This study was aimed to investigate the effect of xylan depolymerizing enzyme namely endo-xylanase (Xyn) combined with debranching enzymes namely arabinofuranosidase (Afd) and feruloyl esterase (FE) on digestion, growth performance and intestinal volatile fatty acid profile of piglets. The in vitro experiments were firstly conducted to examine the enzymological properties of Xyn, Afd and FE, the synergy among these enzymes, together with the effect of combination of these enzymes on digestion of piglet diet. The in vivo experiment was then implemented by allocating 270 35-d-old postweaning piglets into 3 treatment groups: control group, Xyn group and (Xyn+Afd+FE) group. Each group had 6 replicates (15 piglets/replicate). The results revealed a satisfying thermostability and pH stability of Xyn, Afd and FE. Combination of Xyn, Afd and FE had a superiority (P < 0.05) over Xyn alone and its combination with Afd or FE in promoting degradation of different bran fibers rich in arabinoxylan (Abx). Treatment with combination of Xyn, Afd and FE had advantages over Xyn alone to induce increasing trends (P < 0.10) of in vitro digestibility of dietary nutrients (dry matter, crude protein, crude ash and gross energy) and piglet growth performance (average daily gain, final body weight and feed efficiency), concurrent with a reduction (P < 0.05) of diarrhea rate and increases (P < 0.05) in cecal acetic acid, butyric acid and total volatile fatty acids concentrations as well as pH value of piglets. Collectively, combination of Xyn, Afd and FE was efficient in benefiting degradation of Abx in brans, as well as improving digestion, growth performance and intestinal volatile fatty acid profile of piglets.

Notion of median in one dimension is a foundational element in nonparametric statistics. It has been extended to multi-dimensional cases both in location and in regression via notions of data depth. Regression depth (RD) and projection regression depth (PRD) represent the two most promising notions in regression. Carrizosa depth DC is another depth notion in regression. Depth induced regression medians (maximum depth estimators) serve as robust alternatives to the classical least squares estimator. The uniqueness of regression medians is indispensable in the discussion of their properties and the asymptotics (consistency and limiting distribution) of sample regression medians. Are the regression medians induced from RD, PRD, and DC unique? Answering this question is the main goal of this article. It is found that only the regression median induced from PRD possesses the desired uniqueness property. The conventional remedy measure for non-uniqueness, taking average of all medians, might yield an estimator that no longer possesses the maximum depth in both RD and DC cases. These and other findings indicate that the PRD and its induced median are highly favorable among their leading competitors.

Among all the processing technologies of heat-treatable aluminum alloys like 2219 aluminum alloy, using friction stir welding (FSW) as the joining technology and using electromagnetic forming (EMF) for plastic forming technology both have obvious advantages and successful applications. Therefore, there is a broad prospect for the compound technologies which can be used on the 2219 aluminum alloy to manufacture the large-scale thin-wall parts in the astronautic industry. The microstructure and mechanical properties of 2219 aluminum alloy under the process compounded of FSW, heat treatment, and EMF were investigated by means of tensile test, optical microscope (OM), and scanning electron microscope (SEM). The results show that the reduction of strength, which was caused during the FSW process, can be recovered effectively by the post-welding heat treatment composed of solid solution and aging, while the ductility was still reduced after heat treatment. Under the compound technology of FSW, heat treatment, and EMF, the forming limit of 2219 aluminum alloy decreased distinctly due to the poor ductility of the welding joint. A ribbon-pattern, which was formed due to the banded structure caused by FSW process, was found on the fracture surface of welded 2219 aluminum alloy after EMF treatment. During the EMF process, because of the effects of induced eddy current, a unique structure, which was manifested as a molted-surface appearance under the SEM observation, was formed as the material fractured.

Background: Depressive symptoms are a serious public health problem that are associated with BADL and IADL disabilities in Chinese adults.Objective: The limitation of activities of daily living (ADL) affects the mental health of older adults. We distinguished activities of daily living into basic activities of daily living (BADL) and instrumental activities of daily living (IADL) to explore the relationship between these two limitations and depressive symptoms among older Chinese adults using nationally representative cross-sectional data. In addition, this study explored the relationships between BADL, IADL and depression risk in elderly people at the individual and provincial levels and in rural and urban subgroups.Methods: The China Health and Retirement Longitudinal Study(CHARLS) survey used a multistage probability‒proportional‒to-size (PPS) sampling technique. Province-level socioeconomic characteristics were merged with microdata for respondents over 60 years of age from the 2020 China Health and Retirement Longitudinal Study (CHARLS 2020) Wave 5 (n=10,036) by the author. The respondents were asked whether their BADL and IADL were limited . The risk of depression was assessed using the 10-item Center for Epidemiological Studies Depression Scale(CES-D 10). The chi-squared test was used to explore whether having a disability that limits BADL and IADL were associated with mental health status. A binary logistic regression model was used to evaluate this association further after controlling for confounding factors.Results: Overall, 27.5% (2759/10036) and 25.7% (2776/10036) of the participants over 60 years of age were limited in their BADL and IADL, respectively. Regression analyses revealed that older adults whose BADL were not limited (OR=1.942, 95% CI: 1.638–2.303, P < .001) and whose IADL were not limited (OR=1.775, 95% CI: 1.485–2.122, P < .001) had a lower risk of depression than older adults whose BADL and IADL were limited. In addition, older adults who were female (P <.001), were 60-69 years (P < .005), had a partner (P <0.001), were literate (P <.001), lived in a rural area (P <.001), had a retirement pension (P <.001), had 3 or more children (P < .001), did not have any chronic diseases (P < .001), had a fair SRH score (P < .001), drank alcohol (P < .001), exercised (P < .005), did not participate in social activities (P < .001), or had an above average per capita household consumption (P < .001) lived in provinces with the first quartile of GDP per capita (P < .001) and lived in provinces with the second quartile of the number of beds in medical institutions per 10,000 persons (P < .001) were more likely to experience depressive symptoms, while smoking had no effect. In a binary logistic regression, older adults who were single (OR=0.669, 95% CI=0.551, 0.812), illiterate (OR=0.646, 95% CI=0.504, 0.828), living in rural areas (OR=1.485, 95% CI=1.270, 1.735), without retirement pensions (OR=0.671, 95% CI=0.582, 0.819) and with very bad SRH scores (OR=0.411, 95% CI=0.311, 0.544) had a greater risk of depressive symptoms. In the binary logistic regression analysis of the urban and rural subgroups separately, the results indicated that old people whose BADL or IADL were not limited were associated with a risk of depression, especially rural (P < .001) and urban (P < .001) participants.Conclusions: The present study provides evidence of an association between BADL, IADL and depression in older Chinese adults. This study revealed that individuals with limited BADL and limited IADL were predominantly depressed older adults. Binary logistic regression models suggested that disabilities limiting BADL and IADL were more likely to be associated with depressive symptoms in rural Chinese older adults. Older adults should be encouraged to participate in moderate physical and social activities to prevent physical dysfunction. The government and social work organisations should pay attention to the mental health of older adults in rural areas.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

Applied talent is not only a builder of human civilization but also a promoter of economic development. They not only need systematic and solid engineering theoretical knowledge but also rich engineering practical experience. Applied undergraduate colleges are the cradle for cultivating applied talent and shoulder the important mission of cultivating various types of applied talent for society. With the rapid development of higher education, the number of applied undergraduate institutions has sharply increased, but the quality of applied talent cultivated by them has shown a significant decline, which greatly restricts the pace of industrial development in the world. This article proposes a new concept of promoting the "three certificates" (graduation certificate, degree certificate, and skill certificate) education model in applied undergraduate colleges, which is of great significance for the country to cultivate composite talents with the ability of "product design, production management, and product processing" at the same time.

The information data accuracy affects the working reliability of production management system directly. Mobile equipment is an important part of integrated manufacturing system, in the course of its works, due to the complex working environment and the dynamic change of its position, it lead to the important problem of information detection distortion. Because the application of fractional differential operator has the dual functions of enhancing signal strength and reducing data error, we puts forward a data processing method of obtaining production information data of various accuracy by changing the parameters of fractional differential operator. Establish a mobile equipment detection data fusion processing model based on fractional order partial differential equations and apply it in the processing experiment of mobile equipment testing information detection data in an integrated manufacturing system, the feasibility and effectiveness of the method are verified. We conclude that the fractional order partial differential equations used in the processing of mobile equipment monitoring information data of an integrated manufacturing system has the function of obtaining production information data of various accuracy, which are of great significance to improve the working reliability in integrated manufacturing system. which is of great significance to improve the working reliability and scientific decision of integrated manufacturing system.

In engineering practice, various types of information data are affected by many factors during the collection process. For example, information data measurement errors are caused by equipment performance and the working environment. During the transmission of detection information, the signal distortion caused by energy loss and signal interference causes unpredictable detection errors in the collected information data. Through the study of fractional calculus theory, it was found that it is suitable for studying nonlinear, non-causal, and non-stationary signals, and has the dual functions of improving detection information and enhancing signal strength. Therefore, under the influence of many factors, we applied the fractional difference algorithm to the field of information data processing. Multi-sensor detection data fusion algorithm based on the fractional partial differential equation was adopted to establish its online detection data. A multi-sensor detection data fusion algorithm based on a fractional partial differential equation is established, which effectively fuses the information data detection errors caused by various influencing factors and greatly improves the detection accuracy of information data. The effectiveness of this method is proved through its application in an experiment.

3D object detection is essential for an accurate and reliable autonomous driving system. Currently, the methods used by the state-of-the-art two-stage detectors are not flexible enough and their fea-ture extraction capabilities are very limited to cope effectively with the disorder and irregularity of point clouds. In this paper, we combine the advantages of both PV-RCNN and PAConv (Position Adaptive Convolution) to create a completely new network, FANet, in order to overcome the ir-regularity and disorder of point clouds. The convolution in our network builds convolutional ker-nels from a basic weight matrix, whose combined coefficients are learned adaptively by LearnNet from relative points. This network allows for flexible modeling of complex spatial variations and geometric structures in the 3D point cloud, enabling better extraction of point cloud features and producing high-quality 3D proposal boxes. Compared to other methods, FANet is superior in terms of 3D object detection accuracy. Extensive experiments on the KITTI dataset have shown a signif-icant improvement in our approach.

In the field of maneuvering target tracking, the combined observations of azimuth and Doppler may cause weak observation or non-observation in the application of traditional target tracking algorithms. Additionally, traditional target-tracking algorithms require pre-defined multiple mathematical models to accurately capture the complex motion states of targets, while model mismatch and unavoidable measurement noise lead to significant errors in target state prediction. To address those above challenges, in recent years, the target-tracking algorithms based on neural networks, such as recurrent neural networks (RNNs), long short-term memory (LSTM) networks, and Transformer architectures, have been widely used for their unique advantages to achieve accurate predictions. To better model the nonlinear relationship between the observation time series and the target state time series, as well as the contextual relationship among time series points, we present a deep learning algorithm called recursive downsample-convolve-interact neural network (RDCINN) based on convolutional neural network (CNN) that downsamples time series into sub-sequences and extracts multi-resolution features to enable the modeling of complex relationships between time series, which overcomes the shortcomings of traditional target-tracking algorithms in using observation information inefficiently due to weak observation or non-observation. The experimental results show that our algorithm outperforms other existing algorithms in the scenario of strong maneuvering target tracking with the combined observations of azimuth and Doppler.

Ship pilots and maritime safety administration have an urgent need for more accurate and earlier warnings on strong wind gusts. This study firstly investigates the “Oriental Star” cruise ship cap-sizing event in 2015, one of the deadliest shipwreck events in recent years, and explores all related hydro-meteorological components in a global mesoscale model. It is found that, rather than the missing signal in raw surface wind prediction, the cumulus precipitation variable (CP) increases dramatically during the accident occurrence, which significantly corresponds to the sub-grid strong wind gust. The effective lead-time can be extended from 24hr (deterministic model) to 48hr (en-semble model). This finding is then verified in another two recent deadly cruise boat accidents. The introduction of the new variable is bearing the hope of improvement to the current maritime safeguard system, on predicting sub-grid strong wind gusts for small-size cruise boats in offshore and inland rivers. Finally, an automatic-response system is developed to provide economical con-vection prediction via Inmarsat email communication, aiming to explore operational severe con-vective gust early-warning and appropriate numerical mesoscale model application.

