Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The basic idea is to expand the completed zeta function $\xi(s)$ in MacLaurin series (infinite polynomial), which can be further expressed as infinite product (Hadamard product) by conjugate complex roots. Finally, the functional equation $\xi(s)=\xi(1-s)$ leads to $(s-\alpha_i)^2 = (1-s-\alpha_i)^2, i \in \mathbb{N}$ with solution $\alpha_i= \frac{1}{2}, i \in \mathbb{N}$, where $\alpha_i$ are the real parts of the zeros of $\xi(s)$, i.e., $s_i =\alpha_i\pm j\beta_i, i\in \mathbb{N}$. Therefore, a proof of the Riemann Hypothesis is achieved.

The development of computational acoustics allows simulation of sound generation and propagation in complex environment. In particular, meshfree methods are widely used to solve acoustics problems through arbitrarily distributed field points and approximation smoothness flexibility. As a Lagrangian meshfree method, smoothed particle hydrodynamics (SPH) method reduce the difficulty in solving problems with deformable boundaries, complex topologies, or multiphase medium. The traditional SPH method has been applied in acoustic simulation. This study presents the corrective smoothed particle method (CSPM), which is a combination of SPH kernel estimate and Taylor series expansion. The CSPM is introduced as a Lagrangian approach to improve accuracy in solving acoustic wave equations in the time domain. Moreover, a boundary treatment technique based on the hybrid meshfree and finite difference time domain (FDTD) method is proposed to represent different acoustic boundaries with particles. To model sound propagation in pipes with different boundaries, soft, rigid, and absorbing boundary conditions are built with this technique. Numerical results show that the CSPM algorithm is consistent and demonstrates convergence with exact solutions. Main computational parameters are discussed, and different boundary conditions are validated to be effective for benchmark problems in computational acoustics.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

The rock joint fissure slope in cold regions is prone to deformation and failure problems such as relaxation, tension and collapse under freeze-thaw (F-T) cycles. Based on the ideology of clean production and promoting the structural integrity of geotechnical projects in cold areas, this study designed and prepared aeolian-sand (AS) to replace part of river sand as a filling mortar material by taking advantage of the low cost and easy availability of AS. Investigations were carried out to determine the impact of varying proportions of AS in mortar on the microstructure and shear properties of the mortar-rock interface under F-T cycles. Therefore, F-T cycle testing, nuclear magnetic resonance (NMR) testing and shear testing were carried out on grout with different proportions of AS. The results show that the right proportion of AS replacement could enhance the shear deformation resistance and F-T resistance of the mortar-rock interface, and 30% proportion is the optimal proportion. By increasing of F-T cycles, the three types of specimens showed different degrees of particle spalling, shedding and cracking. The slurry-rock interface layer in the A (0%) group exhibited the most severe F-T deterioration, while the B (15%) group showed a lesser degree, and the C (30%) group performed the best. T2 spectrum curve and total spectrum area change law from the microscopic point of view to verify the 30% AS proportion mortar-rock interface F-T resistance is the strongest, followed by 15% AS proportion mortar, the weakest is ordinary mortar. The degradation of the mortar-rock bond is primarily due to the conversion of solid to liquid phases and the movement of internal water caused by fluctuating temperatures. The extent of F-T deterioration in the slurry-rock interface layer is greatly affected by the varying proportions of AS. The shear strength and shear stiffness of specific proportion of AS decreased with the increase of F-T cycles. For same F-T cycles, the shear strength and shear stiffness of group C (30%) were the highest, followed by group B (15%) and group A (0%). The grout material not only reinforces the F-T joint fissure slope, but also reduces the cost of grout reinforcement and promotes the clean production of geotechnical structures.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

In order to correct attenuated millimeter-wavelength (Ka-band) radar data and address the problem of instability, an attenuation correction methodology (attenuation correction with variation trend constraint; VTC) was developed. Using synchronous observation conditions and multi-band radars, the VTC method adopts the variation trends of reflectivity in X-band radar data captured with wavelet transform as a constraint to adjust reflectivity factors of millimeter-wavelength radar. The correction was evaluated by comparing reflectivities obtained by millimeter-wavelength cloud radar and X-band weather radar. Experiments showed that attenuation was a major contributory factor in the different reflectivities of the two radars when relatively intense echoes exist, and the attenuation correction developed in this study significantly improved data quality for millimeter-wavelength radar. Reflectivity differences between the two radars were reduced and reflectivity correlations were enhanced. Errors caused by attenuation were eliminated, while variation details in the reflectivity factors were retained. The VTC method is superior to the bin-by-bin method in terms of correction amplitude and can be used for attenuation correction of shorter wavelength radar assisted by longer wavelength radar data.

In (Semigroup Forum 77: 325-338, 2008) Mahmoudi M. and Renshaw J. solved a study that covers of cyclic $S$-acts over monoids. This article is an attempt to initiate the covers of finitely generated $S$-acts. We give a necessary and sufficient condition for a monoid to have the properties that $n$-generated $S$-acts have strongly flat covers, Condition $(P)$ covers and projective covers. The main conclusions extend some known results. We show also that Condition $(P)$ covers of finitely generated $S$-acts are not unique, unlike the situation for strongly flat covers. Additionally, we demonstrate that the property of Enochs' $\mathcal{X}$-precover of $S$-act $A$, where $\mathcal{X}$ denotes a class of $S$-acts that are closed under isomorphisms.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

With the increasing concern of environment, the energy-efficiency scheduling of manufacturing industry is becoming urgent and popular. In turning processes, both spindle speed and processing time can affect the final energy consumption and thus the spindle speed and scheduling scheme need to be optimized simultaneously. Since the turning workshop can be regarded as the flexible flow shop, this paper formulates a mixed integer linear programming model for energy-efficient scheduling of flexible flow shop. Accordingly, a new decoding method is developed by considering of the optimization of spindle speed and scheduling scheme simultaneously, and an estimation of distribution algorithm adopting the new decoding method is proposed to solve large-size problems. The parameters of this algorithm are determined by statistical technique with a simplified practical case. In order to validate the proposed method, a case from practical factories is studied, in which the makespan can be shortened by 25.22%, and the consumed energy can be saved by 5.48%. These results demonstrate the effectiveness of the proposed mathematical model and algorithm.

This paper aims to address the exponential stability and stabilization problems for a class of delayed nonlinear Markov jump systems under randomly occurring Denial-of-Service (DoS) attack and packet loss. Firstly, the stochastic characteristics of DoS attack and packet loss are depicted by the attack success rate and packet loss rate. Secondly, a Period Observation Window (POW) method and a hybrid-input strategy are proposed to compensate for the impact of DoS attack and packet loss on the system. Thirdly, A Dynamic Event-triggered Mechanism (DETM) is introduced to save more network resources and ensure the security and reliability of systems. Then, by constructing a general common Lyapunov functional and combining with the DETM and other inequality analysis techniques, the less conservative stability and stabilization criteria for the underlying systems are derived. In the end, the effectiveness of our result is verified through a numerical example.

Although Eulerian approaches are standard in computational acoustics, they are less effective for certain classes of problems like bubble acoustics and combustion noise. A different approach for solving acoustic problems is to compute with individual particles following particle motion. In this paper, a Lagrangian approach to model sound propagation in moving fluid is presented and implemented numerically, using three meshfree methods to solve the Lagrangian acoustic perturbation equations (LAPE) in the time domain. The LAPE split the fluid dynamic equations into a set of hydrodynamic equations for the motion of fluid particles and perturbation equations for the acoustic quantities corresponding to each fluid particle. Then, three meshfree methods, the smoothed particle hydrodynamics (SPH) method, the corrective smoothed particle (CSP) method, and the generalized finite difference (GFD) method, are introduced to solve the LAPE and the linearized LAPE (LLAPE). The SPH and CSP methods are widely used meshfree methods, while the GFD method based on the Taylor series expansion can be easily extended to higher orders. Applications to modeling sound propagation in steady or unsteady fluids in motion are outlined, treating a number of different cases in one and two space dimensions. A comparison of the LAPE and the LLAPE using the three meshfree methods is also presented. The Lagrangian approach shows good agreement with exact solutions. The comparison indicates that the CSP and GFD method exhibit convergence in cases with different background flow. The GFD method is more accurate, while the CSP method can handle higher Courant numbers.

