Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

To expand the application scope and increase the demand for non-crimp fabrics (NCFs) as a lightweight vehicle material, the delamination and thermal strain in NCF composites must be restricted. Accordingly, to simultaneously improve the interfacial bonding and thermal stability of the NCF composites, in this study the epoxy resin, in which SiO2 nanoparticles was modified by a silane coupling agent, were infused to the stacked NCFs and between the layers of NCFs through the vacuum-assisted resin infusion molding (VARIM) process.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

The purpose of this paper is to find the time optimal control to a target set for semilinear stochastic functional differential equations involving time delays or memories under general conditions on a target set and nonlinear terms even though the equations contain unbounded principal operators. Our research approach is construct a fundamental solution for corresponding linear systems and establish variations of constant formula of solutions for given stochastic equations. The existence result of time optimal controls for one point target set governed by the given semilinear stochastic equation is also established.

Background: Inflammasomes recognize cytosolic danger signals, including pathogens, and subsequently induce the secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β. Studying inflammasomes in the red fox (Vulpes vulpes) is crucial from a wildlife veterinary and public health perspective, as it can be used to help control and prevent the transmission of zoonotic pathogens. The understanding of how diversity in inflammasomes across species affects pathogen carriage in the red fox is still limited. Methods: We investigated the activation and intracellular mechanisms of three inflammasomes (NLRP3, AIM2, and NLRC4) in fox peripheral blood mononuclear cells (PBMCs), using established triggers and inhibitors derived from humans and mice. Results: Fox PBMCs exhibited normal activation and induction of IL-1β secretion in response to representative inflammasome triggers (ATP and nigericin for NLRP3, dsDNA for AIM2, flagellin for NLRC4). However, in inhibitor studies, MCC950, a selective NLRP3 inhibitor, suppressed IL-1β secretion mediated by the fox AIM2 and NLRC4 inflammasomes. Conclusions: These findings suggest that NLRP3 may have a common role in dsDNA- and flagellin-mediated inflammasome activation in the red fox. In conclusion, this fox inflammasome biology can be applied to the control of zoonotic infections and the treatment of inflammasome-mediated diseases in the red fox.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

An 8-month-old, 3.4 kg, castrated male Toy Poodle was referred for progressive tetraparesis and respiratory disorder without a history of trauma. Diagnostic imaging, including dynamic CT and MRI, revealed concurrent atlanto-occipital dislocation (AOD) and atlantoaxial instability (AAI) with spinal cord compression. This case was unique due to its congenital nature and the absence of trauma. The surgical intervention involved precise removal of the C1 vertebra's ventral articular facet, which was compressing on the spinal cord, attributed to its fixed and malaligned position within the atlantooccipital joint. Following facetectomy, the stabilization of the occipital bone to the C2 vertebra was achieved by screws, wire, and polymethyl methacrylate. Postoperative recovery was monitored with CT and radiographs, showing successful decompression and gradual improvement in gait, despite mild residual ataxia. The dog experienced postoperative complications with screw loosening at 114 days, which was managed successfully by extracting the problematic screws. Postoperatively, the dog showed a near-normal gait and experienced no pain through 21 months of monitoring. This case represents the first report of concurrent congenital AOD and AAI treated with ventral surgical approach, contributing new insights to the understanding and management of such complex cranio-cervical junction disorders in veterinary neurosurgery.

The ground consists of many layers of soil with different properties. The propagation speed and path of seismic waves are affected by different soil layers. It is necessary to understand that layered soil exhibits different dynamic behaviors and responses under the action of seismic waves. This study utilized weathered soil and silica sand as materials to create multi-layered soil conditions with varying degrees of compaction. By conducting 1 g shaking table test on multi-layered soil, the interaction and influence between different soil layers under different earthquake conditions were observed. The approach of numerical analysis aims to validate the experimental results and provide an in-depth understanding of the dynamic behaviors of multi-layered soil grounds during seismic events. The results of this study show that the amplification effect of seismic waves is related to the number of soil layers and the degree of compaction of the soil layers. This indicates that the multi-layered soil ground and the behavior of the soil layers play an important role in the propagation and impact of seismic waves, and this amplification effect is of great significance in actual seismic disaster risk assessment and design.

In this paper we consider Changhee polynomials of type two, which are motivated from the recent work of Kim and Kim. We investigate some symmetry identities for the Changhee polynomials of type two which are derived from the properties of symmtery for the fermionic p-adic integral on Zp.

This study is focused on the development of criteria for night and visual line of sight (VLOS) flights, especially in the context of beyond visual line of sight (BVLOS) drone applications. While BVLOS technology is advancing globally, regulatory restrictions and conservative legal regulations often prohibit these flights. The goal is to provide experimental guidelines for operational procedures in night and BVLOS flights. The study aims to establish empirical criteria for physical distances in night and VLOS flights, using a test team composed of a pilot, recorder, and observers. The observers are tasked with assessing the identification and recognition distances, which are crucial for safe drone operations. The criteria established are based on different variables such as aircraft size, altitude, and visual acuity. This research involves extensive flight tests at varying altitudes using different types of drones and observers with differing visual acuities (20/20, 20/13.3, and 20/10). The study also examines the effect of communication equipment limitations on recognition distance and the use of lighting devices to minimize abnormal conditions during nighttime flights. Overall, the study's findings aim to contribute to the safe and efficient planning of BVLOS and night drone flights, especially considering the ever-evolving technology and regulatory landscape in this field.

