In this paper, we synthesized MC(BeA-co-MMA) copolymer microcapsules through suspension polymerization. The pendent n-behenyl group of BeA is highly crystalline, and it acts as the side-chain in the structure of BeA-co-MMA copolymer. The highly crystalline n-behenyl side-chain provides BeA-co-MMA copolymer thermal-energy-storage capacity. In order to investigate the correlation between thermal properties and crystal structure of BeA-co-MMA copolymer, the effects of monomer ratio, temperature changing and changing rate, as well as synthesis method were discussed. The monomer ratio influenced crystal transition behavior and thermal properties greatly. The DSC results proved that when the monomer ratio of BeA and MMA was 3:1, MC(BeA-co-MMA)3 showed the highest average phase change enthalpy ΔH (105.1 J·g–1). It indicated that the n-behenyl side-chain formed relatively perfect crystal region, which ensured a high energy storage capacity of copolymer. All the DSC and SAXS results proved that the amount of BeA had a strong effect on the thermal-energy-storage capacity of copolymer and the long spacing of crystals, but barely on the crystal lamella. It was found that MMA units worked like defects in the n-behenyl side-chain crystal structure of BeA-co-MMA copolymer. Therefore, a lower fraction of MMA, that is, a higher fraction of BeA contributed to a higher crystallinity of BeA-co-MMA copolymer for providing a better energy storage capacity and thermoregulation property. ST(BeA-co-MMA) copolymer sheets with the same ingredients as microcapsules were also prepared through light-induced polymerization aiming at clarifying the effect of synthesis method. The results proved that synthesis method mainly influenced the copolymer chemical component, but lightly on the crystal packing of n-behenyl side-chain.

Code summarization plays a vital role in aiding developers with program comprehension by generating corresponding textual descriptions for code snippets. While recent approaches have concentrated on encoding the textual and structural characteristics of source code, they often neglect the global hierarchical features causing limited code representation. Addressing this gap, our paper introduces the Statement-grained Hierarchy enhanced Transformer model (SHT), a novel framework that integrates global hierarchy, syntax, and token sequences to automatically generate summaries for code snippets. SHT is distinctively designed with two encoders to learn both hierarchical and sequential features of code. One relational attention encoder processes the statement-grained hierarchical graph, producing hierarchical embeddings. Subsequently, another sequence encoder integrates these hierarchical structures with token sequences. The resulting enriched representation is then fed into a vanilla Transformer decoder, which effectively generates concise and informative summarizations. Our extensive experiments demonstrate that SHT significantly outperforms state-of-the-art approaches on two widely used Java benchmarks. This underscores the effectiveness of incorporating global hierarchical information in enhancing the quality of code summarizations.

This study presents an innovative analytical method for the detection and quantification of 14 β-agonists in pork using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The method involves the use of a solid phase microextraction (SPME) probe, consisting of a wooden tip coated with polyacrylonitrile (PAN) and molecularly imprinted polymer (MIP). This probe has been integrated into an automated extraction device, designed in our laboratory to extract the target analytes prior to LC-MS/MS analysis. Compared to the traditional solid-phase extraction (SPE) procedure, the proposed approach significantly reduces the costs related to adsorbent ma-terial and solvent consumption, and shortens purification time, thereby reducing both the tech-nical workload and associated expenses. The methodology has been carefully validated in ac-cordance with the National Standard of the People's Republic of China (GB/T 22286-2008), evalu-ating key parameters including the limit of detection (LOD), limit of quantification (LOQ), matrix effects, linearity, and both intra-day and inter-day precision. The average recovery rates for all β-agonists were observed to lie between 71.6% and 82.2%, with relative standard deviations (RSDs) consistently below 15% for both types of precision. The LOD and LOQ values were found to range from 0.09 to 0.39 μg/kg and 0.27 to 0.99 μg/kg, respectively. In terms of accurate detection of positive samples, the developed method demonstrated a closer approximation to the true value of the sample compared to the National Standard method GB/T 31658.22-2022. Overall, the proposed method exhibits substantial promise for the routine assessment of β-agonists in pork and presents a practical alternative for compliance monitoring in regulatory settings.

Advanced high-strength steels (AHSS) have a wide range of applications in equipment safety and lightweight design, and enhancing the strength of AHSS to the ultra-high level of 2 GPa is currently a key focus. In this study, a new process of thermo-mechanical control process followed by direct quenching and partitioning (TMCP-DQP) is developed based on Fe-0.4C-1Mn-0.6Si (wt.%) low-alloy steel, and the effects of microstructure evolution on mechanical properties under TMCP-DQP process and conventional hot rolled quenched and tempered process (HR-QT) are comparatively studied. The results show that the TMCP-DQP process not only shortened the processing steps but also achieved outstanding comprehensive mechanical properties. The TMCP-DQP steel exhibits a tensile strength of 2.23 GPa, accompanied by 11.9% elongation and a Brinell hardness of 624 HBW, with an impact toughness of 28.5 J at -20 ℃. In contrast, the HR-QT steel exhibits tensile strengths ranging from 2.16 GPa to 1.7 GPa and elongations between 5.2% and 12.2%. The microstructure of TMCP-DQP steel primarily consists of lath martensite, containing thin-film retained austenite (RA), nanoscale rod-shaped carbides, and a minor number of nanoscale twins. The volume fraction of RA reaches 7.7%, with an average carbon content of 7.1 at.% measured by three-dimensional atom probe tomography (3DAP). Compared to the HR-QT process, the TMCP-DQP process results in finer microstructure, with a prior austenite grain (PAG) size of 11.91 μm, forming packets and blocks with widths of 5.12 μm and 1.63 μm. The TMCP-DQP process achieves the ultra-high strength of low-alloy steel through the synergistic effects of grain refinement, dislocation strengthening, and precipitation strengthening. The dynamic partitioning stage stabilizes the RA through carbon enrichment, while the relaxation stage reduces a small portion of the dislocations generated by thermal deformation, and the self-tempering stage eliminates internal stresses, all guaranteeing considerable ductility and toughness. The TMCP-DQP process may offer a means for industries to streamline their manufacturing processes and provide a technological reference for producing 2.2 GPa grade AHSS.

Most of the phase change materials (PCMs) have been limited to use as functional additions or sealed in containers, and extra auxiliary equipment or supporting matrix is needed. The emergence of 3D printing technique has dramatically advanced the developments of materials and simplified production processes. This study focuses on a novel strategy to model thermal energy storage crystalline gels with three-dimensional architecture directly from liquid resin without supporting materials through light-induced polymerization 3D printing technique. A mask-projection stereolithography printer was used to measure the 3D printing test, and the printable characters of crystalline thermal energy storage P(SA-DMAA) gels with different molar ratios were evaluated. For the P(SA-DMMA) gels with small fraction of SA, the 3D fabrication was realized with higher printing precision both on mili- and micro-meter scales. As a comparison of 3D printed samples, P(SA-DMAA) gels made by other two methods, post-UV curing treatment after 3D printing and UV curing using conventional mold, were prepared. The 3D printed P(SA-DMAA) gels shown high crystallinity. Post–UV curing treatment was beneficial to full curing of 3D printed gels, but did not lead to the further improvement of crystal structure to get higher crystallinity. The P(SA-DMAA) crystalline gel having the highest energy storage enthalpy that reached 69.6 J·g⁻¹ was developed. Its good thermoregulation property in the temperature range from 25 to 40 °C was proved. The P(SA-DMAA) gels are feasible for practical applications as one kind of 3D printing material with thermal energy storage and thermoregulation functionality.

The effects of simulated acid rain (SAR) on the photosynthetic performance of subtropical coniferous species have not been thoroughly investigated. In this study, we treated two coniferous species, Pinus massoniana (PM) and Cunninghamia lanceolata (CL), with SAR and then analyzed photosynthetic activities via the simultaneous measurement of prompt fluorescence(PF), delayed fluorescence(DF), and modulated reflection at 820 nm(MR820). Following the low-pH SAR treatment, the I–P phase of the OJIP curves of PM and CL decreased significantly and then the K-band and L-band were detectable. The delayed fluorescence for both PM and CL decreased as the pH of the SAR solution decreased, with a more significant decrease in the I1 peak than in the I2 peak. According to the MR820 curve, the exposure to SAR stress inhibited the rapid decrease and slow increase in the MR820 transients of PM and CL. The gradients of the decreasing and increasing phases were lower for CL than for PM at pH 2.5. In addition, SAR decreased the light energy captured per unit area (ABS/CSm) and the quantum yield of electron transfer per unit area (ETO/CSm), but it increased the accumulation of QA−, thereby decreasing primary photochemical efficiency (TRO/CSm, φPO). These changes in photosystem II (PSII) resulted in a decrease in the maximum quantum yield of PSII (Fv/Fm) and the performance index (PIABS). Moreover, PSII was protected from thylakoid membrane photodamages through the increase in heat dissipation per unit area (DIO/CSm) in response to SAR. The increase in δRO as the pH of the SAR solution decreased was observed for PM, but not for CL. Considered together, the study findings suggest that SAR treatments can decrease chlorophyll contents and damage the OEC in PM and CL, which obstructs the transfer of electrons on the donor and acceptor sides of PSII. However, PM is better able to withstand SAR stress than CL, likely because of the activation of a protective mechanism (reflected by the change in δRO). Therefore, in coniferous forest areas severely affected by acid rain, CL may need to be protected more than PM.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

