Satellite communication is expected to play a vital role in realizing Internet of Remote Things (IoRT) applications. This article considers an intelligent reflecting surface (IRS)-assisted downlink low Earth orbit (LEO) satellite communication network, where IRS provides additional reflective links to enhance the intended signal power. We aim to maximize the sum-rate of all the terrestrial users by jointly optimizing the satellite’s precoding matrix and IRS’s phase shifts. However, it is difficult to directly acquire the instantaneous channel state information (CSI) and optimal phase shifts of IRS due to the high mobility of LEO and the passive nature of reflective elements. Moreover, most conventional solution algorithms suffer from high computational complexity and are not applicable to these dynamic scenarios. A robust beamforming design based on graph attention networks (RBF-GAT) is proposed to establish a direct mapping from the received pilots and dynamic network topology to the satellite and IRS’s beamforming, which is trained offline using the unsupervised learning approach. The simulation results corroborate that the proposed RBF-GAT can achieve approximate performance compared to the upper bound with low complexity.

Ischemic stroke is one of the most disabling diseases and a leading cause of death globally. Despite advances in medical care, the global burden of stroke continues to grow, as no effective treatments to limit or reverse ischemic injury to the brain are available. However, recent preclinical findings have revealed the potential role of transient receptor potential cation 6 (TRPC6) channels as endogenous protectors of neuronal tissue. Activating TRPC6 in various cerebral ischemia models has been found to prevent neuronal death, whereas blocking TRPC6 enhances sensitivity to ischemia. Evidence has shown that Ca2+ influx through TRPC6 activates cAMP response element-binding protein (CREB), an important transcription factor linked to neuronal survival. Additionally, TRPC6 activation may counter excitotoxic damage resulting from glutamate release by attenuating the activity of NMDA receptors of neurons by posttranslational means. Unresolved though, are the roles of TRPC6 channels in non-neuronal cells such as astrocytes and endothelial cells. Moreover, TRPC6 channels may have detrimental effects on the blood-brain barrier, although their exact role in neurovascular coupling requires further investigation. This review discusses evidence-based cell-specific aspects of TRPC6 in the brain to assess the potential targets for ischemic stroke management.

Considering rotation-induced centrifugal stiffening, spin softening, and Coriolis effects, the three-dimensional finite element model of a rotating blade with a dovetail structure is built through the contact dynamics theory. The fixed-interface component mode synthesis method is then adopted to reduce the model for high computational efficiency and adequate model accuracy. The effects of the number of normal modes on the first-six-order modal characteristics of the model varying with the rotating speed are studied between the reduced and full models. Next, the influence of rotating speed and friction factor on the nonlinear dynamic characteristics of the model under the action of aerodynamic force are elaborately discussed. The results show that: (1) tenon-mortise joint contact-induced nonlinearity under low rotating speeds results in the intermittent interference of contact surfaces and frequency multiplications of aerodynamic excitation frequency in the spectrum cascades, while that under high rotating speeds causes the continuous interface contact and asynchronous excitation at the tenon-mortise joint; (2) the increase of friction factor results in a lower contact pressure distribution and the right shift of the resonance peak (i.e., hard nonlinearity).

The transition region is a very thin but most peculiar layer in the solar atmosphere, located between the solar chromosphere and the corona. It is a key region for understanding the coronal heating, the solar eruptions triggering, and the origin of solar winds. Here, the gradients of all physical parameters are very high, including plasma density, ionization degree, temperature, and magnetic fields, etc. Therefore, the transition region should be highly dynamic, such as fast energy releasing and transporting, plasma heating, and even particle accelerating. They include two physical aspects: thermal and non-thermal processes. The thermal processes can be observed from the ultraviolet (UV) and extreme ultraviolet (EUV) emission by multi-wavelength images. The non-thermal processes, however, should be related to radio emissions especially at millimeter wavelengths, and the frequency range should span from several GHz to beyond 300 GHz, and the emission mechanism should be highly related to the magnetic fields and variations. The ultra-wide broadband spectral observations at millimeter wavelengths with high spectral resolutions may provide rich dynamic information about the transition region, such as non-thermal energy release and transmission, the flows of plasma and energetic particles, the magnetic fields and their variations, the generation and transportation of various waves, and the formation and evolution of the source regions of solar eruptions. Here, we discussed the spectral characteristics of millimeter-wave emission from the transition region and proposed a new conception of ultra-wide broadband millimeter-wave spectrometers to observe them.

Although Darwin‘s evolutionary mutation theory has been widely accepted, many endeavors have been tried to challenge it. With more and more observation of successful hybridization and hybrids, the sexual isolation between species has become vague. The mechanism of evolution has been expanded from the classical model of evolution to multiple routes of speciation. Furthermore, a fundamental crossbreeding theory has been raised and proved by two lines of evidences: paleopolyploidy and fan-shaped spectrum of species. Ancient genome duplications are widespread throughout eukaryotic lineages, particularly in plants. The genome polyploidization, especially in the somatic cell hybridization, can break through the sexual incompatibility between diploid counterparts to hybridize and produce new species. By comparing characteristics, all species in every taxon, both in the extinct fossil and extant organisms, can be arranged into fan-shaped spectrum according to their similarity: left primitive type-middle advanced type-right primitive type. The species are primitive at the two ends and advanced at the middle. The primitive two species always resemble two types of more primitive species that can be confirmed as their ancestors respectively, and the middle species is half similar to the two ancestors respectively. These suggest that the species in the spectrum come from two different ancestors by crossbreeding and gene combination. As a sum, advanced species originated from crossbreeding of two primitive ancestors, by major method of polyploidization, and proved by results of fan-shaped spectrum of species. Then, sex is the cause, force and opportunity for evolution.

A typical solid-state quantum sensor can be developed based on negatively charged nitrogen-vacancy (NV-) centers in diamond. The electron spin state of NV- can be controlled and read at room temperature. Through optical detection magnetic resonance (ODMR) technology, temperature measurement inside living cells can be achieved at the nanoscale. The key to ODMR technology is to apply microwave resonance to manipulate the electron spin state of NV-. Therefore, the microwave field characteristics formed near the NV- have a crucial impact on the sensitivity of ODMR measurement. This article mainly focuses on the temperature situation in cellular applications, and simulates the influence of structural parameters of double open loop resonant (DOLR) microwave antennas and broadband large-area (BLA) microwave antennas on the microwave field’s resonance frequency, quality factor Q, magnetic field strength, uniformity, etc. The parameters are optimized to have sufficient bandwidth, high signal-to-noise ratio, low power loss, and high magnetic field strength in the temperature range of 36 ℃ to 42.5 ℃. Finally, the ODMR spectra are used for effect comparison, and the signal-to-noise ratio and Q values of the ODMR spectra are compared when using different antennas. We have provided an optimization method for the design of microwave antennas and it is concluded that the DOLR microwave antenna is more suitable for living cell temperature measurement in our study.

Monitoring is an important component of pest management, to prevent or mitigate outbreaks of native pests, and to check for quarantine organisms. Surveys often rely on trapping, especially when the target species respond to semiochemicals. Many traps are available for this purpose, but they are bulky in most cases, which raises transportation and deployment issues, and they are expensive, which limits the size and accuracy of any network. To overpass these difficulties, entomologists have used recycled material, such as modified plastic bottles, producing cheap and reliable traps but at the cost of recurrent handywork, not necessarily possible for all end-users (e.g., for national plant protection organizations). These bottle-traps have allowed very large surveys which would have been impossible with standard commercial traps, and we illustrate this approach with a few examples. Here we present, under a Creative Commons BY-SA License, the blueprint of a fan-trap, a foldable model, laser-cut from a sheet of polypropylene, that can rapidly be produced in large numbers, and could be transported and deployed in the field with very little efforts. Our first field comparisons show that fan-traps are as efficient as bottle-traps, and we describe two cases where they are being used for monitoring.

In thermal power plants equipped with air-cooled condensers, axial cooling fans operate under the influence of ambient flow fields. Under inlet cross-flow conditions, the resultant asymmetric flow field is known to introduce additional harmonic forces to the fan blades. This effect has previously been studied only numerically or using blade mounted strain gauges. For this study, Laser Scanning Vibrometry was used to assess fan blade vibration under inlet cross-flow conditions in an adapted fan test rig inside a wind tunnel test section. Two co-rotating laser beams scanned a low pressure axial fan, resulting in spectral, phase resolved surface vibration patterns of the fan blades. Two distinct operating points were examined, with and without inlet cross-flow influence. While almost identical fan vibration patterns were found for both reference operating points, overall blade vibration increased by 100% at low fan flow rate due to cross-flow, and by 20% at high fan flow rate. While numerically predicted natural frequency modes could be confirmed from experimental data as minor peaks in the vibration amplitude spectrum, they were not excited significantly by cross-flow. Instead, primarily higher rotation rate harmonics were amplified, i.a. a synchronous blade tip flapping was strongly excited at the blade pass frequency.

To investigate the effects of plant polysaccharides combined with boric acid on digestive function, immune function, and harmful gas and heavy metal contents in faeces of finishing pigs, for this study, 90 healthy three-way cross-bred pigs were selected and randomly divided into five groups: Con) A control, fed basic feed; BA) fed basic feed supplemented with 40 mg/kg of boric acid; BA+APS) fed basic feed supplemented with 40 mg/kg of boric acid and 400 mg/kg of Astragalus polysaccharides; BA+GLP) fed basic feed supplemented with 40 mg/kg of boric acid with 200 mg/kg of Ganoderma lucidum polysaccharides; and BA+EPS) fed basic feed supplemented with 40 mg/kg of boric acid and 500 mg/kg of Echinacea polysaccharides. Compared with the Con, the average daily gain (ADG) and trypsin activity were higher in BA, along with there being increased glutathione peroxidase (p < 0.05); furthermore, lower malondialdehyde content and harmful substance emissions from manure were observed (p < 0.05). Compared with BA, increases in ADG, gain-to-feed ratio (G/F), trypsin, and maltase activities were observed in BA+EPS (p < 0.05), as well as a lower NH3 emissions (p < 0.05). Compared with BA, BA+APS exhibited higher ADG, average daily feed intake (ADFI), G/F, trypsin, and maltase activities (p < 0.05), while H2S emissions were lower (p < 0.05). And Taken together, our findings reveal that supplementation with boric acid and plant polysaccharides in the diet of finishing pigs synergistically improved their growth performance, trypsin and maltase activities, and immune function, while also discovered the intestinal digestive enzymes, serum inflammatory factors, oxidative stress responseand emissions of harmful gases and heavy metals from feces and urine were tightly related, further reducing the impact of fecal pollution generated by modern animal husbandry on the environment.