The aim of this study is to investigate transient dynamic flow characteristics of the fluid flow through 5-way electric coolant valve (PCCV : Penta-Control Coolant Valve). To achieve this goal, the present paper attempts the three-dimensional dynamic simulation of the fluid flow through the valve using a commercial CFD solver with moving mesh technique to consider flow inertia and dynamic flow in the opening and closing stages of the ball valve rotating motion. Firstly, dynamic flow characteristics and the thermal mixing inside the PCCV ball valve during the opening and closing stage was analyzed. It is found that the discrepancies between dynamic and steady state simulation is remarkable when fluxes with different levels of enthalpy and momentum flow into the PCCV leads to strong flow interference and flow inertia, while the discrepancies are relatively small at low rotation speed and weak flow interference. Then, the effect of dynamic flow characteristics of the valve on dynamic thermal mixing characteristics at two different ball valve rotational speeds and rotational directions were investigated. It was found that the dynamic flow and thermal mixing characteristics inside the PCCV are greatly affected by the rotation speed, rotation direction, and degree of flow interference between fluxes. It is helpful for the design of the better coolant control strategies and the improvement of the FCEV thermal management system.

This study empirically analyzes the effectiveness of resource optimization utilizing artificial intelligence (AI) within cloud computing environments. It compares systems that have been transitioned from a Monolithic structure to Microservices Architecture (MSA) with those adopting a simple Rehost strategy, to validate the operational efficiency of two systems whose resource efficiency has been enhanced compared to traditional legacy systems. The research is based on systems that determined resource efficiency post-cloud migration using APM tools. It points out the limitations of traditional heuristic operation methods in resource optimization, which lead to issues such as application performance degradation, resource over-allocation, and increased operational costs. This study aims to overcome the conventional resource optimization standards that depended on the average peak usage of CPU and memory infrastructure, by introducing AI-based optimization tools, and applying on-premise standards to cloud and container environments to achieve resource optimization. The paper emphasizes the importance of resource optimization through AI-based automation tools, exploring the possibilities of resolving real-world application performance issues in cloud environments, reducing unnecessary resource usage costs, and cutting down on labor risks and operational expenses. Through this, it presents strategic directions on how AI technology can offer financial and operational advantages in managing cloud resources.

Poly(acrylic acid) (PAAc) hydrogels possess good bioadhesive properties and allow enhanced penetration of drugs. In addition, it is possible to localize the absorption site of the drug in the hydrogel and increase the drug residence time. As opposed to other cross-linking processes radiation-induced polymer cross-linking can be easily and rapidly carried out without the use of cross-linking agents and other chemical additives. In this study, we fabricated metronidazole (MD) containing PAAc hydrogel (MD/PAAc) with different MD contents (0.1, 0.25, 0.5 wt%) using varying radiation doses (25, 50, 75 kGy) by gamma-irradiation. The physical and thermal properties were determined by gel content analysis, swelling ratio measurements, compressive strength measurements, differential scanning calorimetery, and thermogravimetric analysis. The properties of the hydrogel degraded due to the crystalline nature of MD. The properties of the hydrogel degraded due to the crystalline nature of MD. Cumulative release observed after 50 min in the case of 0.5MD/PAAc and 0.1MD/PAAc was 50% and 10%, respectively. Our findings suggest that MD/PAAc could be a suitable drug delivery carrier for use with radiation-based techniques.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

Optimum postharvest storage conditions increase the shelf life and postharvest quality of horticultural crops. The effects of forced-air precooling (FAP) and modified atmosphere packaging (MAP) on shelf life, physicochemical quality, and health-promoting properties of bell pepper (Capsicum annuum L. cv. Nagano) harvested at 90% and 50% coloring stages in May and July respectively, stored at 11℃, 95% relative humidity were assessed. Fruits were treated with FAP + 30 μm polyethylene liner (FOLO), FAP (FOLX), 30 μm polyethylene liner (FXLO), and control (FXLX). The quality attributes, viz. weight loss, firmness, color, SSC, soluble sugars, TPC, TFC, DPPH, and ABTS were evaluated. FOLO maintained sensory quality (weight loss, firmness, and color), physicochemical (soluble solids content and soluble sugars), and health-promoting properties compared to other treatments during storage. The investigated parameters differed significantly (p < 0.05) among treatments except soluble sugars. The 50% coloring fruits had a huge variation between treatments than 90% coloring. The results revealed more TPC and antioxidant capacity in 50% than in 90% coloring fruits. The study highlights the need to consider the ideal fruit coloring stage at harvest under the effect of FAP and MAP treatments in preserving bell pepper's postharvest quality and shelf life.

Large epidemiological studies show U-shaped relationships between high-density lipoprotein cholesterol (HDL-C) levels and all-cause mortality in individuals without atherosclerotic cardiovascular diseases (ASCVD). Association in those with ASCVD by sex is unclear. We examined the association between HDL-C levels and 10-year all-cause mortality in subjects (≥40 years of age) with ASCVD using the 2010 National Health Insurance Service and the National Death Registry of Korea. We categorized HDL-C levels into three groups (low: <40 mg/dL for males, <50 mg/dL for females; high: 40-90 mg/dL for males, 50-90 mg/dL for females; extremely high: >90 mg/dL) and 10 mg/dL intervals. We conducted a sex-stratified and adjusted Cox proportional hazards analysis. Out of 1,711,548 individuals (54% female, mean age 61.4 years), 10-year mortality was observed in 218,252 (12.8%). Males had a higher mortality rate than females (16.2% vs 9.8%; P<0.001). When adjusting for age, body mass index, LDL-cholesterol, triglycerides, hypertension, diabetes, smoking, and alcohol consumption, the low and extremely high HDL-C groups had significantly higher hazard ratios for 10-year mortality compared to the high HDL-C group in males [1.183 (1.166-1.199), 1.359 (1.288-1.434)] and in females [1.153 (1.138-1.169), 1.095 (1.029-1.167)]. The frequency distribution bars for the 10-year mortality rate showed sex-specific nadirs of 50-59 mg/dL in males and 70-79 mg/dL in females. In this ASCVD cohort, the extremely high HDL-C (>90 mg/dL) group had 35.9% and 9.5% higher 10-year mortality risk than the high HDL-C group for males and females, respectively. There was a slightly U-shaped relationship between baseline HDL-C levels and 10-year mortality rate, with earlier inflection in males than in females.

