meteorological data, and Statistical Down Scaling Model was used for downscaling. CERES-Wheat was combined with the forecasted meteorological data to simulate the future wheat yield and grain protein concentration (GPC). The risk of wheat yield and quality in three climatic regions of Shaanxi combined with two climate change scenarios of CanESM2 were assessed. Temperature increased 0.22-3.34 °C and precipitation increased 10-60 mm for RCP4.5 and RCP8.5. Elevated temperature and precipitation had positive effects on yield in all regions. The yield risk of most regions with climate change decreased 3.8%-25.1%. The GPC risk of all regions with climate change decreased 7.3%-27.2%. Irrigation decreased yield risk greatly in all regions, while had totally different effects for the three climatic regions. Yield risk with irrigation decreased 37.7%-52.1% in different climate. In contrast to previous studies, GPC risk with irrigation increased greatly 25.8%-28.9% in humid region, 3.9%-8.8% in sub-humid region, and decreased 37.7%-52.1% in semi-arid region. Climate change decreased yield risk and GPC risk together. While irrigation decreased yield risk greatly in all regions, had totally different effects for the three climatic regions.

With the realization of the Grand Canal's full water supply and the strong pursuit of green and low-carbon transportation in contemporary society, the value of the Grand Canal's water transport has been further affirmed, and its coordinated development with other transportation modes has become inevitable and important. This paper analyzes and combs through the characteristics, development status and existing problems of Grand Canal water transport and other transport modes in depth, and takes Jiangsu as an example. A collaboration model of Grand Canal water transport and other transport modes was built and their collaboration degree has been calculated. It is believed that the coordinated development of Grand Canal water transport and other transport modes can be greatly promoted via four aspects: optimizing the construction and governance of Grand Canal water transport, building an integrated management platform of transport modes, improving the integrated transport network structure, and promoting the deep integration of integrated shipping and tourism.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&amp;LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&amp;LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

As the number of end-of-life vehicles continues to grow, the field of separation technology for broken copper and aluminium parts of end-of-life vehicles has emerged as a significant area of research. As a key technology for the separation of non-magnetic non-ferrous metals, such as copper and aluminium, eddy current separation can achieve efficient separation of non-magnetic non-ferrous metals according to their differing conductivity and density. Nevertheless, further research is required in the separation of large-scale broken copper and aluminium parts of end-of-life vehicles. This paper presents a novel magnetic roller model comprising circumferential and axial periodic arrangements of permanent magnets. A single permanent magnet was constructed as an equivalent current model, and the magnetic scalar potential equations were solved using simulation tools. This allowed the distribution of the magnetic field outside the magnetic roller to be studied. The results demonstrate that the novel permanent magnet array magnetic roller can enhance the magnetic field intensity and action distance of the external magnetic field, which is more conducive to the separation of large-scale broken copper and aluminium parts of scrap cars. The findings of this research provide a theoretical foundation for the separation of scrap car broken copper and aluminium parts.

With the increase of global human activities, a large number of technogenic magnetic particles (TMPs) generated by industrial activities such as coal combustion, traffic and so on enter sediments on continental shelves. However, there is currently a lack of understanding of the spatiotemporal distribution of TMPs on continental shelves, as well as the sedimentary effects they cause. This review work comprehensively analyzes the source, morphology, composition, and spatiotemporal distribution characteristics of TMPs. Then it elucidates their magnetic contribution to sedimentary environments in continental shelf seas, as well as the influence of heavy metals and active iron. At the same time, the existing problems and future development directions of TMPs on continental shelves are summarized.

s: The lack of historical employment data for college graduates, the need to solve the system cold-start problem and the consideration of reciprocity of job recommendation in job recommendation, lead to low recommendation satisfaction and immature application of the existing job recommendation methods. The article presents a new approach to job recommendation using college graduates as the object of study. In the screening stage, a semantic keyword iterative algorithm is applied to compute the similarity between the resume and recruitment texts. This algorithm enhances the intersectionality of keywords in the calculation process, maximizing the utilization of resume information to enhance the accuracy of text similarity calculations. The ranking phase utilizes in-school data to build a social network between college graduates and graduated students, and solves the system's cold-start problem by using the social network to recommend jobs for college graduates where graduated students are employed. Building upon the amalgamation of the semantic keyword iterative algorithm and the social network job recommendation method outlined above, we introduce a dual-dimensional matching approach involving specialty and salary. This enhancement is designed to elevate the reciprocity of job recommendations. The analysis of the results indicates that the average satisfaction rate (AR) and normalized discounted cumulative gain (NDCG) values for the newly proposed job recommendation method surpass those of other methods, demonstrating its superior effectiveness. The method caters to the preferences of graduate job seekers, aligns with job recruitment requirements, and offers extensive job search assistance to a broad spectrum of graduates.