We successfully designed an optimized plenum fan with a three-dimensional, smooth, curved blade. The optimized model revealed that the static pressure in the channel had been increased uniformly and stably, and the flow separation at the leading edge was significantly reduced. To conclude, the three-dimensional blade stabilized the fluid flow, and the flow friction was reduced by suppressing the flow separation as much as possible so that both the static pressure and the static efficiency were clearly improved in comparison with those of the original model. The static efficiency, as a result, was improved by 6% compared with that of the original model.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

In this paper, spacetime is defined as the absolutely invariant homogeneous "coordinate spacetime" frame and its modulation by the relatively variable non-homogeneous "metric spacetime" under its constraints. This modulation is caused by matter and motion, and carries the function of transmitting interactions, reflecting the diffeomorphism invariance and Lorentz invariance. This inhomogeneous spacetime concept makes the medium nature of spacetime more obvious and avoids the problem of "path dependence" caused by the concept of curved spacetime. In this paper, it is argued that all energy-momentum has internal spatio-temporal properties, and all interactions must be transmitted through spacetime metrics. On this basis, a converging and dispersing cyclic multiverse model is proposed. This model of the universe is inevitable as long as there are two macroscopic manifestations of the matter of the universe, namely, gravitation induced convergence and "explosive" dispersion caused by different factors. The new cosmic model matches the observed accelerated "expansion" of the universe and no longer requires the dark energy hypothesis.

This paper empirically analyzes the relationship between digital inclusive finance and rural income, and demonstrates that digital inclusive finance plays a significant role in promoting rural income, based on the 2012-2018 panel data of 17 cities in Henan Province of China. Further dimensional research unveils that all of its breadth of coverage, depth of use and degree of digitization present significant positive correlation with rural income, and a robustness test was conducted through the sub-sample method. In addition, according to regression analysis on the influencing factors of digital inclusive finance through the Tobit model, the level of economic development, the Internet popularity rate and the urbanization rate have a positive effect on the development of digital inclusive finance in Henan, while the income gap between urban and rural areas and the degree of opening up have a negative effect. Finally, predicated on the analysis of the restrictive factors of Henan’s digital inclusive finance in increasing rural income, the paper puts forward specific policy proposals based on the native state quo.

The existence of palindrome numbers of arbitrary length greater than 2 that are divisible by the prime number 37 is proven in this paper. The method to construct such a palindrome is also described. It turns out that a palindrome number divisible by 37 is also divisible by 3 and, consequently, divisible by 111.

Underwater Sensor Networks (UWSNs) can enable a broad range of applications such as resource monitoring, disaster prevention, and navigation-assisted. It is especially relevant for sensor nodes location in UWSNs. Global Positioning System (GPS) is not suitable for using in UWSNs because of the underwater propagation problems. Hence some localization algorithms based on the precise time synchronization between sensor nodes have been proposed which are not feasible for UWSNs. In this paper, we propose a localization algorithm called Two-Phase Time Synchronization-Free Localization Algorithm (TP-TSFLA). TP-TSFLA contains two phases, namely, range-based estimation phase and range-free evaluation phase. In the first phase, we address a time synchronization-free localization scheme base on the Particle Swarm Optimization (PSO) algorithm to decrease the localization error. In the second phase, we propose a Circle-based Range-Free Localization Algorithm (CRFLA) to locate the unlocalized sensor nodes which cannot obtain the location information through the first phase. In the second phase, sensor nodes which are localized in the first phase act as the new anchor nodes to help realize localization. Hence in this algorithm, we use a small number of mobile beacons to help achieve location without any other anchor nodes. Besides, to improve the precision of the range-free method, an extension of CRFLA by designing a coordinate adjustment scheme is updated. The simulation results show that TP-TSFLA can achieve a relative high localization ratio without time synchronization.

Deterministic-stochastic empirical mode decomposition (EMD) is used to obtain low-frequency (non-diffusive, i.e., background velocity) and high-frequency (diffusive, i.e., eddies) components from a Lagrangian drifter‘s trajectory. Eddy characteristics are determined from the time series of eddy trajectories from individual Lagrangian drifter such as the eddy radial scale, eddy velocity scale, eddy Rossby number, and eddy-background kinetic energy ratio. A long-term dataset of the SOund Fixing And Ranging float time series obtained near the California coast by the Naval Postgraduate School from 1992 to 2004 at depth between 150 and 600 m (http://www.oc.nps.edu/npsRAFOS/) is used as an example to demonstrate the capability of the deterministic-stochastic EMD.

In this paper, some mixed type bounds on the spectral radius $\rho(A\circ B)$ for the Hadamard product of two nonnegative matrices ($A$ and $B$) and the minimum eigenvalue $\tau(C\star D)$ of the Fan product of two $M$-matrices ($C$ and $D$) are researched. These bounds complement some corresponding results on the simple type bounds. In addition, a new lower bound on the minimum eigenvalue of the Fan product of several $M$-matrices is also presented: $$ \tau(A_{1}\star A_{2}\cdots\star A_{m})\geq \min_{1\leq i\leq n}\{\prod^{m}_{k=1}A_{k}(i,i)-\prod^{m}_{k=1}[A_{k}(i,i)^{P_{k}}-\tau(A_{k}^{(P_{k})})]^\frac{1}{P_{k}}\}, $$ where $A_{1},\ldots, A_{k}$ are $n\times n$ $M$-matrices and $P_{1},\ldots, P_{k}>0$ satisfy $\sum^{m}_{k=1}\frac{1}{P_{k}}\geq 1$. Some special cases of the above result and numerical examples show that this new bound improves some existing results.

The concept of smart morphing blades, which can control themselves to reduce or eliminate the need for active control systems, is a highly attractive solution in blade technology. In this paper an innovative passive control system based on Shape Memory Alloys (SMAs) is proposed. On the basis of previous thermal and shape characterization of a single morphing blade for a heavy-duty automotive cooling axial fan, this study deals with the numerical analysis of the aerodynamic loads acting on the fan. By coupling CFD and FEM approaches it is possible to analyze the actual blade shape resulting from both the aerodynamic and centrifugal loads. The numerical results indicate that the polymeric blade structure ensures proper resistance and enables shape variation due to the action of the SMA strips.

Tourism is an important industry that promotes national economic and social progress. All-for-one tourism is a new concept of regionally coordinated development that uses the tourism industry as an engine to boost resource integration, industrial integration, and social sharing. Tourism service is the main embodiment of cultural ecosystem services for all-for-one tourism cities. Taking Liyang in China as an example, this paper used a combination of GIS spatial analysis and big data text mining to evaluate the tourism service from three aspects: the quality of tourism resources, the comprehensiveness of tourism service facilities, and the satisfaction of tourists. The results show that (1) the tourism service is better in the northwestern and eastern areas of the city, while it is lower in the northeastern and southwestern parts; (2) the hotspot areas should focus on improving the tour routes, the transport capacity, and excessive charges; the cold spot areas should work on ecological restoration and creating new tourism attractions by combining the local industries; (3) rural tourism integrating agriculture and visitation should be highlighted as a key growth point to improve the city’s tourism service function.

Because Newton's gravity and Einstein's general theory of relativity are macroscopic gravitational theories, therefore, this paper attempts to establish a set of quantum gravity theory of the microscopic expression of Newton's and Einstein's theory of gravity to make up for the shortcomings of the existing macro-gravity theory at the micro level, and further develop the macroscopic gravity theory into the microscopic field. Based on the cognition of the field theory model, from the general assumption, space-time is further regarded as an ideal fluid, from the perspective of the distribution of ideal fluid density, this paper derives the Newton's universal gravitational equation and Einstein's general relativity equation. On the micro level, the gravitational field is further interpreted as a gradient field of space-time density; the Newtonian potential is further interpreted as the density of an object at the micro level; gravity is further interpreted as the potential pressure(space-time pressure) exhibited by the gradient of the density of the object at the micro level; flection space-time is further interpreted as the embodiment of the gradient distribution of the ideal fluid (space-time) density at the micro level. Based on a modified gravitational model, it explains the dynamics of the stars' rotation and revolution.

Analyzing horse behavior is crucial for assessing training quality, particularly in accurately identifying actions like standing, walking, and running. Research has been conducted both domestically and internationally in this regard; however, challenges persist, including reliance on single sensors, poor real-time performance, and low identification accuracy. In view of these challenges, this study investigated real-time identification of horse behavior based on wearable devices. The system, centered around a microcontroller and utilizing a 4G network as a carrier, employs multi-axis IMU sensors as input sources to perceive horse posture. The study proposed a behavior classification method based on analysis of acceleration thresholds. The method consists primarily of two sequential stages: first, the resultant acceleration interval counting method, which employs a nonlinear segmentation approach for initial behavior classification; and second, the statistical analysis of variance parameters between segments, which when coupled with multi-level threshold processing, achieves a refined classification. Experimental results indicated that the interval counting method alone achieved an accuracy of 87.55%, while for the variance analysis method alone the accuracy was 90.87%. The proposed method, comprising the two stages, reached a classification accuracy of 91.57%, underpinning its usefulness in supporting future equine research.