Both sand and fly ash were found to be promising for phosphorus removal in bioretention systems. However, nutrient removal in bioretention systems with sand, soil and fly ash was still uncertain due to a lack of data about the influence of layer structure and submerged zone. In this study, a mixture with sand, soil and fly ash (1:1:1) was selected as the base in bioretention systems with different packed layer structures and heights of submerged zone. The comparison of multi-layered structure with mixed structure implied that the used bioretention system with multi-layered structure was superior to that with mixed structure for nitrogen and phosphorus removal. The investigation of the influence of submerged zones on nutrient removal indicated that the submerged zone could significantly improve nitrate removal efficiency with 67.52%-86.32%, while sharply reduce the removal of ammonia nitrogen (from 95.15% to 51.81%) and TP (from 88.66% to 44.50%). Overall evaluation of the effect of packed layer structures and submerged zones suggested that the bioretention system with multi-layered structure at the height of submerged zone at 20-40cm was the most satisfactory, due to its microbial environment.

Due to the special characteristics of the shooting distance and angle of remote sensing satellites, the pixel area ratio of ship targets is small and the feature expression is insufficient, which leads to unsatisfactory ship detection performance and even situations such as missed detection and false detection. In this study, we propose an improved-YOLOv5 algorithm. The improvement strategies mainly include: (1) Add the Convolutional Block Attention Module (CBAM) into the Backbone to enhance the extraction of target-adaptive optimal features; (2) Introduce cross-layer connection channel and lightweight GSConv structure into the Neck to achieve higher-level multi-scale feature fusion and reduce the number of model parameters; (3) The Wise-IoU loss function is used to cal-culate the localization loss in the Output, and assign reasonable gradient gains to cope with dif-ferences in image quality. In addition, during the preprocessing stage of experimental data, a me-dian and bilateral filter method is used for noise reduction to reduce interference from ripples and waves and highlight the information of ship features. The experimental results show that Im-proved-YOLOv5 has a significant improvement in recognition accuracy compared to various mainstream target detection algorithms; Compared to the original YOLOv5s, the mean Average Precision (mAP) has improved by 3.2% and the Frames Per Second (FPN) has accelerated by 8.7%.

The quality of underground space information has become a major problem that endangers the safety of underground spaces. Currently, the main methods for the high-precision and long-distance transmission of detection information are radar and optical methods. However, in practical applications, we found that the radar method has the shortcomings of large energy loss and poor anti-jamming ability, which limit the accuracy of information data transmission and distance. The optical method has the shortcomings that the weather has a great impact on its accuracy and can only be applied to static objects above ground; therefore, it has the limitation of application objects and use environment. More importantly, the current high-precision information remote detection methods are limited to the detection of overground space objects and are not applicable to the detection of various information data in underground space. In this study, we analyze the spectral properties of the fractional differential operator and find that it is suitable for studying non-linear, non-causal, and non-stationary signals. The theory of fractional calculus is applied to the field of data processing, and a mathematical model of remote transmission and high-precision detection of information based on fractional difference is established, which realizes the functions of high-precision and remote detection of information. By fusing the information data to detect the mathematical model over a long distance and with high accuracy, a mathematical model for stratum data processing used to provide long-distance and high-accuracy data was established. Through application in engineering practice, the effectiveness of this method for underground space information data detection was verified.

This study investigates the microstructures and deformation mechanism of hetero-structured pure titanium under different high strain rates (500 s-1，1000 s-1，2000 s-1). The influence of strain rate on the deformation mechanism is examined. As the strain rate increases, the dominance of dislocation slip decreases while deformation twinning becomes more prominent. Notably, at a strain rate of 2000s-1, nanoscale twin lamellae are activated within grain with a size of 500nm, which is a rarely observed phenomenon in pure Ti. Additionally, martensitic phase transformation is also identified. These findings can greatly enhance our understanding of the mechanical responses of Ti and broaden the potential applications of Ti in dynamic deformation scenarios.

In the increasingly complex environment of downhole working conditions such as frequent opening and closing of oil and gas wells, acidification/multi-stage fracturing, steam huff and puff, and strong injection and production, the traditional casing string design method standards based on strength design have gradually highlighted their limitations. It is necessary to formulate string design method standards that consider the full life cycle of wells such as drilling and completion, fracturing, and production operations. Starting from the analysis of the advantages and disadvantages of traditional casing string design methods, this paper presents the characteristics of the strain design methods and seal design methods that have been formulated for the life cycle of the string. The strain design method breaks through the traditional design concept and allows the design concept of controllable deformation of the pipe string. The sealing design method is currently the only standard method for the design of tubing strings. At the same time, it further proposes to consider the trend of pipe strength deterioration and establish a time dimension-based life cycle pipe string design method standard, which effectively solves the safety problem of pipe string design in production and operation.

Strontium (Sr) is a trace element in human body that able to promote bone formation and inhibit bone absorption. The conversion coating of strontium phosphate (Sr-P) on the surface of titanium (Ti) can improve its biological properties, and has a wide application prospect in the fields of dentistry and orthopedics. In this present study, Sr-P coatings with SrHPO4 and Sr3(PO4)2 crystals on Ti are prepared by phosphate chemical conversion (PCC) treatment. And the effect of pH on the properties of Sr-P coatings is researched. The results prove that phase composition, morphology and corrosion resistance of coated Ti are different with the pH values in PCC solution. The morphologies of conversion deposition on Ti change from plat-like to cluster-like, and then homogeneous microcrystals, as pH value changed from 2.50 to 3.25. Only discrete SrHPO4 crystals are generating on substrate at lower pH value, while relative stable Sr3(PO4)2 and SrHPO4 crystals are growing and subsequently forming an integrated coating on Ti as pH is higher than 2.50. The corrosion resistance of coated Ti improves comparing with that of bare Ti because of forming Sr-P coatings with Sr3(PO4)2 phase. In addition, it is indicated that the Sr-P coatings can improve the adhesion and differentiation of BMSCs.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The effects of different pulse frequencies on the microstructure grain size and solid solubility of Al-9Si alloy were systematically investigated using OM, SEM, and EDS. The effects on the mechanical properties of the alloy were analyzed using micro-Vickers hardness tester and multifunctional friction tester. During the solidification process, the Al-9Si alloy is exposed to high-frequency electric current pulses with a current density of 300A/cm2 and frequencies of 0Hz, 500Hz, 1 000Hz, and 2 000Hz. The experimental results show that as the high-frequency pulse frequency increases, the Lorentz force also increases. The intense electromagnetic stirring leads to grain refinement. However, as the pulse frequency continues to increase, the combined effect of Joule heating and Lorentz force results in an enlargement of the melt zone and an increase in grain size. At a pulse frequency of 1 000Hz, the eutectic structure size of the Al-9Si alloy is optimal, with the average size reduced to 13.87μm and a dense distribution, effectively eliminating primary Si. The EDS results revealed that the high-frequency pulse led to a more uniform distribution of Si elements within the matrix, and the solid solubility of Si in the α-Al matrix increased to a maximum value of 1.99%, representing a 39.2% increase. At a pulse frequency of 1 000Hz, the sample demonstrates the most favorable mechanical properties, with the friction coefficient reaching a minimum value of 0.302, representing a 37.7% decrease in the average friction coefficient. The results demonstrate that high-frequency pulsing is an effective method for enhancing the mechanical properties of Al-9Si alloy.

Porous metals possess low bulk density, large specific strength, high stiffness and special thermal, electromagnetic and acoustic conductivity, so that porous metals are widely used in filtration and separation, flame retardant explosion-proof, biomedical application, etc. Compared with its corresponding dense metal, the presence of porous structures also leads to different corrosive performances of porous metal. So, some researches have utilized weight loss method, electrochemical impedance to evaluate porous metals’ corrosion behavior; however, the influence of pore structure on metal corrosion is still controversial, and present methods used for analyses of porous metals’ corrosion are statistical averages of the corrosion behavior of the entire porous material, which cannot accurately reflect the corrosion behavior inside the pore structure. Herein, we prepare porous copper samples with 0, 24, 72, 96 pores using mechanical process, and employ scanning kelvin probe combined with electrochemical polarization curve and impedance spectroscopy to test the corrosion performance of the porous copper in static and dynamic NaCl solution. The relevant results indicate that in static solution, the corrosion resistance of samples gradually increases with the rise of the number of pores. By contrast, the sample with 24 pores exhibits more susceptible to corrosion than the sample without pore.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

To characterize the mechanisms by which the highly-conserved exocyst trafficking complex regulates eye physiology in zebrafish and mice, we focused on exoc5 (aka sec10), a central exocyst component. We analyzed both exoc5 zebrafish mutants and retinal pigmented epithelium (RPE)-specific Exoc5 knockout mice. Exoc5 is present in both the non-pigmented epithelium of the ciliary body and in the RPE. In this study we set out to establish an animal model to study the mechanisms underlying the ocular phenotype and to establish if loss of visual function is induced by postnatal RPE Exoc5-deficiency. Exoc5-/- zebrafish showed smaller eyes, with decreased number of melanocytes in the RPE and shorter photoreceptor outer segments. At 3.5 days post fertilization, loss of rod and cone opsins were observed in zebrafish Tg:exoc5 mutants. Mice with postnatal RPE-specific loss of Exoc5 showed retinal thinning associated with compromised visual function, and loss of visual photoreceptor pigments. This retinal phenotype in Exoc5-/- mice was present at 20-weeks, and the phenotype was more severe at 27-weeks, indicating progressive disease phenotype. We previously showed that the exocyst is necessary for photoreceptor ciliogenesis and retinal development. Here, we report that exoc5 mutant zebrafish and mice with RPE-specific genetic ablation of Exoc5 develop abnormal RPE pigmentation, resulting in retinal cell dystrophy and loss of visual pigments associated with compromised vision. As RPE cells are “downstream” of photoreceptor cells in the visual process, these data suggest exocyst-mediated retrograde communication and dependence between the RPE and photoreceptors.

In view of the problem that the hot and cold loads of mushroom houses are affected by multiple factors such as environment, mushrooms, and equipment, which are difficult to accurately model, this paper proposes a short-term load prediction method based on empirical wavelet transform (EWT) and mixed autoregressive integrated moving average (ARIMA) and convolutional bi-directional short- and long-term attention mechanism (CNN-BiLSTM-Attention). The method first uses the Boruta algorithm to filter the input characteristics, and then uses the EWT method to decompose the mushroom house load data into 4 modal components. Then the Lempel-Ziv method is introduced to divide the modal components into two categories of high and low frequencies, and the CNN-BiLSTM-Attention and ARIMA prediction models are constructed separately. Finally, the two types of prediction results are superimposed and reconstructed to obtain the final load prediction value. The test results show that the Boruta algorithm can effectively filter out the characteristics of key influencing factors. Compared with the Spearman and Pearson correlation coefficient methods, the mean absolute error (MAE) of the prediction results is reduced by 14.72% and 3.75%, respectively; compared with the ensemble empirical mode decomposition (EEMD) method, the EWT method can increase the decomposition and reconstruction error by 103 orders of magnitude, which can effectively improve the prediction accuracy of the model; compared with the individual neural network model, the prediction effect of the model proposed in this paper has obvious advantages, and the MAE, root mean square error (RMSE) and mean absolute percentage error (MAPE) of the prediction results are reduced respectively. 31.06%, 26.52% and 39.27%.

In recent years discrete element method (DEM) has gradually been applied to the traditional fluidization simulation of fine particles in micro fluidized bed (MFB). The application of DEM in simulating fast fluidization of fine particles in MFB has not yet received attention. This article presents a drag model that relies on the surrounding environment of particles, namely particle circumstance-dependent drag modle or PCDD model. Fast fluidization in MFB of fine particles is simulated using DEM based on the PCDD model. It is found that the gas-solid two-phase flow in MFB meets the common law of fast fluidization in circulating fluidized bed (CFB) to a certain extent, and also presents a special law that is significantly different from that in CFB. Simulations indicate that the local structure in MFB exhibits particle aggregation which is a natural property of fast fluidized, forming a structure where continuous dilute phase and dispersed concentrated phase coexist. The formation and fragmentation of particle clusters in different local regions of the bed have time synchronization. There exists strong effect of solid back-mixing in MFB, leading to relatively low outlet solid flux. The gas back-mixing effect is, however, not so distinct. The axial porosity shows a monotonically increasing distribution with the bed height, but does not strictly follow the single exponential distribution. The solid volume fraction at the bottom of the bed is significantly lower than the correlated value in CFB. The axial heterogeneous distribution of the cross-sectional average porosity in the lower half of the bed is also weakened. The radial porosity shows a distribution pattern of higher in the central region and lower in the sidewall region. Compared with the correlation results in CFB, the porosity near the central region in MFB is relatively low, while the porosity near the sidewall region is relatively high. The geometric size of the container, especially the radial size, is much smaller than that of a CFB. The relative area of contact between the MFB wall and particles is larger, and the wall friction factor becomes more significant. This may be the main reason for the time synchronization of particle agglomeration, severe particle back-mixing, low outlet solid flux, monotonically increasing axial porosity and weak core-annular structure of radial porosity.