Effective biomarkers are essential to the early diagnosis of non-small cell lung cancer (NSCLC). Herein, a retrospective study of 49 newly diagnosed and recurrent NSCLC patients, 31 patients with benign pulmonary disease and 24 healthy volunteers was conducted, to evaluate the diagnostic value of circulating rare cells for NSCLC. The expression of circulating tumor cells (CTCs) and circulating tumor-derived endothelial cells (CTECs) in peripheral blood were measured by subtraction enrichment-immunostaining-fluorescence in situ hybridization (SE-iFISH). The level of CTCs (P＜0.001) and CTECs (P＜0.001) was significantly higher in NSCLC group than that in benign pulmonary disease group. The proportion of small CTCs (P＜0.001) and CTECs (P＜0.0001) significantly increased from benign lung disease individuals to NSCLC patients. The AUC of ROC curves of total CTCs and CTECs were 0.815 (95%CI: 0.722~0.907), 0.739 (95%CI: 0.618~0.860), respectively. The cut-off values for discriminating NSCLC with benign lung disease patients were total CTCs 11.5 units/6ml and total CTECs 10.5 units/6ml, with sensitivity and specificity being 67.3% and 83.9%, 77.6% and 77.4%, respectively. When CTCs and CTECs were combined, predictive value significantly increased to 82.6% as measured by the area under the curve. Small CTCs and triploid CTCs had high positive predictive value (PPV) and positive likelihood ratio (LR+) of the diagnosis of NSCLC in early stage. CTCs and CTECs can not only be used as new biomarkers for the diagnosis of NSCLC, but can also improve diagnostic performance of the early stage NSCLC. Moreover, the combined examination of CTCs and CTECs is be superior to the single.

As the Universe is dominated by of baryons, there must have been a process in early Universe creating such a asymmetry via baryon number violation. However, until recently all the confirmed experimental data indicate that lepton and baryon number are conserved in agreement with Standard Model of quarks and leptons. This paper proposes an alternative path of baryogenesis. Once the over abundant magnetic monopoles predicted by grand unification emerged at universe temperature of $10^{16}$ GeV, then their annihilation should first give rise to photons driving the expansion of the early universe. As the universe temperature dropped to the desert scale of around 10 EeV, departure from thermal equilibrium occurred. Thus the annihilation produced photons give rise to electron-positron pairs, which collide with remnant magnetic monopoles and antimonopoles. The resultant unstable intermediate X and antiX particle become asymmetric, and thereby leading to baryon asymmetry. The excess of antimonopoles corresponding to ten times of mass comparing with that of baryons provides a natural candidate for dark matter. The physics of such a desert regime baryogenesis can be simply characterized by three parameters. The collision predicts a ratio of particle and anti-particle equivalent to that of ultra-high-energy neutrino to their anti-particle, which can be tested by future observations, e.g., the constructing IceCube-Gen2.

Over abundance of magnetic monopoles predicted by the Grand Unification Theories is inconsistence with current astronomical observation. The inflationary hypotheses with a vacuum energy deriving the exponential expansion can explain the two long-standing problems, flatness and horizon of the universe; and somehow suppress the abundance of monopoles. However, the dynamical scalar field has considerable uncertainties, which even leads to inflationary models separating from particle physics. This paper makes a small change, the early universe undergoes free expansion rather than an adiabatic one widely adopted, In such a case, the annihilation of abundant magnetic monopoles is just required in driving the inflation, so that the three long-term problems are automatically solved. On the other hand, the relic mass of failed annihilation of monopoles is responsible for the dark matter at present epoch. And ongoing annihilation on stars and compact objects corresponds to the dark energy. As monopole relics may exist in the form of monopole anti-monopole pairs, a new strategy of direct search is proposed.

Nonconventional luminescent materials (NLMs) that do not contain traditional aromatic chromophores are of great interest due to their unique chemical structures, optical properties and their potential applications in various areas such as cellular imaging and chemical sensing. However, most reported NLMs show weak or no emission in dilute solutions, severely limiting their applications. In this work, the dynamic hydrogen bonds were utilized to design NLMs with efficient emission in dilute solutions. To further validate the results, polymers P1 and P2 were successfully prepared and investigated. It was found that luminescence quantum efficiency of P1 and P2 at concentration of 0.1 mg/mL in water solution is 8.9 and 0.6%, respectively. The high efficiency can be attributed to the fact that polymer P1 has more intra- or intermolecular dynamic hydrogen bonds and other short interactions than P2 in dilute solutions, allowing P1 to achieve the through-space conjugation effect to increase the degree of system conjugation, restrict molecular motion, and decrease non-radiative transitions, which can effectively improve luminescence. In addition, polymer P2 exhibits the characteristics of clustering-triggered emission, excitation wavelength-dependent and concentration-dependent fluorescence properties, excellent photobleaching resistance, low cytotoxicity and selective recognition of Fe3+. This work is a preliminary study of the luminescence properties of NLMs in dilute solutions via modulating dynamic hydrogen bonds, which can be used as a semi-empirical method to design and construct novel NLMs in future.

Root crops grow in the soil deeply and bond with soil closely, which results in that the process of the separation between soil and root becomes the most difficult during the harvesting processes. In order to harvest root crops efficiently, the mechanical harvesting has become the main developing trend. However, high power and high damage rate are still occurred when mechanical harvester gets in touch with the roots. In this paper, we review the research of the development and evaluation of the mechanical harvesting of root crops and its performance optimization on the past years. The process of soil separation mainly consists in the initial separation between root and the ground and further separation between root and adhered soil. In general, the soil-cutting operation in the initial separation and the sieving mechanism in the further separation require high draught and power. And the dramatic friction, impact, pressure and so on, which happen in the components and soil-roots, are the key reasons to lead to root damage. The optimization of harvesting methods and parameters, including the digging shovel shape, working conditions, vibration, and screening way, is more significant in improving the harvesting performance. But there are still some limitations in the research and application of the mechanical harvester for root crops. Future research is suggested to focus on the development of the soil break-up when the digging shovel cutting soil, the insight into the interaction between soil and roots by different external compression loads, and the long-term studies to verify the high-efficiency and low-damage performances of mechanical harvester in practical application.

Chemical investigation of the Chinese soft coral Lobophytum sp. has resulted in the isolation of six new compounds, namely lobosteroids A–F (1–6), along with four known compounds. Their structures were determined by extensive spectroscopic analysis and comparison with the spectral data reported in the literature. Among them, the absolute configuration of 1 was determined by X-ray diffraction analysis. These steroids characterized by either the presence of an α,β-αꞌ,βꞌ-unsaturated carbonyl or an α,β-unsaturated carbonyl moiety in ring A, or the existence of a 5α,8α-epidioxy system in ring B, as well as diverse oxidation sites of side chains. The prelimi-nary antibacterial bioassay showed all compounds exhibited significant antibacterial activities against the fish pathogenic bacteria Streptococcus parauberis FP KSP28 and Phoyobacterium damselae FP2244 with all inhibition rates more than 90% at the concentration of 150 µM. And at the same concentration, compounds 2, 6–10 also displayed potent inhibitory effects against vancomy-cin-resistant Enterococcus faecium bacteria G7 with all inhibition rates more than 90%.

Inflationary model provides a conceptual explanation of the horizon problem, the flatness problem and may also suppress the over abundant magnetic monopoles predicted by Grand Unified Theories. Although various inflationary models have been proposed since 1981, difficulties like fine tuning is not only unsolved but also becomes severer in confrontation with data of Planck Satellite. This paper proposes an alternative model of inflation: the spontaneous symmetry breaking phase transition at early universe is only responsible for the production of magnetic monopoles expected by Grand Unified Theories; it is the subsequent energy release of monopole annihilation that drives the inflation. As a result, the early universe underwent a free expansion with a heat source originating in the annihilation, which expects a smooth, plateau-like potential consistent with the observational data. Beside interpreting a number of long standing inflationary problems, the new scenario predicts a significant increase of entropy during the inflation, and tends to produce large scale structures exceed scale of 300 million light-years correlated with a CMB smoothen and flatten by a simple dynamical mechanism.

In 1935 Einstein, Podolsky, and Rosen (EPR) studied general entangled states in the two photon experiment and pointed out the contradiction between local realism and the completeness of quantum mechanism. Most of the EPR experiments in recent years are based on the detection of polarization correlations of optical photons between spatially separated photon channels, some of which are split and directed to two spatially separated Michelson interferometers. Later, the two arms of Michelson interferometers are replaced by dual-channel Fabry-Perot (F-P) interferometry enabling precise analysis of the energy-time entanglement between a pair of photons. On the other hand, F-P type detectors on gravitational radiation have caught dozens of gravitational wave (GW) events successfully. This paper proposes a combined experiment of EPR and GW, exhibiting whether the coincident rate of EPR is modulated by GW induced change of cavity length or not. Such an experiment could test the coupling of quantum mechanics and general relativity for the first time, and be a useful tool to explore the nature of quantum gravity.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

The diffusion coefficient--a measure of dissipation, and the entropy--a measure of fluctuation are found to be intimately correlated in many physical systems. Unlike the fluctuation dissipation theorem in linear response theory, the correlation is often strongly non-linear. To understand this complex dependence, we consider the classical Brownian diffusion in this work. Under certain rational assumption, i.e. in the bi-component fluid mixture, the mass of the Brownian particle $M$ is far greater than that of the bath molecule $m$, we can adopt the weakly couple limit. Only considering the first-order approximation of the mass ratio $m/M$, we obtain a linear motion equation in the reference frame of the observer as a Brownian particle. Based on this equivalent equation, we get the Hamiltonian at equilibrium. Finally, using canonical ensemble method, we define a new entropy that is similar to the Kolmogorov-Sinai entropy. Further, we present an analytic expression of the relationship between the diffusion coefficient $D$ and the entropy $S$ in the thermal equilibrium, that is to say, $D =\frac{\hbar}{eM} \exp{[S/(k_Bd)]}$, where $d$ is the dimension of the space, $k_B$ the Boltzmann constant, $\hbar $ the reduced Planck constant and $e$ the Euler number. This kind of scaling relation has been well-known and well-tested since the similar one for single component is firstly derived by Rosenfeld with the expansion of volume ratio.