Effects of oxygen content on microstructure and creep property of FGH96 superalloy were investigated. When oxygen content increased from 135ppm to 341ppm, prior particle boundary (PPB) rose from degree 2 to degree 3, and the size of γ′ phase on PPB enlarged from 1.07μm to 1.27μm, and MC carbide size grew from 77.4nm to 104.0nm. Meanwhile, the steady creep rate accelerated form 4.34×10-3 h-1 to 1.87×10-2 h-1, and the creep rupture life shortened from 176h to 94h, and the creep rupture mode transferred from intergranular and transgranular mixed fracture to along PPB fracture. During creep, the micro-twins formation and gliding will be restrained by ∑3 boundaries. FGH96 superalloy with higher oxygen content contains less ∑3 boundaries and its micro-twins cross slipped instead of single direction slip in lower oxygen content superalloy. Consequently, specimen with higher oxygen content creeped faster and raptured earlier.

Expansion tube is ideal energy absorber which dissipates kinetic energy through plastic deformation and friction. There is an urgent need to understand the influence of key parameter, e.g. semi angle, tube material, and friction coefficient, on the mechanical response and energy absorption characteristics of expansion tube. In the present work, the material properties of the tubes were tested under quasi-static loading condition, and the numerical simulations were carried out by using commercial software ABAQUS. Based on the validated finite element simulation, all the semi angle, tube material, and friction have significant effects on the energy absorption capacity of expansion tube. The expansion tube with high tensile stress of parent material have high energy absorption capacity, while the specific energy absorption is linear with the tensile stress/density of tube material. This work would give a guidance to the structural design and parent materials selection for expansion tubes.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

The exceptional performance advantages of the fiber optic gyroscope (FOG) position it as a dominant player in middle and high-end inertial navigation systems. To prevent the loss of sensor precision caused by algorithm design and simplify the complex modeling strategy in traditional methods. We gradually demonstrate the significant role of Convolutional Neural Network (CNN) in the navigation system based on FOG, and utilize the particle swarm optimization algorithm (PSO) to expedite the convergence of the network. The experimental results demonstrate that the initial alignment method based on deep learning is more accurate than the traditional method. The attitude angle error is reduced by 81.25%, 92.54% and 36.53% respectively. The research provides support for the future application of deep learning in optical navigation systems.

Semisolid casting can provide excellent castings, but the nature of the pore-forming mechanisms has not been properly clarified. In the current communication, it was suggested that hydrogen precipitated during slurry making might have a decisive role in the formation of both gas and shrinkage porosity. Intensive stirring at the end of the slurry making process may act as a degassing step. Without the intense stirring, structures of primary slurry particles form around the hydrogen pores, strongly affecting pore formation and feeding during the intensification stage.

This study investigates the impact of specimen size on the mechanical properties of wood, specifically focusing on compression strength, elastic modulus, and Poisson's ratio. Compression tests were conducted using three different specimen sizes (20mm×20mm×30mm, 40mm×40mm×60mm, 60mm×90mm×90mm) in the longitudinal, radial, and tangential directions. Mechanical parameters, failure mechanisms, load-displacement curves, and stress-strain relationships were systematically analyzed for each size. The study also evaluated the influence of specimen size on the accuracy of finite element numerical simulations by utilizing the obtained mechanical parameters. The results reveal a significant correlation between compressive strength and specimen size, indicating a decrease in compressive strength with increasing specimen size. Conversely, elastic modulus and Poisson's ratio exhibit less sensitivity to variations in specimen size. Notably, parameters derived from small-sized specimens (20mm×20mm×30mm) exhibited substantial errors, while those obtained from medium-sized (40mm×40mm×60mm) and large-sized specimens (60mm×90mm×90mm) demonstrated greater reliability, providing precise results in finite element numerical simulations.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

Sunflower is one of the oil crops and its planting areas was listed behind Soybean, peanut and rapeseeds in China. It will encounter different kind of diseases during planting, thus limited the seeds yield. Fusarium species are the major threat to different crops nowadays, it is very important to identify the species caused diseases on different hosts, so that the potential control measures may be explored. In Inner mongolia, Sunflower Disk Rot (SDR) was found in different sunflower planting field, the average infection ratio around 8.50%, typically in some verieties, its infection ratio reach to 11.67%. The diseased receptacle were collected from different locations and Koch’s postulate was conducted. The results showed that Fusarium verticillioides was the main causal agent caused SDR. Fungicide toxicity tests shown that Fludioxonil and Flutolanil were screened out from six fungicides for controlling F. verticillioides, with EC50 values of 0.05 µg/mL (R = 0.9825) and 0.96 µg/mL (R = 0.9964) , respectively. This is the first report of SDR caused by F. verticillioides, and it will alert sunflower reseachers to include SDR in the disease list, so as to control sunflower diseases with integrated management strategy successfully.

Rapid and accurate detection of road cracks is of great significance for road health monitoring, but currently this work is mainly completed through manual site surveys. Low-altitude UAV remote sensing can obtain images with centimeter or even subcentimeter ground resolution, which provides a new efficient and economical approach for rapid crack detection. Nevertheless, crack detection networks face challenges such as edge blurring and misidentification due to the heterogeneity of road cracks and the complexity of the background. To address these issues, we propose a real-time edge reconstruction crack detection network (ERNet) which adopts multi-level information aggregation to reconstruct crack edges and improve the accuracy of segmentation between the target and background. To capture global dependencies across spatial and channel levels, we propose an efficient bilateral decomposed convolutional attention module (BDAM) that combines depth separable convolution and dilated convolution to capture global dependencies across spatial and channel levels. To enhance the accuracy of crack detection, we use a coordinate-based fusion module that integrates spatial, semantic, and edge reconstruction information. In addition, we propose an automatic measurement of crack information for extracting the crack trunk and its corresponding length and width. Experimental results demonstrate that our network achieves the best balance between accuracy and inference speed.

Domain generalization has led to remarkable achievements in Hyperspectral Image (HSI) classification. Inspired by contrastive language-image pre-training (CLIP), the language-aware domain generalization method has been explored to learn cross-domain-invariant representation. However, existing methods face some challenges: 1) The weak capacity to extract long-range contextual information and inter-class correlation. 2) Due to the inadequacies of the large-scale pre-training for HSI data, the spatial-spectral features of HSI and linguistic features can not be straightforwardly alignment. To address the above problems, a novel network has been proposed with a CLIP framework, which consists of an image encoder, based on an encoder-only transformer to obtain the global contextual information and inter-class correlation, a frozen text encoder, and a cross-attention mechanism, named Linguistic-Interact-with-Visual Engager (LIVE), enhances the interaction between two modalities. Extensive experiments demonstrating superior performance over state-of-the-art methods in HSI Domain Generalization with a CLIP framework.