Two new compounds, named aspergilins A (1) and B (2), were isolated from the mangrove endophytic fungus Aspergillus sp. A1E3 associated with the fruit of Rhizophora mucronata, together with averufanin (3). The planar structures and absolute configurations of these compounds were unambiguously established by extensive NMR investigations, quantum-chemical electronic circular dichroism (ECD) calculations, and single-crystal X-ray diffraction analysis. Most notably, the absolute configuration of aspergillin A (1) was determined by single-crystal X-ray diffraction analysis of its tri-pivaloyl derivative 4, conducted with Cu Kα radiation, whereas that of averufanin (3) was first clarified by quantum-chemical ECD calculations. Aspergilin A is the first orsellinic acid–ribose–​pyridazinone-Noxide hybrid containing a unique β-oxo-2,3-dihydropyridazine 1-oxide moiety, whereas aspergilin B and averufanin are the sterigmatocystin and anthraquinone derivative, respectively. From the perspective of biosynthesis, aspergilin A could be originated from the combined assembly of three building blocks, viz., orsellinic acid, β-D-ribofuranose, and L-glutamine. It is an unprecedented alkaloid-Noxide involving biosynthetic pathways of polyketide, pentose, and amino acid. Aspergilin B (2) exhibited potent antiproliferative activity against four cancer cell lines. In addition, Aspergilin B (2) dose-dependently induced G2/M phase arrest in HepG2 cells.

Micro-nanoparticles' characteristics in geothermal fluids can be applied to detect of deep hidden geothermal resources. Observations using a nanoparticle tracking analyzer (NTA) indicated that the karst geothermal water collected in the central area of Shandong Province (Jinan and Zibo) contains many natural micro-nanoparticles with sizes primarily ranging between 100 nm and 5 μm. The micro-nanoparticles’ type, shape, crystal form, and chemical composition in the samples were analyzed using transmission electron microscopy (TEM). TEM images and energy dispersive spectroscopy showed that the micro-nanoparticles in geothermal water samples were mostly amorphous, irregular, or nearly spherical, with rough edges. The micro-nanoparticles were mainly carbonates, sulfates, and chlorine-containing Fe, Ca, Na, and Mg. The characteristics of the particles can reveal the properties of the deep, hot reservoirs and aquifers from where they originate. Therefore, we believe that natural micro-nanoparticles can be essential to detecting and studying deep, hidden geothermal resources, which is a novel approach to exploring deep, hidden geothermal resources.

In this paper, an adaptive proportional and integral (PI) controller for speed control of electric drives is developed. The adaptive PI controller is designed based on model reference adaptive identification and the Lyapunov function so that the system stability can be proved. To identify the inertia, the viscous friction torque coefficient, and the load torque simultaneously and smoothly, sinusoidal speed reference is usually employed. A modified motion equation considering the low-pass filter for feedback speed and the Coulomb friction torque is introduced and the relationship between the identified parameters and their actual values are clarified. A high-precision digital simulation model is built based on MATLAB/Simulink. The effectiveness of the proposed method is verified by simulations under various conditions.

The biosynthesis of C27-29 sterols from their C30 precursor squalene involves C24-alkylation and removal of three methyl groups, including two at the C4 position. The two C4 demethylation reactions require a bifunctional enzyme known as 3β-hydroxysteroid dehydrogenase/C4-decarboxylase (3βHSD/D) that removes an oxidized methyl (carboxylic) group at C4 while simultaneously catalyzing the 3β-hydroxyl3-keto oxidation. Its loss-of-function mutations cause ergosterol-dependent growth in yeast and congenital hemidysplasia with ichthyosiform erythroderma and limb defect (CHILD) syndrome in humans. Although plant 3βHSD/D enzymes were well studied enzymatically, their developmental functions remain unknown. Here we employed a CRISPR/Cas9-based genome-editing approach to generate knockout mutants for two Arabidopsis 3βHSD/D genes, HSD1 and HSD2, and discovered the male gametophytic lethality for the hsd1 hsd2 double mutation. Pollen-specific expression of HSD2 in the heterozygous hsd1 hsd2/+ mutant not only rescued the pollen lethality but also revealed critical roles of the two HSD genes in embryogenesis. Our study thus demonstrated essential functions of the two Arabidopsis 3βHSD/D genes in male gametogenesis and embryogenesis.

Landslide is one of the most common geological disasters in China, which is characterized by suddenness and uncertainty, and it is difficult to realize accurate identification, early warning and forecasting of landslide disaster by conventional means. With the development of high-resolution remote sensing satellites and InSAR surface deformation monitoring technology, the traditional means of landslide monitoring data sources are limited, and there is a lack of effective methods to excavate the characteristics of the spatial distribution of landslide hazards and their triggering factors and other issues. In this paper, the area extending 10 km outside the VII isobar of the Gengma earthquake is taken as the study area, and 13 evaluation factors are screened out by integrating the factors of InSAR surface deformation, topography and geological environment, and the Bayesian Optimized Convolutional Neural Network (BO-CNN) is used for the evaluation of landslide susceptibility, and the BO-RF and PSO-SVM models are selected for the comparative analysis. The model accuracy evaluation was carried out by three indexes: ROC curve, AUC value and FR value, in which the ROC curves of PSO-SVM, BO-RF and BO-CNN were all close to the upper-left corner of the corner, and the AUC values were 0.9388, 0.9529, and 0.9535, respectively, and the FR value of landslide in the high susceptibility area of BO-CNN was as high as 14.9, and was higher than that of PSO-SVM and BO-RF, respectively. SVM and BO-RF model is 4.55 and 3.69 higher, the experimental results show that the BO-CNN model used in this paper has a better effect in landslide susceptibility evaluation, and the research results of the local government's disaster prevention and mitigation measures are of great significance.

The main objective of this study is to develop a Hapke photometric model that is suited for Chang’E-1 (CE-1) Interference Imaging Spectrometer (IIM) data. We first divided the moon into three areas including ‘maria’, ‘new highland’ and old ‘highland’ with similar photometry characteristic based on the Hapke parameters of the moon derived from Lunar Reconnaissance Orbiter Camera (LROC) Wide Angle Camera (WAC) multispectral data. Then, we selected the sample data in the ‘maria’ area and obtained a new set of Hapke model’s parameters that can best fit these data. Result shows that photometric correction using Hapke model with these new derived parameters can eliminate the effect of variations in viewing and luminating geometry, especially ‘opposition surge’, more efficiently than the empirical model. The corrected mosaic shows no significant artifacts along the tile boundaries, and more detailed information of the image can be exhibited due to a better correction of ‘opposition surge’ at small phase angle (g <15°).

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Liposome vesicle is an ideal carrier for carbon nanotube (CNT) to serve as the water channel that allows the fast transport of water molecules, and thus enhancing the membrane permeability. However, low quantity of the inserted CNT in the liposome vesicle is an important factor that limited further improvement of the membrane flux. In present study, positively charged lipids (2,3-dioleoyloxy-propyl)-trimethylammonium-chloride (DOTAP) was introduced to the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamineon (DOPE) liposome vesicles to tailor the vesicle charge, so as to evaluate the effect of positively charged DOTAP on the insertion of CNT into liposomes and separation performance of thin-film nanocomposite (TFN) membranes. The results showed that addition of DOTAP induced more quantity of CNT inserted into the liposome vesicles, since the shrinkage rate (k) and permeability (Pf) of liposome vesicles present obvious increase with increased content of DOTAP in the liposome vesicles. Besides, it contributed to 252.3% higher water flux for TFN membranes containing DOPE/DOTAP2:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 2:1) than TFC membranes. More important, it presented 106.7% higher water flux for TFN membranes containing DOPE/DOTAP4:1-CNT liposomes (the mass ratio between DOPE and DOTAP was 4:1), which was originated from the more water channels that the CNT provided in the liposome vesicles. In all, positively charged DOTAP effectively tailored the vesicle charge, which provided a better carrier for the insertion of more quantity of CNT, and contributed to higher permeability of TFN membranes.

Three-dimensional (3D) imaging has attracted more and more interests because of its widespread applications, especially in information and life science. These techniques can be broadly divided into two types: ray-based and wavefront-based 3D imaging. Issues such as imaging quality and system complexity of these techniques limit the applications significantly, and therefore many investigations have focused on 3D imaging from depth measurements. This paper presents an overview of 3D imaging from depth measurements, and provides a summary of the connection between these the ray-based and wavefront-based 3D imaging techniques.

This paper propose a kernel geometric mean metric learning (KGMML) algorithm. The basic idea is to obtain the closed-form solution of the geometric mean metric learning (GMML) algorithm in the high-dimensional feature space determined by the kernel function. Then, the solution is generalized as a form of kernel matrix by using the integral representation of the weighted geometric mean and the Woodbury matrix in this new feature space. Experimental results on 15 datasets show that the proposed algorithm can effectively improve the accuracy of the GMML algorithm and other metric algorithms.

With the increased use of laterite nickel ore, the impact of high Al2O3 slag on blast furnace smelting has gradually increased. In this paper, the effects of slag basicity and Al2O3 content on slag viscosity and enthalpy change under constant temperature conditions was investigated. The changes in slag structure were analyzed by activation energy and Fourier Transform Infrared (FT-IR) spectroscopy. The relationship between slag components and slag temperature and viscosity when slag heat is reduced was investigated. The results showed that the viscosity first slightly decreased and then significantly increased with increasing basicity at constant temperature. With the addition of Al2O3 content, the viscosity of the slag increases. The activation energy increases with increasing slag basicity and Al2O3. With increasing basicity, the [SiO4]4- tetrahedral unit trough depth becomes shallow, the [AlO4]5- asymmetric stretching band migrates to lower wave numbers, and the slag structure depolymerizes. With the increase of Al2O3 content, the trough of [SiO4]4- tetrahedra deepens and the center of the symmetric stretching band moves to a higher wave number. The [AlO4]5- asymmetric stretching band becomes obvious, indicating the complexity of the slag structure. When the heat decreases, the slag temperature increases as the basicity increases, and the slag thermal stability is better at the basicity of 0.95-1.05. As the Al2O3 content increases, the thermal stability of the slag becomes worse.

Three kinds of hydrophobic groups grafted starches of maleic anhydride grafted starch (MAH-g-starch), lactic acid grafted starch (LA-g-starch), and methyl acrylate grafted starch (MA-g-starch) were prepared by in-situ solid phase polymerization. The results of Fourier transform infrared spectroscopy (FT-IR) and X-ray photoelectron spectroscopy (XPS) were confirmed successful grafting. The grafting ratios of MAH-g-starch, LA-g-starch and MA-g-starch were 6.50%, 12.45%, and 0.57%, respectively. Influenced by the grafting ratio, LA-g-starch had the best hydrophobic properties and the largest molecular weight, and those for MA-g-starch was the worst. The surfaces of grafted starches were covered with graft polymer, with obvious surface roughness and bond degree of MAH-g-starch and LA-g-starch. The crystalline structure of grafted starches showed some damage, with LA-g-starch exhibiting the greatest decrease in crystallinity, and less of a change for MA-g-starch. Overall, the grafting reaction improved thermoplasticity, with LA-g-starch the most improved, followed by MAH-g-starch, and then MA-g-starch.

The previous studies on the diversion pipe of pumped storage power stations (PSPS) primarily focused on numerical simulations of pulsating pressure propagation within the pipe and its inducing factors. However, there was a lack of field monitoring and analysis of measured data to support surface ambient vibration, resulting in insufficient credibility and practicality of the numerical results. Based on ambient monitoring and data analysis, this paper examines the factors contributing to the ambient vibration of the water diversion pipeline in Changlongshan (CLS) PSPS. It is concluded that: (1) The primary source of vibration originates from units operation-induced ambient vibrations; (2) Vibration during pumping conditions exceeds that during power generation conditions; (3) The ground measuring point's vibration acceleration primarily depends on the distance from the vibration source; (4) Different types of units have varying effects on water diversion pipeline vibrations.