The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

Stereotactic radiosurgery (SRS) is considered the initial treatment for lung cancer patients with small-sized and limited number of brain metastases. The objective of this study was to assess clinical outcomes of SRS treatment using CyberKnife (CK) for recursive partitioning analysis (RPA) class II/III patients with one to three brain metastases from lung cancer and identify which patients in the high RPA class could benefit from SRS. A total of 48 lung cancer patients who received CK-based SRS for their metastatic brain lesions from 2010 to 2017 were retrospectively analyzed. Radiographic response was evaluated during follow-up period. Overall survival (OS) and intracranial progression-free survival (IPFS) were calculated and prognostic variables associated with OS and IPFS were evaluated. Median follow-up time was 6.6 months. Local control rates at 6 months and 1-year following SRS were 98% and 92%, respectively. The median OS of all patients was 8 months. One-year and 2-year OS rates were 40.8% and 20.9%, respectively. In multivariate analysis, uncontrolled primary disease (p = 0.008) and ECOG performance status of 2 or 3 (p = 0.001) were independent prognostic factors for inferior OS. These two factors were also significantly associated with inferior IPFS. In subgroup analysis according to RPA class, primary disease status was the only prognostic factor, showing statistically significant OS differences in both RPA class II and III (controlled vs. uncontrolled: 41.1 vs. 12.3 months in RPA class II, p = 0.031; 26.9 vs. 4.1 months in RPA class III, p = 0.011). Our results indicated that SRS could be an effective treatment option for RPA class II/III patients with brain metastases from lung cancer in the modern treatment era. SRS might be particularly considered for patients with controlled primary disease.

Skin photoaging is caused by prolonged exposure to ultraviolet (UV) radiation from sunlight. UV-exposed skin appears rough, thick, dry, loose, and shows deep wrinkles, and thickening. Our previous research showed that a Phaseolus angularis seed extract (PASE) effectively inhibits photoaging through UVB protection in HaCaT cells. However, its efficacy has not been evaluated in clinical trials so far. In this single-centered, randomized, double-blind study, we investigated the anti-aging effect of PASE in eye wrinkle areas. To these 21 healthy adult women aged 30 to 65, a PASE cream was applied to the right eye wrinkle area and a placebo to the left eye wrinkle area twice a day (morning and evening) for 12 weeks. The change in thick, deep crease wrinkles around the eyes was confirmed by visual evaluation, skin measurements, and a questionnaire. As a result, the R1 (surface roughness), R2 (maximum roughness), R3 (average roughness), R4 (smoothness depth), and R5 (arithmetic mean roughness) values in the group using the PASE cream all decreased. Particularly, R1, R4, and R5 significantly decreased by 18.1%, 18.6%, and 25.0%. In addition, no participants reported side effects. Our study showed that PASE led to clinically significant levels of wrinkle improvement. In conclusion, as PASE is a natural food, safe, and with few side effects, it can be a good resource for natural anti-wrinkle cosmetics in the future.

In the present era, infertility is one of the major issues which restricts many couples to have their own kids. Infertility is the inability to achieve a clinical pregnancy after regular unprotected sexual intercourse for the period of one year or more. Various factors including defective male or female germ cell development, unhealthy and improper lifestyles, diseases like cancer and associated chemo-or-radiation therapies, congenital disorders etc. may be responsible for infertility. Therefore, it is highly important to understand the basic concepts of germ cell development including primordial germ cell (PGC) formation, specification, migration, entry to genital ridges and their molecular mechanisms, activated pathways, paracrine and autocrine signaling, along with possible alteration which can hamper germ cell development and can cause adversities like cancer progression and infertility. Knowing all these aspects in a proper way can be very much helpful in improving our understanding about gametogenesis and finding possible ways to cure related disorders. Here in this review, various aspects of gametogenesis especially female gametes and relevant factors causing functional impairment have been thoroughly discussed.

Canine lymphoma (CL) is one of the most common malignant tumors in dogs. The cause of CL remains unclear. Genetic mutations that have been suggested as possible causes of CL are not fully understood. Whole-exome sequencing (WES) is a time- and cost-effective method for detecting genetic variants targeting only protein-coding regions (exons) that are part of the entire genome region. A total of eight patients with B-cell lymphomas were recruited, and WES analysis was performed on whole blood and lymph node aspirate samples from each patient. A total of 17 somatic variants (GOLIM4, ITM2B, STN1, UNC79, PLEKHG4, BRF1, ENSCAFG00845007156, SEMA6B, DSC1, TNFAIP1, MYLK3, WAPL, ADORA2B, LOXHD1, GP6, AZIN1, and NCSTN) with moderate to high impact were identified by WES analysis. Through a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of 17 genes with somatic mutations, a total of 16 pathways were identified. Overall, the somatic mutations identified in this study suggest novel candidate mutations for CL, and further studies are needed to confirm the role of these mutations.