Purpose: To clarify the mechanism of state anxiety on intertemporal decision-making, two studies were conducted to investigate the role of trait anxiety and inhibitory control. Study 1 examined the moderating effect of trait anxiety. Study 2 continued to investigate the mediating effect of inhibition control on the basis of study 1. Methods: A total of 266 Chinese college students participated. Participants’ state anxiety, trait anxiety and intertemporal decision-making were measured by questionnaires (scales) respectively. And inhibition control was evaluated by two-choice oddball paradigm. Results: The results of Study 1 indicated that state anxiety could predict intertemporal decision-making and that the moderating effect of trait anxiety on this relationship was significant. Study 2 found that inhibitory control could completely moderate the relationship between state anxiety and intertemporal decision-making and that this indirect effect was affected by trait anxiety. Conclusion: 1)Individuals with higher trait anxiety are more inclined to make more impulsive and intertemporal decisions when they have a high level of state anxiety; 2)state anxiety allows inhibitory control ability to have a further effect on intertemporal decision-making; and 3)the higher trait anxiety in individuals, the stronger mediating effect of inhibitory control on the relationship between state anxiety and intertemporal decision-making.

Hydrological connectivity plays a major role in solving water resource and eco-environmental problems. However, this phenomenon has not been afforded the attention it deserves. Detailed analysis of connectivity in river systems could provide considerable insight into structural and functional attributes of riverine landscapes. The current study used graph theory approach and associated connectivity indicators to explore the characteristics and evolution of river systems and hydrological connectivity in a large catchment (Poyang Lake, China). The results revealed that the structure of the river system tended to be complex during 1990-2020, characterized by a dynamic evolution of tributaries in certain northern areas. Both river density and complexity exhibited an increasing trend by up to 15%, with the change rate after 2000 approximately twice as high as that of the preceding period. Overall, human activities across the catchment are more likely to play a key role in leading to significant changes in the quantity, morphometric, and structure characteristics of the river system. Additionally, the functional connectivity analysis indicated that the index of connectivity (IC) in the downstream catchment is stronger than that of the upstream vegetation areas, suggesting a strong contribution to the runoff-sediment transport (r=0.6-0.7). This study highlights the spatial and temporal evolution of both the structural and functional connectivity in the large Poyang Lake catchment. The findings of this work will bene-fit future water resource management and applications by providing a strategy for protecting the surface hydrology and mass transport of large river basins under climate and land-use changes.

The increased global incidence of myopia requires the establishment of therapeutic approaches. Previous studies have suggested that inflammation plays an important role in the development and progression of myopia. We used human retinal pigment epithelial cell to study the molecular mechanisms on how FJE and PVE lowering the inflammation of the eye. The effect of FJE and PVE in MFD induced hamster model and explore the role of inflammation cytokines in myopia. Expression levels of IL-6, IL-8, and TNF-α were upregulated in retinal pigment epithelium (RPE) cells treated with IL-6 and TNF-α. FJ extract (FJE) + PV extract (PVE) reduced IL-6, IL-8, and TNF-α expression in RPE cells. Furthermore, FJE and PVE inhibited inflammation by attenuating the phosphorylation of protein kinase B (AKT), and nuclear factor kappa-light-chain-enhancer of activated B (NF-κB) pathway. In addition, we report two resveratrol + ursolic acid compounds from FJ and PV and their inhibitory activities against IL-6, IL-8, and TNF-α expression levels in RPE cells treated with IL-6 and TNF-α. FJE, PVE, and FJE + PVE were applied to MFD hamsters and their axial length was measured after 21 days. The axial length showed statistically significant differences between phosphate-buffered saline- and FJE-, PVE-, and FJE + PVE-treated MFD eyes. FJE + PVE suppressed expressions of IL-6, IL-8, and TNF-α. They also inhibited myopia-related transforming growth factor-beta (TGF)-β1, matrix metalloproteinase (MMP)-2, and NF-κB expression while increasing type Ⅰ collagen expression. Overall, these results suggest that FJE + PVE may have a therapeutic effect on myopia and be used as a potential treatment option.