This paper uses polypropylene (PP) as the matrix and acrylic acid (AA) and maleic anhydride (MAH) as functional monomers to prepare PP-g-(AA-MAH) fibers by suspension grafting and melt-blown spinning technology that are easy to industrially scale-up. The fibers can be used to adsorb aniline from wastewaters. Results showed that the grafting ratio reached the maximum of 12.47%. The corresponding optimal conditions were grafting time of 3h, AA : MAH = 0.75, total monomer content of 55%, benzoyl peroxide 1.4%, xylene concentration of 6 mL/g PP, and deionized water content of 8 mL/g PP. Owing to its good fluidity and thermal stability, the product of suspension grafting can be used for melt-blown spinning. Infrared spectroscopic and nuclear magnetic resonance spectroscopic analyses indicated that AA and MAH were successfully grafted onto PP fibers. After grafting, the hydrophilicity of PP-g-(AA-MAH) fiber increased. Therefore, it had higher adsorptivity for aniline and the adsorption capacity could reach 42.2 mg/g at 45 min. Moreover, the PP-g-(AA-MAH) fibers showed good regeneration performance.

Since the electro-hydraulic servo shaking table exists many nonlinear elements, such as, dead zone, friction and blacklash, its acceleration response has higher harmonics which result in acceleration harmonic distortion, when the electro-hydraulic system is excited by sinusoidal signal. For suppressing the harmonic distortion and precisely identify harmonics, a combination of the adaptive linear neural network and least mean M-estimate (ADALINE-LMM), is proposed to identify the amplitude and phase of each harmonic component. Namely, the Hampel’s three-part M-estimator is applied to provide thresholds for detecting and suppressing the error signal. Harmonic generators are used by this harmonic identification scheme to create input vectors and the value of the identified acceleration signal is subtracted from the true value of the system acceleration response to construct the criterion function. The weight vector of the ADALINE is updated iteratively by the LMM algorithm, and the amplitude and phase of each harmonic, even the results of harmonic components, can be computed directly online. The simulation and experiment are performed to validate the performance of the proposed algorithm. According to the experiment result, the above method of harmonic identification possesses great real-time performance and it has not only good convergence performance but also high identification precision.

Polychlorinated phenoxathiins (PCPTs), polychlorinated dibenzothiophenes (PCDTs), and polychlorinated thianthrenes (PCTAs) are sulfur analogues of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/DFs). Chlorothiophenols(CTPs) and chlorophenols (CPs) are key precursors to form PCTA/PT/DTs, which can form chloro(thio)phenoxy radical, sulfydryl/hydryl-substituted phenyl radical and (thio)phenoxyl diradicals. The available radical/radical PCTA/DT formation mechanism failed to explain the higher concentration of PCDTs than that of PCTAs under the pyrolysis or combustion conditions. Thus in this work, a detailed thermodynamics and kinetic calculations were carried out to investigate the pre-intermediates formation for PCTA/PT/DTs from radial/molecule coupling of 2-C(T)P with their key radical species. Our study found that the radial/molecule mechanism can thermodynamically and kinetically contribute to the gas-phase formation of PCTA/PT/DT/s. The S/C coupling modes to form thioether-(thio)enol intermediats are preferable over the O/C coupling modes to form ether-(thio)enol intermediats. Thus, although the radial/molecule coupling of chlorophenoxy radical with 2-C(T)P have no effect on the PCDD/PTs formation, the radial/molecule coupling of chlorothiophenoxy radical with 2-C(T)P play an important role in the PCDT/PT formation. Most importantly, the pre-PCDT intermediates formation pathways from the coupling of sulfydryl/hydryl-substituted phenyl radical with 2-C(T)P and the coupling of (thio)phenoxyl diradicals with 2-C(T)P are more favorable to pre-PCTA/PT intermediates formation pathways from the coupling of chlorothiophenoxy radical with 2-C(T)P, which can give reasonable explanation for the high PCDT-to-PCTA ratio in the environment.

The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

High-rise building machines (HBMs) play a critical role in the successful construction of super-high skyscrapers, providing essential support and ensuring safety. The HBM’s climbing system relies on a jacking mechanism consisting of several independent jacking cylinders. A reliable control system is imperative to maintain a smooth posture of the construction steel platform (SP) under the action of the jacking mechanism. This research introduces three multivariate time series neural network models—namely, Long Short-Term Memory (LSTM), Gated Recurrent Unit (GRU), and Temporal Convolutional Network (TCN)—to predict the posture of HBM. The models take pressure and stroke measurements from the jacking cylinders as inputs, and their outputs determine the levelness of the SP and the posture of the HBM at various climbing stages. The development and training of these neural networks are based on historical on-site data, with the predictions subjected to thorough comparative analysis. All proposed neural network models exhibit the capability to dynamically predict the posture of the HBM during the climbing process, using data from sensors. Notably, the GRU model shows better predictive performance.

With the development of IoT technology, various information resources, such as social resources and physical resources, are deeply integrated for different comprehensive applications. Social networking, car networking, medical services, video surveillance and other forms of IoT information Service model gradually change people's daily life. Facing the vast amounts of IoT information data, IoT search technology is used to quickly find accurate information to meet real-time search needs of users. However, IoT search requires to use a large number of user privacy Information, such as personal health information, location information, social relations information, to provide personalized services. User privacy information will meet security problems if an effective access control mechanism is missing during the IoT search process. Access control mechanism can effectively monitor the access activities of resources, and ensure authorized users to access information resources under legitimate conditions. This survey examines the growing literature on access control for IoT search. Problems and challenges of access control mechanism are analyzed to facilitate the adoption of access control solutions in real-life settings. This paper aims to provides theoretical, methodological and technical guidance for IoT search access control mechanism in large-scale dynamic heterogeneous environment. Based on the literature study, we also analyzed future development direction of access control in the age of IoT.

Human-robot collaboration is a new trend in modern manufacture. The safety or human protection is of great significance due to the share of the same workshop between humans and robots. To achieve effective protection, in this paper, a contact force sensor based on the 8-shaped wound polymer optical fiber is proposed. The 8-shaped wound structure can convert the normal contact force to the shrinkage of the 8-shaped optical fiber ring. The macro-bending loss of the optical fiber is used to detect the contact force. Compared with conventional sensors, the proposed scheme has the advantage of high flexibility, low cost, fast response, high repeatability, which shows the great promise on actively alarming collision and passively reducing the hurt.

Bistatic radar experiments have been used to study surface characteristics of extra-terrestrial bodies in the Solar System, including the Moon, Venus, Mars, and Titan. This paper proposes a 3D model to characterize the scattered field of a Gaussian rough surface on an extra-terrestrial body for an orbital bistatic radar configuration. Specifically, this model will investigate how the variability of surface roughness impacts the spectral broadening of the received signal using physical optics approximations and ray tracing on a surface model using a facet approach with Gaussian properties. A linear relationship between spectral broadening of the signal and surface roughness was found. This relationship is in line with results obtained by commonly used analytical models for bistatic radar on planetary surfaces.

Retinal vein cannulation involves puncturing an occluded vessel on the micron scale. Even single millinewton force can cause permanent damage. An ophthalmic robot with a piezo-driven injector is precious enough to perform this delicate procedure, but the uncertain viscoelastic characteristics of the vessel makes it difficult to achieve the desired contact force without harming the retina. The paper utilizes a viscoelastic contact model to explain the mechanical characteristics of retinal blood vessels in order to tackle this issue. The uncertainty in the viscoelastic properties is considered an internal disturbance of the contact model, and an active disturbance rejection controller is then proposed to precisely control the contact force. The experimental results show that this method can precisely adjust the contact force at the millinewton level even when the viscoelastic parameters vary significantly (up to 403.8%). The root mean square (RMS) and maximum value of steady-state error are 0.32 mN and 0.41 mN. The response time below 2.51 s with no obvious overshoot.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the notorious pests causing substantial loses to many cruciferous vegetables across the nations. We have got the result that 200Gy dosage irradiated 6-day male pupae of P. xylostella inducing F1 generation sterile. First, in our research, we detected Oxidase system and stress response mechanism of irradiated pupae, the results displayed that 200Gy irradiation significantly alters the antioxidant enzyme regulation in 6-day male pupae of P. xylostella. The level of SOD, CAT were increased significantly in contrast the level of POD and GST were decreased in 12-24h post-treatment. The heat shock proteins (Hsps) gene expression level was significant increasing, maximum > 2 folds up-regulation of genes were observed in peak. But they also had a trend of gradual recovery with development. Second, in order to explore the irradiated sterility further, we detected the testis LDH and ACP activity found that in male adults testis they increased significantly than control during its development. Thus the present research investigation highlights that the ⁶⁰Co-γ radiation treatments alters the physiological development of diamondback moth. The results showed that 200Gy dosage resulted stress damage to the body and reproductive system of the diamondback moth.

Bamboo plastic composites have become a hot research topic and a key focus of research. However, the many strong, polar, hydrophilic hydroxyl groups in bamboo flour (BF) results in poor interfacial compatibility between BF and hydrophobic polymers. Maleic anhydride-esterified (MAH-e-BF) and lactic acid-esterified bamboo flour (LA-e-BF) were prepared using an in situ solid-phase esterification method with BF as the raw material and maleic anhydride or lactic acid as the esterifying agent. Fourier transform infrared spectroscopy results confirmed that BF esterification with maleic anhydride and lactic acid was successful, with the esterification degrees of MAH-e-BF and LA-e-BF at 21.04 and 14.36%%, respectively. Esterified BF was characterized by scanning electron microscopy, contact angle testing, X-ray diffractometry, and thermogravimetric analysis. The results demonstrated that esterified BF surfaces were covered with graft polymer and the surface roughness and bonding degree of MAH-e-BF clearly larger than those of LA-e-BF. The hydrophobicity of esterified BF was significantly higher than BF and the hydrophobicity of MAH-e-BF better than LA-e-BF. The crystalline structure of esterified BF showed some damage, with MAH-e-BF exhibiting a greater decrease in crystallinity than LA-e-BF. Overall, the esterification reaction improved BF thermoplasticity, with the thermoplasticity of MAH-e-BF appearing better than LA-e-BF.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

DNA extraction for downstream molecular diagnostic applications can be an expensive, time-consuming process. We devised a method to quickly extract genomic DNA from environmental samples based on sodium hydroxide lysis of cells with or without capture by magnetic beads, for subsequent PCR or quantitative PCR. The final DNA extraction method using NaOH is extremely low-cost and can be completed in 10 minutes at room temperature. NaOH extraction was effective for Gram-negative and Gram-positive bacteria in samples from air, soil, sewage, food, laboratory surfaces, and chicken cloacal swabs. The NaOH extraction method was comparable to commercial kits for extraction of DNA from pig fecal samples for 16S amplicon sequencing analyses. We demonstrate that an impinger and portable pump can efficiently capture bacteria in poultry facilities for rapid DNA extraction for quantification of total bacteria and for detection of specific species using qPCR. The air sampling and NaOH extraction procedures are well-suited for routine, high throughput screening, and for metagenomic analyses for specific pathogens, even in resource-limited situations.

The operation status of manufacturing equipment is directly related to the reliability of the operation of manufacturing equipment and the continuity of operation of the production system. Based on the analysis of the operation status of manufacturing equipment and its characteristics, it is proposed that the concept of assessing the operation status of manufacturing equipment can be realized by applying real-time acquisition of accurate inspection data of important parts of weak motion units and comparing them with their motion status evaluation criteria. Through the study of the application characteristics of fractional-order calculus theory, a differential data fusion model based on the fractional-order differential operator is established. The advantages of Internet of Things (IoT）technology and fractional order differential fusion algorithm are integrated to obtain real-time high-precision data of the operating parameters of manufacturing equipment, and the research objective of operating condition assessment of manufacturing equipment is realized. The feasibility and effectiveness of the method are verified by the application of the method in machining center operation status assessment.