We reveal the significance of plasmonic nanoparticle’s (NP) shape and its surface morphology en route to an efficient self-assembled plasmonic nanoparticle cluster. A simplified model is simulated in the form of free-space dimer and trimer nanostructures (NPs in shape of sphere, cube, and disk). A ~ 200 % to ~ 125% raise in near field strength (gap mode enhancement) is observed for spherical NPs in comparison with cubical NPs (from 2 nm to 8 nm gap sizes). Full-width three-quarter maximum reveals better broad-spectral optical performance in a range of ~ 100 nm (dimer) and ~ 170 nm (trimer) from spherical NPs as compared to a cube (~ 60 nm for dimer and trimer). These excellent properties for sphere-based nanostructures are merited from its dipole mode characteristics.

Preproenkephalin (PPE) is a precursor molecule for multiple endogenous opioid peptides Leu-enkephalin (ENK) and Met-ENK, which are involved in a wide variety of modulatory functions in the nervous system. Despite the functional importance of ENK in the brain, the effect of brain-derived factor(s) on PPE expression is unknown. We report the dual effect of neural epidermal growth factor (EGF)-like-like 2 (NELL2) on PPE gene expression. In cultured NIH3T3 cells, transfection of NELL2 expression vectors induced an inhibition of PPE transcription intracellularly, in parallel with downregulation of protein kinase C signaling pathways and extracellular signal-regulated kinase. Interestingly, these phenomena were reversed when synthetic NELL2 was administered extracellularly. The in vivo disruption of NELL2 synthesis resulted in an increase in PPE mRNA level in the rat brain, suggesting that the inhibitory action of intracellular NELL2 predominates the activation effect of extracellular NELL2 on PPE gene expression in the brain. Biochemical and molecular studies with mutant NELL2 structures further demonstrated the critical role of EGF-like repeat domains in NELL2 for regulation of PPE transcription. These are the first results to reveal the spatio-specific role of NELL2 in the homeostatic regulation of PPE gene expression.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Although numerous citrus varieties have recently been developed to enhance their quality, information on their quality characteristics is limited. We assessed the quality characteristics of Yellowball, a novel citrus variety, by evaluating its appearance, storability, sensory properties, functionality, and metabolite profiles and comparing these characteristics with those of its parent varieties: Haruka and Kiyomi. The metabolite profiles between the citrus varieties differed significantly, resulting in distinct physicochemical and functional qualities. The storability of Yellowball was significantly increased compared with that of its parent varieties owing to its strong antifungal activity and unique peel morphology, including the stoma and albedo layers. While we did not investigate the volatile compounds, overall functional activities, and detailed characteristics of each metabolite, our data provide valuable insights into the relationship between citrus metabolites, peel morphology, physicochemical properties, and storability and demonstrate the potential of Yellowball as a promising variety in the citrus industry.

Glucagon-like peptide-1 (GLP-1) is an incretin hormone that acts on the pancreas to increase insulin and decrease glucagon secretion. Albuminuria is the pivotal marker for diabetic nephropathy, which is the leading microvascular complication of diabetes mellitus. Most of the previous studies mainly focused on the clinical trials of the therapeutic renal protective effect after administration of GLP-1 receptor agonists (GLP-1 RAs), not prior to administration. Therefore, this study aimed to investigate the association between fasting plasma GLP-1 levels and albuminuria before GLP-1 RA administration. A cross-sectional study was designed to evaluate the association between fasting plasma GLP-1 levels and albuminuria in patients with type 2 diabetes mellitus (T2DM). A total of 68 T2DM participants were analyzed from the data at Wonkwang University Hospital in Iksan, Korea. Logistic regression analysis was performed to evaluate the odds ratio (OR) and 95% confidence interval (CI) of the incidence of albuminuria between the GLP-1 low group (Group L) and the high group (Group H). The OR (95% CI) for the incidence of albuminuria comparing the Group L with the Group H of fasting plasma GLP-1 levels was 3.410 (1.160-10.023), p = 0.026 after adjustment for age, gender, fasting plasma glucose, HbA1c, C-peptide, the use of ACE inhibitors or ARBs, SGLT-2 inhibitors, and DPP-4 inhibitors. As a continuous variable, the OR (95% CI) for the incidence of albuminuria associated with the reduction of each 1 pmol/L in fasting plasma GLP-1 levels was 1.673 (1.173-1.870), p = 0.018, after full adjustment. This study showed the negative association between fasting plasma GLP-1 levels and the incidence of albuminuria in Korean patients with T2DM, before GLP-1 RA administration. This result suggests that endogenous GLP-1 may play a role in attenuating albuminuria.

Supplementary lighting is commonly used in high-quality seedling production. In this study, grafted tomato seedlings were grown for 10 days in a glasshouse with a 16-hour daily supplementary lighting at 100 μmol·m⁻²·s⁻¹ PPFD from either high pressure sodium (HPS), metal halide (MH), far-red (FR), white LEDs (W), or mixed LEDs (W₁R₂B₁) to determine which light sources improve the seedling quality. The control did not have any supplementary light. The physiological parameters and the expression of genes related to photosynthesis were analyzed. The results show that the root length, biomass, number of leaves, chlorophyll (SPAD), dry weight to height ratio (WHR) of the scion, and specific leaf weight (SLW) were the greatest for grafted seedlings grown in W₁R₂B₁. The level of root ball formation was the greatest for seedlings grown in W₁R₂B₁, followed by those grown in W, HPS, and MH. Seedlings grown in FR did not fare very well, as they were very thin and weak. Moreover, the expression of two photosynthetic genes (PsaA and PsbA) was significantly increased by W₁R₂B₁ and W, which suggests that the plastid or nuclear genes might be regulated. The overall results suggest that W₁R₂B₁ was the most suitable light source to enhance the quality of grafted tomato seedlings. The results of this study could be used as a reference for seedling production in glasshouses, and provide new insights in the research of lights affecting the development of plants.