Moso bamboo is famous for fast growing and biomass accumulation, as well as high annual output for timber and bamboo shoots. These high outputs require high nutrient inputs to maintain and improve stand productivity. Soil nitrogen (N), phosphorus (P) and potassium (K) are important micronutrients for plant growth and productivity. Due to high variability of soils, analysing spatial patterns of soil N, P and K stocks is necessary for scientific nutrient management in Moso bamboo forests. In this study, soils were sampled from 138 locations across Yong’an City and ordinary kriging was applied for spatial interpolation of soil N, P and K stocks. Soil N stock showed a strong spatial dependence while soil N and P stocks presented a moderate spatial dependence, indicating soil N was mainly controlled by intrinsic factors while soil N and P stocks were controlled by both intrinsic and extrinsic factors. Different spatial patterns were observed for soil N, P and K stocks across the whole study area, indicating that fertilizations with different ratios of N:P:K should be applied for different sites to maintain and improve stand productivity. The total soil N, P and K stocks within 0-60 cm were 0.624, 0.020 and 0.583 Tg, respectively.

Classical mechanics describes the laws of motion in the macroscopic material world, while quantum mechanics describes the laws of motion in the microscopic material world that classical mechanics cannot explain, and achieves a highly accurate mathematical representation of the laws of microscopic physical motion. But even with such a successful theory, there is confusion about the probability wave. Therefore, this paper attempts to improve the physical definition of the conceptual basis of quantum mechanics, thus solving the confusion of quantum mechanical probability waves, and finally surprisingly discovered another feasible interpretation of the principle of cosmic redshift and the invariance of the speed of light.

Toshiba devised the bladeless fan (or Air Multiplier) concept in 1981. Researchers like James Dyson and Jafari et al. further developed it. Bladeless fans are more energy-efficient, safer due to the hidden blades, easier to clean, and more adjustable than conventional fans. From a performance point of view, bladeless fans are better because they multiply mass flow rate, eliminate buffeting, consume less power, and are quieter. This paper investigates the influence of the airfoil’s outlet slit thickness on the discharge ratio by varying the outlet slit thickness of an Eppler 473 airfoil from 1.2 mm to 2 mm in intervals of 0.2 mm. Results indicated that smaller slits showed higher discharge ratios. The airfoil with a 1.2 mm slit thickness showed a discharge ratio of 18.78, a 24% increase from the discharge ratio of the 2 mm slit. The effect of outlet angle on the pressure drop across the airfoil was also studied. Outlet angles were varied from 16∘ to 26∘ by an interval of 2∘. The airfoil profile with a 24∘ outlet angle showed a maximum pressure difference of 965 Pa between the slit and leading edge. In contrast, the 16∘ outlet angle showed the least pressure difference of 355 Pa. Parameters such as average velocity, turbulent kinetic energy, the standard deviation of velocity and outlet velocity magnitude was used to assess the performance of airfoil profiles used in bladeless fan.

Concerning fan systems with an air pipe connecting air intake and a closed outlet, aerodynamic noise cannot be directly transmitted from the fan inlet and outlet to the outside. At this moment, the volute vibrational radiation noise induced casing surface vibration is the major noise component. The main factors affecting the fan vibrational noise are analyzed through theoretical derivation, then a vibrational noise optimization control method for the volute casing is proposed that considered the influence of vibro-acoustic coupling, taking the panel thickness of the volute (front-panel thickness [FT], side-panel thickness [ST], and back-panel thickness [BT]) as design variables, and the acoustical power of the volute surface and the total mass of the volute as the optimal target function. The optimization method is mainly divided into three main parts: the first was based on the simulation of unsteady flow of the fan to obtain the vibrational noise source; the second, using the design of experimental (DOE) method and the proposed numerical simulation of fluid-structure-acoustic coupling method to obtain the designing space, then the radical-based function (RBF) method is used to construct the approximate surrogate model instead of the simulation model previously mentioned, which was used to provide the basic mathematical model for the optimization of the next part; the third part, implementing the low vibrational noise optimization for the fan volute, applied the single-target (taking volute radiated acoustical power as the target function) and the multi-target (taking the volute radiated acoustical power and volute total mass as the target function) methods. In addition, the fan aerodynamic performance, volute casing surface fluctuations, and vibration response were validated by experiments, showing good agreement. It is of utmost importance that the dynamic pressure measurements and vibrational tests on the volute casing verify the accuracy of the numerical calculation. The optimization results showed that the vibrational noise optimization method proposed in this study can effectively reduce the vibration noise of the fan, obtaining a maximum value of noise reduction of 7.3 dB. The optimization identified in this paper provides a significant reference for the design of a low-vibrational-noise volute.

The Gurney flap (GF) is a miniature lift-enhancement device and is usually mounted at the trailing edge of an airfoil. The GF and has been successfully applied to isolated airfoils, multi-element airfoils, and aircraft wings as well as helicopter rotor due to its attractive features of simplicity, cost-effective and separation control. The GF also has aroused the attention of researchers in the turbomachinery industry. However, limited studies are currently available on the application of a GF to an axial fan.Hence, in this paper, we conduct a wind tunnel and computational fluid dynamic (CFD) investigation on an axial fan profiled with a NACA 65-(12)10 airfoil to evaluate the effect of the GF on the performance of the fan. We also present the detailed flow features of the fan with and without the GF after validating the simulation results with the experimental results. The experimental results show that as the GF is installed higher on the fan blade, it can produce a higher total pressure rise accompanied with a greater loss of efficiency. The installation of the GF also enlarges the work capacity of the fan. Detailed flow field analysis, including the surface pressure distribution, vorticity distribution at the trailing edge and streamline distribution of the fan, is carried out to understand the mechanisms of the effect of the GF on the performance of the fan.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Purpose: This study aimed to focus on the design and development of low-cost DIY air purifiers, using a ventilating fan, air pump, water pump, and an ultrasonic generator, with regard to filtration efficacy and also cost-effectiveness that can be used during the COVID-19 pandemic and haze pollution. Methods: Six types of household air purifiers, incorporating a HEPA filter, a HEPA filter & electrostatic fiber, an air pump, an air pump & ultrasonic wave, a water pump, and a water pump & ultrasonic wave, were fabricated. The amount of particulate matter (PM) and CO₂ levels were recorded at 0, 10, 20, 30, and 60 min, then, repeated 3 times. After 10 min of the 3^rd experiment of each study, the last measurement of air pollution would be recorded. Results: At 60 min, the HEPA filter & electrostatic fiber showed the best performance regarding reduction of PM and CO₂ levels. The highest PM reduction rate had occurred at 30 min using an air pump procedure (99.330 to 100%). The CO₂ levels of all experiments had fluctuated at different times. After 10 min of a closed machine, HEPA filter & electrostatic fiber revealed the highest rate of PM elevation, while PM levels of all water-based purifier systems were decreased. A water pump and air pump were the cheapest air cleaners, when taking into account maintenance expenses and electricity charges. Conclusion: An air pump is the optimum method for reducing particulate matter at minimum cost but without the benefit of reduced humidity, while the HEPA filter & electrostatic fiber is the best system to decrease PM levels, but this requires an enclosed structure at the inlet to prevent dust coming back into the room. As filtration efficiency is increased by the use of filters & electrostatic fiber mechanisms, the more expensive the system becomes.

Attribute reduction is a core technique in the rough set domain and an important step in data preprocessing. Researchers have proposed numerous innovative methods to enhance the capability of attribute reduction, such as the emergence of multi-granularity rough set models, which can effectively process distributed and multi-granularity data. However, these innovative methods still have many shortcomings, such as how to deal with complex constraints and how to perform multi-angle effectiveness evaluations. Based on the multi-granularity model, this study proposes a new method of attribute reduction, namely using multi-granularity neighborhood information gain ratio as the measurement criterion. This method combines both supervised and unsupervised perspectives, and by integrating multi-granularity technology with neighborhood rough set theory, constructs a model that can adapt to multi-level data features. This model can select the optimal granularity level or attribute set according to the requirements. Finally, the proposed method is experimented with on 15 UCI datasets against six other attribute reduction algorithms. The experimental outcomes, upon analysis and comparative review, substantiate the reliability and consistency of the attribute reduction approach introduced in this study.

Leucokinins (LKs) constitute a neuropeptide family first discovered in a cockroach and later identified in numerous insects and several other invertebrates. The LK receptors are only distantly related to other known receptors. Among insects, there are many examples of species where genes encoding LKs and their receptors are absent. Furthermore, genomics has revealed that LK signaling is lacking in several of the invertebrate phyla and in vertebrates. In insects, the number and complexity of LK expressing neurons vary, from the simple pattern in the larva of Drosophila where the entire CNS has 20 neurons of three main types, to cockroaches with about 250 of many different types. Common to all studied insects is the presence or 1-3 pairs of LK-expressing neurosecretory cells in each abdominal neuromere of the ventral nerve cord, that, at least in some insects, regulate secretion in Malpighian tubules. This review summarizes the diverse functional roles of LK signaling in insects, as well as other arthropods and mollusks. These functions include regulation of ion and water homeostasis, feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. Other functions are implied by the neuronal distribution of LK, but remain to be investigated.