Using smartphone especially android platform has already got eighty percent market shares, due to aforementioned report, it becomes attacker’s primary goal. There is a growing number of private data onto smart phones and low safety defense measure, attackers can use multiple way to launch and to attack user’s smartphones.(e.g. Using different coding style to confuse the software of detecting malware). Existing android malware detection methods use multiple features, like safety sensor API, system call, control flow structure and data information flow, then using machine learning to check whether its malware or not. These feature provide app’s unique property and limitation, that is to say, from some perspectives it might suit for some specific attack, but wouldn’t suit for others. Nowadays most malware detection methods use only one aforementioned feature, and these methods mostly analysis to detect code, but facing the influence of malware’s code confusion and zero-day attack, aforementioned feature extraction method may cause wrong judge. So, it’s necessary to design an effective technique analysis to prevent malware. In this paper, we use the importance of word from apk, because of code confusion, some malware attackers only rename variables, if using general static analysis wouldn’t judge correctly, then use these importance value to go through our proposed method to generate picture, finally using convolutional neural network to see whether the apk file is malware or not.

The study of man-land relationship in urbanization process is the current frontier and focus of international research. How to balance urban development and ecosystem conservation in the Upper Yellow River is a key issue for sustainable development in China. In this study, we evaluated the Lanzhou-Xining urban agglomeration （LXUA）by constructing a multi-dimensional assessment system for urbanization quality and ecosystem services. The efficacy function model, entropy weight method, and Integrated Valuation of Ecosystem Services and Tradeoffs (InVEST) model were used to quantitatively assess the subsystems' state of development. Then, the coupling model (CD) and the coordination degree（CCD）model were used to explore the coupling coordination relationship and spatial-temporal change characteristics of the composite system. The findings indicate that: 1）In 2020, the quality of urbanization in LXUA showed the pattern of "double core". The development of urban centers in each city is insufficient, and the proportion of counties with low-level is too high. 2）Integrated ecosystem services showed an increasing distribution pattern from the northeast to the southwest. Water provision services, soil conservation services and carbon fixation services all showed growth trends. 3）Each county’s composite system was in the run-in stage or highly coupled stage. The subsystems were closely related to each other. 4）The CCD was decreased by 6% between two decades. The number of counties on the verge of disorder was the highest. About 80% of the counties are relatively lagging behind in ecosystem services.

Accurate image registration is essential for eye movement compensation in optical coherence tomography (OCT) and OCT angiography (OCTA). The spatial resolution of an OCT instrument is typically anisotropic, i.e., different resolutions in the lateral and axial dimensions. When OCT images have anisotropic pixel resolution, residual distortion (RD) and false translation (FT) were always observed after image registration for rotational movement. In this study, RD and FT were quantitively analyzed over different degrees of rotational movement and various lateral and axial pixel resolution ratio (RL/RA) values. The theoretical analysis confirmed that the RD and FT increase significantly with the rotation degree and RL/RA. An image resizing assisting registration (RAR) strategy was proposed for accurate image registration. The performance of direct registration (DR) and RAR for retinal OCT and OCTA images were quantitatively compared. Experimental results confirmed that unnormalized RL/RA causes RD and FT, RAR can effectively improve the performance of OCT and OCTA image registration and distortion compensation.

Sequential hypothesis test and change-point detection when the distribution parameters are unknown is a fundamental problem in statistics and machine learning. We show that for such problems, detection procedures based on sequential likelihood ratios with simple one-sample update estimates such as online mirror descent are nearly second-order optimal. This means that the upper bound for the algorithm performance meets the lower bound asymptotically up to a log-log factor in the false-alarm rate when it tends to zero. This is a blessing, since although the generalized likelihood ratio (GLR) statistics are optimal theoretically, but they cannot be computed recursively, and their exact computation usually requires infinite memory of historical data. We prove the nearly second-order optimality by making a connection between sequential analysis and online convex optimization and leveraging the logarithmic regret bound property of online mirror descent algorithm. Numerical and real data examples validate our theory.