In order to achieve its carbon peak and neutrality targets, a high proportion of distributed power sources are connected to the distribution network in China, which greatly increases the risk of distribution network operation. Aiming at the above problems, this paper proposes an active distribution network risk planning model based on multi-source data from carbon capture and power internet of things, and conducts exceeding testing of distribution network based on the stochastic load flow algorithm with semi-invariant and level expansion, calculates the semi-invariant of each order of node state vectors and branch current vectors, and then utilizes the Gram-Charlier level expansion to obtain the exceeding probability density function and probability distribution function of the node voltages and line powers of the distribution network. The probability density function and probability distribution function of the exceeding are obtained using the Gram-Charlier series expansion. Combined with multi-source data, the active distribution network with integrated energy system considering carbon capture is modeled. According to the risk scenario of the distribution network, the nonconvex constraints in the model are simplified by the second-order cone relaxation, and the optimal planning scheme of the distribution network is solved by combining the gurobi solver with the risk index as the first-level objective and the economic benefit as the second-level objective. The simulation results of a coupled network consisting of a 39-node distribution network and an 11-node transportation network verify the effectiveness of the proposed model.

Soybean is one of the world’s most economically significant crops and is widely utilized as an essential source of vegetable protein and edible oil. Cultivated soybean is domesticated from its annual counterpart, wild soybean, which is considered valuable germplasm for soybean breeding. However, wild soybean accessions generally produce seeds with impermeable coats, a trait known as hard seededness (HS), which is beneficial for long-term seed survival but is undesirable for the uniform water absorption and germination of seeds, thus limiting the utilization of wild soybeans in breeding. However, moderate HS can isolate the embryo from the surrounding environment and is thus beneficial for long-term seed storage and germplasm preservation. The HS trait is primarily associated with the structure and chemical composition of the seed coat. However, its development is also influenced by various environmental conditions, such as water and temperature. Genetic analysis has revealed that HS of soybean is a complex quantitative trait controlled by multiple genes or minor quantitative trait loci (QTL), with many QTLs and several causal genes currently identified. Investigating the physiological and molecular mechanisms underlying this trait is crucial for soybean breeding, production, and food processing. For this article, the literature was reviewed and condensed to create a well-rounded picture of the current understanding of internal and external factors, QTLs, causal genes, and the regulatory mechanisms related to the HS of soybean, with the aim of providing reference for future research and utilization of this trait.

Common prosperity is the core goal of rural revitalization, and sustainable growth of farmers' income is an inevitable requirement. This study uses CLDS2016-2020 village and family level questionnaire data to reveal how the degree of village organization affects the sustainable growth of farmers' income, thus providing reference and decision-making for the local government to promote the increase of farmers' income and narrow the gap from the village level. The results show that the degree of village organization can significantly affect farmers' income, and the analysis results of the degree of formal organization are consistent with them. Specifically, for every 1% increase in the degree of village organization, the per capita household income will increase by 32.4%, among which the wage income will increase by 22.6%, the operational income will increase by 5%, the property income will increase by 0.8%, and the transfer income will increase by 4.2%. The estimation results through instrumental variables are consistent, and the results are robust. At the same time, improving the degree of village organization can also significantly increase the proportion of farmers' non-agricultural income and narrow the income gap among farmers. On the impact of heterogeneity, it is found that the geographical distance between villages and county and township governments, as well as the political identity and education level of farmers will affect the role of the degree of organization. The results of mechanism analysis show that improving the degree of village organization is mainly through promoting the circulation of agricultural land, socialized service of agricultural machinery and industrial and commercial capital to the countryside to increase farmers' income. The research revealed that the modernization of rural governance should be accelerated, and the degree of village organization should be improved, especially the degree of formal organization, so as to build a benign trust and cooperation relationship between the two village committees and the villagers, and implement policies and measures to improve the income of farmers according to local conditions. At the same time, strengthen the publicity and education in party member to improve the proportion of rural party member and the education level of farmers.

FV (finger vein) identification is a biometric identification technology that extracts the features of FV images for identity authentication. To address the limitations of CNN-based FV identification, particularly the challenge of small receptive fields and difficulty in capturing long-range dependencies, an FV identification method Let-Net(Large kernel and attention mechanism Network) was introduced, which combines local and global information. Firstly, Let-Net employs large kernels to broaden the receptive field and incorporates depthwise convolution with residual connections to reduce parameter count. Secondly, Let-Net integrates an attention mechanism to enhance the information flows in channels and spaces for more comprehensive and distinctive FV feature extraction. The experimental results on nine public datasets show that Let-Net has excellent identification performance, and the EER and accuracy rate on the FV_USM dataset can reach 0.04% and 99.77%. The parameter number and FLOPs of Let-Net are only 0.89M and 0.25G, which means that the time cost of training and reasoning of the model is low, and it is easier to deploy and integrate into various applications.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

With the rapidly increasing of people’s purchasing power, the fast moving consumer goods (FMCG) industry is supposed to grow dramatically. In order to gain more market access and profile, it is important for the FMCG manufacturers and retailers to find the preferences and provincial characteristics of consumers, to develop more suitable goods distribution strategy. Based on retails marketing data with geographic characteristics, this paper proposes a new combination of geography methods to solve the problems in distribution of FMCG. Via multiple K-means clustering and cross validation of KNN half off, the mesoscopic sales features are extracted through the classification of retails, which can indirectly grasp the consumer behavior characteristics. Based on space division and Moran’ I spatial autocorrelation arithmetic, two strategies are developed to satisfy consumer’s needs and promote sales, including conservative and positive strategies. According to our analysis, the total sales volume of the regions will increase by 5.1% and 10.3%. This study can be applied to the provide purchase strategies for FMCG retails according to their locations. The research can explore the consumption potential of different areas, thus improving the profile of retails and the development of economy in more mesoscopic scale.

This paper considers the direction of arrival (DOA) estimation problem of phase ambiguity for unfolded coprime linear array (UCLA). The existing most common stacking subarray-based method can tackle the phase ambiguity problem. However, the method is not always true. For a given DOA, it has its corresponding steering vector, but if there are two DOAs which have the same steering vectors with the given DOA for different subarrays, the phase ambiguity problem still arises. A modified method, which defines a decision variable and uses the classic beamforming technique to estimate the DOAs is proposed. However, this method needs additional algorithm to distinguish the true DOAs besides multiple signal classification (MUSIC) spectrum. And sometimes this method is not reliable if the decision variable is not chosen appropriately. Therefore, based on the UCLA, we reconstruct the array to design an improved UCLA called IUCLA. With moving the reference element, the linear relationship among the directional vectors can be broken. In this way, we can directly utilize the MUSIC algorithm to estimate with no additional algorithm. The proposed method can solve the phase ambiguity problem and it does not demand other technique to decrease the complexity. Moreover, the Cramer-Rao Bound (CRB), as the lower bound of the unbiased estimation, is provided and numerical simulations are given to demonstrate the effectiveness and superiority of the proposed method.

Since the discovery of graphene, due to its excellent optical, thermal, mechanical and electrical properties, it has a broad application prospect in energy, materials, biomedicine, electromagnetism and other fields. A great quantity of researches on the physical mechanism of graphene has been applied to engineering in electromagnetism and optics. To study the properties of graphene, different kinds of numerical methods have been developed for simulating the electromagnetic field effects of graphene, and equivalent boundary conditions have been employed to replace graphene in the computational domain. In this work, the numerical methods with equivalent boundary conditions are reviewed, and some examples are provided to illustrate their applicability.

Land use is an embodiment of human socioeconomic activities and represents a bridge between these activities and natural systems. Through social activities, humans transform land use to promote social and economic development and improve production, living conditions, and eco-logical functions of land. Rural residential land represents a space for rural residents to reside in and exhibits spatial characteristics that evolve over time, which is proof of rural socioeconomic development. This paper observes rural residential land in 21 cities on the Grand Canal and analyses its spatial differentiation. Then, it explores the driving factors of this land using spatial grid analysis and the geographic detector model. Lastly, it proposes three different forms of rural residential land based on the results. The study found that: (1) the change of rural residential land in the northern part of the Grand Canal was more volatile than that in the southern part. The change of rural residential land from 1990 to 2020 conformed to the pattern of cultivated land - rural residential land - urban construction land; (2) Based on the driving factors of rural residen-tial land, the land is divided into one-dimensional cities, two-dimensional cities and three-dimensional cities. Circular, linear, and scattered cities of different sizes were affected by socioeconomic factors, transportation accessibility, and the natural environment, respectively; and (3) Finally, according to the spatial differentiation characteristics and the driving factors of rural residential land, the study proposes the construction of three types of villages through the strate-gies of constructing large-scale villages, relocating and reconstructing new villages, and con-structing high-quality villages, respectively. Enhancing the scientific planning of rural residential land and its efficiency can offer the protection of agricultural land and the integration of urban and rural areas in the new era.