Activities in the digital economy driven by information technology have rapidly increased in scope and speed in the aftermath of COVID-19. Meanwhile, social isolation accelerated by quarantine measures has increased concerns about individuals’ mental health. However, little is known about the specific consequences of online interactions, especially when applied in online fan community-based relationships where loyal community members are prevalent. Therefore, we examined whether a sense of virtual community (SOVC) can link fans’ online activities with their mental well-being and behavioral loyalty to the platform. For this purpose, we focus on BTS fandom “Adorable Representative MC for Youth” (ARMY) behaviors and attitudes on the fan community platform Weverse. With 202 valid data samples acquired from global ARMY, this study conducted a partial least squares–structural equation modeling analysis. The empirical findings reveal that SOVC in Weverse is significantly influenced by the intensity of online interactions with other fans and parasocial relationships with celebrities. SOVC is found to be the direct predictor of fans’ behavioral loyalty and mental well-being. When considering fans’ perceptions of other social media platforms, dissatisfaction with previous online fan communities enhances the intensity of online interactions with other fans in Weverse.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

In order to balance the conflicts among mass flow rate, total pressure ratio, adiabatic efficiency and stall margin in a low-bypass transonic fan, the optimization of the rotor blade is implemented in this study. An advanced 3D optimization design system is adopted, and flow diagnostic methods based on vorticity dynamics are employed to discuss the flow field. Results indicate that by controlling the blade camber line curvature, significant improvements in the aerodynamic performance for the fan stage are achieved, the total pressure ratio is increased by 1.90%, while the adiabatic efficiency and mass flow rate are increased by 4.45% and 5.82%, respectively. Vorticity diagnosis suggest that there exists a close link between performance parameters and vorticity parameters in the axial fan/compressor, both azimuthal vorticity and boundary vortex flux have significant influences on the stage performance. Moreover, the boundary layer separation is accompanied by the spike of entropy and static pressure, while the derivation/gradient of these flow parameters would also suffer drastic changes under the effect of shock wave. The vorticity parameters could provide detailed flow information about the on-wall flow with high accuracy, which provides the researchers with a novel method for the turbomachinery aerodynamic design and analysis.

New innovative green concepts in electrified vertical take-off and landing vehicles currently emerge as a revolution to urban mobility going into the third dimension (vertically). The high population density of cities makes the market share highly attractive while posing an extraordinary challenge for community acceptance due to the increasing and possibly noisier commuter traffic. In addition to passenger transport, package deliveries to customers by drones may enter the market. The new challenges associated with this increasing transportation need in urban, rural and populated areas pose challenges for established companies and startups to deliver low-noise emission products. The article's objective is to revisit the benefits and drawbacks of an affordable acoustic measurement campaign focused on early prototyping. In the very early phase of product development, often considerably limited resources are available. With this in mind, the article discusses the sound power results using the enveloping surface method in a typically available low-reflection room with a reflecting floor according to DIN EN ISO 3744:2011-02. The method is applied to a subsonic electric ducted fan (EDF) unit of a 1:2 scaled electrified vertical take-off and landing vehicle. The results show that considerable information at low costs can be gained for the early prototyping stage, despite this easy-to-use, easy-to-realize, and not fine-tuned measurement setup. Furthermore, the limitations and improvements to a possible experimental setup are presented to discuss a potentially more ideal measurement environment. Measurements at discrete operating points and transient measurements across the total operating range were conducted to provide complete information on the EDF's acoustic behavior. The rotor-self noise and the rotor-stator interaction were identified as primary tonal sound sources, along with the highest broadband noise sources located on the rotor. Based on engineering experience, a first acoustic improvement treatment is also quantified with a sound power level reduction of 4dB(A). In conclusion, the presented method is a beneficial first measurement campaign to quantify the acoustic properties of an electric ducted fan unit at minimal resources in a reasonable time of several weeks when starting from scratch.

Topography represented by high resolution digital elevation models are able to inform past and present morphological process on the terrain. High resolution LiDAR data taken by the General Directorate of Map at the surroundings of the Bergama city shows great opportunities to understand the morphological process on alluvial fan on which the city is located and the flood plain of Bakırçay river near the alluvial fan. In this paper the LiDAR data collected in 2015 have been used to create DEM’s to understand the geomorphological evolution of the alluvial fan and the flood plain around it. Since the proximal roots and medial parts of the alluvial fan have been the scene for a long human settlement most topographical traces of the morphological process have been distorted. Nevertheless, the traces of past and present morphological process at the distal fan which consist the contact zone with the flood plain are very clear on the DEM created from LiDAR data. The levees and some old courses of Bergama and Bakırçay rivers have been shown on the maps which are also important to understand the ancient roads which follows these levees.

In this perspective article, we ponder topographical enhancements of artificial neural networks. In our recent paper in JMLR, we proved a quasi-equivalence between the network width and depth and also discussed the power of intra-links, which can be viewed as network height. In 1982, Hopfield published a network to model human associative memory, which contains many loops for dynamic evolution toward fixed points. Based on noising-denoising loops, diffusion models are recently developed to enable Bayesian modeling and inference with big data. Furthermore, we envision development of multi-AI-agent systems through “netware” engineering as a quantum leap of software engineering for emergent behaviors and autonomous AI at individual and population levels. We believe that the novel use of links and loops in space and time via multi-scale coupling would catalyze the next-generation neural networks.

Air passenger traffic prediction is crucial for the effective operation of civil aviation airports. Despite some progress in this field, the prediction accuracy and methods need further improvement. This paper proposes an integrated approach to the prediction of air passenger index as follows. Firstly, the air passenger index is defined and classified by the K-means clustering method. Based on the mutual information (MI) principle, the information entropy is used to analyze and select the key influencing factors of air passenger travel. By incorporating the MI principle into the support vector regression (SVR) framework, this paper presents an innovative MI-SVR machine learning model used to predict the air passenger index. Finally, the proposed model is validated by passenger throughput data of the Shanghai Pudong International Airport, China. The experimental results prove the model feasibility and effectiveness by comparing them with conventional methods, such as ARIMA, LSTM, and other machine learning models, outperformed by the MI-SVR model. Besides, it is shown that the prediction effect of each model could be improved by introducing influencing factors based on mutual information. The main findings are considered instrumental to the airport operation and air traffic optimization.

Air passenger traffic prediction is crucial for the effective operation of civil aviation airports. Despite some progress in this field, the prediction accuracy and methods need further improvement. This paper proposes an integrated approach to the prediction of air passenger index as follows. Firstly, the air passenger index is defined and classified by the K-means clustering method. Based on the mutual information (MI) principle, the information entropy is used to analyze and select the key influencing factors of air passenger travel. By incorporating the MI principle into the support vector regression (SVR) framework, this paper presents an innovative MI-SVR machine learning model used to predict the air passenger index. Finally, the proposed model is validated by passenger throughput data of the Shanghai Pudong International Airport, China. The experimental results prove the model feasibility and effectiveness by comparing them with conventional methods, such as ARIMA, LSTM, and other machine learning models, outperformed by the MI-SVR model. Besides, it is shown that the prediction effect of each model could be improved by introducing influencing factors based on mutual information. The main findings are considered instrumental to the airport operation and air traffic optimization.

The cuttlebone-like structure is a complex porous bionic structure with asymmetric sinusoidal S-shaped wall structure connecting laminar septa, and studies have shown that the cuttlebone-like structure has light weight, high strength and excellent energy absorption capability. It has become an important research to investigate the mechanical mechanism of cuttlebone-like structure and to design a bionic structure beyond nature structure based on it. In order to investigate the mechanical properties of the static compression and shearing processes of the cuttlebone-like structure, this paper establishes theoretical formulas and analyzes the influence of dimensionless parameters such as height-to-thickness ratio $\lambda$, period-to-thickness ratio $\xi$ and amplitude to period ratio $\eta$ on the compression and shearing processes with the help of ABAQUS finite element software.The parameter sensitivity analysis method was used to compare the important influence degree of each dimensionless parameter on the mechanical properties of the structure and to determine the relative optimal parameters of the structural mechanical properties under compression and shearing. Based on the relatively optimal parameter of the cuttlebone-like structure, the cross-sectional geometry of the structure is improved to build a new cuttlebone-like structure.The experimental results showed that the new cuttlebone-like structure with revised cross-section improved the mechanical properties of the cuttlebone-like structure.The study results are of theoretical guidance to enhance the mechanical properties and geometric design of cuttlebone-like structures.

A Systemic Lupus Erythematosus (SLE) is a prototypical systemic autoimmune disease characterized by a complex interplay of genetic, molecular, and cellular factors. It is considered a multifactorial disorder influenced by genetic susceptibility, environmental triggers, and dysregulated immune responses. Understanding the molecular and cellular mechanisms driving SLE pathogenesis has been instrumental in developing targeted therapies to manage the disease and improve patient outcomes. In this essay, we will delve into the intricate molecular and cellular processes underlying SLE and examine the key lessons learned from human therapies.

Recent advances in differential topology single out four-dimensions as being special, allowing for vast varieties of exotic smoothness (differential) structures, distinguished by their handlebody decompositions, even as the coarser algebraic topology is fixed. Should the spacetime we reside in takes up one of the more exotic choices, and there is no obvious reason why it shouldn't, apparent pathologies would inevitably plague calculus-based physical theories assuming the standard vanilla structure, due to the non-existence of a diffeomorphism and the consequent lack of a suitable portal through which to transfer the complete information regarding the exotic physical dynamics into the vanilla theories. An obvious plausible consequence of this deficiency would be the uncertainty permeating our attempted description of the microscopic world. We tentatively argue here, that a re-inspection of the key ingredients of the phenomenological particle models, from the perspective of exotica, could possibly yield interesting insights. Our short and rudimentary discussion is qualitative and speculative, because the necessary mathematical tools have only just began to be developed.

It is well known but under-appreciated in astrophysical applications, that it is possible for gravity to take on a life of its own in the form of Weyl-curvature-only metrics (note we are referring to the Weyl-only solutions of ordinary General Relativity, we are not considering Weyl conformal gravity or any other modified gravity theories), as numerous examples demonstrate the existence of gravitational fields not being sourced by any matter. In the weak field limit, such autonomous gravitational contents of our universe manifest as solutions to the homogeneous Poisson's equation. In this note, we tentatively explore the possibility that they may perhaps account for some phenomenologies commonly attributed to dark matter. Specifically, we show that a very simple solution of this kind exists that can be utilized to describe the rising tails seen in many galaxy rotation curves, which had been difficult to reconcile within the cold dark matter or modified Newtonian dynamics frameworks. This solution may also help explain the universal $\sim 1$Gyr rotation periods of galaxies in the local universe.