To compare The effects of organic and inorganic impregnation on the properties of unmodified, phenol formaldehyde oligomer-modified (PFOMCF), and sodium silicate-modified Chinese fir wood (SSMCF) were compared using samples prepared using the respiratory impregnation method. Impregnation and reinforcement effects and water resistance of PFOMCF and SSMCF were compared and the results was showed that the weight percentage gain, density increase rate, bending strength, and compressive strength of SSMCF were clearly higher than those of PFOMCF and had a lower water absorption rate within 60 h. The impregnation and reinforcement effects and dimensional stability of SSMCF were better than those of PFOMCF. FT-IR, XRD, CONE, and TGA examinations were used to test and analyze the chemical structure, crystalline structure, flame retardancy, and heat resistance of these modified woods. The results indicated that SSMCF possessed more hydrogen bonds than PFOMCF and that Si–O–Si chemical bonding with high bond energy was formed. Meanwhile, the weakened degree of the diffraction peak of SSMCF was much less than that of PFOMCF. These results explained that the mechanical properties and water resistance of SSMCF were better than PFOMCF. Compared with PFOMCF, SSMCF had a lower heat release rate (HRR), peak-HRR, mean-HRR, total heat release, smoke production rate, and total smoke production as well as higher thermal decomposition temperature and residual rate. Inorganic sodium silicate was shown to be a better flame retardant, while SSMCF had good smoke suppression effects, thermal stability, and safety performance in the case of fire.

During routine bridge maintenance, edge detection allows the partial condition of the bridge to be viewed. However, many edge detection methods often have unsatisfactory performances when dealing with images with complex backgrounds. Moreover, the processing often involves the manual selection of thresholds, which can result in repeated testing and comparisons. To address these problems in this paper, the wavelet transform modulus maxima method is used to detect the target image, and then the threshold value of the image can be determined automatically according to the OTSU method to remove the pseudo-edges. Thus, the real image edges can be detected. The results show that the information entropy and SSIM of the detection results are the highest when compared with the commonly used Canny and Laplace algorithms, which means that the detection quality is optimal. To more fully illustrate the advantages of the algorithms, images with more complex backgrounds were detected and the processing results of the algorithms in this paper are still optimal. In addition, the automatic selection of thresholds saves the operator’s effort and improves the detection efficiency. Thanks to the combined use of the above two methods, detection quality and efficiency are significantly improved, which has a good application in engineering practice.

To improve the adaptability of aerial reflective opto-mechanical structures to low-temperature environments, an optimized thermal control design is proposed. Firstly, the relationship be-tween conventional heating methods and axial/radial temperature differences of mirrors with different shapes is analyzed. Based on heat transfer analyses, it is pointed out that optimized thermal control design is necessary to ensure the temperature uniformity of the fused silica mirror and take into account the temperature level when working in low temperature environ-ments. A thermal control scheme based on temperature negative feedback variable power zone heating is proposed for the characteristics of aerial electro-optics systems. Using the thermal control scheme at low temperatures ensures that the average temperature of the mirror fluctu-ates slowly and slightly around 20℃. At the same time, the temperature differences within a mirror and between the primary mirror and the secondary mirror can be controlled within 5℃. Thereby, satisfactory image quality is obtained.

Unmanned Aerial Vehicles (UAVs) image object detection has great application value in military and civilian fields. However, the objects in the captured images from UAVs have problems of large scale variation, complex backgrounds, and a large proportion of small objects. To resolve these problems, a multi-scale object detector based on coordinate and global information aggregation is proposed, named CGMDet. Firstly, a Coordinate and Global Information Aggregation Module (CGAM) is designed by aggregating local, coordinate, and global information, which can obtain features with richer context information. Secondly, a Multi-Feature Fusion Pyramid Network (MF-FPN) is proposed, which can better fuse features of different scales and obtain features containing more context information through repeated use of feature maps, to better detect multi-scale targets. Moreover, more location information of low-level feature maps is integrated to improve the detection results of small targets. Furthermore, we modified the bounding box regression loss of the model to make the model more accurately regress the bounding box and faster convergence. Finally, the proposed CGMDet was tested on VisDrone and UAVDT datasets and mAP0.5 of 50.9% and 48% was obtained, respectively. At the same time, our detector achieved the best results compared to other detectors.

Though Cyber Physical Systems (CPS) become very popular in last the decade, dependability of CPS is still a critical issue and related survey is rare. We try to spell out the jigsaw of technologies and figure out the technical trends of dependable self-managing CPS. This survey first recalls the motivation and the similar concepts. By analyzing four generic architectures, we summarize the common characteristics and related assurance technologies, and propose a more generic environment-in-loop processing flow of CPS and a formal interaction flow between physical space and cyber space. Further, the similarity between correctness and dependability is formally analyzed and the new five research questions of dependable self-managing CPS are presented. Then we review the critical technologies and related correctness verification & validation (V&V) methods, the architectures for dependable self-managing CPS. Further, the detail dependability management and V&V technologies are surveyed, which covers the areas of running-time fault management methods and whole life cycle V&V technologies, maintenance and available tool sets. For holistic CPS development, Modeling techniques and MDE (model driven engineering) based V&V methods are analyzed in detail. Then we complete the jigsaw of technologies and figure out the missing part. Further, we propose the technical challenges and the further direction. To our best knowledge, this is the first comprehensive survey on dependable self-managing CPS development and evaluation.

Large scale cropland erosion rates mapping and dynamic monitoring are critical for agricultural planning but extremely challenging. In this study, by using field investigation data collected from 20,155 land parcels in 2,781 sample units in the National Soil Erosion Survey, land use change data for two decades from the National Land Use/Cover Database of China (NLUD-C), we proposed a new point to surface approach to quantitatively assess long-term cropland erosion based on the CSLE model and non-homogeneous voting. The results show that cropland in Yunnan suffers from serious problem with unsustainable mean soil erosion rate of 40.47t/(ha·a) and erosion ratio of 70.11%, which are significantly higher than those of other land types. Engineering control measures (ECMS) have a profound impact on reducing soil erosion, soil erosion rate of cropland with and without ESMs differs by more than five times. Over the past two decades, the cropland area in Yunnan continues to decrease, with a net reduction of 7461.83 km2 and a ratio of −10.55%, which causes corresponding 0.32×108 t (12.12% ) decrease in cropland soil loss. We also quantified the impact of different LUCC scenarios on cropland erosion, and extraordinarily high variability was found in soil loss in different basins and periods. Conversion from cropland to forest contributes the most to cropland erosion reduction, while conversion from grassland to cropland contributes 56.18% of the increase in soil erosion. Considering the current speed of cropland regulation, it is the sharp reduction in land area that leads to cropland erosion reduction rather than treatments. The dilemma between the Grain for Green Policy and Cropland Protecting Strategy in mountainous areas should be treated carefully with shared understanding and collaborations from different roles.

To prevent CO2 leakage and ensure the safety of long-term CO2 storage, it is essential to investigate the flow mechanism of CO2 in complex pore structures at the pore scale. This study focuses on reviewing the experimental, theoretical, and numerical simulation studies on the microscopic flow of CO2 in complex pore structures during the last decade. For example, advanced imaging techniques, such as X-ray computed tomography (CT) and nuclear magnetic resonance (NMR), are used to reconstruct the complex pore structures of rocks. Mathematical methods, such as Darcy's law, Young–Laplace’s law, and the Navier-Stokes equation, are used to describe the microscopic flow of CO2. Numerical methods, such as the lattice Boltzmann method (LBM) and pore network (PN) model, are used for numerical simulation. The application of these experimental and theoretical models and numerical simulation studies is discussed, considering the effect of complex pore structures. Finally, future research is suggested to focus on: (1) Conducting real-time CT scanning experiments of CO2 displacement combined with the developed real-time CT scanning clamping device to realize real-time visualization and provide quantitative description of the flow behavior of CO2 in complex pore structures; (2) The effect of pore structures change on the CO2 flow mechanism caused by the chemical reaction between CO2 and the pore surface, the flow theory of CO2 considering wettability and damage theory in a complex pore structures; (3) The flow mechanism of multi-phase CO2 in complex pore structures; (4) The flow mechanism of CO2 in the pore structures at multiscale and the scale upgrade from microscopic to mesoscopic to macroscopic. Generally, this study focuses on reviewing the research progress of CO2 flow mechanisms in complex pore structures at the pore scale and affords an overview of potential advanced developments to enhance the current understanding of CO2 microscopic flow mechanisms.

We have developed circular defects in 2-dimensional photonic crystal lasers that allow current injection for interconnected optical communications. However, when cleaving the sample to measure the output light, the output light intensity changes due to the cleaving position. In a previous study, we discovered through simulation that this effect could be eliminated and that a higher optical output might be obtained by applying a convex edge structure. In this paper, we develop the fabrication technology for this structure, fabricate samples, and measure the output light experimentally. Room-temperature continuous-wave laser oscillations using this structure are observed. The laser threshold is similar to well-lasing samples with normal cleavage edge faces. We are assured that these results contribute to future work such as accurate manufacturing and improving the end-face configuration to obtain higher outputs.

Basil, renowned for its aromatic properties, exhibits commendable drought tolerance and holds significant value both as an edible and medicinal plant. Recognizing the scarcity of studies addressing basil’s response to drought stress, we undertook a comprehensive analysis of the volatile metabolome and transcriptome of sweet basil across four distinct levels of drought stress. Our metabolic analysis meticulously identified 830 metabolites, with 215 differentially accumulated metabolites discerned. Notably, the primary constituents of sweet basil volatiles exhibited minimal alterations, while the differentially accumulated metabolites were predominantly lipids and terpenes. The transcriptome analysis unveiled 27,181 differentially expressed DEGs, with a predominant focus on metabolic pathways and biosynthesis of secondary metabolites. Integrating insights from both transcriptome and volatile metabolomic analyses highlighted the pivotal roles of Alpha-linolenic acid, flavonoid, and lignin metabolism in fortifying the resistance of sweet basil against drought stress. This holistic approach not only enriches our understanding of the molecular intricacies underpinning basil’s drought resistance but also furnishes valuable insights for the molecular breeding of basil varieties endowed with enhanced drought tolerance.

Semen Allii Fistulosi is the seed of Allium fistulosum L. of the Liliaceae family. The purpose of this study was to extract, characterize, and evaluate the antioxidant activity in vitro of proteins from Semen Allii Fistulosi (PSAF). Using single factor and orthogonal design, the optimum conditions of extraction were determined to be as follows: extraction time 150 min, pH 8.5, temperature 60℃, and ratio (v/w, mL/g) of extraction solvent to raw material 35. The isoelectric point of the pH was determined to be about 4.4 and 10.2, by measuring the protein content of PSAF solutions at different pH. The amino acid composition of PSAF was determined by high performance liquid chromatography (HPLC), and the results suggested that the species of amino acids contained in the PSAF was complete. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS–PAGE) analysis showed the molecular weight was mainly between 40 and 55 kDa, and Fourier-transform infrared spectroscopy (FTIR) characterized prevalent protein absorption peaks. PSAF exhibited potent scavenging activities against DPPH assays, via targeting of hydroxyl and superoxide radicals, while chelating Fe2+ activity, and demonstrating weak reducing power. This work revealed that PSAF possessed potential antioxidant activity in vitro, suggesting potential for use of PSAF as a natural antioxidant.

In the context of the rural revitalization strategy, it is urgent to accurately grasp the spatial differentiation characteristics and influencing factors of rural settlements in underdeveloped arid inland river basins. Taking the Shiyang River Basin as an example, the rural settlements from 2000 to 2019 were obtained by visual interpretation using satellite remote sensing data and official statistical data. Following the logical of "state characteristics - evolutionary patterns - influence factors - layout optimization", the average nearest index, gravity-center migration model, spatial statistical analysis and other methods were used combine with GIS. The spatiotemporal pattern evolution characteristics of rural settlements in the past 20 years have been analyzed. The results revealed the following: 1) The distribution pattern of rural settlements in the study area is sheet-like and strip-shaped. The projects in the southeast are mostly distributed in a patchy pattern with high density, while the characteristics in the west and north are exactly opposite. The objects in the south are distributed in the alluvial area of rivers, while settlements in the north are located in the oasis area. 2) From 2000 to 2019, the scale of rural settlements in the Shiyang River Basin, where simultaneous occurrence of new-built and disappearing phenomena, shows an expansion trend that fast firstly and then slow. Spatially, rural settlements in the basin show a trend of clustering towards the southwest. 3) The distribution characteristics of rural settlements are close to water and roads, greatly influenced by urban-rural integration and ecological migration. The results will provide scientific basis for accelerating the modernization of rural areas, and the construction of new rural areas according to local conditions.

Document image binarization is a challenging task, especially when it comes to text segmentation in degraded document images. The binarization, as a pre-processing step of optical character recognition (OCR), is one of the most fundamental and commonly used segmentation methods. It separates the foreground text from the background of the document image to facilitate subsequent image processing. In view of the different degradation degree of document image, researchers have proposed a variety of solutions. This paper reviews the main binarization techniques, including both traditional algorithms and deep learning-based algorithms. We also summarize some difficulties and challenges in the field of document image binarization. Here, we evaluate various image binarization techniques to identify shortcomings in current methods and provide some help for future research.