Automatic recognition methods for non-stationary EEG data collected from EEG sensors play an essential role in neurological detection. The integrative approaches proposed in this study consists of Symlet wavelet processing, a gradient boosting machine, and a grid search optimizer for a three-level classification scheme for normal subjects, intermittent epilepsy, and continuous epilepsy. Fourth-order Symlet wavelets were adopted to decompose the EEG data into five time-frequency sub-bands, whose statistical features were computed and used as classification features. The grid search optimizer was used to automatically find the optimal parameters for training the classifier. The classification accuracy of the gradient boosting machine was compared with that of a support vector machine and a random forest classifier constructed according to previous descriptions. Multiple-index were used to evaluate the Symlet wavelet transform-gradient boosting machine-grid search optimizer classification scheme, which provided better classification accuracy and detection effectiveness than has recently reported in other work on three-level classification of EEG data.

Background: Participation is low (43%) in Australia’s National Bowel Cancer Screening Program which provides a biennial Fecal Immunochemical Test kit mailed to the home of Australians aged 50-74 years. While several factors for non-participation have been identified, the role of mental and physical health on screening behaviour has not been assessed. Methods: Participants of the Australasian Colorectal Cancer Family Registry Cohort were asked to complete a questionnaire on their colorectal cancer screening in the past five years and a validated measure of mental and physical health. The association between mental and physical health and screening was determined for Australian participants aged 45-75 years who had never been diagnosed with colorectal cancer. Multivariable logistic regression was used to adjust for measured potential confounders. Results: Of the 1130 eligible participants, 819 reported colorectal cancer screening in the past five years (72%). After adjusting for potential confounders, there was no evidence that overall mental or physical health was associated with colorectal cancer screening. However, one specific scale, general health, was positively associated with colorectal cancer screening (p=0.014) with those reporting higher levels of general health undergoing screening.Conclusion: We found limited evidence that mental and physical health, as measured by a short questionnaire, are associated with colorectal cancer screening. A potential limitation is reverse causation where previous screening may have impacted mental or physical health. A more detailed study of physical and mental health as barriers or enablers of screening is needed.

This paper presents a complete control strategy of the active return-to-center (RTC) control for electric power steering (EPS) systems. We first establish the mathematical model of the EPS system and analyze the source and influence of the self-aligning torque (SAT). Second, based on the feedback signals of steering column torque and steering wheel angle, we give the trigger conditions of a state switch between the steering assist state and the RTC state. In order to avoid the sudden change of the output torque for the driving motor when the state switches frequently between the steering assist state and the RTC state, we design an undisturbed state switching logic algorithm. This state switching logic algorithm ensures that the output value of the RTC controller is set to an initial value and increases in given steps up to a maximum value after entering the RTC state, and the output value of the RTC controller will reduce in given steps down to zero when exiting the RTC state. This therefore ensures smooth switch control between the two states and improves the driver’s steering feeling. Third, we design the RTC controller, which depends upon the feedback signals of the steering wheel angle and the angular velocity. In addition, the controller increases the auxiliary control function of the RTC torque based on vehicle speed. The experimental results show that the active RTC control method does not affect the basic assist characteristics, which effectively reduces the residual angle of the steering wheel at low vehicle speed and improves the RTC performance of the vehicle.

In mesoscale eddies, chemical properties and biological composition are different from those in surrounding water, due to their unique physical processes. It is unclear how physical-biological coupling occurs in warm-core eddies, particularly since no study has examined the relationship between bacteria and viruses. The purpose of the present study was to examine the influence of anticyclonic warm eddy on the relationship between bacterial and viral abundances as well as viral activity (viral production) in different depths. In the core of warm eddy, bacterial abundance (0.48 to 2.82 ×105 cells mL−1) fluctuated less than that of the outside eddy (1.12 to 7.03×105 cells mL−1). In particular, there was four-folds higher of viral-bacterial abundance ratio (VBR) estimated within the eddy below DCM than the outside eddy. We suggest that prevailing physical forces with downwelling at the center of the anticyclonic warm eddy, viruses can also be transmitted into the deep ocean directly through adsorption on particulate organic matter during sinking. Overall, our findings provide valuable insights into the interaction between bacterial and viral communities and their ecological mechanism within the warm eddy.

Global wind observations are fundamental for studying weather and climate dynamics. Most wind measurements come from atmospheric motion vectors (AMVs) by tracking the displacement of cloud or water vapor features. These AMVs generally rely on thermal infrared (IR) techniques for their height assignments, which are subject to large uncertainties in the presence of weak or reversed vertical temperature gradients around the planetary boundary layer (PBL) and with tropopause folding. Stereo imaging can overcome the height assignment problem using geometric parallax for feature height determination. In this study we develop a stereo 3D-Wind algorithm to simultaneously retrieve AMV and height from geostationary (GEO) and low Earth orbit (LEO) satellite imagery and apply it to collocated Geostationary Operational Environmental Satellite (GOES) and Multi-angle Imaging SpectroRadiometer (MISR) imagery. The new algorithm improves AMV and height relative to products from GOES or MISR alone, with an estimated accuracy of <0.5 m/s in AMV and <200 m in height with 2.2 km sampling. The algorithm can be generalized to other LEO-GEO or GEO-GEO combinations for greater spatiotemporal coverage. The technique demonstrated with MISR and GOES has important implications for future high-quality AMV observations, for which a low-cost constellation of CubeSats can play a vital role.

In this paper, a land utilization efficiency evaluation model, which takes environmental loss into consideration, has been structured via taking advantage of the slack-based measure (SBM) model. Meanwhile, based on the panel data from 280 prefecture-level cities in China from 2003 to 2013, the paper thoroughly probed into, and discussed, the effect imposed by industry clustering and specialization on the utilization efficiency of urban land. Research results indicate several conclusions, as follows: (1) Taking environmental loss into account, the land utilization efficiency of prefecture-level cities in China is generally low. During the research period, the average value of the land utilization efficiency of prefecture-level cities in China is only 0.349, with, first, a declining trend, and then a rise. Geographically speaking, the land utilization efficiency presents a “depression in the center” phenomenon which means the land utilization efficiency of prefecture-level cities in the central China are relatively lower than in the east and west. Now, the difference among the urban land utilization efficiency in China significantly reflects the distinctions among Eastern, Western, and Central China. Moreover, the contribution degree of the difference of the land utilization efficiency among cities of central China to the aggregation difference shows an ascending momentum. Additionally, the relation between the population scale and land utilization efficiency in cities manifests as a U shape; (2) theoretically speaking, the relation between industry clustering and urban land utilization efficiency presents an inverted-U shape. However, this kind of relation is not significant in Western and Central China and medium-sized cities. Moreover, most of cities are still relatively far away from the inflection point or the critical value; and (3) the industry professional level has imposed a positive influence on urban land utilization efficiency. However, that influence is not significant in Eastern China and large cities. Consequently, strengthening the industry professional development of Western and Central China and small and medium-sized cities, facilitating diversified development of industries in Eastern China and large cities, and accelerating industrial clustering, all of these measures above will be conducive to improving urban land utilization efficiency in China.

Tungsten carbide (WC) was well known as a wear-resistant material. Iron-based pow-der was suitable for remanufacturing of cast iron engine parts. To improve the wear resistance of the remanufactured iron-based cast iron engine parts, WC-Co was intro-duced into iron-based powders to prepare composite coatings for cast iron engine components. In this work, FeAlC-x(WC-Co) composite coatings were prepared by plasma transfer arc on compacted graphite cast iron. The influences of WC-Co con-tents in the Fe-AlC-x(WC-Co) composite coatings on the microstructure and properties of the composite coatings were investigated. The composite coatings contained γ-Fe, α-Fe, WC and Fe3W3C mainly. The microhardness of FeAlC-x(WC-Co) composite coatings had the highest hardness of 814 HV0.2, the-lowest coefficient of 0.5 and the lest wear mass loss of 1.3mg when the weight content of WC-Co in the composite coating was 20wt%. As compared with the FeAlC coating, FeAlC-x(WC-Co) composite coating achieved the effect of reducing friction and wear resistance simultaneously, which resulted from the self-lubricating effect of graphite and high wear-resistance of carbides in the claddings.