Multimodal remote sensing data classification can enhance the model’s ability to distinguish land features through multimodal data fusion. In this context, how to help models understand the relationship between multimodal data and target tasks is the focus of researchers. Inspired by human feedback learning mechanisms, causal reasoning mechanisms, and knowledge induction mechanisms, this paper integrates causal learning, reinforcement learning, and meta learning into a unified remote sensing data classification framework and proposed the causal meta-reinforcement learning (CMRL). First, based on feedback learning mechanisms, we have overcome the limitations of traditional implicit optimization of fusion features and customized a reinforcement learning environment for multimodal remote sensing data classification tasks. Through feedback interactive learning between agents and the environment, we help them understand the complex relationships between multimodal data and labels, thereby achieving full mining of multimodal complementary information. Second, based on the causal inference mechanism we designed causal distribution prediction action, classification reward, and causal intervention reward, capturing pure causal factors in multimodal data and cutting off false statistical associations between non-causal factors and class labels. Finally, based on the knowledge induction mechanism, we designed a bi-layer optimization mechanism based on meta-learning. By constructing a meta training task and meta validation task simulation model in the generalization scenario of unseen data, we helped the model induce cross-task shared knowledge, thereby improving its generalization ability for unseen multimodal data. The experimental results on multiple sets of multimodal datasets show that the proposed method achieved state-of-the-art performance in multimodal remote sensing data classification tasks.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Abstract: Toxicity of emerging organic pollutants to photosystems of aquatic plants are still not well clarified. This study aimed to develop a novel ecotoxicological experimental protocol based on nanoscale electrochemical mapping of photosynthetic oxygen evolution of aquatic plants by SECM (scanning electrochemical microscopy). The protocol was also checked by confocal laser scanning microscopy (CLSM), the traditional Clark oxygen electrode method and chlorophyll fluorescence technique. The typical persistent organic pollutant 2,4-dichlorophenol (2,4-DCP) in water environment and the common aquatic Microsorium pteropus (M. pteropus) were chosen as the model organic pollutant and tested plant, respectively. It was found that the SECM method could well discriminated the responses of stoma micromorphology and spatial pattens of photosynthetic oxygen evolution on single stoma. The shape of stoma blurred with increasing 2,4-DCP concentration, which was in good agreement with the CLSM images. The dose-response curves and IC50 values obtained from the SECM data were verified by the data measured by the traditional Clark oxygen electrode method and chlorophyll fluorescence test. The IC50 value of single stoma oxygen emission of 24 h exposed plant leave, which was derived from the SECM current data (32535 μg L-1), was close to those calculated from the maximum photosynthetic efficiency (Fv/Fm) measured by chlorophyll fluorescence test (33963 μg L-1), and the Clark oxygen electrode method photosynthetic oxygen evolution rate (32375 μg L-1). The 72 h and 96 h 2,4-DCP exposure data further confirmed the reliability of the nanoscale stoma oxygen emission mapping methodology for ecotoxicological assessment. In this protocol, the procedures for how to collect effective electrochemical data and how to extract useful information from the single stoma oxygen emission pattern were well established. This study showed that SECM is a feasible and reliable ecotoxicological tool for evaluation of toxicity of organic pollutants to higher plants with unique nanoscale visualization advantage over the conventional methods.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

We consider the financial planning problem of a retiree wishing to enter a retirement village at a future uncertain date. The date of entry is determined by the retiree's utility and bequest maximisation problem within the context of uncertain future health states. In addition, the retiree must choose optimal consumption, investment, bequest and purchase of insurance products prior to her full annuitisation on entry to the retirement village. A hyperbolic absolute risk-aversion (HARA) utility function is used to allow necessary consumption for basic living and medical costs. The retirement village will typically require an initial deposit upon entry. This threshold wealth requirement leads to exercising the replication of an American put option at the uncertain stopping time. From our numerical results, active insurance and annuity markets are shown to be a critical aspect in retirement planning.

Open-vocabulary learning has recently gained prominence as a means to enable image segmentation for arbitrary categories based on textual descriptions. This advancement has extended the applicability of segmentation systems to a broader range of generally purpose scenarios. However, current methods often revolve around specialized architectures and parameters tailored to specific segmentation tasks, resulting in a fragmented landscape of segmentation models. In response to these challenges, we introduce OVAMTSeg, a versatile framework designed for Open-Vocabulary and Multitask Image Segmentation. OVAMTSeg harnesses adaptive prompt learning to empower the model to capture category-sensitive concepts, enhancing its robustness across diverse multi-task and scenario contexts. Text prompts are employed to effectively capture semantic and contextual features of the text, while cross-attention and cross-modal interactions enable the fusion of image and text features. Furthermore, a transformer-based decoder is incorporated for dense prediction. Extensive experimental results underscore the effectiveness of OVAMTSeg, showcasing its state-of-the-art performance and superior generalization capabilities across three segmentation tasks. Notable achievements include a 47.5 mIoU in referring expression segmentation, 51.6 mIoU on Pascal-VOC with four unseen classes, 46.6 mIoU on Pascal-Context in zero-shot segmentation, 65.9 mIoU on Pascal-5i, and 35.7 mIoU on COCO-20i datasets for one-shot segmentation.

Structural health monitoring has been studied by a number of researchers as well as various industries to keep up with the increasing demand for preventive maintenance routines. This work presents a novel method for reconstruct prompt, informed strain/stress responses at the hot spots of the structures based on strain measurements at remote locations. The structural responses measured from usage monitoring system at available locations are decomposed into modal responses using empirical mode decomposition. Transformation equations based on finite element modeling are derived to extrapolate the modal responses from the measured locations to critical locations where direct sensor measurements are not available. Then, two numerical examples (a two-span beam and a 19956-degree of freedom simplified airfoil) are used to demonstrate the overall reconstruction method. Finally, the present work investigates the effectiveness and accuracy of the method through a set of experiments conducted on an aluminium alloy cantilever beam commonly used in air vehicle and spacecraft. The experiments collect the vibration strain signals of the beam via optical fiber sensors. Reconstruction results are compared with theoretical solutions and a detailed error analysis is also provided.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

Channel bends are one of the most important characteristic features of natural streams. These bends often create the conditions for a hyporheic zone, which has been recognized as a critical component of stream ecosystems. The streambed vertical hydraulic conductivity (K_v), vertical hydraulic gradient (VHG) and Darcian flux (DF) in the hyporheic zone were estimated at 61 locations along a channel bend of the Beiluo River during July 2015 and January 2016. All the streambed attributes showed great spatial variability along the channel bend. Both upward fluxes and downward fluxes occurred during the two test periods, most of studied stream sections were controlled by downwelling, indicating stream water discharge into the subsurface. The average downward flux was higher at the downstream side than at the upstream side of the channel bend, especially in July 2015. The distribution of streambed sediment grain size has a significant influence on the variability of K_v; high percentages of silt and clay sediments generally lead to low K_v values. Higher K_v at the depositional left bank at the upstream site shifted toward the erosional right bank at the downstream site, with K_v values positively correlated with the water depth. This study suggested that the variabilities of K_v and VHG were influenced by the stream geomorphology and that the distribution of K_v was inversely related, to a certain extent, to the distribution of VHG across the channel bend. K_v and VHG were found to have opposite effects on the DF, and the close relationship between K_v and DF indicated that the water fluxes were mainly controlled by K_v.