Semantic communication is not obsessed with improving the accuracy of transmitted symbols, but is concerned with expressing the desired meaning that the symbol sequence exactly carried. However, the generation and measurement of semantic messages are still an open problem. Expansion combines simple things into complex systems and even generates intelligence, which is consistent with the evolution of the human language system. We apply this idea to semantic communication system, quantifying and transmitting semantics by symbol sequences, and investigate the semantic information system in a similar way as Shannon did for digital communication systems. This work was the first to propose the concept of semantic expansion and knowledge collision, which may provide a new paradigm for semantic communications. We believe that expansion and collision will be the cornerstone of semantic information theory.

In foggy weather scenarios, the scattering and absorption of light by water droplets and particulate matter cause object features in images to become blurred or lost, presenting a significant challenge for target detection in autonomous driving vehicles. To tackle this problem, this study proposes a foggy weather detection method, YOLOv5s-Fog, based on the YOLOv5s framework. The model enhances the feature extraction and expression capabilities of YOLOv5s by introducing a novel target detection layer, SwinFocus. Additionally, this research incorporates decoupled head into the model and replaces the conventional non-maximum suppression method with Soft-NMS. Experimental results demonstrate that these improvements effectively enhance the detection performance for blurry objects and small targets in foggy weather conditions. Compared to the baseline model YOLOv5s, YOLOv5s-Fog achieves a 5.4% increase in mAP on the RTTS dataset, reaching 73.4%. This method provides technical support for rapid and accurate target detection in adverse weather conditions, such as foggy weather, for autonomous driving vehicles.

Sphalerite has been recognized as the most important carrier of critical metal of Indium (In) due to that In mainly exists in the sphalerite lattice by isomorphic substitution. There are two significant replacing schemes for In entry into sphalerite, these are, Ag++In3+→2Zn2+ and Cu++In3+→2Zn2+. In order to understand the reaction process and constraints of the two substitution schemes, this paper uses first-principles methods to calculate In and Ag, Cu replacing Zn in sphalerite. According to the substitution schemes of Ag++In3+→2Zn2+ and Cu++In3+→2Zn2+, two doped sphalerite systems of Zn30InAgS32 and Zn30InCuS32 were constructed using 2×2×2 supercell model of sphalerite. Firstly, the pressure is controlled to 30MPa, and the temperature is set from 20-40MPa to simulate the response of the two doped sphalerite systems to temperature; Then, the control temperature was unchanged to 600K, and the pressure was set from 20-40MPa to investigate the pressure control of the two doped sphalerite systems. The lattice parameters, substitution energy, electronic structure, and population analysis of the designed models before and after replacement have been critically compared. The main conclusions can be drawn that it is more stable for In to enter sphalerite via the coupled substitution scheme Cu++In3+→2Zn2+, and the conditions that the two substitution schemes most likely to occur are 650K and 40MPa. This study not only reveals the physical and chemical properties of In-rich sphalerite formed by the two reaction processes of Ag++In3+→2Zn2+ and Cu++In3+→2Zn2+, but also has a certain enlightenment effect on the search for indium in sphalerite, and promotes the application of first principles in mineralization analysis.

An energy model that correlates fan airflow, head, speed, and system power input is essential to detect device faults and optimize control strategies in fan systems. Since the application of variable frequency drives (VFDs) makes the motor efficiency data published by manufacturers inapplicable, the fan efficiency and drive (belt-motor-VFD) efficiency must be identified for each individual system to obtain accurate energy models. The objectives of this paper are to identify an energy model of existing VFD-motor-fan systems using available experimental data and demonstrate its applications in loose belt fault detection and virtual airflow meter development for optimal control. First, an approach is developed to identify the fan head, fan efficiency and drive efficiency curves using available fan head, speed, and system power input as well as temporarily measured airflow rate without measuring shaft power. Then the energy model is identified for an existing VFD-motor-fan system. Finally, the identified model is applied to detect the slipped belt faults and develop the virtual airflow meter. The experiment results reveal that the developed approach can effectively obtain the energy model of VFD-motor-fan systems and the model can be applied to effectively detect slipped belt faults and accurately calculate the fan airflow rate.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Plant-microbe interactions are essential for ecosystem health and agricultural productivity. Metabolomics has revolutionized our understanding of these interactions by providing powerful methods to decipher the complex chemical signals involved. This review highlights the various metabolomics techniques used to study plant-microbe interactions, such as mass spectrometry, nuclear magnetic resonance spectroscopy, and advanced imaging technologies. We also discuss the role of contemporary bioinformatics tools, extensive databases, and the increasing influence of artificial intelligence and machine learning in the analysis of metabolomics data. Integrating metabolomics with other omics fields, including transcriptomics, proteomics, and metagenomics, allows for a comprehensive understanding of the molecular mechanisms underlying plant-microbe interactions. The review emphasizes the significance of fluxomics in elucidating the dynamic nature of metabolic networks. While there are challenges in data analysis, integration, and interpretation, metabolomics has profoundly expanded our knowledge of the role metabolites play in shaping plant-microbe interactions. As metabolomics technologies advance and integrate further with other omics approaches, we anticipate groundbreaking discoveries that will provide deeper insights into these complex interactions, ultimately leading to innovative strategies for sustainable agriculture and biotechnology.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Prediction of protein-ligand binding affinities is crucial for computational drug discovery. A number of deep learning approaches have been developed in recent years to improve the accuracy of such affinity prediction. While the predicting power of these systems have advanced to some degrees depending on the dataset used for model training and testing, the effects of the quality and quantity of the underlying data have not been thoroughly examined. In this study, we employed erroneous datasets and data subsets of different sizes, created from one of the largest databases of experimental binding affinities, to train and evaluate a deep learning system based on convolutional neural networks. Our results show that data quality and quantity do have significant impacts on the prediction performance of trained models. Depending on the variations in data quality and quantity, the performance discrepancies could be comparable to or even larger than those observed among different deep learning approaches. In particular, the presence of proteins during model training leads to a dramatic increase in prediction accuracy. This implies that continued accumulation of high-quality affinity data, especially for new protein targets, is indispensable for improving deep learning models to better predict protein-ligand binding affinities.

Cooling fans are one of the critical components of air-forced (AF) dry-type transformers for regulating internal temperatures. Therefore, effective malfunction detection is crucial to maintain the transformer temperature within an acceptable range and prevent overheating. Regular maintenance occurs periodically and issues with cooling fans may arise between maintenance periods, leading to prolonged operation under malfunctioning conditions and potential failures. In addition, utilities typically have online information about whether a fan works or not without providing information about cooling fan malfunctioning circumstances. To address these challenges, this study proposes learning-based online monitoring techniques to detect malfunctions in AF transformer cooling fans. Random forests (RFs) and convolutional neural networks (CNNs) are developed to classify the audio signals from cooling fans into normal and malfunctioning classes. Unlike RFs, which require separate feature extraction, CNNs are trained based on spectrogram images derived from audio signals. Thus, various time-frequency techniques are utilized for feature extraction in RFs. Besides, multiple data augmentation techniques are employed to enhance the dataset size and diversity. Algorithmic performance is optimized through hyperparameter tuning and classifier threshold adjustment. Simulations reveal that CNNs outperform RFs, whereas the latter provides superior interpretability of acoustic features compared to the former.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Global warming poses a threat to plant survival, impacting growth and agricultural yield. Protein turnover, a critical regulatory mechanism balancing protein synthesis and degradation, is crucial for cellular response to environmental changes. We investigated the effects of elevated temperature on proteome dynamics in Arabidopsis thaliana seedlings using 15N-stable isotope labeling and ul-tra-performance liquid chromatography-high resolution mass spectrometry, coupled with the ProteinTurnover algorithm. Analyzing different cellular fractions from plants grown under 22°C and 30°C growth conditions, we found significant changes in the turnover rates of 571 proteins, with a median 1.4-fold increase, indicating accelerated protein dynamics under thermal stress. Notably, soluble root fraction proteins exhibited smaller turnover changes, suggesting tissue-specific adap-tations. Significant turnover alterations occurred with redox signaling, stress response, protein folding, secondary metabolism, and photorespiration, indicating complex responses enhancing plant thermal resilience. Conversely, proteins involved in carbohydrate metabolism and mito-chondrial ATP synthesis showed minimal changes, highlighting their stability. This analysis high-lights the intricate balance between proteome stability and adaptability, advancing our under-standing of plant responses to heat stress and supporting the development of improved thermo-tolerant crops.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Irrigation is one of key agricultural management practices of crop cultivation in the world. Irrigation practice is traceable on satellite image. Most irrigated area mapping methods were developed based on time series of NDVI or back scatter coefficient within the growing season. However, it found the winter irrigation out of growing season is also dominating in north China. This kind of irrigation aims to increase the soil moisture for coping with spring drought, and also reduce the wind erosion with the wet soil in the field surface as the strong wind happens in spring. This study developed a remote sensing-based classification approach to identify irrigated fields with Radom Forest algorithm out of growing season. The results showed that the mean of the highest accuracies of 7 RF models was 94.9% and the mean of the averaged accuracies of 7 RF models was 94.1%; the overall accuracy for all 7 outputs was in the range of 86.8-92.5%, Kappa in the range of 84.0-91.0% and F-1 score in the range of 82.1-90.1%. These results showed that the classification was acceptable and not over performed as the accuracies of all classified images were lower than the models. This study also found that irrigation started to apply in early November and irrigated fields were increased and suspended in December and January due to freeze. The newly irrigated fields were found again in March and April when the temperature goes up above zero degree. The area of irrigated fields in the study area were increasing over time with sizes of 98.6, 166.9, 208.0, 292.8, 538.0, 623.1, 653.8 km2 from December to April, accounting for 6.1%, 10.4%, 12.9%, 18.2%, 33.4%, 38.7%, and 40.6% of the total irrigatable land in the study area, respectively.