Increased attention has been paid to the influence of coal mining subsidence on ecological environment. Restoration of ecosystem in damaged mining area is critical for restoring disturbed environment. The comparing of plant communities and microbial communities in the artificial restoration and natural restoration areas provides an effective method for evaluating the restoration effects. However, such studies are limited in coal mining subsidence restoration areas. Subsidence area in Shendong mining area, located in the semi-arid region of Western China, was restored from 2003 with 5 ecological restoration plant species. In July 2017, the comparison and analysis of plant and microbial communities were conducted at the artificial restoration areas (AR) and the natural remediation areas (NR). The results showed that the artificial ecological restoration in Shendong mining area has achieved some success, but it has not recovered to a similar ecosystem before the destruction. A higher plant species, coverage and bacterial community diversity were observed in AR. However, these features have lower similarity compared with those in NR sites. Potential soil factors, such as pH, moisture content, total carbon content, organic matter, nitrogen and bulk density, have a greater impact on soil bacterial community structure and diversity. In the ecological restoration of the mining area, attention should be paid to the restoration of soil properties in the mining area. This study can provide theoretical guidance for more scientific ecological restoration in the damaged mining area.

To handle the problem of solving the results of aircraft’s visual navigation with scene matching, this paper take the measure of the spherical EPnP positioning posture solving by measuring the central angle threshold value and approaches for constructing a measuring model. The detailed steps are as follows: firstly, this approach needs to construct a positioning coordinate model for the earth surface, makes sure the expression for the 3-dimensional coordinate of the earth surface and solves the positioning of constructing data model with EPnP positioning posture solving algo-rithm. Secondly, by contrasting and analyzing the positioning posture value of approximate plane coordinates, the critical value is acquired, which can be recognized as plane calculation. Lastly, this method should construct a theoretical model of measurement for the visual height and central angle with the decided central angle threshold value. The simulation experiment shows that the average positioning precision of taking the spherical coordinates as input is 16.42 percent way higher than taking the plane coordinates as input. When the central angle is less than 0.05 degrees and the surface district is less than 5585 square meters, the positioning precision of the plane co-ordinates is pretty much equal to the spherical coordinates. At this moment, the sphere can be seen as flat. The conclusion of this essay can theoretically guide the further study of positioning posture solving of the scene matching, which is also of vital significance for theory research and engineering application.

The prediction of system degradation is very important as it serves as an important basis for the formulation of condition-based maintenance strategies. An effective health indicator (HI) plays a key role in the prediction of system degradation as it enables vital information for critical tasks ranging from fault diagnosis to remaining useful life prediction. To address this issue, a method for monitoring data fusion and health indicator construction based on autoencoder (AE) and long short-term memory (LSTM) network is proposed to improve the predictability and effectiveness of health indicator in this study. Firstly, an unsupervised method and overall framework for HI construction is built based on deep autoencoder and LSTM neural network. The neural network is trained fully based on the normal operating monitoring data and then the construction error of the AE model is adopted as the health indicator of the system. Secondly, we propose related machine learning techniques for monitoring data processing to overcome the issue of data fusion, like mutual information for sensor selection and t-distributed stochastic neighbor embedding (T-SNE) for operating condition identification, etc. Thirdly, in order to verify the performance of the proposed method, experiments are conducted based on CMAPSS dataset and results are compared with algorithms of principal component analysis (PCA) and vanilla autoencoder model. Result shows that LSTM-AE model outperforms the PCA and Vanilla-AE model in metrics of monotonicity, trendability, prognosability and fitness. Fourthly, in order to analyze the impact of the time step of the LSMT-AE model on HI construction, we construct and analyze the system HI curve under different time steps of 5, 10, 15, 20, and 25 cycles. Finally, the results demonstrate that the proposed method for HI construction can effectively characterize the health state of system, which is helpful for further failure prognostics and converting the scheduled maintenance into condition-based maintenance.

This manuscript investigates the dispersion of cetyltrimethylammonium bromide (CTAB) treated cellulose nanocrystals (CNCs) in polypropylene (PP) by melt mixing. FTIR spectra of CTAB-modified CNCs and unmodified CNCs in a PP matrix were used to evaluate the surface treatments. The surface energies and morphologies of CTAB surface modified CNCs in polypropylene (PP) were used to interpret the effects of nanoparticle dispersion on the crystallization and rheological and mechanical properties of the PP matrix.

Locomotor impairment is a high-prevalent and significant source of disability and significantly impacts a large population’s quality of life. Despite decades of research in human locomotion, the challenges of simulating human movement to study the features of musculoskeletal drivers and clinical conditions remain. Most recent efforts in utilizing reinforcement learning (RL) techniques are promising to simulate human locomotion and reveal musculoskeletal drives. However, these simulations often failed to mimic natural human locomotion because most reinforcement strategies have yet to consider any reference data regarding human movement. To address these challenges, in this study, we designed a reward function based on the trajectory optimization rewards (TOR), and bio-inspired rewards, which includes the rewards obtained from reference motion data captured by a single Intertial Moment Unit (IMU) sensor. The sensor was equipped on the participants’ pelvis to capture reference motion data. Also, we adapted the reward function by leveraging previous research in walking simulation for TOR. The experimental results showed that the simulated agents with the modified reward function performed better in mimicking the collected IMU data from participants, which means the simulated human locomotion was more realistic. Also, as this bio-inspired defined cost, IMU data enhanced the agent’s capacity to converge during the training process. As a result, the models’ convergence is faster than those developed without reference motion data. Consequently, human locomotion can be simulated more quicker and in a broader range of environments with a better simulation performance.

The work safety standardization of enterprises based on the traditional work safety theory has played a significant role in reducing the number of accidents and improving work safety to some extent in China. However, some problems are coming with the work safety standardization of enterprises developing constantly in China. On the one hand, it is not combined with the actual situation of the enterprise, lacking pertinence and specificity, these defects resulted that it is not integrated with original safety production management system of enterprise and make it difficult to carry out. On the other hand, there is a lack of systematic management methods for the work safety management system of enterprise, most of enterprises only pay attention to the inspection result rather than the process control. This means after the check of the government, many enterprises will relax to carry out the system. This paper puts forward a new method for optimizing the standardization management mode of work safety based on the Viable System Model(VSM), which can solve the defects of work safety standardization of enterprises management system. An optimization model of work safety standardization based on VSM was construct for explaining the process optimization and control of work safety standardization management. It can improve the connectivity between the enterprise and the government. The conclusion of this paper can provide reference for achieving the development and optimization of work safety standardization of enterprises in China.

The damage evolution rules of coal under true triaxial combined static-dynamic loads are important to understand and reveal the mechanism of rockburst in coal mines. The numerical simulation was carried out using FLAC3D to explore the coupling effect of static and dynamic stress, especially the influence of dynamic load parameters. The results show that the increase of dynamic load amplitude not only makes the plastic zone grow exponentially and shorten the damage development time, but also decreases the residual strength of the coal sample, which leads to a much more violent of the dynamic failure. The stress wave can propagate more stable in the coal sample with the increase of dynamic load frequency and the development time of the plastic zone also show synchronous fluctuating features, and when the frequency is like the intrinsic frequency of the coal sample, the dynamic load has a significant stimulate effect. The static and dynamic loads have different damage effect to the coal sample under true triaxial stress path, the weight decreases in order of the minimum principal stress, the maximum principal, the amplitude of the dynamic load and at last the dynamic stress frequency by the entropy weight method analysis.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

Inclusive and sustainable development has become an important part of China's sustainable development agenda, the self-recovery and stability of China's economy cannot be achieved without the macro-governance of the government. Figuring out the internal logic of digital finance and economic resilience is an important part of effective government governance. Based on the panel data of 193 counties in five provinces in northwest China from 2014 to 2021, the paper tested digital finance and county-level economic resilience by using two-way fixed-effect model, intermediary-effect model and threshold-effect model, to test whether financial development promotes government governance in underdeveloped regions. The results prove that digital inclusive finance significantly enhances the resilience of county economies by improving capital allocation efficiency, stimulating entrepreneurship and employment, and reducing pollution emissions. In addition, there are dual threshold effects between capital allocation efficiency and employment vitality, in which capital allocation efficiency has a gradually increasing threshold effect, and entrepreneurship and employment vitality have a fluctuating increasing threshold effect. Therefore, "Digital inclusive finance" in underdeveloped regions is an indispensable part of financial globalization；promoting the healthy development of digital finance is the basis and premise for providing a good financial environment for government management; deepening the reform in the financial field and promoting the green and sustainable development of finance are the future trend and direction of efforts.

With the rapid development of Internet of Vehicles (IoV), particularly the introduction of mobile edge computing (MEC), vehicles can efficiently share data with one another. However, edge computing nodes are vulnerable to various network attacks, posing security risks to data storage and sharing. Moreover, the presence of abnormal vehicles during the sharing process poses significant security threats to the entire network. To address these issues, this paper proposes a novel reputation management scheme, which proposes an improved multi-source multi-weight subjective logic algorithm. This algorithm fuses direct and indirect opinion feedback of nodes through the subjective logic trust model while considering factors such as event validity, familiarity, timeliness, and trajectory similarity. Vehicle reputation values are periodically updated, and abnormal vehicles are identified through reputation thresholds. Finally, blockchain technology is employed to ensure the security of data storage and sharing. By analyzing real vehicle trajectory datasets, the algorithm is proven to effectively improve the differentiation and detection rate of abnormal vehicles.