Underwater visual detection technology plays a pivotal role in fields such as marine exploration. With the increasing demand for underwater monitoring, the quest for efficient and reliable methods for underwater target recognition has become particularly significant. To address this requirement, this study developed an innovative underwater object detection architecture based on YOLOv8, named YOLOv8-MU, aimed at significantly enhancing detection accuracy.By integrating the LarK module proposed in UniRepLKNet to optimize the backbone network, YOLOv8-MU aims to achieve a larger receptive field without increasing the model’s depth. Further, this research introduces C2fSTR, an innovative method that combines Swin Transformer with the C2f module. Additionally, we have incorporated the SPPFCSPC_EMA module, which combines Cross-Stage Partial Fast Spatial Pyramid Pooling (SPPFCSPC) with attention mechanisms, significantly improving the detection accuracy and robustness of various biological targets. Moreover, by introducing a fusion block based on DAMO-YOLO into the neck of the model, we further enhanced the model’s capability in multi-scale feature extraction. Finally, the adoption of the MPDIoU loss function, designed around vertex distance, effectively tackles the challenges of localization accuracy and boundary clarity in underwater organism detection. Experimental results on the URPC2019 dataset demonstrate that the YOLOv8-MU model achieved an [email protected] of 78.4%, marking improvements of 5.6%, 1.1%, and 4.0% over YOLOv5s, YOLOv7, and YOLOv8n respectively, indicating the leading performance (SOTA) of this method. On the other hand, further evaluation on the URPC2020 dataset confirmed the generalization capability of the YOLOv8-MU architecture, with its [email protected] reaching 80.4%, surpassing various models including YOLOv5x and YOLOv8n, showcasing the wide applicability of our proposed improved model architecture.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

The electroencephalogram (EEG) is a record of brain activity. Brain Computer Interface (BCI) technology formed by the EEG signal has become one of the hotspots at present. How to extract the feature signal of EEG is the most basic research of BCI technology. In this paper, A new method of recognizing fatigue, conscious, concentrated state of human brain is proposed by the combination of discrete wavelet transform and the neural network based on EEG signal. First of all, the law signal is preprocessed by the wavelet denoising method because the law EEG signal contains a large number of high frequency noise, which is decomposed into multi-layer high frequency signal and low frequency signal. thus, δ wave, θ wave, α wave, β wave are obtained by the wavelet transform. And then, frequency band energy of the different wave is regards as the feature signal of EEG. In the experiment, the feature signal is classified by radial basic function (RBF) and annealed chaotic competitive learning network (ACCLN). RBF and ACCLN networks are trained with 500 sets of sample data and are tested by 100 sets of samples in different mental states. The experimental results show that the average accuracy of RBF network under three conditions are 88.75%, 88.25%, 88.5%, respectively, and the correct rate of ACCLN network is 97%, 98%, 98%, respectively.

The task of weakly supervised point cloud semantic segmentation has received widespread attention and also has been widely used in autonomous driving, robotics, and modern industries. Due to the high dimensionality and large volume of point cloud data, many technical difficulties appeal to weakly supervised semantic processing, especially segmentation. However, weakly-supervised schemes usually provide only partial labelling information of the underlying point cloud data and thus need to effectively extract local features, geometric information, and contextual relationships only using these limited labelled data for supervised learning. To improve weakly-supervised semantic segmentation, we propose a novel segmentation network through the boundary-based feature aggregation based on a K-NN algorithm with down-sampling operation, and also introduce the smoothness loss and Siamese loss for effective segmentation. The experiments on public datasets demonstrate that our presented segmentation method exceeds most of the existing fully supervised and weakly-supervised methods in terms of mIoU. Specifically, our network has high segmentation accuracy on the labels of objects with similar geometrical structures, such as ceiling, wall, floor, chair and table, reaching 91.2%, 98.8%, 83.3%, 75.3% and 80.2%, respectively. Extensive experiments also illustrate its robustness, effectiveness, and generalization of the proposed weakly supervised segmentation network.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

To estimate the progressive collapse resistance capacity of a multi-column frame tube structure with the assembled truss beam composite floor (ATBCF), the pushdown analysis, and the nonlinear dynamic analysis as well, are conducted for such a structure by using the alternate load path (ALP) method. The bearing capacities of the remaining structures at three different work conditions, which are the side middle column failure, the edge middle column failure, and the corner column failure, are individually studied, and the collapse mechanism for the remaining structures is analyzed from the aspects of the internal force redistribution and the failure mode of the second defense line. Simultaneously, the influence of the column failure time on the dynamic response of the remaining structure and the dynamic amplification coefficient are discussed. The results show that the residual bearing capacity of the remaining structure with the bottom corner column failure is higher than that of the one with the side or edge middle column failure, while the latter has a stronger plastic deformation capacity. When the ALP method is adopted to operate the progressive collapse analysis, it is reasonable to take the column failure time as 0.1 times of the first-order vertical vibration period of the remaining structure, and it is suitable to set the dynamic amplification coefficient as of 2.0, which is the ratio of the maximum dynamic displacement to the static displacement of the remaining structure under the transient loading condition.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

In agriculture, soil-borne fungal pathogens, especially Fusarium oxysporum strains, are posing a serious threat to efforts to achieve global food security. In the search for safer agrochemicals, silica nanoparticles (SiO2NPs) have recently been proposed as a new tool to alleviate pathogen damage including Fusarium wilt. Hollow mesoporous silica nanoparticles (HMSNs), a unique class of SiO2NPs, have been widely accepted as a desired pesticide carrier. However, their role in enhancing the disease resistance and the specific mechanism remain unknown. In this study, three sizes of HMSNs (19, 96 and 406 nm as HMSNs–19, HMSNs–96 and HMSNs–406, respectively) were synthesized and characterized to determine their effects on seed germination, seedling growth, and Fusarium oxysporum f. sp. phaseolus (FOP) suppression in cowpea roots by foliar spray using phenotypes, fresh biomass and disease progression as indicators. The results revealed that three HMSNs exhibited no adverse impacts on seed germination and tended to improve plant growth. Also, they exert their FOP suppression with a size- and concentration-dependent manner. HMSNs–406 possessed the best control effect at a concentration of 1000 mg/L showing an upto 40.00% decline in the disease severity. The Si(OH)4 control was also effective on FOP suppression at a lower concentration of 100 mg/L, whereas its higher concentrations exhibited obviously adverse impacts on FOP control, seed germination and plant growth. Moreover, we conformed that HMSNs posed their Fusarium wilt suppression in cowpea plant by activating SA (salicylic acid)-dependent SAR (systemic acquired resistance) responses rather than directly suppressing FOP. A higher level of SA content and elevated expression of its maker genes of PR-1 and PR-5 in HMSNs–406 treated cowpea roots provided substantial evidences of this mode of action. Other resistance-related genes, as well as defense-responsive enzymes, were also involved in the HMSNs-activated SAR pathway. Overall, for the first time, our results extended a new role of HMSNs as a potent elicitor to serve as a versatile alternative for plant disease protection of low cost, highly efficiency and sustainability.

By using the particle swarm optimization algorithm for crystal structure prediction, we reveal a newly orthorhombic Cmcm structure of HfB4, which is more energetically superior to the previously proposed YB4-, ReP4-, FeB4-, CrB4-, and MnB4-type structures in the considered pressure range. The phonon dispersion and elastic constants calculations confirm that the new phase is dynamically and mechanically stable. The calculated large shear modulus (240 GPa) and high hardness (45.7 GPa) imply that the predicted Cmcm-HfB4 is a potential superhard material. Meanwhile, the directional dependences of the Young's modulus, bulk modulus, and shear modulus for HfB4 are systematically investigated. Further analyses of the density of states and electronic localization function indicate that the strong B-B and B-Hf covalent bonds greatly contribute to its high hardness and stability.

The spectra and global distributions of the X-ray emissions generated by the solar wind charge-exchange (SWCX) process in the terrestrial magnetosheath are investigated based on a global hybrid model and a global geocoronal hydrogen model. The solar wind O6+ ions which are the primary charge state for oxygen ions in solar wind are considered. The line emissivity of the charge-exchange born O5+ ions are calculated by Spectral Analysis System for Astrophysical and Lab oratory (SASAL). It is found that the emission lines from the O5+ ranges from 105.607 to 118.291 eV with the strong line at 107.047 eV. We then simulated the magnetosheath X-ray emission intensity distributions with a virtual camera at two positions of north pole and dusk at six stages during the passing of a perpendicular interplanetary shock combined with a tangential discontinuity structure through the Earth’s magnetosphere. During this process, the X-ray emission intensity increases with time, and the maximum value is 27.11 keV cm-2 s-1 sr-1 on the dayside, which is 4.5 times that before the solar wind structure reaches the Earth. A clear shock structure can be seen in the magnetosheath and moves earthward. The maximum emission intensity seen at dusk is always higher than that seen at north pole.