The South-to-North Water Transfer Jiangsu Water Supply Area (JWSA) is a mega inter-basin water transfer area (water source) that provides water resources from JiangHuai, combines drainage and flooding management, and regulates nearby rivers and lakes. Analyzing the spatiotemporal soil moisture dynamics in the area will inform agricultural drought and flood disaster assessment and early warning studies. Therefore, we evaluated the quality of European Space Agency Climate Change Initiative Soil moisture (ESA CCI_SM) data in the South-North Water Transfer JWSA. Then, we used ensemble empirical modal decomposition, Mann-Kendall tests, and regression analysis to study the spatiotemporal variation in soil moisture for the past 29 years. The CCI _SM data showed a high correlation with local soil measurements at nine sites. We then analyzed the CCI_SM data from three pumping stations (the Gaogang, Hongze, and Liushan stations) in the South-North Water Transfer JWSA. These stations had similar periodic characteristics of soil moisture, with significant periodic fluctuations around 3.1 d. The overall soil moisture at the three typical pumping stations showed an increasing trend. We then investigated whether there were abrupt soil moisture changes at each station. The spatial distribution of soil moisture in the South-North Water Transfer JWSA was characterized by “dry north and wet south”, with higher soil moisture in winter, followed by autumn, and low soil moisture in spring and summer. Although the linear trend of soil moisture in the South-North Water Transfer JWSA varied in significance, the overall soil moisture in the JWSA has increased over the past 29 years. The areas with significantly enhanced soil moisture are mainly distributed in the Yangzhou and Huai'an areas in the southeastern part of the study area. The areas with significantly decreased soil moisture are small in size and mainly located in northern Xuzhou.

This paper discusses about control of the linear switched reluctance machines (LSRMs) network for the zero phase-difference tracking to a sinusoidal reference. The dynamics of each LSRM is derived by online system identification and modeled as a second-order linear system. Accordingly, based on the coupled harmonic oscillators synchronization manner, a distributed control is proposed to synchronize each LSRM state to a virtual LSRM node representing the external sinusoidal reference for tracking it with zero phase-difference. Subsequently, a simulation scenario and an experimental platform with the identical parameter setup are designed to investigate the tracking performance of the LSRMs network constructed by the proposed distributed control. Finally, the simulation and experimental results verify the effectiveness of the proposed LSRMs network controller, and also prove that the coupled harmonic oscillators synchronization method can improve the synchronization tracking performance and precision.

A switchable and tunable terahertz (THz) metamaterial based on photosensitive silicon and Vanadium dioxide (VO2) was proposed. By using finite-difference time-domain (FDTD) method, the transmission and reflective properties of the metamaterial were investigated theoretically. The results imply that, the metamaterial can realize a dual electromagnetically induced transparency (EIT) or two narrow-band absorption depending on the temperature of the VO2. Additionally, the magnitude of the EIT and two narrow-band absorption can be tuned by varying the conductivity of photosensitive silicon (PSi) via pumping light. Correspondingly, the slow light effect accompanying the EIT can also be adjusted.

β-glucosidases (BGLs) play a crucial role in the degradation of lignocellulosic biomass as well as in industrial applications such as pharmaceuticals, foods, and flavors. However, the application of BGLs has been largely hindered by issues such as low enzyme activity, product inhibition, low stability, etc. Many approaches have been developed to engineer BGLs to improve these enzymatic characteristics to facilitate industrial production. In this article, we review the recent advances in BGL engineering in the field, including the efforts from our laboratory. We summarize and discuss the BGL engineering studies according to the targeted functions as well as the specific strategies used for BGL engineering.

We investigated the effect of C. psittaci and H9N2 coinfection on HD11 cells in vitro, expecting to find the potential pathogenesis of airsacculitis caused by co-infection of C. psittaci and H9N2. HD11 cells were infected with C. psittaci and/or H9N2 in a different order, and effects of the co-infection on iNOS expression and activity, NO synthesis, cell phagocytosis, and cytokines levels in HD11 cells were determined. Results showed that C. psittaci and H9N2 can significantly aggravate the mortality of HD11 cells compared to the effects of infection with one pathogen alone. In addition, infection with C. psittaci can increase the replication of H9N2 in HD11 cells, whereas decrease the iNOS level and enzyme activity as well as NO concentration of HD11 cells by H9N2 infection. We also found that C. psittaci infection alone can significantly decrease the phagocytosis of HD11 cells, compared to H9N2 infection alone. Furthermore, infection with C. psittaci can increase the mRNA expressions of type Th2 cytokines IL-6 and IL-10 of HD11 cells by H9N2 infection. All the above data indicated that primary C. psittaci infection is able to aggravate H9N2 invasion by down-regulating functions of HD11 cells

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In order to obtain stable super-hydrophobicity, suitable hydrophobic treatment agent should be selected according to different materials. In this paper, cotton and poly (-ethylene terephthalate) (PET) fabric was respectively coated by dodecyl methacrylate (LMA) via argon combined capacitively coupled plasma (CCP), and the surface hydrophobicity and durability of treated cotton and polyester fabrics were also discussed. An interesting phenomenon was happened that LMA coated cotton fabric (Cotton-g-LMA) had better water repellency and mechanical durability than LMA coated PET fabric (PET-g-LMA), and LMA coated hydroxyl grafted PET fabrics (PET fabrics were successively coated with polyethylene glycol (PEG) and LMA, PET-g-PEG&amp;LMA) had similar performance to those of cotton fabrics. The water contact angle (WCA) of Cotton-g-LMA, PET-g-LMA and PET-g-PEG&amp;LMA was 156 °, 153 ° and 155 °, respectively, and after 45 washing cycles or 1000 rubbing cycles, the corresponding WCA was decreased to 145 °, 88 °, 134 °and 146 °, 127 °, 143 °, respectively. Also, thermoplastic polyurethane (TPU) and polyamides-6 (PA6) fabrics were all exhibited the same properties to PET fabric. Therefore, the grafting of hydroxyl can improve the hydrophobic effect of LMA coating and the binding property between LMA and fabrics effectively without changing the wearing comfort..

Silver powder, as the primary component of solar silver paste, significantly influences various aspects of paste performance, including printing, sintering, and conductivity. Silver powders prepared using the liquid-phase reduction method exhibit different microstructures depending on whether the growth process is dominated by aggregation or crystalline growth. This study explores the impact of different silver powder microstructures on packing density and sintering activity. It is observed that polycrystalline aggregated silver powder possesses higher surface energy, lower packing density, and greater sintering activity. Investigation into the influence of different silver powders on the electrical conductivity, adhesion, and structural density of silver paste reveals that polycrystalline aggregated silver powder is more suitable for lower sintering temperature pastes, whereas crystalline growth-type silver powder is better suited for higher sintering temperature pastes, resulting in a denser sintered silver layer. Finally, an analysis of the impact of various silver powders on the aspect ratio and electrical performance of solar cell silver grid lines yields higher aspect ratios (0.40) and photoelectric conversion efficiency (19.26%).

The exploitation of bio-based foams implies an increase in the use of renewable biological resources to reduce the rapid consumption of petroleum-derived resources. Both tannins and furfuryl alcohol are derived from forestry resources and are therefore considered as attractive precursors for the preparation of tannin-furanic foams. In addition, toughening modification of tannin-furanic foams using polyvinyl alcohol (PVOH) resulted in a more flexible network-like structure, which imparts excellent flexibility to the foams with acquirement of relative properties that are even close to those of polyurethane foams, which are the most used polymers for fabrication of insoles for athletes. In addition, the addition of PVOH did not affect the thermal insulation of the foams, resilience and elongation at break, while reducing the brittleness of the samples and improving the mechanical properties. Also the observation of the morphology of the foam indicated that the compatibility between PVOH and tannin-furanic resin is good, and the cured foam does not show fragmentation or collapse, while the bubble pore structure is uniform. The developed flexible foam derived from biomass resources endowed the foam good thermal insulation properties and high mechanical properties, and the samples exhibited suitable physical parameters to be used as flexible insoles for athletes.

High-performance electromagnetic interference (EMI) shielding materials with ultralow density and environment friendly properties are greatly demanded to address electromagnetic radiation pollution. Herein, carbon nanotubes/polylactic acid (CNTs/PLA) materials with different CNTs contents, which exhibit characteristics of light weight, environmental protection and good chemical stability, are fabricated by 3D printing technology, where CNTs are evenly distributed and bind well with PLA. The performances of 3D printed CNTs/PLA composite are improved compared to pure 3D printed PLA composite, which include mechanical properties, conductive behaviors and electromagnetic interference (EMI) shielding. The EMI shielding effectiveness (SE) of CNTs/PLA composite could be improved when the contents of CNTs increase. When it reaches 15 wt%, the EMI SE of 3D printed CNTs/PLA composite could get up to 47.1 dB, which shields 99.998% of electromagnetic energy. Meanwhile, the EMI shielding mechanism of 3D printed CNTs/PLA composite is mainly of absorption loss, and it generally accounted for more than 80% of the total shielding loss. These excellent comprehensive performances endow the 3D printed CNTs/PLA composite with great potential for use in industrial and aerospace area.

Cyber Physical Systems (CPS) has been a popular research area in the last decade. The dependability of CPS is still a critical issue, and rare survey has been published in this domain. CPS is a dynamic complex system, which involves various multidisciplinary technologies. To avoid human error and to simplify management, self-management CPS (SCPS) is a wise choice. And to achieve dependable self-management, systematic solution is necessary to verify the design and to guarantee the safety of self-adaptation decision, as well as to maintain the health of SCPS. This survey first recalls the concepts of dependability, and proposes a generic environment-in-loop processing flow of self-management CPS, and then analyzes the error sources and challenges of self-management through the formal feedback flow. Focus on reducing the complexity, we first survey the self-adaptive architecture approaches and applied dependability means; then we introduce a hybrid multi-role self-adaptive architecture, and discuss the supporting technologies for dependable self-management at the architecture level. Focus on dependable environment-centered adaption, we investigate the verification and validation (V&V) methods for making safe self-adaptation decision and the solutions for processing decision dependably. For system-centered adaption, the comprehensive self-healing methods are summarized. Finally, we analyze the missing pieces of the technology puzzle and the future directions. In this survey, the technical trends for dependable CPS design and maintenance are discussed, an all-in-one solution is proposed to integrate these technologies and build a dependable organic SCPS. To the best of our knowledge, this is the first comprehensive survey on dependable SCPS building and evaluation.

Polygonatum cyrtonema Hua. is an important medicinal and edible food in China and the traditional processing method of nine-steaming and nine-drying has been used to process its rhizome. However, the global dynamic changes in secondary metabolites during the processing and whether this method could enhance the accumulation of functional components remain unclear. This study aimed to explore the processing-induced mechanisms involved in the accumulation of secondary metabolites and provide theoretical support for the pharmacological study on P. cyrtonema. Results showed the first 6 processing cycles induced drastic changes in the accumulation of secondary metabolites, while the last 3 did not induce further changes. The accumulation of most secondary metabolites significantly increased after the first 3 cycles and stabilized after 6 cycles. The first 3 cycles led to numerous newly added metabolites while the last 6–9 cycles led to a small number of disappeared metabolites. Processing enhanced the biosynthesis of various secondary metabolites and significantly affected the metabolisms of amino acids. Together, a short period of processing was helpful for enhancing the biosynthesis of secondary metabolites. However, the enhancing effects will be reversed or weakened under continuous processing. The processing cycles should be reduced to 3–6 to maintain the enhancing effects.

Lentiviral vectors (LVs) are a powerful tool for gene and cell therapy and human embryonic kidney cells (HEK293) have been extensively used as a platform for production of these vectors. Like most cells and cellular tissues, HEK293 cells release extracellular vesicles (EVs). EVs released by cells share similar size, biophysical characteristics and even a biogenesis pathway with cell-produced enveloped viruses, making it a challenge to efficiently separate EVs from LVs. Thus, EVs co-purify with LVs during downstream processing, becoming “impurities” in the context of cell therapy. To characterize EVs from an inducible lentivirus producing cell line, two conditions were studied: non-induced and induced. EVs’ identity was confirmed by transmission electron microscopy and western blot. Seven proteins were identified by mass spectrometry as potential EV markers. Lipid composition of EVs and LVs showed similar enrichment in phosphatidylserine. RNA cargos in EVs showed enrichment in genes involved in viral processes and binding functions. Flow virometry, GTA and ddPCR results also confirmed the heterogenic nature of EVs and LVs populations. These findings provide insights on the product profile of lentiviral preparation and could help develop separation strategies of co-produced EVs.