In patients with unilateral tinnitus with normal hearing, several studies have compared the ipsilateral and contralateral ears; however, few studies have investigated its relationship with the duration of tinnitus. We compared the auditory brainstem response and otoacoustic emission parameters between ipsilateral and contralateral ears in adults with unilateral tinnitus and normal hearing. This retrospective review included 84 patients with unilateral tinnitus and normal hearing who underwent auditory brainstem response and otoacoustic emission; they were categorized according to the duration of tinnitus. The latencies and amplitudes of waves I, III, and V, and V/I ratio of both ears in auditory brainstem response, and the results of distortion-product otoacoustic emission and transient evoked otoacoustic emission were examined. The auditory brainstem response parameters, distortion-product otoacoustic emission parameters, and transient evoked otoacoustic emission parameters between the ipsilateral and contralateral ears along the duration of tinnitus were analyzed. Moreover, the failure rates of both distortion-product otoacoustic emission and transient evoked otoacoustic emission between the ears along with the duration and the effects of the variables on the amplitude and latency of each wave were examined. Although there was little significant difference between the ipsilateral and contralateral ears, laterality seemed to have an effect on wave I latency in the multiple linear regression analysis. The distortion-product otoacoustic emission failure rate of the ipsilateral ear was higher than that of the contralateral ear in all patients. However, there was no remarkable difference between the ears in the distortion-product otoacoustic emission and transient evoked otoacoustic emission parameters throughout the duration. We found that outer hair cells and the distal portion of the cochlear nerve are possible pathologic lesions in tinnitus with normal hearing and cochlear synaptopathy could be suspected. Further studies, including those on inner hair cells and higher central cortex, are needed.

Hydrogels incorporated with hydrophobic motifs have received considerable attention to recapitulate the cellular microenvironments, specifically for the bio-mineralization of a 3D matrix. Introduction of hydrophobic motifs into a hydrogel often results in irregular arrangement of the motifs, and further phase separation of hydrophobic domains, but limited efforts have been made to resolve this challenge in the hydrophobically-modified hydrogel. Therefore, this study presents an advanced integrative strategy to incorporate hydrophobic domains regularly in a hydrogel by self-assembling of polymer cross-linkers, building blocks of a hydrogel. Self-assemblies between polymer cross-linkers were examined as micro-domains to incorporate hydrophobic motifs in a hydrogel. The self-assembled structures in a pre-gelled solution were confirmed with the fluorescence analysis and the hydrophobicity of a hydrogel could be tuned by incorporating the motifs in a controlled manner. Overall, the results of this study would greatly serve to tuning performance of a wide array of hydrophobically-modified hydrogels in drug delivery, cell therapies and tissue engineering.

This study presents a comprehensive ecological evaluation of avian species based on 5,322 photographs obtained through camera-trap sampling. We identified 1,427 independent bird sightings, encompassing 26 families and 49 species. The study focused on temporal activity patterns, nesting behaviors, habitat preferences, and the overlap coefficient of activity patterns among 22 species of Passeriformes. Two species exhibited predominant morning activity, while five species were active in the afternoon, and 15 exhibited cathemeral activity (activity throughout the day). A cross-analysis revealed varying degrees of overlap in the activity patterns of pairs of species with similar behavioral ecology. Our findings indicate that despite exhibiting similar ecological behavior, these species display unique activity patterns, likely influenced by factors such as resource availability, competition avoidance, and thermoregulation strategies. The results highlight the richness and complexity of avian temporal niches and emphasize the need for further research into their correlation with environmental factors. This study contributes to a deeper understanding of niche separation within Passeriformes and expands our knowledge of avian behavioral ecology.

Field cricket (Gryllus bimaculatus) is newly emerged as an edible insect in several countries. Anti-inflammatory effect of glycosaminoglycan derived this cricket was not fully investigated on chronic disease animal model such as diabetic mouse. For potential therapeutic agents, anti-diabetic activities of field cricket glycosaminoglycan (GbG) was evaluated in diabetic mice based on their abilities to reduce glucose, ALT, AST, LDL-cholesterol, and BUN levels, compared with dung beetle (Catharsius molossus) glycosaminoglycan (CaG) as a positive control glycosaminoglycan. Db mice were orally administered for one month according to their groups: Db Hetero (normal), Db Homo (type-2 diabetic), CaG (5 mg/kg), GbG (5 mg/kg), and metformin (10 mg/kg). Blood glucose level was decreased after 1^st week treatment with GbG. It also inhibited LDL-cholesterol and alkaline phosphatase levels. Regarding oxidative damage of diabetic state, levels of hepatocellular biomarkers levels and protein carbonyl content were reduced in db mice treated with GbG. Especially anti-oxidative activities of catalase, superoxide dismutase, and glutathione peroxidase were significantly increased in GbG treated group compared to those in the control. GbG was composed of heparin disaccharides and main N-glycan was identified as Hex₉GlcNAc₂ (m/z 1905.7) of with neutral mono-sugar mainly comprising of hexose, L (+) rhamnose by mass spectroscopy. These results from sero-biochemical, hepatocellular anti-oxidant assay in db mice data suggest cricket (G. bimaculatus) glycosaminoglycan might play a role in its anti-diabetic action.