Aerial image classification has become popular and has attracted extensive research efforts in recent decades. The main challenge lies in its very high spatial resolution but relatively insufficient spectral information. To this end, spatial-spectral feature extraction is a popular strategy for classification. However, parameter determination for that feature extraction is usually time-consuming and depends excessively on experience. In this paper, an automatic spatial feature extraction approach based on image raster and segmental vector data cross-analysis is proposed for the classification of very high spatial resolution (VHSR) aerial imagery. First, multi-resolution segmentation is used to generate strongly homogeneous image objects and extract corresponding vectors. Then, to automatically explore the region of a ground target, two rules, which are derived from Tobler’s First Law of Geography (TFL) and a topological relationship of vector data, are integrated to constrain the extension of a region around a central object. Third, the shape and size of the extended region are described. A final classification map is achieved through a supervised classifier using shape, size, and spectral features. Experiments on three real aerial images of VHSR (0.1 to 0.32 m) are done to evaluate effectiveness and robustness of the proposed approach. Comparisons to state-of-the-art methods demonstrate the superiority of the proposed method in VHSR image classification.

Forest ecosystems make a greater contribution to carbon (C) stocks than any other terrestrial ecosystem. To understand the role of regional forest ecosystems in global climate change and carbon exchange, forest C stock and its spatial distribution within the small (2,300 km2) Liuxihe River basin were analyzed to determine the different contributors to the C stock. Forest C stocks were quantified by measuring the biomass of trees, understory vegetation, litter and roots, as well as soil organic C, using data from field samples and laboratory experiments. The results showed that forests stored 38.04 Tg C in the entire basin, with secondary and planted forests accounting for 89.82% and 10.18%, respectively, of the stored C. Five types of forests, a subtropical evergreen broad-leaved forest, a subtropical coniferous and broad-leaved mixed forest, a subtropical coniferous forest, a timber forest, and a non-wood forest, stored 257.55 ± 15.01, 218.92 ± 9.59, 195.24 ± 18.29, 177.42 ± 17.55, and 117.86 ± 6.04 Mg C ha−1, respectively. In the forest ecosystem C stocks of the basin, soils averagely contribute about 73.78%, not including root underground biomass. It provides a comprehensive method for forest ecosystem carbon investigation and forest management in small basin scale.

Abstract: Kiwifruit, a perennial horticultural crop known for its nutritional value, faces significant challenges due to biotic and abiotic stresses, affecting its yield and quality. Leucine-rich repeat receptor-like proteins (LRR-RLPs), a major group of receptor-like proteins in plants, have diverse functions in plant physiology, including growth, development, signal transduction, and stress responses. Despite their importance, the specific roles of kiwifruit LRR-RLPs in response to biotic and abiotic stresses remain poorly understood. In this study, we investigated the expression patterns of kiwifruit LRR-RLPs under various stress conditions, including pathogen stress, heat stress, waterlogging stress, and copper stress. Through genome and transcriptome analyses, we identified a total of 101, 164, and 105 LRR-RLPs in Actinidia Chinensis 'Hongyang', Actinidia eriantha 'Huate', and Actinidia chinensis 'Red5' kiwifruit, respectively, classified into 9 subgroups based on phylogenetic relationships. Synteny analysis revealed that the expansion of kiwifruit LRR-RLPs was primarily attributed to segmental duplication events. Using RNA-seq data from pathogen-infected kiwifruits, we identified specific LRR-RLP genes potentially involved in different stages of pathogen infection. Additionally, we observed the potential involvement of kiwifruit LRR-RLPs in abiotic stress responses, with upstream transcription factors possibly regulating their expression. Furthermore, protein interaction network analysis unveiled the participation of kiwifruit LRR-RLP genes in the regulatory network of abiotic stress responses. These findings highlight the crucial roles of LRR-RLPs in mediating both biotic and abiotic stress responses in kiwifruit, offering valuable insights for the breeding of stress-resistant kiwifruit varieties.

Despite the partial disclosure of driving scenario knowledge graphs, they still fail to meet the comprehensive needs of intelligent connected vehicles for driving knowledge. Current issues include the high complexity of pattern layer construction, insufficient accuracy of information extraction and fusion, and limited performance of knowledge reasoning models. To address these challenges, a hybrid knowledge graph method was adopted in the construction of the Driving Scenario Knowledge Graph (DSKG). Firstly, core concepts in the field were systematically sorted and classified, laying the foundation for the construction of a multi-level classified knowledge graph top-level ontology. Subsequently, by deeply exploring and analyzing the Traffic Genome data, 34 entities and 51 relations were extracted and integrated with the ontology layer, achieving the expansion and updating of the knowledge graph. Then, in terms of knowledge reasoning models, an analysis of the training results of the TransE, Complex, Distmult, and Rotate models in the entity linking prediction task of DSKG revealed that the Distmult model performed the best in metrics such as hit rate, making it more suitable for inference in DSKG. Finally, a standardized and widely applicable Driving Scenario Knowledge Graph was proposed. The DSKG and related materials have been publicly released for use by industry and academia.

Employing remote sensing techniques to evaluate crop residue cover (CRC) enables rapid mapping of tillage practices over large cropland areas, which has significant practical implications for monitoring the implementation of conservation tillage practices. This research utilized Sentinel-2 MSI and Landsat-8 OLI remotely sensed data, various spectral indices were calculated and the datasets were correlated with the field-measured CRC data. Selected spectral indices, highly significantly correlated, were chosen to build a correlation model between the indices and the CRC. Considering Sentinel-2 MSI and Landsat 8 OLI remotely sensed data variations in spectral and spatial scales, the accuracy of CRC models was evaluated using R2 and RMSE values. From the results, it's evident that all six spectral indices, including STI, NDTI, SRNDR, NDI5, NDI7 and NDSVI, registered correlation coefficients with the CRC exceeded 0.3 in the study area. STI and NDTI showed a stronger correlation to CRC, with coefficients of 0.810 and 0.803, respectively. For the Landsat 8 data, the lowest correlation obtained was for NDSVI with the Landsat 8 data with a correlation coefficient of 0.358. Applying the linear regression technique, STI and NDTI obtained higher accuracy compared to other indices in the Sentinel-2 MSI data. For NDTI and STI, The R2 values were 0.650 and 0.665, respectively, while their corresponding RMSE values were 3.96% and 4.03%. The highest model accuracy was obtained for the STI and NDTI constructed from the Landsat 8 OLI data (R2 values 0.41 and 0.40; RMSE values 5.25% and 5.27%, respectively). The CRC model built using partial least squares regression (PLSR) exhibited greater precision when applied to the Sentinel-2 MSI data (R2 value 0.894; RMSE value 2.18%) in comparison to the Landsat 8 OLI data (R2 value 0.695; RMSE value 3.70%). PLSR has the potential to enhance the precision of the model. In addition, the study area shows that the estimation of the CRC is better in the one-dimensional linear regression model and the PLSR model created with the Sentinel-2 MSI optical data compared to the Landsat 8 OLI optical remotely sensed data. The validation suggests that the CRC estimation in the study area is more precise when using the model relying on Sentinel-2 satellite imagery rather than the Landsat 8 OLI imagery.