Molecular hydrogen (H2) has been shown to have antioxidant and anti-inflammatory activities that may reduce the development and progression of many diseases. In this study, Hydrogen-rich water (HRW) was obtained by reacting hybrid magnesium-carbon hydrogen storage materials with water. Then the effects of intake of HRW on the activities of xenobiotic-metabolizing enzymes, membrane transporters, and oxidative stress in rats were investigated. Rats were given HRW ad libitum for 4 weeks. Results showed that intake of HRW had no significant effect on the activities of various cytochrome P450 (CYP) enzymes (CYP1A1, 1A2, 2B, 2C, 2D, 2E1, 3A, 4A), glutathione-S-transferase and UDP-glucuronosyltransferase. Except for a slight lower plasma glucose concentration, intake of HRW had no effect on other plasma biochemical parameters in rats. P-Glycoprotein and multidrug resistance-associated protein (Mrp)2 protein expressions in liver were elevated after intake of HRW. However, HRW had no significant effects on glutathione, glutathione peroxidase, or lipid peroxidation in liver. Results from this study suggest that consumption of HRW may not affect xenobiotic metabolism or oxidative stress in liver. However, intake of HRW may increase the efflux of xenobiotics or toxic substances from the liver into bile by enhancing the expression of p-glycoprotein and Mrp2 protein.

The recent advancements of the Semantic Web and Linked Data have changed the working of the traditional web. There is significant adoption of the Resource Description Framework (RDF) format for saving of web-based data. This massive adoption has paved the way for the development of various centralized and distributed RDF processing engines. These engines employ various mechanisms to implement critical components of the query processing engines such as data storage, indexing, language support, and query execution. All these components govern how queries are executed and can have a substantial effect on the query runtime. For example, the storage of RDF data in various ways significantly affects the data storage space required and the query runtime performance. The type of indexing approach used in RDF engines is critical for fast data lookup. The type of the underlying querying language (e.g., SPARQL or SQL) used for query execution is a crucial optimization component of the RDF storage solutions. Finally, query execution involving different join orders significantly affects the query response time. This paper provides a comprehensive review of centralized and distributed RDF engines in terms of storage, indexing, language support, and query execution.

This paper presents a wideband dual-polarized dipole antenna structure operating at 1.7-3.8 GHz (76.4%). For a traditional 4G dipole antenna which covers the band 1.71 GHz- 2.69 GHz, it’s difficult to maintain the satisfactory impedance matching and normal stable radiation patterns within the 5G sub-6 GHz band 3.3-3.8 GHz, which mainly due to the fixed antenna height is no longer a quarter-wavelength. To solve this, a connected-ring-shaped metasurface structure is proposed and deployed to operate as an artificial magnetic conductor (AMC). As a result, stable antenna radiation patterns are obtained within the whole band 1.7-3.8 GHz. For verification, this wideband dipole antenna using AMC is implemented and tested. The measured results show that the proposed antenna has an impedance bandwidth of 80.7% (1.7-4.0 GHz). It has an average measured in-band realized gain of 7.0±1.0 dBi and a stable 70∘±5∘ half power beam width (HPBW) within the 4G/5G-sub 6GHz bands 1710-2690 MHz and 3300-3800 MHz.

Increased soluble endoglin (sENG) were observed in human brain arteriovenous malformations (bAVMs), and overexpression of sENG with vascular endothelial growth factor (VEGF)-A induced dysplastic vessel formation in mouse brain. However, the underlying mechanism of sENG-induced vascular malformations is not clear. While evidence suggests the role of sENG as a pro-inflammatory modulator, increased microglial accumulation and inflammations were observed in bAVMs. Therefore, we hypothesized that microglia mediate sENG-induced inflammation and endothelial cell (EC) dysfunction in bAVMs. In this study, we confirmed that sENG with VEGF-A overexpression induced dysplastic vessel formation. Remarkably, there were increased microglial activation around dysplastic vessels with expression of NLRP3, inflammasome marker. We found that sENG increased the gene expression of VEGF-A, pro-inflammatory cytokines/inflammasome mediators (TNF-α, IL-6, NLRP3, ASC, Caspase-1, and IL-1β), and proteolytic enzyme (MMP-9) in BV2 microglia. The conditioned media from sENG-treated BV2 (BV2-sENG-CM) significantly increased angiogenic factors (Notch-1 and TGFβ) and pERK1/2 in ECs while it decreased IL-17RD, an anti-angiogenic mediator. Finally, the BV2-sENG-CM significantly increased EC migration and tube formation. Together, our study demonstrates that sENG provokes microglia to release angiogenic/inflammatory responses which may be involved in EC dysfunction. Our study suggests the contribution of microglia in the pathology of sENG-associated vascular malformations.