Commiphora molmol myrrh resin extracts, which have different physical properties such as polarity and dielectric constant, were prepared by immersion in extraction solvents (hot water, DMSO, hexane, ethanol, and methanol). Methanolic myrrh resin extracts showed broad antibacterial activity against isolated airborne bacteria. Furanoeudesma-1,3-diene and curzerene, as the main terpenoids in the methanolic myrrh resin extract, were analyzed using GC-MS, and the methanolic myrrh resin extracts were found to have antiviral activity (81.2% viral RNA inhibition) against H1N1 influenza virus. Biochars (wood powder-and rice husk-derived) coated with myrrh resin extracts also showed antiviral activity (22.6% and 24.3% viral RNA inhibition), due to the adsorption of terpenoids onto biochar. Myrrh resin extract using methanol as the extraction solvent is a promising agent with antibacterial and antiviral efficacy, and it can be utilized as a novel material via adsorption onto biochar for air filtration processes, cosmetics, fertilizers, drug delivery, and corrosion inhibition.

In order to reduce the large damage caused by train derailment, protective facilities of various shapes and conditions can be installed on railroad tracks. These protective facilities are referred to as derailment containment provisions (DCPs) and three different types are used worldwide. However, there are no clear standards for DCPs design such as installation location, size, and design load, and performance verification of DCPs installed in the actual railway field is not sufficiently performed. In this paper, the functionality of DCPs is analyzed through the full-scale derailment test. In order to propose a method for estimating the collision load acting on the DCP type I after derailment, the experimental results and simulation results are compared. The function of DCP type I according to the change of the vehicle's center of gravity is identified through comparative analysis of the post derailment behavior.

This paper proposes a metaphysical framework for distinguishing between human and machine intelligence. By drawing an analogy from Kant’s incongruent counterparts, it posits two identical deterministic worlds -- one comprising a human agent and the other comprising a machine agent. These agents exhibit different types of information processing mechanisms despite their apparent sameness in a causal sense. By postulating the distinctiveness of human over machine intelligence, this paper resolves what it refers to as “the vantage point problem” – namely, how to legitimize a determinist’s assertion of determinism by placing the determinist within the universe.

The objective of this study was to evaluate the effects of dietary supplementation with bacteriophage and β-mannanase on health and growth performance in calves. Thirty-six pre-weaning male Holstein calves were randomly allocated to one of four dietary treatments: no supplementation, 0.1% β-mannanase, 0.1% bacteriophage, and both 0.1% bacteriophage and β-mannanase supplementation in a starter. The experiment lasted from 2 weeks before weaning to 8 weeks after weaning. Twenty-two calves survived to the end of the experiment. No interaction was observed between the two methods of supplementation. A 1-kg increase in initial BW resulted in a 1.41-fold increase in the odds ratio of survival (p < 0.01). The bacteriophage supplementation tended to increase the odds ratio of survival (p = 0.09). The number of Escherichia coli in feces significantly decreased one week after weaning. β-mannanase supplementation increased the concentrates intake (p < 0.01) and tended to increase the final BW (p = 0.08). Analysis of repeated measures indicated β-mannanase supplementation increased weekly body weight gain (p = 0.018). We conclude that bacteriophage supplementation may have a positive effect on calf survival rate, while β-mannanase supplementation may increase the growth rate and intake of a starter in calves.

Background and Objectives: The ingestion of anhydrous calcium chloride (CaCl2) causes direct injury to the gastrointestinal wall via a thermal burn. Severe CaCl2 intoxication can induce a hypercalcemic crisis, presenting with arrhythmia, acute pancreatitis, and acute kidney injury. This case report details a patient with hematemesis and hypercalcemia following the ingestion of a commercial desiccant. We aimed to report the progression of the case and focused on the elec-trocardiographic manifestations. Case presentation: A 39-year-old female presented at a regional emergency center with blood in her vomit after the ingestion of a commercial desiccant. Bloody emesis was the initial symptom, and various electrolyte imbalances developed during admission. Electrocardiogram (ECG) changes occurred early after hospitalization and disappeared before the electrolyte levels normalized. The patient was maintained in an NPO state throughout her hospital stay. Bloody emesis and abdominal pain resolved rather early, despite her minimal mention of symptoms, possibly due to her suspected negative psychiatric symptoms. Conclusions: The rise in suicidal attempts has led to an increase in unusual intoxication cases. Previous reports on CaCl2 ingestion primarily considered the gastrointestinal injury. In this case, we observed the dynamic and prolonged multiple electrolyte imbalances along with the early-phase ECG changes, all of which responded well to supportive care. This report adds to the understanding of the diverse manifestations and management of CaCl2 intoxication.

Osteoporosis is an abnormal bone remodeling condition characterized by decreased bone density, which leads to high risks of broken bones. Previous studies have demonstrated that Lycii Radicis Cortex (LRC) extract inhibits bone loss in ovariectomized (OVX) mice by enhancing the osteoblast differentiation. A bioactive compound, Kukoamine B (KB), was identified from a fractionation of LRC extract as a candidate component responsible for an anti-osteoporotic effect. This study investigated the anti-osteoporotic effects of KB using in vitro and in vivo osteoporosis models. KB treatment significantly increased the osteoblastic differentiation and mineralized nodule formation of osteoblastic MC3T3-E1 cells, while it significantly decreased the osteoclast differentiation of primary-cultured monocytes derived from mouse bone marrow. The effects of KB on osteoblastic and osteoclastic differentiations under more physiological conditions were also examined. In the co-culture of MC3T3-E1 cells and monocytes, KB promoted osteoblast differentiation but did not affect osteoclast differentiation. For the in vivo experiments, KB significantly inhibited OVX-induced bone mineral density loss and restored the impaired bone structural properties in osteoporosis model mice. These results suggest that KB may be a potential therapeutic candidate for the treatment of osteoporosis.