The Mara River basin (MRB) has a world-famous ecosystem, but the vegetation has been damaged due to economic development in recent years, and there is little known about the area that will experience severe vegetation damage in the future. Based on the vegetation vulnerability system, principal component analysis, and three CMIP6 scenarios (SSP1-2.6, SSP2-4.5, SSP5-8.5), vegetation vulnerability was calculated in the base period (2010-2019), near-term period (2020-2059) and long-term period (2060-2099) in the MRB. The spatial cluster of vegetation vulnerability was revealed by spatial correlation analysis, and the transition of vegetation vulnerability of different periods was analyzed by stochastic matrix. The results showed that in all periods, the vulnerability showed a high-high cluster in the east, and a low-low cluster midstream and downstream. From the stochastic matrix, the area of high vulnerability increased the least under the SSP1-2.6, while it increased the most under the SSP5-8.5. The vegetation vulnerability upstream increased the most from the base period to the near-term period and long-term period in the MRB. By comparing the vegetation vulnerability under different scenarios, and pointing out the areas with the highest vulnerability increase, this study can better provide comprehensive decision-making for vegetation protection in the MRB.

Quantifying the landscape pattern change can effectively demonstrate the ecological progresses and the consequences of urbanization. Based on remotely sensed land cover data in 1994, 2000, 2006 and a gradient analysis with landscape metrics at landscape- and class- level, we attempted to characterize the individual and entire landscape patterns of Shanghai metropolitan during the rapid urbanization. We highlighted that a roadscape transect approach that combined the buffer zone method and the transect-based approach was introduced to describe the urban-rural patterns of agricultural, residential, green, industrial, and public facilities land along the railway route. Our results of landscape metrics showed significant spatiotemporal patterns and gradient variations along the transect. The urban growth pattern in two time spans conform to the hypothesis for diffusion–coalescence processes, implying that the railway is adaptive as a gradient element to analyze the landscape patterns with urbanization. As the natural landscape was replaced by urban landscape gradually, the urban fringe expanded radically. The results also showed that the desakota region expanded its extent widely. Satellite towns witnessed the continual transformation from the predominantly rural landscape to peri-urban landscape. Furthermore, the gap between urban and rural areas remained large especially in public service. More reasonable urban plans and land use policies should push to make more of an effort to transition from the urban-rural separation to coordinated urban-rural development. This study is a meaningful trial in demonstrating a new form of urban–rural transects to study the landscape change of large cities from a strategic viewpoint. By combining gradient analysis with landscape metrics, we addressed the process of urbanization both spatially and temporally, and provided a more quantitative approach to urban studies.

With continuous increase in integration of the semiconductor devices, the requirements on size accuracy and surface quality of the etched lead frame are higher. The etchant is a key factor on etching process and etched surface quality, while effects of the difference in etchants on microscopic etched surface morphology of the Cu alloy have not been directly studied. In this study, the aqua regia, acidic FeCl3 and CuCl2 solutions were used as etchants, and the CuCrSn alloy specimens with different microstructure were etched and characterized. The results show that the etching rate in aqua regia is high, and the grain orientation, grain boundary (GB) and dislocation have significant influence on the local etching rate. The preferential etching of some atomic planes forms steps between grains with different orientations, and the preferential etching around the GB and dislocation group forms grooves, resulting in high surface roughness. For etching of the FeCl3 and CuCl2 etchants, the steps and grooves become blurred, and almost invisible on the surface etched by the CuCl2 etchant, thus the surface roughness is much lower. The CuCrSn alloy surface etched by the aqua regia is clean, with little Cr-rich particles, while high density Cr-rich particles are remained on the surfaces etched with the FeCl3 and CuCl2 etchants. For the same kind of etchant, the ion concentration can affect the etching mechanism and etching surface morphology.

To enhance the applicability of dual-phase high-entropy alloys (HEAs) like Fe32Cr33Ni29Al3Ti3, fabricated via selective laser melting (SLM), a focus on improving their mechanical properties is essential. As part of this effort, heat treatment was explored. This study compares the microstructure and mechanical properties of the as-printed sample with those cooled in water after undergoing heat treatment at temperatures ranging from 1000 to 1200 ℃ for 1 hour. Both pre- and post-treatment samples reveal a dual-phase microstructure comprising FCC and BCC phases. Although heat treatment led to a reduction in tensile and yield strength, it significantly increased ductility compared to the as-printed sample. This strength-ductility trade-off is related to changes in grain sizes with ultrafine grains enhancing strength and micron grains optimizing ductility, also the influence of the content of FCC/BCC phases and dislocation density. In particular, the sample heat-treated at 1000 °C for 1 hour and then water-cooled exhibited a better combination of strength and ductility, a yield strength of 790 MPa, and an elongation of 13%. This research offers innovative perspectives on crafting dual-phase HEA of Fe32Cr33Ni29Al3Ti3, allowing for tailorable microstructure and mechanical properties through a synergistic approach involving SLM and heat treatment.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

Pyrethroid pesticides (PYRs) as the third most widely used pesticides, following organophosphorus and carbamate pesticides, which are of significant importance in the analysis and detection of vegetables. However, the current pretreatment technology for PYRs confronts challenges of difficult separation and low enrichment efficiency, resulting in a cumbersome and time-consuming pretreatment process with poor selectivity. Here, a simple and efficient magnetic solid-phase extraction (MSPE) strategy was developed to simultaneously purify and enrich five PYRs in vegetables, with the magnetic covalent organic framework nanomaterial COF-SiO2@Fe3O4 as an adsorbent. The COF-SiO2@Fe3O4 was prepared by a simple solvothermal conditions method, using Fe3O4 as magnetic core, benzidine and 3,3,5,5-tetraaldehyde biphenyl as two building units. COF-SiO2@Fe3O4 could effectively capture the targeted PYRs by virtue of its abundant π-electron system and hydroxyl groups. The impact of various experimental parameters on extraction efficiency was investigated to optimize the MSPE conditions, including adsorbent amount, extraction time, elution solvent type and elution time. Subsequently, method validation was conducted under the optimal conditions in conjunction with gas chromatography-mass spectrometry (GC-MS). Within the range of 5.00–100 μg·kg-1 (1.00–100 μg·kg-1 for bifenthrin and 2.5–100 μg·kg-1 for fenpropathrin), the five PYRs exhibited a strong linear relationship, with determination coefficients ranging from 0.9990 to 0.9997. The limits of detection (LODs) were 0.3–1.5 μg·kg-1, and the limits of quantification (LOQs) were 0.9–4.5 μg·kg-1. The recoveries were 80.2–116.7% with relative standard deviations (RSDs) below 7.0%. Finally, COF-SiO2@Fe3O4, NH2-SiO2@Fe3O4 and Fe3O4 were compared as MSPE adsorbents for PYRs. The results indicated that COF-SiO2@Fe3O4 was an efficient and rapid selective adsorbent for PYRs. This method holds promising prospects for the determination of PYRs in real samples.

This paper analyzes and compares models for predicting average magnet losses in interior permanent-magnet motors with fractional-slot concentrated windings due to harmonics in the armature reaction (assuming sinusoidal phase currents). Particularly, loss models adopting different formulations and solutions to the Helmholtz equation to solve for the eddy currents are compared to a simpler model relying on an assumed eddy-current distribution. Boundaries in terms of magnet dimensions and angular frequency are identified (numerically and using an identified approximate analytical expression) to aid the machine designer whether the more simple loss model is applicable or not. The assumption of a uniform flux-density variation (used in the loss models) is also investigated for the case of V-shaped and straight interior permanent magnets. Finally, predicted volumetric loss densities are exemplified for combinations of slot and pole numbers common in automotive applications.