This research examines how rainfall and mining affect the slope damage resulting from the transition from open-pit mining to underground mining. Using unmanned aerial vehicle (UAV), the Huangniu slope of Dexing Copper Mine was fully characterized, and experiments were conducted on rock samples from appropriate sites. First, the mechanical properties of the samples were measured. Then, the parameters of the similarity simulation experiments were derived based on the similarity theory. Subsequently, the rainfall, rock slope, data acquisition and monitoring systems were designed. Finally, the rock mass failure with different slope angles was analyzed, and the deformation and damage patterns under the coupling effect were obtained. The results show that rainfall increases pore water pressure and moisture content. Rainfall and slope-slip water have more impact on the open-pit platform. The pore water pressure values on the upper rock mass rise faster than inside. In the open-pit mining stage, the rock mass shifts slightly to the upper left. In the room mining stage, vertical fractures and goaf sinking occur. The fractures above the mine room form a semi-ellipse. In the pillar mining stage, the overlying rock displacement is evident, and fractures persist. In the continuous pillar mining stage, the overlying rock collapses massively. The 65° slope model is the most damaged, while the 55° slope model is the least damaged. The results also suggest that the UAV guides sample selection.

This study investigated the phenolic compounds of 15 Chrysanthemum morifolium Ramat cv. ‘Hangbaiju’, including 6 ‘Duoju’ and 9 ‘Taiju’ using high performance liquid chromatography. The antioxidant activities of these ‘Hangbaiju’ were estimated by DPPH, ABTS and FPAR assays. Results showed that a total of 14 phenolic compounds were detected in these flowers, including 3 mono-caffeoylquinic acids, 3 di-caffeoylquinic acids, 1 phenolic acid and 7 flavonoids. ‘Duoju’ and ‘Taiju’ possessed different concentration of phenolic compounds, and ‘Taiju’ exhibited higher caffeoylquinic acids and stronger antioxidant activities than ‘Duoju’. Caffeoylquinic acids showed a strong correlation with the antioxidant activities of the samples. Principal component analysis revealed an obvious separation between ‘Duoju’ and ‘Taiju’ using phenolic compounds as variables. Apigenin-7-O-glucoside, 3,5-di-O-caffeoylquinic acid, luteolin and acacetin were found to be the key phenolic compounds to differentiate ‘Duoju’ from ‘Taiju’.

The tailoring of the surface properties of cellulose nanocrystals (CNCs) to meet various requirements in environmental, food, and material areas has always been of great interest. In this study, the surface chemistry of CNCs was noncovalently modified by cetyltrimethylammonium bromide (CTAB), followed by characterizations and an application as a coating material for interfacial interaction investigation over various substrates. Due to the CTAB modification, the surface charge of the CNCs was neutralized, resulting in an increased size of each nanocrystal at the aqueous status and the aggregated microfibers when dried up. The CTAB modification not only decreased the crystallinity of the samples from 48.57% to 9.12% but also hydrophobized the CNCs and decreased their total surface energy. Finally, the adsorption behavior of the CNCs and CTAB-CNCs over nonionic, anionic, and cationic polymers was investigated by ellipsometry. Based on the thickness of the CNC and CTAB-CNC layers over 2-Hydroxyethyl cellulose (HEC), carboxymethyl cellulose (CMC), and polyethyleneimine (PEI), we proposed that the adsorption behavior was overall influenced by electrostatic interaction, hydrogen bonding, and van der Waals forces and the thickness of the adsorbed layers could be impacted by both the surface charge and the size of the crystals.

Hepatocellular carcinoma (HCC) is characterized by uncontrolled cellular proliferation driven by aberrant signal transduction. Cells respond to potential carcinogenic signals by inducing cellular senescence (CS) as a defense mechanism. However, assessing CS levels in various tumors is challenging due to heterogeneity and the lack of universal CS markers. This study integrates single-cell RNA sequencing (scRNA-seq) and bulk RNA-seq data from HCC samples to analyze gene expression profiles. HCC-specific senescence-related pathways are identified, and genes from these pathways distinguish molecular subtypes associated with senescence in HCC. These subtypes exhibit significant variations in biological and clinical attributes. A specific CS risk model is developed, revealing associations between CS scores and prognosis, clinical staging, immune infiltration, immunotherapy response, and drug sensitivity. The key gene G6PD is identified as a potential senescence-related target in liver cancer. Molecular experiments confirm the effective suppression of HepG2 cell proliferation, invasion, and migration upon G6PD knockdown. In summary, this analysis enhances our understanding of HCC-specific senescence molecular features and introduces a novel senescence-related biomarker, offering promising implications for future research.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

To date, viral RNA detection is almost the only way to confirm SARS-CoV-2infectionin practice.However, variousreasons can cause low sensitivity for RNA detection, and thisposes aserious challenge to disease control. We tested the performance of detecting total antibody(Ab) and IgM levels in serum by the methods of chemiluminescence, enzyme-linked immunosorbent assay (ELISA), and colloidal golddetection. The datashowed that the sensitivity and specificity for detecting total Ab and IgM levels were high by all three methods, and the sensitivity was higher for detecting total Ab than for detecting IgM. Evidence from studieshas shown thatviral RNA testingcombinedwith serological testing could increase the diagnostic sensitivity while maintaining a high specificity. Specific serology testsfor SARS-CoV-2 havegreat value for clinical practice and public health.

Dolomite is a common type of natural soluble rock. The strength of rock decreases under the action of corrosion, which has a significant impact on the self-stability and long-term safety of the tunnel surrounding the rock. To reveal the microscopic structure evolution and strength-damage law of carbonate rock caused by corrosion, chemical corrosion, rock uniaxial compression, and electron microscope scanning tests are conducted at different pH values on the dolomite of the Doushantuo Formation. The rock dissolution at different pH values exhibits four typical stages: the initial dissolution stage, secondary dissolution acceleration stage, stable dissolution rate stage, and dissolution attenuation stage. During the dissolution process, the initial dissolution rate is 25.91 times that of the stable stage, and the maximum strength attenuation is 76.2% after 21 days of dissolution. For macroscopic failure, the rock is developed from 1 to 2 external fractures to multiple internal and external fractures and penetrated, and the specimen transforms from brittle to flexible. For microstructure, the sample exhibits corrosion characteristics along the joint surface, intensified corrosion at the edge, etc. The porosity increase rate is 0.6%/d; however, the length–width ratio of the pores is maintained at 1.7–1.85, indicating that the development rate of pores in different directions is similar. The results of this study have enriched the study of the dolomite dissolution mechanism and have important reference value for the stability evaluation of tunnel surrounding rock in karst environments.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Repair mortar is commonly used to rehabilitate reinforced concrete structures or components that exhibit a relatively high level of distresses. Yet, this repair mortar can be contaminated by salt from its service environment. This work employs a two-dimensional finite element model to investigate the transport behavior of ionic species in salt-contaminated and water-saturated repair mortar under an externally applied electric field. The model was experimentally validated and then utilized to evaluate the effectiveness of electrochemical chloride extraction (ECE) with or without electrical injection of corrosion inhibitor (EICI). In the case study, both the ECE alone and the ECE+EICI treatment was found effective in decontaminating the zone in front of the steel rebar. In both techniques, the magnitude of current density has a significant effect on removing chloride out of the mortar and increasing the pH of the pore solution near the rebar, whereas the treatment time any not have a significant effect under some scenarios. The injection of the organic corrosion inhibitor significantly slowed down the removal of chloride. Changes in the ionic distribution in the mortar were generally beneficial in reducing the corrosion risk of the steel rebar and thus extending the service life of the repair mortar.

The traffic light detection and recognition are crucial for enhancing the security of unmanned systems. This study proposes a YOLOv5-based traffic light detection algorithm to tackle the challenges posed by small targets and complex urban backgrounds. Initially, the mosaic-9 method is employed to enhance the training dataset, thereby boosting the network’s ability to generalize and adapt to real-world scenarios. Furthermore, the network incorporates the Squeezed-and-Excitation (SE) attention mechanism to improve. Moreover, the YOLOv5 algorithm’s loss function has been optimized by substituting it with EIoU_loss, which addresses issues like missed detection and false alarms. Experimental results demonstrate that the model , trained with this enhanced network, achieves a 99.4% mAP on a custom dataset, which is 6.3% higher than the original YOLOv5, while maintaining a detection speed of 74 f/s. Therefore, this algorithm offers higher detection accuracy and effectively meets real-time operational requirements.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

the intermittency and variability of these permeated Distributed Generators (DGs) could critically cause many security and economy risks to distribution systems. This paper applied a certain mathematical distribution to imitate the output variability and uncertainty of DGs. And then, four risk indices EENS, PLC, EFLC and SI were established to reflect the system risk level of distribution system. For the certain mathematical distribution of the DGs' output power, a developed PEM (point estimate method)-based method was proposed to calculate these four system risk indices. In this developed PEM-based method, enumeration method was used to list the states of distribution systems, an improved PEM was presented to deal with the uncertainties of DGs and the value of load curtailment in distribution systems was calculated by an optimal power flow algorithm. Finally, the effectiveness and advantages of this proposed PEM-based method for distribution system assessment were verified by the tests of a modified IEEE 30-bus system. Simulation results have shown that this proposed PEM-based method has a high computational accuracy and highly reduced computational costs compared with other risk assessment methods and is very effective for risk assessments.