To analyze the impact of weather factors on the resilience of airport flight operations, particularly on flight operation, economic performance, and transportation capacity, Kolmogorov-Arnold Network (KAN) model was used to identify key weather features and establish the mapping relationship between weather factors and airport operational resilience. Taking Xi'an Xianyang International Airport as an example, the weights of each route were determined using the Grey Relational Analysis method considering average daily flight volume, flight distance, and airport flow stability indicators. Flight operation records and weather data were utilized to calculate the importance of key weather factors on the resilience of critical flight operation indicators. The results indicate significant differences in average daily flight volume, flight distance, and airport flow stability across different routes, with routes in economically developed areas having a greater impact on airport flow stability. Temperature and wind speed changes are the key factors affecting flight operation and economic indicators, with importance values of 0.35 and 0.32 respectively. Wind direction change and wind speed change have the greatest impact on flight transportation capacity, with importance values of 0.7 and 0.65 respectively. Therefore, when conducting flight scheduling and risk assessment, special attention should be paid to key weather factors such as temperature and wind speed, while also considering the weight of each route to ensure flight safety, efficiency, and economic benefits.

Atherosclerosis (AS) is an age-related disease. Mitochondria and telomere links have been considered to play important roles in AS. PinX1 is a potent and highly conserved endogenous telomerase inhibitor. However, the role of pinX1 in AS and its role in oxidative stress have not been reported. In order to investigate the role of pinX1 in AS, we established a classical AS mice model in the present work and increased pinX1 protein expression using pinX1 overexpression adeno-virus by tail vein injection. Then, red-oil O and HE staining were employed to evaluate the severity of AS. Serum lipid profile and oxidative stress were also detected by using its specific chemical testing kit. The results indicated that high-fat diet (HFD) markedly decreased pinX1 and increased p66shc protein expression, whereas overexpression of pinX1 protein expression in mice produced the opposite results. In addition, pinX1 significantly minimized plaque area and alleviated the abnormal serum lipid profile. By using Western blot and Biochemical assay kits, overexpression of pinX1 decreased p66shc and MMP-9 protein expression and reduced oxidative stress. This study showed pinX1 can inhibit p66shc, MMP-9, and related oxidative stress, pinX1 may be considered as a new candidate target for the treatment of AS.

Space tourism began in 2001 and became popular in 2021 because of commercial operations. With the development of space technology and commercialization, like re-launchable rockets to travel to space in recent years, it has gradually entered the era of space. However, the space industry causes massive emissions, inducing some opposition to its development. It is essential to investigate the attitude of residents toward space tourism and balance the pros and cons of sustainability. Quantitative analysis was adapted to test two models based on duality theory. The data were obtained from 284 samples from various regions of China and analyzed using the partial least squares structural equation modeling (PLS-SEM). The results show that the two-factor model of economic development conflicted with environmental protection. However, study two indicates that educational interventions can facilitate sustainable space tourism because they mediate the relationship between economic and environmental factors.

The collapsible loess will rapidly soften and lose its bearing capacity when soaked in water. Under a mild condition (20°C), the biomimetic inorganic agent, Diammonium phosphate (DAP), reacts with calcite in the collapsible loess, producing a stronger bonding material, hydroxyapatite (HAP), to modify and stabilize the soil. Uniaxial compression, permeability tests and morphological analysis using XRD and SEM/EDX microscopy were carried out to assess the effectiveness of DAP stabilization on the collapsible loess. The results indicated that HAP improved the inter-particle bonding within loess, filled the pores within particles, reduced the permeability, and consequently mitigated collapsibility of loess. The compressive strength of DAP-treated loess increased as DAP concentration increased. Following 28-days curing, the compressive strength of the loess treated with a 3.0 mol/L DAP solution was six times greater than that of the untreated group. DAP's reinforcement effect on loess was superior to that of cement. The compressive strength of DAP-treated loess was about double that of cement-treated loess and the permeability coefficient was reduced by more than 50% at equivalent solid content. Furthermore, DAP generated 68% fewer carbon emissions compared to Portland cement. Considering eco-friendly and sustainable development, DAP offers a more competitive alternative for modification and stabilization of loess.