Global warming may increase the potential evapotranspiration (Etp), thereby affecting the amount of clean water resources available in a region. In this study, the systematic biases in temperature outputs of 24 global climate models (GCMs) under 3 emission scenarios are corrected by using 8 bias correction methods. The trend of Etp in Yangzi River Delta in the 21st century is projected by using 4 Etp calculation formulas. The uncertainty of the projections is estimated and decomposed by using multi-way analysis of variance. The influence of uncertainty on the projected change signal is quantified by using the signal-to-noise ratio. The results show that, relative to the reference period (1971~2000), the annual mean daily Etp in Yangzi River Delta will increase by 0.14~0.17mm/d during the period 2021~2050 and by 0.21~0.41mm/d during the period 2061~2090, respectively. During 2021~2050, the uncertainty of Etp increase projections is dominantly contributed by the main effects of GCM (63%) and Etp calculation formula (24%). During 2061~2090, it is mainly contributed by the main effect of GCM (36%), followed by the main effects of emission scenario (34%) and Etp calculation formula (18%). The increase projections of Etp are generally reliable and robust during the two projection periods.

In order to develop novel botanical insecticides, the joint action of Ligusticum chuanxiong oil (LCO) and lemongrass oil (LO) against Aphis citricola van der Goot was determined systematically indoors and outdoors. The chemical profiles of LCO and LO as determined by gas chromatography- mass spectrometry analysis revealed that main compounds from LCO were Z-Ligustilide (44.58%) and Senkyunolide A (26.92%), and that of LO were geranial (42.16%) and neral (32.58%), respectively. The mixture of LCO and LO showed significant synergy against A. citricola, with a common-toxicity coefficient (CTC) value of 221.46 at the optimal ratio of LCO to LO (4: 1, w/w). Based on the results of solvents and emulsifiers screening, L. Chuanxiong oil · Lemongrass oil 20% emulsifiable concentrate (20% LCO · LO EC) was developed, which was confirmed to meet the requirements of a commercial pesticide by quality test. Field trials indicated that the insecticidal activity of the diluted 20% LCO · LO EC (1000 fold dilution) was comparable to conventional pesticide (20% imidacloprid EC) on A. citricola 7 days after application. Thus, the mixture of LCO and LO has the potential to be further developed as a botanical pesticide.

The properties of the annual, semiannual and triennial oscillations (AO, SAO and TO) in the middle atmosphere have been investigated using the TIMED/SABER temperature data. The Lomb-Scargle and wavelet spectra were used to determine the dominant oscillations in the background temperature field. The AO is prominent at the mid-latitudes. The AO amplitudes present an asymmetry between the two Hemispheres, being larger in the mesosphere than in the stratosphere. The SAO dominates the tropical regions, with three amplitude maxima at altitudes of 45, 75, and 85 km. The SAOs in the upper mesosphere (75 km) are out of phase with those in the mesopause (85 km) in the tropical regions, which can generate an enhancement of 11 K at each equinox, contributing to the lower mesospheric inversion layer. The TO is significant in the tropical region, with amplitude being maximum at 35, 45 and 85 km. Result shows that there may be potential interaction by the TO with SAO at 85km at the equator. The relation between ENSO and TO has also been discussed. The ENSO signal may modulate the amplitude of the TO, mainly in the lower stratosphere. The real origin of the TO may lie in the wave-mean-flow interaction.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

Ti and its alloys are the most commonly used materials for biomedical applications. However, bacterial infection after implant placement is still one of the significant rising complications. Therefore, the application of the antimicrobial agents into implant surfaces to prevent implant-associated infection has attracted lots of attention. Scientific papers have shown that inorganic antibacterial metal element (e.g. Ag, Cu, Zn) can be introduced to implant surfaces with the addition of metal nanoparticles or metallic compounds into electrolyte via micro-arc oxidation (MAO) technology. In this review, the effects of the composition and concentration of electrolyte and process parameters (e.g. voltage, current density, oxidation time) on morphological characteristics (e.g. surface morphology, bonding strength), antibacterial ability and biocompatibility of MAO antimicrobial coating were discussed in detail. Anti-infection and osseo-integration can be simultaneously accomplished with the selection of the proper antibacterial elements and operating parameters. Besides, MAO assisted by magnetron sputtering (MS) to endow Ti-based implant materials with superior antibacterial ability and biocompatibility was also discussed. Finally, the development trend of MAO technology in the future was forecasted.

Soil organic matter (SOM) is important for the global carbon cycle, and hyperspectral remote sensing has proven a promising method for fast SOM content estimation. However, soil physical properties significantly affect the sensitivity of satellite hyperspectral imaging to SOM, leading to poor generalization ability of the estimation model. This study aims to improve the spatiotemporal transferability of the SOM prediction model by alleviating the coupling effect of soil physical properties on the spectra. Based on satellite hyperspectral images and soil physical variables, including soil moisture (SM), soil surface roughness (root mean squared height, RMSH), and soil bulk weight (SBW), a soil spectral correction strategy was established based on the information unmixing method. Two important grain-producing areas in Northeast China were selected as study areas to verify the performance and transferability of the spectral correction model and SOM content prediction model. The results showed that soil spectral corrections based on fourth-order polynomials and the XG-Boost algorithm had excellent accuracy and generalization ability, with residual predictive deviations (RPD) exceeding 1.4 in almost all bands. In addition, when the soil spectral correction strategy was adopted, the accuracy of the SOM prediction model and the generalization ability after model migration were significantly improved. The SOM prediction accuracy based on the XG-Boost corrected spectrum was the highest, with a coefficient of determination (R2) of 0.76, root mean square error (RMSE) of 5.74 g/kg, and RPD of 1.68. The prediction accuracy, R2, RMSE, and RPD of the model after migration were 0.72, 6.71 g/kg, and 1.53, respectively. Compared with the direct migration prediction of the model, adopting the soil spectral correction strategy based on fourth-order polynomials and XG-Boost reduced the RMSE of the SOM prediction results by 57.90% and 60.27%, respectively. The performance comparison highlighted the advantages of considering soil physical properties in regional-scale SOM prediction.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

The hospital indoor environment plays a significant role in shaping the microbial exposures that humans encounter. Resistance to antibiotics is one of the mechanisms employed by bacteria to develop resilience against stress in indoor environments. The extensive usage of antibiotics has been a key factor in driving changes in the ecological function of antibiotic resistance genes (ARGs) and their acquisition by pathogenic bacteria. By integrating the 16S rRNA Illumina sequencing and high throughput-qPCR approaches with water and air dust samples across seven departments at Peking University Shenzhen Hospital, China, this study yielded intriguing findings regarding the department-specific variation, transmission, and correlation of bacteria, ARGs and MGEs within the hospital indoor environment. One notable observation was that the seasonal variation played a vital role in shaping the bacterial composition in the overall hospital indoor environment across seven studied departments. Nevertheless, a similar significant seasonal impact was only observed in the blood test room and emergency departments, rather than in the other five departments. Another intriguing finding was the correlation between ARGs and MGEs abundance. This correlation was evident in the overall hospital indoor environment, which was conversely not found in the emergency, pneumology and gynecology departments. Additionally, while there was no significant relationship that occurred between bacterial communities and ARGs/MGEs within the hospital, the gynecology department demonstrated a close link between bacterial communities and the presence of ARGs/MGEs. Notably, the gynecology department also stood out as an important source of bacteria and ARGs/MGEs for other departments. This study underscores the need for careful surveillance and monitoring of antibiotic resistance, particularly in Legionella spp. in man-made water systems. The findings also show the importance of monitoring and understanding the genetic elements such as Tp614 involved in gene transfer and recombination, as well as their impact on antimicrobial treatment efficacy.