A lot of previous research have proposed various frameworks and algorithms to optimize routes to reduce the total transportation cost, which accounts for over 70% of overall logistics cost. However, it is very hard to find the cases applied the mathematical models or algorithms to the practical business environment cases, especially daily operating logistics services like convenient stores. Most of previous research have considered the developing an optimal algorithm which can solve the mathematical problem within the practical time while satisfying all constraints such as the capacity of delivery and pick-up, and time windows. For the daily pick-up and delivery service like supporting several convenient stores, it is required to consider the unit transporting container as well as the demand, capacity of trucks, traveling distance and traffic congestion. Especially, the reusable transporting container, trays, should be regarded as the important asset of logistics center. However, if the mathematical model focuses on only satisfying constraints related delivery and not considering the cost of trays, it is often to leave the empty trays on the pick-up points when there is not enough space in the track. In this research, it has been proposed to build the mathematical model for optimizing pick-up and delivery plans by extending the general vehicle routing problem of simultaneous delivery and pickup with time windows while considering left-over cost. With the numerical experiments, it has been proved that the proposed model may reduce the total delivery cost. It may be possible to apply the proposed approach to the various logistics business which uses the reusable transporting container like shipping containers, refrigerating containers, trays, and pallets.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Wireless Sensor Networks (WSNs) has the characteristics of large-scale deployment, flexible networking, and wide application. It is an important part of the wireless communication networks. However, due to limited energy supply, the development of WSN is greatly restricted. Wireless Rechargeable Sensor Networks (WRSNs) transform the distributed energy around the environment into usable electricity through energy collection technology. In this work, a joint optimization strategy is proposed to improve the energy management efficiency for WRSNs. The joint optimization strategy is divided into two phases. In the first phase, we design an Annulus Virtual Force based Particle Swarm Optimization (AVFPSO) algorithm for area coverage planing. It adopts the multi-parameter joint optimization method to improve the efficiency of the algorithm. In the second phase, a Queuing Game-based Energy Supply (QGES) algorithm is designed for energy scheduling. It converts energy supply and consumption into network service. By solving the game equilibrium of the model, the optimal energy distribution strategy can be obtained. The simulation results show that our scheme improves the efficiency of coverage and energy, and extends the lifetime of WSN.

Chinese investors are easily affected by hot topics on the media and Internet and likely take irrational behavior. They tend to consume rationally and invest emotionally. This research aims to analyze the Baidu index’s effect on share price of solar power industry in China. Three main models are established to identify the correlation between Baidu index and stock price of solar industry. The media index and searching index of Baidu are chosen as an independent variable to measure the influence from media and Internet, and stock price as the dependent variable. To improve and complete the analysis, Hexun index is taken into consideration as mediator variable. This study applied Multiple Linear Regression Model and VAR (Vector auto-regression) Model. The research mainly uses the tools of SPSS, Eviews and Excel to conduct data analysis. The test is based on the theories of Granger Causality, unit root test, F-test, and t-test. The research proves the relationship between the close price of stock and Baidu index, and it also created a model for further forecasting.

Industrial Control Systems (ICS) are integral to managing and optimizing processes in various industries, including manufacturing, power generation, and more. However, the scarcity of widely adopted ICS datasets hampers research efforts in areas like optimization and security. This scarcity arises due to the substantial cost and technical expertise required to create physical ICS environments. In response to these challenges, this paper presents a groundbreaking approach to generating synthetic ICS data through a data-driven ICS network simulation. We circumvent the need for expensive hardware by recreating the entire ICS environment in software. Moreover, rather than manually replicating the control logic of ICS components, we leverage existing data to autonomously generate control logic. The core of our method involves the stochastic setting of setpoints, which introduces randomness into the generated data. Setpoints serve as target values for controlling the operation of the ICS process. This approach enables us to augment existing ICS datasets and cater to the data requirements of machine learning-based ICS intrusion detection systems and other data-driven applications. Our simulated ICS environment employs virtualized containers to mimic the behavior of real-world PLCs and SCADA systems, while control logic is deduced from publicly available ICS datasets. Setpoints are generated probabilistically to ensure data diversity. Experimental results validate the fidelity of our synthetic data, emphasizing its ability to closely replicate temporal and statistical characteristics of real-world ICS networks. In conclusion, this innovative data-driven ICS network simulation offers a cost-effective and scalable solution for generating synthetic ICS data. It empowers researchers in the field of ICS optimization and security with diverse, realistic datasets, furthering advancements in this critical domain. Future work may involve refining the simulation model and exploring additional applications for synthetic ICS data.

Solar3D is an open-source software application designed to interactively calculate solar irradiation at three-dimensional (3D) surfaces in a virtual environment constructed with combinations of 3D city models, digital elevation models (DEMs), digital surface models (DSMs) and feature layers. The GRASS GIS r.sun solar radiation model computes solar irradiation based on two-dimensional (2D) raster maps for given day, latitude, surface and atmospheric conditions. With the increasing availability of 3D city models and demand for solar energy, there is an urgent need for better tools to computes solar radiation directly with 3D city models. Solar3D extends GRASS GIS r.sun from 2D to 3D by feeding the model with input, including surface slope, aspect and time-resolved shading, that is derived directly from the 3D scene using computer graphics techniques. To summarize, Solar3D offers several new features which, as a whole, distinguish itself from existing 3D solar irradiation tools: (1) the ability to consume massive heterogeneous 3D city models, including massive 3D city models such as oblique airborne photogrammetry-based 3D city models (OAP3Ds or integrated meshes); (2) the ability to perform near real-time pointwise calculation for duration from daily to annual; (3) the ability to integrate and interactively explore large-scale heterogeneous geospatial data. (4) the ability to calculate solar irradiation at arbitrary surface positions including at rooftops, facades and the ground. Solar3D is publicly available at https://github.com/jian9695/Solar3D.

In wireless sensor networks, there is no a central controller to enforce cooperation between nodes. Therefore, nodes may generate selfish behavior to conserve their energy resources. In this paper, we address the problems of transmission power minimization and energy balance in wireless sensor networks using a topology control algorithm. We considered the energy efficiency and energy balance of the nodes, and an improved optimization-integrated utility function is designed by introducing the Theil index. Based on this, a topological control game model of energy balance is established, and it is proved that the topological game model is an ordinal potential game with Pareto optimality. Additionally, an energy-balanced topology control game algorithm (EBTG) is proposed to construct topologies. The simulation and comparison show that, compared with other topological control algorithms based on game theory, the EBTG algorithm can improve energy balance and energy efficiency while reducing the transmitting power of nodes, thus prolonging the network lifetime.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

This paper studies the finite-time synchronization problem of fractional-order stochastic memristive bidirectional associative memory neural networks (MBAMNNs) with discontinuous jumps. A novel criterion for finite-time synchronization is obtained by utilizing the properties of quadratic fractional-order Gronwall inequality with time delay and the comparison principle. This criterion provides a new approach to analyze the finite-time synchronization problem of neural networks with stochasticity. Finally, numerical simulations are provided to demonstrate the effectiveness and superiority of the obtained results.

For traffic management under sudden disaster in high-density areas, the first and foremost step is to prevent traffic congestion in the disaster-affected area by traffic flow control, as to provide enough and flexible traffic capacity for emergency evacuation and emergency rescue. Catastrophe border identification is the foundation and the key to traffic congestion prediction under sudden disaster. This paper uses a mathematical model to study the regional traffic flow in the high-density area under sudden fire disaster based on the Cusp Catastrophe Theory (CCT). The catastrophe border is identified by fitting the CCT-based regional traffic flow model to explore the stable traffic flow changing to the instable state, as to provide a theoretical basis for traffic flow manage and control in disaster-affected areas, and to prevent the traffic flow being caught into disorder and congestion. Based on VISSIM simulator data by building simulation scenarios with and without sudden fire disaster in a Sudoku traffic network, the catastrophe border is identified as 439pcu/lane/h, 529pcu/lane/h, 377pcu/lane/h at 5s, 10s, 15s data collection interval respectively. The corresponding relative precision, which compares to the method of Capacity Assessment Approach (CAA), is 89.1%, 92.7% and 76.5% respectively. It means that 10s data collection interval would be the suitable data collection interval in catastrophe border identification and regional traffic flow control in high-density area under sudden fire disaster.

A debris flows generation related to a poorly sorted mixture of soil, catchment topography and rainfall characteristic. Runoff of some depth on valley resulting from intensive rainfall can incur the sediments movement of beds or adjacent banks. The fluid flow in channel affected by rainfall parameters combinations, such as duration, intensity, cumulative rainfall, etc., is the key factor for debris movement. In this paper, the rainfall characteristics and occurrence conditions of debris flow in Xiongmao gully on July, 26th, 2016, have been explored, combined with field survey and indoor simulation experiment on the collected critical discharge parameters of debris movement. Further, debris distribution and the critical discharge characteristics have been analysed, by means of investigation on the catchment topography and occurrence cause of the debris flow, analysis of the critical discharge parameters on which the channel debris began to move, and K value clustering analysis method to characterize the rainfall pattern of the studied area, the discharge calculation of debris flow occurring in different rainfall patterns. The results have shown that, for the debris flow occurrence in Xiongmao gully, the debris initiation on the middle reaches of the gully provide the majority of solid particles for the disaster on July, 26th, 2016, and the upstream confluent provided catchment. Based on the relationship obtained from laboratory test, in which the calculated critical discharge was 43.8m3/s, less than the peak discharge (Qc =66.7m3/s), calculated by morphological method. In addition, it has been indicated that the dominated rainfall patterns of the studied area are first-quartile and second-quartile, that is, the rainfall is primarily at earlier or middle to preliminary stage of this time rainfall event. The critical discharge for the occurrence of debris flow on July, 26th was achieved 20a rainfall frequency, the larger runoff volume generated on shorten heavily rainfall. Based on individuality characteristics, such as distributed hydrological analysis, critical discharge and rainfall pattern of debris flow, the forewarning could be more efficient.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