The 70/30 copper–nickel alloy is mainly used in critical parts with more demanding conditions in marine settings. There is a need for innovative methods that offer fast production and cost-effectiveness to supplement current copper–nickel alloy manufacturing processes. In this study, we employ wire-arc additive manufacturing (WAAM) to fabricate the 70/30 copper–nickel alloy. The as-built microstructure is characterized by columnar grains with prominent dendrites and chemical segregation in the inter-dendritic area. The aspect ratio of the columnar grain increases with increasing travel speed (TS) at the same wire feed speed (WFS). This is in contrast to an equiaxed grain structure with a more random orientation of conventional sample. The sample built with a WFS of 8 m/min, TS of 1000 mm/min, and a track distance of 3.85 mm exhibits superior corrosion properties in the 3.5 wt% NaCl solution compared to the conventional one, as evidenced by a higher film resistance and breakdown potential, along with a lower passive current density of the WAAM sample. The corrosion morphology reveals the critical roles played by the nickel element unevenly distributed between the dendrite core and inter-dendritic area.

Objective: To explore the hot spots and development trends of community public health research. Methods: The literature related to this topic was searched in CNKI and PubMed databases, and the trend map of the number of articles was drawn according to the obtained data. The included literature were analyzed with Vosviewer software for keyword and author co-occurrence, and CiteSpace 6.3.R1 Basic software was used for mechanism co-occurrence, key emergence and clustering analysis, and timeline distribution map drawing. Results: 189 Chinese literature and 77 English literature were selected. The Chinese literature focused on “community public health service, emergency management, and community governance”, and the research trend was “community public health emergency management and community governance”; English literature focuses on “nursing education, health education, human qualitative research”. Conclusion: Although the Chinese and English literature shows that scholars in this field have different emphases, the primary community health is the key and difficult point to realize the national public health service project, and improving the basic public health service in the primary community is related to the health of all the people, so it is very important.

Electric vehicles can effectively make use of the time-of-use electricity price to reduce the charging cost, meanwhile using the grid power to preheat the battery before departure is particularly important for improving the vehicle mileage and reducing the use cost.In this paper, a dynamic programming algorithm is used to optimize the battery AC charging-preheating strategy to minimize the total cost of battery charging and preheating, with the charging current and battery preheating power consumption as the control variables. The cost difference between the optimized control strategy and the conventional preheating strategy was analyzed under different ambient temperatures (-20℃~ 0℃) and different target travel time (7:00 ~ 12:00). The simulation results show that the optimized control strategy makes the battery SOC and temperature reach the set value at the user's target departure time, and the total cost of the grid is the lowest. Compared with the conventional preheating strategy, the optimized control strategy can utilize the power grid energy in the valley price area, reduce the opening time of water heating PTC in the flat and the peak price zones, and the cost utilization rate can reach 18.41% ~ 73.96%, and the cost-saving effect is significant.

Postharvest 1-MCP treatment can inhibit lignification of fruit and vegetables. It has been suggested that the mode of action of 1-MCP is through inhibiting ethylene production, but the effect of 1-MCP and ethylene on lignification of common bean remain unknown. This work compared the effect of 0.5 μL L-1 1-MCP and 100 μL L-1 ethylene on lignification of common bean during storage. Postharvest 1-MCP significantly inhibited the increase of lignified cell group, sclerenchyma became thicker, vascular bundles thickened and lignified cells grew during storage, while ethylene is the opposite. 1-MCP inhibited the increase in respiration rate, sucrose phosphate synthase (SPS), sucrose synthase (SuSy), phenylalanine ammonialyase (PAL), cinnamyl-alcohol dehydrogenase (CAD), and peroxidase (POD) activities, whereas ethylene hastened all. Ethylene treatment can be stimulated and 1-MCP inhibited the decline of reducing sugar and cellulose content. Expression of genes, including PvACO1, PvAOG1, PvSuSy, PvPAL3, and Pv4CL1, PvCOMT1 together with lignin content were significantly increased in common bean during storage. 1-MCP treatment markedly inhibited expression of PvACO1, PvSuSy2, PvPAL3, Pv4CL1 and PvCOMT1 genes, while strengthened expression of PvETR1 and PvAOG1, while ethylene was opposite. This work provides evidence that ethylene plays a key role in regulating the lignin biosynthesis of common bean, and also provides strategies for the maintenance of fruit quality during storage.