Non-alcoholic steatohepatitis (NASH) is diagnosed by the occurrence of fat buildup, inflammation, and fibrotic changes within the liver. NASH has the capacity to proceed to the advancement of decompensated cirrhosis and carcinoma by inflammation and oxidative stress. Although Agrimonia pilosa has traditionally been used medicinal purposes, its effects on the liver remains incompletely elucidated. In this research, we assessed the therapeutic outcomes of Agrimonia pilosa extract (APE) on free fatty acid (FFA)-treated HepG2 cellular hepatic steatosis and in a choline-deficient, L-amino acid-defined, high-fat diet with 0.1% methionine (CDAHFD)-induced NASH mouse model. In FFA-treated cells, APE inhibited intracellular lipid accumulation, and regulated the mRNA and protein expressions of modulators of fatty acid (FA) synthesis as well as FA oxidation proteins, through down-regulation of the AMP-activated protein kinase/sirtuin 1 signaling pathway. In the CDAHFD-induced NASH mouse model, APE significantly enhanced liver histology and serum levels of liver damage. APE also significantly attenuated hepatic expression of mRNA and proteins related to FA synthesis, inflammation, and fibrosis. Furthermore, APE mitigated the expression levels of oxidative stress and endoplasmic reticulum stress. Overall, these discoveries indicate that Agrimonia pilosa has the potential to treat NASH by regulating hepatic lipid metabolism, alleviating inflammation, and mitigating oxidative stress.

Regulated autophagy is involved in the repair of renal ischemia-reperfusion injury (IRI). ω3-Polyunsaturated fatty acids (ω3-PUFAs) show protective effects against various renal injuries. It was recently reported that ω3-PUFAs regulate autophagy. We assessed whether ω3-PUFAs attenuated IR-induced acute kidney injury (AKI) and evaluated associated mechanisms. C57Bl/6 background fat-1 mice and wild-type mice (wt) were divided into four groups: wt sham (n = 10), fat-1 sham (n = 10), wt IRI (reperfusion 35 min after clamping both the renal artery and vein; n = 15), and fat-1 IRI (n = 15). Kidneys and blood were harvested 24 h after IRI. Renal histological and molecular data were collected. The kidneys of fat-1 mice showed better renal cell survival, renal function, and pathological damage than those of wt mice after IRI. In addition, fat-1 mice showed less oxidative stress and autophagy impairment; greater amounts of LC3, Beclin-1, and Atg7; lower amounts of p62; and higher levels of renal cathepsin D and ATP6E than wt kidneys. They also showed more AMPK activation, which resulted in the inhibition of phosphorylation of the mammalian target of rapamycin (mTOR). Collectively, ω3-PUFAs in fat-1 mice contributed to AMPK mediated autophagy activation, leading to a renoprotective response.

A fern, Polypodium aureum, possesses a specialized spore-releasing mechanism like a catapult induced by quick expansion of vaporized bubbles. This study introduces lipid-coated perfluorocarbon droplets to enable repeatable vaporization-condensation cycles, inspired by the repeatable vaporization of Polypodium aureum. Lipid-perfluorocarbon droplets have been considered not to exhibit repeatable oscillations due to bubble collapse by low surface tension of lipid layers. However, a single lipid-dodecafluoropentane droplet with a diameter of 9.17 µm shows expansion-contraction oscillations over 4,000 cycles by changing lipid composition and applying low power of 1.7 MHz ultrasound to induce partial vaporization of droplets. The optimal combinations of shell composition, droplet fabrication, and acoustic conditions can minimize damage on shell structure and quick recovery of damaged shell layers. The highly-expanding oscillatory microbubbles provide a new direction for fuel-free micro or nanobots as well as biomedical applications of contrast agents and drug delivery.

The dynamic and surface manipulation of the M13 bacteriophage meeting application demands enable a pathway to design efficient applications with high selectivity and responsivity rate. Herein, we report the role of the M13 bacteriophage thin film layer deposited on an optical nanostructure involving gold nanoparticles/SiO2/Si and its influence on optical and geometrical properties. The thickness of the M13 phage layer was either controlled by varying the concentration or humidity exposure levels, and optical studies were conducted. We designed a standard and dynamic model based upon three-dimensional finite-difference time-domain (3D FDTD) simulations distinguishing the necessity of each model under variable conditions. As seen from the experiments, the origin of respective peak wavelength positions is addressed in detail with the help of simulations. The importance of the dynamic model was noted when humidity-based experiments were conducted. Inexpensive, multi-wavelength optical characteristics from a single structure, reproducibility, and reversible properties are significant advantages of involving M13 bacteriophage. We believe this work will provide fundamental insight into understanding and interpreting the geometrical and optical properties of the nanostructures involving M13 bacteriophage.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Arthrospira platensis is the widely available source of spirulina and contains distinctive natural pigments including carotenoids and C-phycocyanin (C-PC). In this study, the major carotenoid and C-PC contents were determined in seven commercially available spirulina powder products and laboratory-prepared A. platensis trichomes (AP-1) by an LC-DAD method and a UV-Visible spectrometry, respectively. The correlation of these two pigment content levels with Hunter color coordinates and antioxidant activity was also evaluated. The L* value failed to show a significant correlation with pigment content, but a positive correlation was observed between a* values and the contents of total carotenoid and C-PC. As b* values decreased, the total carotenoid and C-PC contents increased. AP-1 exhibited the highest content of total carotenoids, chlorophyll a and C-PC, and antioxidant activities among the samples. This observation could be related to degradation of these pigments during the mass production process. The carotenoid profiles suggested that the commercial spirulina powders originated from two different sources, A. platensis and A. maxima. Total carotenoid and C-PC content exhibited positive significant correlations with antioxidant activities measured by DPPH and ABTS assays. These results provide a strong scientific foundation for the establishment of standards for the commercial distribution of quality spirulina products.