The magnetic polarization tensor has a promising capability of determining the geometry and material properties of metallic samples. In this paper, a novel computation method is proposed to estimate the magnetic polarization tensors for the metallic samples using the boundary element method. In this method, the metallic sample is placed in a uniformly distributed magnetic field. Based on assumptions that the excitation frequency and/or the conductivity of the sample is very high, the metallic sample is regarded as a perfect electrical conductor (PEC). Therefore, the scattered field at a certain distance can be simulated. By utilising the boundary element method, the magnetic polarization tensor can be derived from the simulated scattered field. The theoretical calculation is presented and simulations and experiments have been carried out to validate the proposed method. The results from the simulation are matched with the analytical solution for the case of sphere samples. Moreover, there is a good agreement between the simulation results and the experimental results for the copper cylindrical samples.

The properties of the annual, semiannual and triennial oscillations (AO, SAO and TO) in the middle atmosphere have been investigated using the TIMED/SABER temperature data. The Lomb-Scargle and wavelet spectra were used to determine the dominant oscillations in the background temperature field. The AO is prominent at the mid-latitudes. The AO amplitudes present an asymmetry between the two Hemispheres, being larger in the mesosphere than in the stratosphere. The SAO dominates the tropical regions, with three amplitude maxima at altitudes of 45, 75, and 85 km. The SAOs in the upper mesosphere (75 km) are out of phase with those in the mesopause (85 km) in the tropical regions, which can generate an enhancement of 11 K at each equinox, contributing to the lower mesospheric inversion layer. The TO is significant in the tropical region, with amplitude being maximum at 35, 45 and 85 km. Result shows that there may be potential interaction by the TO with SAO at 85km at the equator. The relation between ENSO and TO has also been discussed. The ENSO signal may modulate the amplitude of the TO, mainly in the lower stratosphere. The real origin of the TO may lie in the wave-mean-flow interaction.

A pilot study regarding the transplantation of 100 specimens of the critically endangered Pinna nobilis took place in summer of 2019 in Maliakos Gulf (Central Aegean, Greece). In this study we present the relationships between total height (HT, in cm), unburied length (UL, in cm), and shell width (SW, in cm) for P. nobilis and the relationship between HT and net weight (W, in g). Length-length relationships were all linear for all cases: r2 > 0.900), whereas the relationship between HT and W was exponential with the value of the exponent b being allometric. "Ecology, Conservation and Restoration of Threatened Animal"

As the first time, 0D-1D-3D and fully 3D steady-state aero-thermo-fluid simulations of a structural oil-to-air Fan Outlet Guide Vane Cooler (FOGVC) in a jet engine are presented. Using the commercial softwares Ansys Fluent, the thermo-mechanical module of Ansys and the 1D fluid solver Flownex, 5 simulation types (3D fully conjugate heat transfer with and without a thin wall model, 3D with a thin wall model, 1D-3D coupled, 1D and 0D) corresponding to 4 levels of simplification in 3 possible domains (oil, oil-metal and oil-metal-air) have been compared to provide selection criteria when a determined level of accuracy in the simulations without prohibited computational times is desired. The methodologies are applied to two different oil internal cavities: an inverted U with rectangular cross section and a coil internal cavity with a circular cross section. The obtained results show that depending on the scope of the research (outlet oil temperature, dissipated heat rate or oil pressure drop) and the accuracy of the results, one method or the other may be used. Experimental data would be needed to validate the numerical results by all employed methodologies and geometries.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

No-till and cereal-legume intercropping have been recognized as favorable cropping practices to increase crop yields while maintaining soil quality in arid and semiarid environment, but the bio-logical mechanisms are poorly understood. The present study was to determine the response of soil properties, enzyme activities, and microbial community diversity and composition in mono- and inter-cropping under conventional and no-tillage conditions. We initiated a field experiment in Wuwei, a typical arid area of China, in 2014. Soil was sampled in August 2022 and, yields, soil properties, enzyme activities, and the microbial community diversity and composition were de-termined in the maize and pea strips in inter- and mono-cropping systems. Results revealed that the maize and pea strips in the no-till intercropping significantly increased yields, total and or-ganic carbon stocks, decreased NO3--N, and obtained the highest total and organic P in the soil. The α- and β-diversity of archaea and eukaryotes were significantly affected by planting patterns, while α- and β-diversity of the bacterial community were significantly affected by tillage practices. Both no-tillage and intercropped maize significantly increased the abundance of archaea phylum Thaumarchaeota and bacterial phylum Nitrospirae, benefiting nitrogen fixation of intercropped pea from the atmosphere under the no-tillage cereal/legume intercropping. No-till intercropping was conducive to the accumulation of organic carbon, while decreasing the abundance of Prote-obacteria, Acidobacteria, and Verrucomicrobia. Limited soil enzyme activities (ACP, ALP, DP, NAG, BG, AG, CB) led to decreases in organic carbon turnover and utilization. Intercropping al-tered soil microbial community diversity and composition due to changes in soil properties and enzyme activities. These findings suggest that no-tilled cereal-legume intercropping is a sustaina-ble cropping practice for improving soil properties and enhancing microbial (archaea, bacterial, Eukaryota) diversity, but the long-term persistence is not conducive to rapid turnover of soil nu-trients due to limited enzyme activities.

The recent rise in ocean temperatures, accompanied by other environmental changes, has notably increased the occurrence and spread of diseases in Octocorallia, of which many species are integral to shallow tropical and subtropical coral reef ecosystems. This study focuses on the understanding of these diseases, which has been largely limited to symptomatic descriptions, with clear etiological factors identified in only a fraction of cases. A key example is the multifocal purple spots syndrome (MPSS) affecting the common Caribbean octocoral sea fan Gorgonia ventalina, linked to the gall-forming copepods of the genus Sphaerippe, a member of the widespread family Lamippidae. The specialized nature of these copepods as endoparasites in octocorals suggests the potential for the discovery of similar diseases across this host spectrum. Our investigation employed four molecular markers to study disease hotspots in Saint Eustatius, Curaçao, northwest and southwest Cuba, and Bonaire. This led to the discovery of a group of copepod species in these varied Caribbean locations. Importantly, these species are morphologically indistinguishable through traditional methods, challenging established taxonomic approaches. The observed diversity of symbionts, despite the host species' genetic uniformity, is likely due to variations in larval dispersal mechanisms. Our phylogenetic analyses confirmed that the Lamippidae copepods belong to the order Poecilostomatoida (Copepoda) and revealed their sister group relationship with the Anchimolgidae, Rhynchomolgidae, and Xarifiidae clades, known for their symbiotic relationships with scleractinian corals. These results add to our understanding of the evolutionary and ecological interactions of copepods and their hosts, and the diseases they cause, important data in a changing climate.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Underwater image often exhibit detail blurring and color distortion due to light scattering, impurities, and other influences, obscuring essential textures and details. This presents a challenge for existing super-resolution techniques in identifying and extracting effective features, making high-quality reconstruction difficult. This research aims to innovate underwater image super-resolution technology to tackle this challenge. Initially, an underwater image degradation model was created by integrating random subsampling, Gaussian blur, mixed noise, and suspended particle simulation to generate a highly realistic synthetic dataset, thereby training the network to adapt to various degradation factors. Subsequently, to enhance the network's capability to extract key features, improvements were made based on the symmetrically structured Blind Super-Resolution Generative Adversarial Network (BSRGAN) model architecture. An attention mechanism based on energy functions was introduced within the generator to assess the importance of each pixel, and a weighted fusion strategy of adversarial loss, reconstruction loss, and perceptual loss was utilized to improve the quality of image reconstruction. Experimental results demonstrate that the proposed method achieved significant improvements in Peak Signal-to-Noise Ratio (PSNR) and Underwater Image Quality Measure (UIQM) by 0.85 dB and 0.19, respectively, significantly enhancing the visual perception quality and indicating its feasibility in super-resolution applications.

Co-integration and Causality was built to conduct studies on causality relation between carbon intensity and coal consumption leading to providing important basis for the transition to a low carbon economy. The EG two-step method was performed to study the relation between carbon intensity and coal consumption of China during 1990-2015 and the co-integration and Granger test was constructed to build up the co-integration and error correction models for analysis of the interaction between carbon intensity and coal consumption. The results showed that in long term there is a stable co-integration relation and a positive correlation between carbon intensity and coal consumption; whereas fluctuations exist in short term and there is a one-way Granger causality of carbon intensity with respect to coal consumption.

This study extends the CGAN-based MODIS cloud vertical-profile (64×64-scene, about 70km width×15km height) retrieval technique developed by Leinonen et al. (2019) [1] to construct seamless 3D cloud fields for the MODIS granules [2]. Firstly, the accuracy and spatial continuity of the Leinonen et al. [1] retrievals are statistically evaluated. Then, according to the characteristics of the retrieval error, a spatially overlapping-scene ensemble generation method and a bi-directional Ensemble Binning Probability Fusion (CGAN-BEBPF) technique are developed, which improves the CGAN retrieval accuracy and support to construct seamless 3D clouds. The CGAN-BEBPF technique involves three steps: cloud masking, intensity scaling, and optimal value selection. It ensures adequate coverage of the low reflectivity areas while preserving the high reflectivity cloud cores. The technique is applied to retrieve the 3D cloud fields of Typhoon Chaba and a multi-cell convective system. The cloud structures of the CGAN-BEBPF results are highly consistent with the ground-based radar observations. It can retrieve weak clouds at the top levels of convective storms and hurricanes that were missed by ground-based radars and fill the gaps of the ground-based radar lower-level PPI scan. Overall, CGAN-BEBPF can be automated to retrieve the rich informative 3D structures of typhoons and severe convective systems over the oceans along the MODIS swath, which certainly presents great value for improving maritime and near-shore typhoons and convection prediction and other cloud-sensitive applications.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

We studied the effect of the structure parameters of engine annular cooling fan with outer ring on the aerodynamic performance by means of experiments and model simulation in fluent^®. Firstly, based on the experiment, a computational model is developed to calculate and analyze the aerodynamic performance of the tested annular fan. The model is validated by comparing the test results with the calculated data. Besides, the aerodynamic performance differences between two types of fans (common fan without outer ring and annular fan with outer ring) are discussed. Based on the computational model, the relation between aerodynamic performance and the outer ring structure parameters are investigated. The results show that the relative parameter on the axial direction has great influence on the aerodynamic performance; while the effect of radial relative parameter is minor. In addition, the outer ring with arc chamfer structure in the downstream side can improve its static pressure efficiency effectively.