Brassica yellows virus (BrYV) is a tentative species of the genus Polerovirus, which occurs widely and mostly damage Brassicaceae plants in East Asia. Since BrYV could not be transmitted mechanically, an insect transmission method is required for further virus research. Here, a reliable and unrestricted method was described, in which non-viruliferous aphids (Myzus persicae) acquired BrYV from transgenic Arabidopsis thaliana plants with virus full length genome germinated from seeds and frozen infected leaves were used to transmit the virus to healthy plants, and there was no significant difference in acquisition rate though transmission rate from frozen infected leaves was somehow lower compared to fresh infected leaves. This novel simple method could be applied to preservation of virus inocula, evaluation of variety resistance to BrYV, biological research on interaction among BrYV, aphid and host, which also provide a new idea on establishing a basic method using virus genomic transgenic plants or frozen infected leaves for other poleroviruses research.

Biotic and abiotic factors influence the formation of fungal-algal pairings in lichen symbiosis. It is poorly known which factors determine the specific associations, especially when distantly related fungi are considered. Here, we investigated the effect of different drivers on the association patterns of taxonomically diverse lichenized fungi and their trebouxioid symbiotic partners. In 200 samples collected across three biomes, we found 41 species of lichenized fungi, associating with 16 species of trebouxioid green algae, of which 62% were previously unreported. Species identity of the fungal and algal partner had the greatest effect on the outcome of the symbiosis compared with abiotic factors such as climatic variables and geographic distance. Partner specificity was found to be higher in tropical regions than in temperate and arctic regions. Co-phylogenetic analyses indicated congruent phylogenies of trebouxioid algae and associated fungi, rejecting their random associations. Evolutionary mechanisms contributing most to the observed phylogenetic patterns were ‘loss’ and ‘failure to diverge’ of the algal partners. This study broadens our knowledge of fungi-algae symbiotic patterns in view of Trebouxia-associated fungi.

Staphylococcus aureus(S. aureus) is associated with mastitis in dairy cows, this study investigates the therapeutic effect of maggot antimicrobial peptides on S. aureus induced mastitis in mice. The maggot AMP was isolated and purified, tested for antimicrobial activity, and used to treat a pathological model of rat mastitis. The concentration of 1.5mg/（Kg. BW）AMP was selected as intramammary treatment in S. aureus-induced mastitis in mice. The mice were divided into four groups of 30 mice each: group I (healthy control), group II (disease control), group III (AMP), and group IV (ciprofloxacin). To evaluate the therapeutic efficacy of maggot AMP in mastitis induced by S. aureus based on clinical presentation, mammary gland structure, bacterial load, histopathology, and cure. During the 7-day treatment period, all the mice in Group II died in the afternoon of the fifth day, and the clinical signs of the mice in Group III began to improve on the third day, as evidenced by the gradual recovery of the mice's mental status, dietary intake, and water intake. During the treatment period, the bacterial load count of Group III was significantly lower than that of Group II but higher than that of Group IV, while the bacterial load count of Group III gradually decreased and approached that of Group IV from the fifth to the seventh day. The levels of TNF-α in groups III and IV were significantly lower than those in group II, suggesting that maggot AMP has a certain inhibitory effect on TNF-α. Treatment with AMP@ 1.5 mg/(Kg. BW) showed restoration of clinical signs, reduced bacterial load, and lower TNF-α levels in mice, leading to significant improvement in histopathological changes as compared to disease controls. The final cure rate was 40% for mice in Group III compared to 70% for mice in Group IV, compared to all mice in Group II that died. From this study, it can be concluded that maggot AMP can be used as a potential alternative treatment option to antibiotics for the treatment of bovine mastitis.

In order to serve the online monitoring of the aging state of high-voltage (HV) cables, a novel method based on impedance spectroscopy has been proposed. Firstly, the method uses the Debye model to restore the dielectric response of the insulating material from the mechanism. Secondly, based on the transmission line equation, a calculation model for the impedance spectroscopy of HV cables was established. Then, the characteristics of the impedance spectroscopy under different overall aging and local deterioration states were analyzed. Further, the simulation analysis of the influence of factors such as load factor, length, metal resistivity, and geometric parameters on the impedance spectroscopy was carried out. Finally, diagnostic criteria were proposed, which are divided into two major categories: known cable parameters and unknown cable parameters. If the geometric parameters are known, the aging state can be determined using the resonance peak values and the resonance peak frequencies. If the geometric parameters are unknown, it is necessary to test the impedance spectroscopy in the healthy condition of the cable as the baseline curve. By comparing the impedance spectroscopy of the cable under test with the baseline curve, the aging development trend of the cable can also be determined.

Three typhoons (Rammasun, Kalmaegi, and Sarika) travelled through the deployed stations in the northern South China Sea from 2014–2016. During the passage of typhoons, strong winds and vigorous currents resulted in horizontal displacement of buoy over 2000 m, vertical displacement of ropes on buoys as much as 200 m. The rectification can correct the warm anomaly to cool anomaly of temperature. These movements lead to biases of raw data, with temperature bias as much as 4°C, salinity as much as 0.05 psu, velocity bias as much as 0.4 m/s. The crosscheck of current velocity from different instruments shows that the bias of overlapping velocity and correlation coefficient after depth rectification obviously enhances. The observation shows that temperature cools 1.5 °C, and 0.1 psu saltier in maximum, the near-inertial current increases to 0.4 m/s in the upper layer. The inertial kinetic energy propagates downward with the upward phase, and the maximum depth can reach over 2000 m.

Humanity’s path to avoiding extinction is a daunting and inevitable challenge which proves difficult to solve, partially due to the lack of data and evidence surrounding the concept. We aim to address this confusion by addressing the most dangerous threats to humanity, in hopes of providing a direction to approach this problem. Using a probabilistic mode, we observed the effects of nuclear war, climate change, asteroid impacts, artificial intelligence and pandemics, which are the most harmful disasters in terms of their extent of destruction on the length of human survival. We consider the starting point of the predicted average number of survival years as the present calendar year. Nuclear war, when sampling from an artificial normal distribution, results in an average human survival time of 60 years into the future starting from the present, before a civilization-ending disaster. While climate change results in an average human survival time of 193 years, the simulation based on impact from asteroids results in an average of 1754 years. Since the risks from asteroid impacts could be considered in the far future, it can be concluded that nuclear war, climate change, and pandemics are presently the most prominent threats to humanity. Additionally, the danger from superiority of artificial intelligence over humans, although abstract in its sense, is a factor of careful study and could also have wide ranging implications, impeding man’s advancements towards becoming a more advanced civilization.

Climate change poses a significant threat to global food security, necessitating a thorough examination across multiple dimensions. Establishing appropriate food security evaluation indicators that align with the evolving concept of food security is imperative. This study enhances food security evaluation by refining a multi-dimensional framework and analyzing the impact of climate change across various regions from 2002 to 2021. By constructing an Food Security Index system composed of a three-tier indicator system and employing the entropy method for weighting, we assess the impacts of climate change on food security using a climate-economic model. Regression analysis reveals a negative linear relationship between mean temperatures and food security (p&lt;0.01), while precipitation impacts food security non-linearly, particularly exhibiting inverse U-shaped patterns in major grain-producing and grain-consuming areas. Extreme high temperatures consistently reduce food security, whereas extreme precipitation displays a complex, statistically significant inverse U-shaped association. In regions where production and consumption are balanced, mean temperatures have a negative effect on food security, while precipitation exhibits a positive correlation, but excessive precipitation can have adverse effects. These findings highlight the intricate interplay between climate change, regional disparities, and food security in China, emphasizing the need to consider multi-dimensional factors and regional variations in addressing food security challenges. These insights are invaluable for policy-making and planning aimed at enhancing food security in China.

Epithelial-to-mesenchymal transition (EMT) plays a role in chronic obstructive pulmonary diseases (COPD). Cyclic adenosine monophosphate (cAMP) can inhibit transforming growth factor-β1 (TGF-β1) mediated EMT. Although compartmentalization via A-kinase anchoring proteins (AKAPs) is central to cAMP signaling, functional studies on their therapeutic value in the lung EMT process are lacking. Bronchial epithelial (BEAS-2B, primary HAE cells) were exposed to TGF-β1. Epithelial (E-cadherin, ZO-1) and mesenchymal markers collagen Ӏ (mRNA, protein) were analyzed. St-Ht31 disrupted AKAP-PKA interactions. TGF-β1 release was measured by ELISA. TGF-β1-sensitive AKAPs Ezrin, AKAP95 and Yotiao were silenced using siRNA. Cell migration was analyzed by wound healing assay, xCELLigence, Incucyte. Prior to TGF-β1, dibutyryl-cAMP (dbcAMP), fenoterol, rolipram, cilostamide, forskolin were used to elevate intracellular cAMP. TGF-β1 induced morphological changes, decreased E-cadherin but increased collagen Ӏ and cell migration, a process reversed by PF-670462. TGF-β1 altered (mRNA, protein) expression of Ezrin, AKAP95 and Yotiao. St-Ht31 decreased E-cadherin (mRNA, protein), but counteracted TGF-β1-induced collagen Ӏ upregulation. Cigarette smoke (CS) increased TGF-β1 release, activated TGF signaling, augmented cell migration and reduced E-cadherin expression, a process blocked by TGF-β1 neutralizing antibody. Silencing of Ezrin, AKAP95 and Yotiao diminished TGF-β1-induced collagen Ӏ expression, as well as TGF-β1-induced cell migration. Fenoterol, rolipram, and cilostamide, in AKAP silenced cells pointed to distinct cAMP compartments. We conclude that Ezrin, AKAP95 and Yotiao promote TGF-β1-mediated EMT, linked to a TGF-β1 release by CS. AKAP members define the ability of fenoterol, rolipram and cilostamide to modulate the EMT process, and are potential relevant targets in the treatment of COPD.

Although the neurofilament light chain (NfL) is used as a biomarker for neurodegenerative decline, its use in surgery- and anaesthesia-induced acute cognitive dysfunction remains controversial. We aimed to synthesise the evidence to explore the potential of NfL as an established biomarker for perioperative neurocognitive disorders (PND). We systematically searched the PubMed, EMBASE, MEDLINE, Cochrane Library electronic databases, and Cochrane Central Registry of Clinical Trials. Our results show that CSF NfL levels positively correlated with blood NfL levels (r = 0.63; 95% confidence interval [CI], 0.42-0.77). The pooled standardised mean difference (SMD) showed a significantly higher preoperative CSF NfL levels (SMD = 0.27; 95% CI, 0.07-0.47) and both pre- and postoperative blood NfL levels (SMD = 0.53, 95% CI, 0.40-0.66 and SMD = 0.58, 95% CI, 0.43-0.73) in the postoperative delirium (POD) group. Postoperative blood NfL levels were significantly elevated in both POD group (SMD = 0.49; 95% CI, 0.34-0.64) and no-POD group (SMD = 0.67; 95% CI, 0.53-0.81). Our meta-analysis indicates that NfL may serve as a potential biomarker for POD, and elevated preoperative blood NfL levels could be a risk factor for POD. Further studies are needed to confirm the association of CSF/blood NfL levels with other PND types.

Environmental nanoparticles have been shown to exist in most aquatic environments, and environmental nanoparticles in water distribution systems significantly affect water quality. However, little research has been conducted on the environmental nanoparticles in mineral water, which is a special water resource. Nanoparticle tracking analysis (NTA) and high-resolution transmission electron microscopy (HRTEM) were conducted. This study was the first to identify many environmental nanoparticles in natural mineral water in Zibo City, Shandong Province, China. The results of the NTA showed that the concentration of the particles was 5.5 ×106 particles/mL and the peak diameter of the size distribution was 180 nm. The HRTEM showed that the nanoparticles were granular, pinniform, rodlike, and flakey in shape, and some of the nanoparticles existed in aggregation. The energy-dispersive spectrometry results showed that most of the nanoparticles contained O, Mg, Ca, Si, Fe, Ti, and P, and some of them also contained F, V, S, and Mn. When combined with the characteristics of the selected area electron diffraction pattern, the nanoparticles were confirmed to be Ca-bearing nanoparticles, attapulgite nanorods, MnO2 nanosheets, and TiO2 nanoparticles. These results indicate a new form of elements occurring in mineral water. In addition, based on the chemical and physical characteristics of the nanoparticles and mineral water, these environmental nanoparticles in the mineral water are likely to be the weathering byproducts of minerals. These nanoparticles within mineral water provide a good opportunity for understanding the behavior of nanoparticles in varied systems. Moreover, environmental nanoparticle science is important for continuing efforts in water safety, treatment, and remediation.