Streptococcus agalactiae is a highly contagious Gram- positive bacterium that causes mastitis, has a high infectivity for mammary epithelial cells, and is challenging to treat. However, the molecular interactions between it and mammary epithelial cells remains poorly understood. This study analyzed differential gene expression in mammary epithelial cells with varying levels of S. agalactiae infection using UID- Dual Seq and bioinformatics tools. This study identified 211 differentially expressed mRNAs (DEmRNAs) and 452 differentially expressed lncRNAs (DElncRNAs) in host cells, primarily enriched in anti-inflammatory responses, immune responses, and cancer-related processes. Additionally, 854 pathogen differentially expressed mRNAs (pDEmRNAs) were identified, mainly enriched in protein metabolism, gene expression, and biosynthesis processes. Mammary epithelial cells activate pathways, such as the ERK1/2 pathway to produce, to produce reactive oxygen species (ROS) to eliminate bacteria. However, the bacteria disrupt the host's innate immune mechanisms by interfering with the alternative splicing processes of mammary epithelial cells. Specifically, the bacterial genes of tsf, prfB, and infC can interfere with lncRNAs targeting RUNX1 and BCL2L11 in mammary epithelial cells, affecting the alternative splicing of target genes and altering normal molecular regulation.

Solid-state LiDAR offers multiple advantages over mechanism mechanical LiDAR, including higher durability, improved coverage ratio, and lower prices. However, solid-state LiDARs typically possess a narrow field of view, making them less suitable for odometry and mapping systems, especially for mobile autonomous systems. To address this issue, we propose a novel rotating solid-state LiDAR system that incorporates a servo motor to continuously rotate the solid-state LiDAR, expanding the horizontal field of view to 360∘. Additionally, we propose a multi-sensor fusion odometry and mapping algorithm for our developed sensory system that integrates an IMU, wheel encoder, motor encoder and the LiDAR into an iterated Kalman filter to obtain a robust odometry estimation. Through comprehensive experiments, we demonstrate the effectiveness of our proposed approach in both outdoor open environments and narrow indoor environments.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

A thermal-oxidative aging test at 120°C was condutcted on Ethylene Propylene Diene Monomer (EPDM) vulcanizates of the semi-efficient vulcanization system. The effect of thermal-oxidative aging on EPDM vulcanizates was systematically studied by curing kinetics, aging coefficient, cross-linking density, macroscopic physical properties, contact angle, Fourier Transform Infrared Spectrometer (FTIR), Thermogravimetric analysis (TGA) and thermal decomposition kinetics. The results show that the content of hydroxyl and carbonyl groups as well as the carbonyl index increased with increasing aging time, indicating that EPDM vulcanizates are gradually oxidized and degraded. As a result, the EPDM vulcanized rubber chains were cross-linked, and its conformational transformation was limited and its flexibility was weakened. The thermogravimetric analysis demonstrates the thermal degradation of EPDM vulcanizates had competitive reactions of cross-linking and degradation, and the thermal decomposition curve can be divided into three stages, meanwhile the thermal stability of EPDM vulcanizates gradually decreases with the increase of aging time. The introduction of antioxidant in the system can promote the cross-linking speed and reduce the cross-linking density of EPDM vulcanizates, while inhibiting the surface thermal and oxygen aging reaction. This is attributed to the fact that the antioxidant can reduce the thermal degradation reaction level, but it is not conducive to the formation of a perfect crosslinking network structure and reduce the activation energy of thermal degradation of the main chain.

The reservoir water level fluctuation zones (RWLFZs) and the natural riparian zones (NRZs) are two riparian ecosystems with the dramatically opposite hydrological rhythms which notably influence the plant guilds. However, little is known about the discrepancy of functional traits and niche characteristics of plant guilds in the RWLFZ and NRZ under different flooding rhythms. Here the RWLFZs (degraded riparian zones) and NRZs were chosen in the Xiangxi River Basin of the Three Gorges Reservoir (TGR) to investigate the variation in plant community structure, the spatial patterns of diversity, key functional traits and niche characteristics of dominant plant populations. The results showed that a total of 78 vascular plant species were identified in the riparian zones of Xiangxi River Basin. Most of the dominant species were annual herbs in the two riparian ecosystems and the percentage of annual dominant species increased from 65.79% in the NRZ to 67.34% in the RWLFZ. Compared with the NRZ, the specific leaf area, vegetation coverage and the aboveground biomass in the RWLFZ significantly increased by 74%, 27% and 19.6% respectively, while the water use efficiency of the RWLFZ decreased by 59.6% and there was no significant difference in the net photosynthetic rate between them, which showed that annuals in the RWLFZ adopt the R adaptation strategy with fast-growing, short lifespan and quickly acquiring and investing resources by altering leaf morphology such as expanding leaf area. The Simpson dominance index of RWLFZ was significantly higher than that of NRZ. Thus counter-seasonally hydrological alterations had the significant effects on functional traits of dominant species in the RWFLZ. Moreover, the highly adaptable and widely distributed species with larger niche breadths and high important values usually had a higher niche overlap value in the RWLFZ than in the NRZ, which showed that the competition in the plant community after experiencing anti-seasonal flooding was much more intraspecific than interspecific and would facilitate the expansion of species niches. And the distribution of the plant community was mainly driven by elevation (flooding depth), flooding duration and TK in the WLFZs. Our findings imply that the species with large niche breadths and high important values should be prioritized in ecological restoration efforts in the newly formed hydro-fluctuation zone of the TGR.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Yaw misalignment can make a wake steer, which is an effective method to increase the power of wind farms, but it also increases the fatigue load of the turbines. In this paper, the method of combining yaw misalignment and pitch control (CYMP) is proposed to investigate the potential to mitigate wake interference, the wind velocity distribution and turbulence distribution in the wake, as well as the power and load changes of the wind turbine are studied, focusing on power in-crement and fatigue damage reduction. Although some studies have found that the method of CYMP are beneficial to increase power generation and reduce fatigue loads, there are no papers that have made a detailed analysis of the effects of wake turbulence, wind speed distribution, power, especially fatigue damage under this control. Simulation tool FAST.Farm is used to model and analyze wind farms, obtain the variation details of wake and provide simulation data for calculating power and fatigue load. The pitch control brings bias to the CYMP optimization results was neglected, the case studies show that the method of CYMP can reduce the fatigue load by 10.29% and increase the total power by 1.7% compared with only wake steering. The Model Predictive Control collaborative method based on CYMP is proposed, which can increase power by more than 2% and reduce thrust by more than 4% under 10m/s turbulent wind.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Machine learning has gained significant recognition within healthcare organizations as a potent technology for medical image analytics. Among various medical image modalities, Contrast-Enhanced CT (CECT) is widely utilized to acquire additional diagnostic information that can help to better visualize and evaluate certain structures or abnormalities in the human body. Accordingly, there is an increasing demand for machine learning systems for disease analytics using CECT. However, developing such systems presents two significant challenges: high technical complexity and high development effort. This paper presents a software platform that can effectively remedy these challenges. This platform embodies a unified software process for CECT-specific disease diagnosis including oncological diseases, cardiovascular diseases, and gastrointestinal diseases. It integrates multiple types of machine learning models into the disease diagnosis process, where the models can diagnose lesions, malignancies, tumors, medical features of tumors, temporal transitions with a contrast agent, and disease progress. The platform has been implemented in Python using Scikit-learn and TensorFlow libraries. To validate its applicability and reusability, a Hepatocellular Carcinoma (HCC) diagnosis system has been implemented.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

A simple design of an ultrathin six-band polarization-insensitive terahertz perfect metamaterial absorber (PMMA) composed of a metal cross-cave-patch resonator (CCPR) placed over a ground plane was proposed and investigated numerically. The numerical simulation results demonstrate that the average absorption peaks are up to 95% at six resonance frequencies with high quality-factors (>65). In addition, the absorption properties can be kept stability for both normal incident transverse magnetic (TM) and transverse electric (TE) waves. The physical mechanism behind the observed high level absorption is illustrated by the electric and power loss density distributions. The different absorption mainly originates from the higher order multipolar and multipolar plasmon resonance of the structure, which are sharp different to the most previous studies of the PMMAs. Furthermore, the resonance absorption of the PMMA can be tunable by varying the geometric parameters of the unit cell.

A simple design of an ultrathin six-band polarization-insensitive terahertz perfect metamaterial absorber (PMMA) composed of a metal cross-cave-patch resonator (CCPR) placed over a ground plane was proposed and investigated numerically. The numerical simulation results demonstrate that the average absorption peaks are up to 95% at six resonance frequencies with high quality-factors (>65). In addition, the absorption properties can be kept stability for both normal incident transverse magnetic (TM) and transverse electric (TE) waves. The physical mechanism behind the observed high level absorption is illustrated by the electric and power loss density distributions. The different absorption mainly originates from the higher order multipolar and multipolar plasmon resonance of the structure, which are sharp different to the most previous studies of the PMMAs. Furthermore, the resonance absorption of the PMMA can be tunable by varying the geometric parameters of the unit cell.