In recent years, semantic communication has received significant attention from both academia and industry, driven by the growing demands for ultra-low latency and high-throughput capabilities in emerging intelligent services. Nonetheless, a comprehensive and effective theoretical framework for semantic communication has yet to be established. In particular, finding the fundamental limits of semantic communication, exploring the capabilities of semantic-aware networks, or utilizing theoretical guidance for deep learning in semantic communication are very important yet still unresolved issues. In general, the mathematical theory of semantic communication and the mathematical representation of semantics are referred to as semantic information theory. In this paper, we introduce the pertinent advancements in semantic information theory. Grounded in the foundational work of Claude Shannon, we present the latest developments in semantic entropy, semantic rate-distortion, and semantic channel capacity. Additionally, we analyze some open problems in semantic information measurement and semantic coding, providing a theoretical basis for the design of a semantic communication system. Furthermore, we carefully review several mathematical theories and tools and evaluate their applicability in the context of semantic communication. Finally, we shed light on the challenges encountered in both semantic communication and semantic information theory.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The development of a method to produce coumarins unsubstituted on the pyranic nucleus catalyzed from Wells–Dawson heteropolyacid (H₆P₂W₁₈O₆₂), phenol derivatives and ethyl 3,3-diethoxypropionate using Pechmann condensation under solvent-free conditions is described. This catalytic method was also applied successfully to synthesize various substituted coumarins, including the corresponding phenols and ethyl 3,3-diethoxypropionate. This work provides a novel, cheaper and safer way to syhthesize coumarins unsubstituted on the pyranic nucleus.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

This paper studies the flexural behavior of the bridge deck link slabs made with the Polyvinyl Alcohol-Strain Hardening Cementitious Composites (PVA-SHCC). Tensile and flexural properties of the PVA-SHCC with four volume fractions, i.e., 0%, 1%, 1.5%, and 2%, were evaluated first. Next, using the similarity theory, composite models with a geometric similarity ratio of 1: 5 were designed to represent the bridge deck with the link slabs. The models considered three materials for link slabs, including concrete, cement mortar and self-compacting PVA-SHCC; and two different curing ages at 7 and 56 days. Bending tests were performed to investigate the flexural behavior of the models. Based on the fractal theory, cracking characteristics of the models with different types of link slabs were compared, and the relationship between Df and the flexural behavior of the models were studied. Numerical models were built to correlate with the results from the bending tests. It is illustrated that the flexural behavior of the self-compacting PVA-SHCC link slab is better than that of concrete and cement mortar link slabs, where the crack initiation and propagation can be postponed.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

A class of semi-linear elliptic equations with critical Hardy-Sobolev exponent has been considered. This model is widely used in hydrodynamics and glaciology, gas combustion in thermodynamics, quantum field theory and statistical mechanics, as well as gravity balance problems in galaxies. The $\left( PS\right) _{c}$ sequence of energy functional has been investigated, and then the mountain pass lemma was used to prove the existence of at least one nontrivial solution. Also a multiplicity result has been obtained. Some known results have been generalized.

In this paper, a class of semi-linear elliptic equations involving Hardy-Sobolev critical exponents has been investigated. This problem comes from the consideration of standing waves in the anisotropic Schr\"{o}dinger equation, also it is very important in the field of hydrodynamics, glaciology, quantum field theory and statistical mechanics. By a detailed estimation for the extremum function and using Mountain Pass Lemma with $\left( PS\right) _{c}$ conditions, the existence of positive solutions has been obtained. On the other hand, by establishing Pohozaev-type identity and using the properties of Bessel function, the nonexistence of positive solution also has been obtained. These results are extensions of E. Jannelli's research (\cite[Theorem 1.A-1.C]{EJ}).

With the rapidly increasing of people’s purchasing power, the fast moving consumer goods (FMCG) industry is supposed to grow dramatically. In order to gain more market access and profile, it is important for the FMCG manufacturers and retailers to find the preferences and provincial characteristics of consumers, to develop more suitable goods distribution strategy. Based on retails marketing data with geographic characteristics, this paper proposes a new combination of geography methods to solve the problems in distribution of FMCG. Via multiple K-means clustering and cross validation of KNN half off, the mesoscopic sales features are extracted through the classification of retails, which can indirectly grasp the consumer behavior characteristics. Based on space division and Moran’ I spatial autocorrelation arithmetic, two strategies are developed to satisfy consumer’s needs and promote sales, including conservative and positive strategies. According to our analysis, the total sales volume of the regions will increase by 5.1% and 10.3%. This study can be applied to the provide purchase strategies for FMCG retails according to their locations. The research can explore the consumption potential of different areas, thus improving the profile of retails and the development of economy in more mesoscopic scale.

In the current study, a two-dimensional numerical study is carried out to investigate the performance of a novel Double-chamber Parallel Flexible Valves micropump, which utilized the electrowetting-on-dielectrics (EWOD) effect to drive the microfluid flow. By observing the flow fields, the internal circulations are seen on both the left and right side of the pump. The generation of the backflow is discussed by tracking the movement of the vortices. Only slight flow fluctuation is seen in the micropump. Based on the simulation outcomes, the structural parameters including the width of the inlet/outlet, the width of the pumping channel and the diverging angle in the micropump are analyzed, the influence of these parameters on the pumping volume and the maximum pressure have been discussed. Eventually, a group of optimal parameter combinations is given according to the results to extend the operating potential of the micropump.

Affective prosody is an indispensable cognitive cue that moderates social activities, and has become a prevailing research topic in psychology-related disciplines. The present study conducts the first bibliometrics-based visualization analysis concerning affective prosody to evaluate the influential cases, including countries/regions, institutions, publication venues, academic articles, and disciplinary contributions, and the diachronic changes of publication trends and research hotspots. With the combination of statistical results and a qualitative literature inspection, limitations of extant studies and promising research directions were also proposed. The present study extracted the bibliographic data of 1,624 articles retrieved from the Web of Science Core Collection, which were published over the past 25 years (1997-2021). Statistical results revealed four leading powers (the U.S., Germany, England, and Canada) and four emerging fronts (China, France, Netherlands, and Switzerland), and identified three primary research themes in this field, including clinical implication, measurable index, and modality-specific issues. Literature inspection demonstrated current limitations in individual characteristics control and experiment-related influential factors, and proposed two prosperous research directions. Findings of the present study could facilitate academic retrieval of affective prosody research, help concerned researchers identify thematic hotspots and seek appropriate collaboration, and provide convenience for research policy and management in this field.

Tengchongite is a uranyl molybdate uranium mineral and it was found and named by Chen 1985.No more scholars studied on tengchongite after Chen’s work, The identification of this mineral has only been confirmed by single crystal X-ray diffraction. In the paper, micro laser Raman spectroscopy and infrared spectroscopy are used to identify the spectroscopy properties of tengchongite. The studies fill in the gaps of more than 30 years in terms of the molecular spectroscopy research of tengchongite. The mineral has an ideal model of Ca(UO₂)₆(MoO₄)₂O₅•12H₂O its bands attributed to the vibrating units are clearly identified in the Raman spectrum. Symmetric stretching modes at 812 cm^-1 and 839 cm^-1 are assigned to ν1 (UO₂)²⁺ ,The ν3 antisymmetric stretching modes of (UO₂)²⁺ are observed at 896 cm^-1, Symmetric stretching modes at 419^-1 and 440 cm^-1 are assigned to ν2 (UO₂)²⁺ .Symmetric stretching modes at 919cm-1 are assigned to ν1(MoO₄)^2-,The ν3 antisymmetric stretching modes of (MoO₄)^2- are observed at 752 cm^-1, the in-plane ν2(MoO₄)^2-and the out-of-plane ν4(MoO₄)^2- bending modes are at 169 cm^-1 and 254 cm^-1. IR spectrum of tengchongite shows the major uranyl band at 858 cm^-1 and 693 cm^-1, Mo-O bonds are observed at about 985 cm^-1 and 780 cm^-1, and H₂O groups are present with a wide range peaks from 3100 cm^-1 to 3500 cm^-1 and 1647 cm^-1, and the band at 1432.4 cm^-1 is probably due to the stretching vibration hydroxyl (OH^-1), therefore, tengchongite contains may include hydroxyl and its chemical formula needs to be modified .