Understory plants are important components of forest ecosystem productivity and diversity. Compared to biomass models of overstory canopy trees, few are available for understory saplings and shrubs and therefore their roles in estimation of forest carbon pools are often ignored. In this study, we harvested 24 understory species including 4 saplings, 9 tree-like shrubs and 11 typical shrubs in coniferous and broadleaved mixed forest in northeastern China and developed the best fit allometric equations of above- and below-ground and total biomass by species-specific or multispecies using morphological measurements of basal diameter, height and crown area as independent variables. The result showed that single basal diameter, height or crown area had good explanatory power for both species-specific and multispecies (p<0.001). The best-fit models included only basal diameter in sapling and tree-like shrubs, and combinations of crown area, height, and basal diameter in typical shrubs. The logarithmic model was most desired among the 4 model forms of linear, quadratic, multiple linear and logarithmic, for species-specific and multispecies. The models we developed should help the estimation of forest ecosystem carbon stocks, especially for belowground component, and provide tools for quantification of individual species biomass of understory plants.

Background: The coronavirus disease-19 (COVID-19) has spread globally with more than 80,000 people infected, and nearly 3000 patients died. Currently, we are in an urgent need for effective treatment strategy to control the clinical deterioration of COVID-19 patients. Methods: The clinical data of 10 COVID-19 patients receiving short-term moderate-dose corticosteroid (160mg/d) plus immunoglobulin (20g/d) were studied in the North Yard of The First Hospital of Changsha, Hunan from January 17^th to February 27^th, 2020. Epidemiological, clinical, laboratory, radiological findings were analyzed. Results: After treatment with combination of low-dose corticosteroid (40-80mg/d) and immunoglobulin (10g/d), patients’ lymphocyte count (0.88±0.34 vs 0.59±0.18, P<0.05), oxygenation index including SPO₂ (94.90±2.51 vs 90.50±5.91, P<0.05) and PaO₂/FiO₂ (321.36±136.91 vs 129.30±64.97, P<0.05) were significantly lower than pre-treatment, and CT showed that the pulmonary lesion deteriorated in all patients. While after treatment of short-term moderate-dose corticosteroid plus immunoglobulin, patients’ APACHE Ⅱ score (9.10±6.15 vs 5.50±9.01, P<0.05), body temperature (37.59±1.16 vs 36.46±0.25, P<0.05), lymphocyte count (0.59±0.18 vs 1.36±0.51, P<0.05), Lactate dehydrogenase (419.24±251.31 vs 257.40±177.88, P<0.05), and C-reactive protein (49.94±26.21 vs 14.58±15.25, P<0.05) significantly improved compared with post-treatment with low-dose therapy. In addition, oxygenation index including SPO₂ (90.50±5.91 vs 97.50±1.18, P<0.05), PaO₂ (60.47±14.53 vs 99.07±34.31, P<0.05), and PaO₂/FiO₂ (129.30±64.97 vs 340.86±146.72, P<0.05) significant improved. Furthermore, CT showed that pulmonary lesions obviously improved in 7 patients. After systematic therapy, 4 out of 10 COVID-19 patients recovered and discharged. Conclusions: Short-term moderate-dose corticosteroid plus immunoglobulin is effective for reversing the continued deterioration of COVID-19 patients who failed to respond to the low-dose therapy. Funding: This work was supported by the Innovative Major Emergency Project Funding against the New Coronavirus Pneumonia in Hunan Province (Dr. Ji-Yang Liu, number 2020SK3014; Dr. Yuan-Lin Xie, number 2020SK3013).

In the world's first pig-to-human cardiac xenotransplant, the elevated levels of porcine cytomeg-alovirus (PCMV) are considered key factors contributing to patient mortality. This has renewed attention to PCMV, a virus widely prevalent in pigs. Currently, there are no effective drugs or vaccines targeting PCMV, and its high detection difficulty poses challenges for prevention and control research. In this study, antiviral small hairpin RNA (shRNA) was selected and inserted into the Rosa26 and miR-17-92 loci of pigs via a CRISPR/Cas9-mediated knock-in strategy. Further in vitro viral challenge experiments demonstrated that these genetically edited pig cells could effec-tively limit PCMV replication. Through this process, we constructed a PCMV-infected cell model, validated partial viral interference sites, enhanced gene knock-in efficiency, performed gene editing at two different gene loci, and ultimately demonstrated that RNA interference (RNAi) technology combined with CRISPR/Cas9 has the potential to generate pig cells with enhanced antiviral infec-tion capabilities. This opens up possibilities for the future production of pig populations with anti-viral functionalities.

Phytochromobilin (PΦB) participates in the regulation of plant growth and development as an important synthetase of photoreceptor phytochromes (phy). And Arabidopsis Long Hy-pocotyl 2 (HY2) appropriately works as a key PΦB synthetase. However, whether HY2 takes part in plant stress response signal network remains unknown. Here, we described the func-tion of the HY2 in NaCl signaling. The hy2 mutant was NaCl-insensitive, whereas HY2-overexpressing lines showed NaCl-hypersensitive phenotypes during seed germination. The exogenous NaCl induced the transcription and the protein level of HY2 which positively mediated the expression of downstream stress-related genes of RD29A, RD29B and DREB2A. Further quantitative proteomics showed the patterns of 7,391 proteins under salt stress. HY2 was then found to specifically regulate 215 differentially regulated proteins (DRPs) which, according to GO enrichment analysis, were mainly involved in ion homeostasis, flavonoid biosynthetic & metabolic, hormone response (SA, JA, ABA, ethylene), reactive oxygen spe-cies (ROS) metabolic, photosynthesis and detoxification pathway to respond to salt stress. More importantly, ANNAT1-ANNAT2-ANNAT3-ANNAT4 and GSTU19-GSTF10-RPL5A-RPL5B-AT2G32060, two protein interaction networks specifi-cally-regulated by HY2, jointly participated in the salt stress response. These results direct the pathway of HY2 participating in salt stress, and provide new insights for the plant to re-sist salt stress.

Background: Early diagnosis of postoperative complications is an urgent task, allowing timely prescribing of appropriate therapy and reducing the cost of patient treatment. Prognostic models based on various data could help in the early diagnosis of postoperative complications after cardiac surgery. Objectives: The purpose of the study was to determine whether an integrated approach based on clinical data along with metabolites and biomarkers had greater predictive value than the models built on less data. Methods: The study included patients (n=62) admitted for planned cardiac surgery (coronary artery bypass grafting with cardiopulmonary bypass), who were retrospectively divided into two groups depending on the presence (n=26) or absence (n=36) of postoperative complications of all types. Clinical and laboratory data on the first day after surgery were analyzed. Additionally, patients' blood samples were collected before and on the first day after surgery to determine biomarkers (interleukin-6, procalcitonin, NT-proBNP, high-sensitivity troponin T) and metabolites (8 aromatic and 2 dicarboxylic acids were detected using gas chromatography-mass spectrometry). Results: Patients before surgery, compared with healthy donors, differed in the concentration of metabolites (p &lt; 0.05), and had concentrations of a number of biomarkers exceeding the corresponding reference values. Multivariate PLS-DA models, predicting the presence or absence of postoperative complications, were built using clinical data (ROC-AUC=0.71), concentrations of metabolites and biomarkers (ROC-AUC=0.60), and the entire data set (ROC-AUC=0.75). For comparison we built univariate models using the EuroScore2 (ROC-AUC=0.59) and SOFA (ROC-AUC=0.76) scales; concentrations of lactate (ROC-AUC=0.71), the dynamic changes of 4-hydroxyphenyllactic acid (ROC-AUC=0.69), and the sum of three sepsis-associated metabolites (ROC-AUC=0.70). The proposed complex model using entire data set was comparable to the SOFA scale, which confirms the expediency of searching for new predictive models based on a variety of factors.

Milk serves as a crucial source of natural bioactive compounds essential for human nutrition and health. The gastrointestinal digestion of milk proteins releases various biologically active peptides that positively impact human health and enhance physiological performance. With the growing production of cheese, Greek yogurt, and other dairy products, the volume of unutilized acid whey is significantly increasing. Acid whey, containing almost all whey proteins and approximately one-quarter of casein, presents a valuable raw material for generating peptides with potential health benefits. These peptides exhibit properties such as antioxidant, antimicrobial, anti-inflammatory, anticarcinogenic, antihypertensive, antithrombotic, opioid, mineral-binding, and growth-stimulating activities, contributing to improved human immunity and the treatment of chronic diseases. Enzymatic hydrolysis of milk proteins has been developed as a method to produce these peptides, facilitating their use in food fortification. To incorporate whey into functional beverages, it undergoes fermentation by lactic acid bacteria with proteolytic activity. To specifically enrich these beverages with peptides exhibiting targeted bioactivities, it is essential to select lactic acid bacteria strains possessing the requisite protease profiles. Additionally, the sensory properties of the final product can be enhanced using starter cultures with diverse metabolic capabilities, even in the absence of added flavoring agents. Given the imperative to develop waste-free technologies and enhance the profitability of the dairy industry, there is a growing need to efficiently utilize and transform acid whey into a broad spectrum of valuable products and food additives. This approach is justified not only by the nutritional benefits of the bioactive components in whey but also by the commercial potential of safe and health-enhancing products.

The paper focuses on the application of a multilevel, integrative and territorial approach to the protection of cultural heritage through planning instruments in Serbia. It points out the problems of the sectoral approach and discusses international recommendations that can be integrated into the planning methodology. The case study is the area of Djerdap National Park, which has an already established international and national importance. The research suggests that the cultural heritage in the area, with the exception of the Roman limes, is still recognized at the level of individual localities. The study emphasizes the importance of aligning all levels of governance to safeguard the whole spatial entity rather than focusing solely on its particular areas. The interna-tional and national importance of the planning area contributes to the strengthening of awareness of heritage and its institutional protection. However, the vitality of the area, which is key to its sustainable development, comes from the local level. Planning documents contribute to the inte-gration of local values and local communities into development programs and projects.

In order to shorten the detection time and improve the average precision on embedded devices, A lightweight and high accuracy model is proposed for passion fruit in complex environments (backlight, occlusion, overlap, sunny, cloudy, rainy). Firstly, replacing the backbone network of YOLOv5 with a lightweight GhostNet model reduces the number of parameters and computation while improving detection speed. Secondly, a new feature branch is added to the GhostNet network, and the feature fusion layer in the neck network is reconstructed to effectively combine the lower-level and higher-level features, which not only improves the accuracy of the model but also maintains its lightweight. Finally, the knowledge distillation methods are used to transfer the knowledge from the more capable teacher model to the less capable student model, which significantly improving the detection accuracy. The improved model is denoted as G-YOLO-NK. The average accuracy of the G-YOLO-NK network is 96.00%, which is 1.00% higher than the original YOLOv5s model. Furthermore, the improved model size is 7.14MB, reduced to half of the original model, and the real-time detection frame rate is 11.25 FPS on the Jetson Nano. Compared to the state-of-the-art model, the proposed model outperforms them in terms of average precision and detection performance. The present work provides an effective model for real-time detection of passion fruits in complex orchard scenes, which can provide valuable technical support for the development of orchard picking robots and greatly improve the intelligence level of orchards.

The impact of interaction SS with MJO on rainfall along Java Island to East Nusa Tenggara has been studied using daily rainfall observation data from 2140 weather observation stations, which are also equipped with GSMaP, OLR, and ERA5 data. There were 61 SS events found, 17 during active MJO and 44 in inactive MJO. Rainfall increases more in the western study area when the active MJO and more in the eastern study area when the inactive MJO is due to SS. SS reduces rainfall in the Jakarta region, regardless of the activity or inactivity of the MJO. SS causes extreme rainfall to only occur in a small part of certain areas, so it tends to significantly reduce the possibility of extreme rainfall. In the southern part of the IMC, SS predominates over MJO in supporting increased water vapor transport. Large-scale synoptic circulations like the monsoon, SS, and MJO can interact with local land-sea wind circulation to produce spatiotemporal variability in rainfall on Java Island. Rainfall mostly increases in the afternoon and decreases in the morning when SS occurs, whether there is MJO or not. Convective instability analysis indicates that SS increases precipitation, most likely by lowering CIN and raising VIMFC.