Motion related human activity recognition using wearable sensors can potentially enable various useful daily applications. So far, most studies view it as a stand-alone mathematical classification problem without considering the physical nature of human motions. Consequently, they suffer from data dependencies and encounter the dimension disaster problem and the over-fitting issue, and their models are never human-readable. In this study, we start from a deep analysis on natural physical properties of human motions, and then propose a useful feature selection method to quantify each feature's classification contribution capability. On one hand, the "dimension disaster" problem can be avoid to some extent, due to the affined dimension of key features; On the other hand, over-fitting issue can be depressed since the knowledge implied in human motions are nearly invariant, which compensates the possible data inadequacy. The experiment results indicate that the proposed method performs superior to those adopted in related works, such as decision tree, k-NN, SVM, neural networks.

Achieving the dual development of rural revitalization and urbanization is an important strategic goal of China’s current modernization. Rural population and settlements are the main components of the countryside in traditional agricultural areas, and play an important role in the development of the countryside itself in terms of urban and rural land use and in the formation of urban and rural development patterns. This study analyzes the spatial and temporal changes in rural populations and settlements at the township level, as well as the degree and type of coupled development. A framework for urban–rural development relationships based on different types of coupled development is proposed, and a model of urban–rural forces is constructed to derive the spatial pattern of urban–rural development at the township level that may be formed in the future. Our study shows that the rural population and settlements in the study area are characterized by significant spatial and temporal dynamics, indicating that traditional rural areas are in a process of rapid development and change. The results of the township-level coupling measurements present four types of development in terms of the spatial pattern of urban–rural development: A-type is most likely to produce new cities or satellite towns in the Jixi–Harbin–Qiqihar area in the future; B-type is the fastest dying area in the future, located in the Harbin and Qitaihe clusters, with a tendency to merge into Harbin; C-type is the area to be focused on in the future to attract population and strictly control the growth of the rural settlement area to avoid it turning into B-type; D-type may develop regional township centers in the future in the combined area of Jiamusi City, Suihua City and Mudanjiang City. The results of the study provide experience in realizing rural revitalization according to local conditions. The new spatial pattern of urban–rural development provides an important reference for formulating land use policies, optimizing urban–rural land allocation and realizing integrated urban–rural development strategies.

Lactoperoxidase (LP), which is a high-value minor whey protein, has recently drawn extensive attention from research scientists and industry due to its multi-function and potential therapeutic applications. In this study, the separation and optimization of two similar-sized proteins, LP and lactoferrin (LF) were investigated using strong cation exchange column chromatography. Optimization was started with central composite design based experiments to characterize the importance of different decision variables. The three variables used in the optimization were flow rate, length of gradient and final salt concentration in the linear elution gradient step. The obtained empiric functional model represented the effect of the significant factors on the yield as the objective function. Afterwards, the calibrated mechanistic model was employed to predict accurate optimal set of variables. The optimal operating points were found and the results were compared with validation experiments. Predictions respecting yield confirmed a very good agreement with experimental results while keeping purity, a product quality characteristic, equal or above to a predefined value.

Predicting the outcome of a future game between two National Basketball Association (NBA) teams poses a challenging problem of interest to statistical scientists as well as the general public. In this article, we formalize the problem of predicting the game results as a classification problem and apply the principle of maximum entropy to construct NBA maximum entropy (NBAME) model that fits to discrete statistics for NBA games, and then predict the outcomes of NBA playoffs by the NBAME model. The best NBAME model is able to correctly predict the winning team 74.4 percent of the time as compared to some other machine learning algorithms which is correct 69.3 percent of the time.

A co-curing resin system consisting of 9368 epoxy resin for prepreg and 6808 epoxy resin for resin transfer molding (RTM) was developed. A corresponding preparation method of novel polymer composite bolted T-joint with internal skeleton and external skin was proposed based on prepreg-RTM co-curing process, and novel T-joints were fabricated. A series of conventional configuration T-joints based on RTM process and T-joints made of 2A12 aluminum alloy were prepared simultaneously. Bending performances were studied on these T-joints experimentally. The results indicate that 9368 epoxy resin and 6808 epoxy resin exhibit good compatibility in rheological and thermophysical properties. The novel T-joints prepared with prepreg-RTM co-curing process show no obvious fiber local winding or resin-rich regions inside, and the interface quality between internal skeleton and external skin is excellent. The main failure modes of the novel T-joint under bending load include separation of skin and skeleton and fracture along the thickness on the base panel; the skeleton carries the main bending load, but there is still load transfer between external skin and internal skeleton through their interface. The internal damages of the novel T-joint are highly consistent with surface damages observed visually, facilitating the detection and timely discovery of damages. The initial stiffness, damage initiation load, and ultimate load of the novel T-joint are 1.65 times, 5.89 times, and 3.45 times that of conventional T-joint, respectively. When considering the influence of density, the relative initial stiffness and relative ultimate load of the novel T-joint are 1.44 times and 2.07 times that of aluminum alloy T-joint, respectively.

A set of polymer composite bolted T-joints with novel configuration consisting of internal skeleton and external skin was fabricated using a prepreg-RTM co-curing molding process. Experiments were conducted to study their mechanical properties under bending load. A finite element model with a polymer resin area between the skin and skeleton was established and verified by the experimental results. Then, the damage propagation process and failure mechanism of the joint and the influence of three factors related to the layer characteristics of the skin and skeleton were investigated by the validated models. The results show that the bending stiffness and the yield limit load of the novel composite T-joint are 0.81 times and 1.65 times that of the 2A12 aluminum T-joint respectively, while at only 55.4% of its weight. The damage of the joint initiates within the resin area and leads to a degradation of the joint bending performances. The preferred stacking sequence of the skeleton is [0/+45/90/-45]ns when primarily subjected to bending loads. The decrease in bending performances is within 5% with the inclining angle of the skeleton less than 12 degrees. The more layers of 90° in the skin, the better bending performances of the joints, while the more layer of 0°, the poorer bending performances.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

Intelligent fault diagnosis techniques have replaced the time-consuming and unreliable human analysis, increasing the efficiency of fault diagnosis. Deep learning model can improve the accuracy of intelligent fault diagnosis with the help of its multilayer nonlinear mapping ability. This paper has proposed a novel method named Deep Convolutional Neural Networks with Wide First-layer Kernels (WDCNN). The proposed method uses raw vibration signals as input (data augmentation is used to generate more inputs), and uses the wide kernels in first convolutional layer for extracting feature and suppressing high frequency noise. Small convolutional kernels in the preceding layers are used for multilayer nonlinear mapping. AdaBN is implemented to improve the domain adaptation ability of the model. The proposed model addresses the problem that currently, the accuracy of CNN applied to fault diagnosis is not very high. WDCNN can not only achieve 100% classification accuracy on normal signals, but also outperform state of the art DNN model which is based on frequency features under different working load and noisy environment.

The collapsible loess will rapidly soften and lose its bearing capacity when soaked in water. Under a mild condition (20°C), the biomimetic inorganic agent, Diammonium phosphate (DAP), reacts with calcite in the collapsible loess, producing a stronger bonding material, hydroxyapatite (HAP), to modify and stabilize the soil. Uniaxial compression, permeability tests and morphological analysis using XRD and SEM/EDX microscopy were carried out to assess the effectiveness of DAP stabilization on the collapsible loess. The results indicated that HAP improved the inter-particle bonding within loess, filled the pores within particles, reduced the permeability, and consequently mitigated collapsibility of loess. The compressive strength of DAP-treated loess increased as DAP concentration increased. Following 28-days curing, the compressive strength of the loess treated with a 3.0 mol/L DAP solution was six times greater than that of the untreated group. DAP's reinforcement effect on loess was superior to that of cement. The compressive strength of DAP-treated loess was about double that of cement-treated loess and the permeability coefficient was reduced by more than 50% at equivalent solid content. Furthermore, DAP generated 68% fewer carbon emissions compared to Portland cement. Considering eco-friendly and sustainable development, DAP offers a more competitive alternative for modification and stabilization of loess.