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Soil extracellular enzyme activity (EEAs) and enzymatic stoichiometry (ES) can provide a crucial indication of changes in soil ecosystem's nutrient availability and the microbial resource limitations. However, the changing characteristics of soil EEAs and ES at different stages of the native succession process and their key drivers are unclear. In order to investigate the soil EEAs, ES and driving factors of soil under vegetation at different succession stages, we adopted the "spatio-temporal substitution" method to collect the surface soil of bryophyte community, herbaceous community, shrub community and tree community in the new volcanic lava platform of Wudalianchi Volcanic Nature Reserve. We measured seven soil EEA, including carbon(C)-acquiring enzyme (β-1,4-glucosidase (BG)), N-acquiring enzymes (β-N-acetyl-glucosaminidase (NAG) and leucine aminopeptidase (LAP)) and phosphorus (P)-acquiring enzyme (acid phosphatase (AP)) activities. The length and angle of vectors defined by ratios of enzyme activities (BG/(NAG + LAP) vs. BG/AP) were used to indicate relative microbial investments in C- (length), and N- and P- (angle) acquiring enzymes. Our results showed that the contents of TC, TN, TP, MBC, DOC and NO3-N in shrub community soil were significantly higher than those in bryophyte, herb and tree communities, and increased by 441%, 246%, 137%, 5570%, 12% and 484%, respectively. The highest soil EEA of C-, N- and P-acquiring were found in shrub community, and the soil EEAs/MBC of C-, N- and P-acquiring were the highest in bryophyte community. Enzyme C:N, C:P and N:P ratios increased progressively in the order of bryophyte, herb and shrub community, but the enzyme C:N, C:P and N:P ratios of tree community were both far less than shrub community. Vector lengths increased progressively in the order of bryophyte (1.16), herb (1.27), tree (1.29) and shrub (1.40), and Vector angles decreased progressively in the order of bryophyte (49.15°), herb (45.65°), Tree (45.31°) and shurb (44.54°), suggested that as succession progresses, soil microbial nutrients transforms from P limitation (angle＞45°) to N limitation (angle＜45°). Redundancy analysis showed that TC, TN, EC and C:N were important drivers of variation in soil EEAs and ES in vegetation at different succession stages. Our findings highlight that the primary succession process cause nutrient limitation transformation. Soil ES might be a sensitive indicator mediated by soil microorganisms to the relative resource limitation at different stages of the primary succession process.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

ATP-binding cassette (ABC) transporters, acting as cellular "pumps," facilitate solutes translocation through membranes via ATP hydrolysis. Their overexpression is closely tied to multidrug resistance (MDR), a major obstacle in chemotherapy and neurological disorder treatment, hampering drug accumulation and delivery. Extensive research has delved into the intricate interplay between ABC transporter structure, function, and potential inhibition for MDR reversal. Cryo-electron microscopy has been instrumental in unveiling structural details of various MDR-causing ABC transporters, encompassing ABCB1, ABCC1, ABCG2, as well as recently revealed ABCC3 and ABCC4 structures. The newly obtained structural insight has deepened our understanding of substrate and drug binding, translocation mechanisms, and inhibitor interactions. Given the growing body of structural information available for human MDR transporters and their associated mechanisms, we believe it is timely to compile a comprehensive review of these transporters and compare their functional mechanisms in the context of multidrug resistance. Therefore, this review primarily focuses on the structural aspects of clinically significant human ABC transporters linked to MDR, with the aim of providing valuable insights to enhance the effectiveness of MDR reversal strategies in clinical therapies.

Escherichia coli (E. coli) is a common pathogen in veterinary clinical infections, typically not causing disease. However, under certain conditions, it can cause severe diarrhea, septicemia, and respiratory infections in domestic animals. Here, we report a large-scale mortality event in young donkeys, caused by E. coli infection in a farm with a herd of 340 donkeys, of which over 100 were under 4 months old. The characteristics of the E. coli strain were determined through clinical observation, complete blood count, blood biochemical analysis, H&E staining, histopathological examination, 16S rRNA analysis, and antibiotic sensitivity testing. A mice experiment using the isolated bacteria was also conducted, resulting in the onset of clinical and pathological symptoms similar to those observed in the donkeys. Molecular Evolutionary Genetic Analysis (MEGA) showed that the isolated bacteria, named CEG-GZL20, shared 99.98% sequence identity with E. coli. CEG-GZL20 exhibited high antibiotic resistance and only showed sensitivity to two antibiotics, Tetracycline and Gentamicin. As E. coli is a key component of the gut microbiota, responsible for digestion, nutrient absorption, and immune health, diseases and mortality caused by E. coli have significant implications for animal husbandry and human health.

With the rise of serious problems of urbanization and climate change, the call for intelligent and sustainable urban development is increasing nowadays. Therefore, smart cities have become a hot topic in academia, industry, and politics, resulting in the emergency of numerous smart city programs and projects. This study selected 26 evaluation frameworks proposed in recent years or large-scale research projects that have lasted for many years and analyzed and compared them from the 7 aspects of generalizability, comprehensiveness, availability, flexibility, scientific, transparency, and interpretability. The result indicates that the current smart city evaluation framework still needs to be upgraded and updated. These standards can not only guide the development direction and hotspot of the future smart city evaluation model but also serve as a guide for model demanders to test results and an effective tool to verify the framework designed by themselves.

Impact of land use and land cover (LULC) change on soil erosion is still imperfectly understood, especially in northeastern China (NEC). Based on the Revised Universal Loss Equation (RUSLE), the variability of soil erosion at different spatial scales following land use changes in1980, 1990, 2000, 2010, and 2017 was analyzed. The regionally spatial patterns of soil loss coincided with the topography, rainfall erosivity, soil erodibility, and use patterns, and around 45% soil loss came from arable land. Regionally, soil erosion rates increased from 1980 to 2010 and decreased from 2010 to 2017, ranging from 3.91 to 4.45 t ha-1 yr-1 with an average of 4.22 t ha-1 yr-1 in 1980-2017. The rates of soil erosion less than 1.41 t ha-1 yr-1 decreased from 1980 to 2010, and increased from 2010 to 2017, and opposite changing patterns occurred in higher erosion classes (i.e., above 5 t ha-1 yr-1). At a provincial scale, Liaoning Province experienced the highest soil erosion rate of 9.43 t ha-1 yr-1, followed by Jilin Province, the east Inner Mongolia, and Heilongjing Province. Arable land continuously increased at the expense of forest in the high-elevation and steep-slope areas from 1980 to 2010, and decreased from 2010 to 2017, resulting in increased areas with erosion rates higher than 7.05 t ha-1 yr-1. At a county scale, around 75% of the countries had soil erosion rate higher than its tolerance level. The county numbers with higher erosion rate increased in 1980-2010 and decreased in 2010- 2017, resulting from the sprawl and withdrawal of arable land. The results indicate that appropriate policies can control soil loss through limiting arable land sprawl in areas of unfavorable regions in the NEC.

Ovarian hypofunction or primary ovarian insufficiency (POI) is a common cause in the etiology of female infertility. It is a heterogeneous disorder, affecting approximately 1% of women before the age of 40. The characteristics of POI are menstrual disorders, including amenorrhea and delayed menstruation, accompanied by a raised gonadotrophin level and decreased estradiol level. In recent years, electrophysiology (EP) technology has been advancing rapidly in the diagnosis and treatments of numerous diseases. According to studies, bioelectrical stimulation (BES) therapy is an electrophysiology technology that plays significant roles in numerous diseases, including on the thin endometrium in patients with POI. In this review, the overall research progress of this electrophysiological technology has been discussed in relation to the advancement of primary ovarian insufficiency.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Liquid biopsy has been developed to diagnose and monitor cancer. Despite the recent advances in investigating early cancer detection and diagnosis strategies, there is still a lack of improvements in capturing (CTCs). To archive this, we developed an efficient CTC detection system by integrating gold nanoparticles and a microfluidic platform, which can achieve CTC capture within 120 min. The microdevice was functionalized by immobilizing antibodies specific to the target cells. The method was tested with spiked tumor cells in whole human blood with three pancreatic cancer cell lines and compared with purified cancer cells suspended in a phosphate buffer solution. Our results captured pancreatic cancer cells spiked in blood samples with efficiency (90±3.2)% and were used to isolate CTCs from patients with metastatic pancreatic cancer. This methodology will enable the production of functionalized, patterned surfaces that interact with tumor cells, enhancing the selective capture of CTCs from biological assays.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Coupled Delft3D-object model has been developed to predict object’s mobility and burial on sandy seafloor. The Delft3D model is used to predict seabed environment such as currents, waves (peak period, significant wave height, wave direction), water level, sediment transport, and seabed change, which are taken as the forcing term to the object model consisting of three components: (a) object‘s physical parameters such as diameter, length, mass, and rolling moment, (b) dynamics of rolling cylinder around its major axis, and (c) empirical sediment scour model with re-exposure parameterization. The model is compared with the observational data collected from a field experiment from 21 April to 23 May 2013 off the coast of Panama City, Florida funded by the Department of Defense Strategic Environmental Research and Development Program. The experimental data contain both objects’ mobility using sector scanning and pencil beam sonars and simultaneous environmental time series data of the boundary layer hydrodynamics and sediment transport conditions. Comparison between modeled and observed data clearly show the model capability.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

The reliability of concrete cable-stayed bridge structure is time variant. This is due to strength deterioration and time-variant mechanical and environmental loadings. Demands for keeping concrete cable-stayed bridge structure in functional and reliable states require maintenance interventions. Limited financial resources require optimal maintenance strategies. These strategies have to consider the effects of uncertainties not only on the structural reliability deterioration but also on the maintenance interventions. By analyzing variation of concrete cable-stayed concrete cable-stayed bridge liabilities and benefit expectation through different maintenance programs, on the condition of satisfying the concrete cable-stayed bridge performance, with the maximum expected benefit as the target to discuss repair and reinforcement strategies for the concrete cable-stayed bridges in service. The method takes into account the present performance and future expected benefit, optimizing the performance of the concrete cable-stayed bridge and the expected benefit through determination policies of concrete cable-stayed concrete cable-stayed bridge maintenance program. The proposed method also includes an advanced cost model which takes into account the interaction between costs of maintenance interventions and their effect on reliability. Examples are presented demonstrating the application of the proposed method to a stock of existing deteriorating concrete cable-stayed bridges under various maintenance scenarios.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.