Highly photoluminescent C-Dots are prepared by hydrothermal reaction of citric acid and piperazine as dual reason in both hydrolysis and surface passivation agent along with the N-doping agent. The resulting C-Dots without external passivation showed PL enhancement by electron transfer from C-Dots-donor to piperazine-acceptor with the maximum emission yields of more than 84%. After mixing the prepared C-Dots with the mixture of EtOH and acetone (1:1 vol %), a novel washing process was performed by centrifugation to remove the precursors and by-products. The resulting C-Dots showed much better stability than dialysis. For evaluating the possible application of the C-Dots as a fluorescent biological probe which possess the wide dosing window and multicolor properties. The C-Dots were localized in perinuclear vacuole-like structures with granular pattern in cytoplasm sparing the nucleus. No signs of any morphological deterioration like nuclear shrinkage were observed.

Background: Oenothera biennis (evening primrose) produces bioactive substances with a diverse range of pharmacological functions. However, it is currently unknown whether extract prepared from the aerial parts of O. biennis (APOB) can protect the skin against oxidative stress. To investigate the protective effects of APOB against oxidative stress-induced damage in human skin keratinocytes (HaCaT) and elucidate the underlying mechanisms. Methods: We pretreated HaCaT cells with various concentrations of APOB or the antioxidant N-acetyl-L-cysteine before applying H2O2. We then compared the cell viability, intracellular reactive oxygen species (ROS) production, and DNA and mitochondrial damage between pretreated and untreated control cells using a range of assays, flow cytometry, and Western blot analysis and also examined the reducing power and DPPH free radical-scavenging activity of APOB. Results: APOB pretreatment significantly increased cell viability, effectively attenuated H2O2-induced comet tail formation, and inhibited H2O2-induced phosphorylation of the histone γH2AX, as well as the number of apoptotic bodies and Annexin V-positive cells. APOB was found to have a high reducing power and DPPH radical-scavenging activity and also exhibited scavenging activity against intracellular ROS accumulation and restored the loss of mitochondrial membrane potential caused by H2O2. APOB pretreatment almost totally reversed the enhanced cleavage of caspase-3, the degradation of poly (ADP-ribose)-polymerase (PARP), DNA fragmentation that usually occurs in the presence of H2O2 and increased the levels of heme oxygenase-1 (HO-1), a potent antioxidant enzyme that is associated with the induction of nuclear factor-erythroid 2-related factor 2 (Nrf2). Conclusions: APOB can protect HaCaT cells from H2O2-induced DNA damage and cell death by blocking cellular damage related to oxidative stress via a mechanism that affects ROS elimination and by activating the Nrf2/HO-1 signaling pathway.

In the field of visualization, understanding users’ analytical process is important to determine the effectiveness of a designed visualization application. To understand the users’ analytical process, numerous studies have been performed to capture and analyze user interactions. Although many studies have emphasized the importance of analyzing user interactions to understand users’ analytical reasoning processes, few have successfully linked these interactions to users’ reasoning processes. This paper introduces an approach that bridges this gap by correlating semantic user interactions with analysis decisions through an interactive wire transaction analysis system and a visual state transition matrix. With the designed analysis system, interactive analysis can be performed to evaluate financial fraud in wire transactions. It also allows the mapping of captured user interactions and analytical decisions back onto the visualization, revealing users’ distinct results. The visual state transition matrix further aids to help understanding users’ analytical flows, revealing their decision-making processes. Classification machine learning algorithms are applied to assess the effectiveness of our approach in understanding analysts’ strategies by connecting them to their decisions. From the study, we observed an average of 72% accuracy in clearly classifying the semantic user interactions. For classifying individual decisions, we observed an average of 70% classification accuracy. This emphasizes the importance of capturing semantic user interactions to understand users’ analytical processes. Overall, it is determined that the proposed approach not only enhances the understanding of analytical behaviors but also offers a robust approach for evaluating user interactions in visualization tools.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Citrus peel has been used in Asian traditional medicine for the treatment of cough, asthma, and bronchial disorders. However, the anti-inflammatory effect of quercetogetin (QUE), a polymethoxylated flavone isolated from the peel of citrus unshui is poorly understood. We investigated the anti-inflammatory effect and the molecular mechanisms of QUE in lipopolysaccharide (LPS)-induced RAW264.7 cells. QUE inhibited the production of NO and prostaglandin E2 by suppressing the LPS-induced expression of inducible nitric oxide synthase and cyclooxygenase-2 at both the mRNA and protein levels. QUE suppressed the production of proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α. QUE also inhibited the translocation of the nuclear factor kappa B subunit, p65, into the nucleus by interrupting the phosphorylation of IκB-α in LPS-induced RAW 264.7 cells. Based on the finding that QUE significantly decreased p-ERK protein expression in LPS-induced RAW264.7 cells, we confirmed that suppression of the inflammatory process by QUE was mediated through the MAPK pathway. This is the first report on the strong anti-inflammatory effects of QUE, which is a compound that can potentially be used as a therapeutic agent for inflammatory diseases.

The use of autonomous Unmanned Aerial Vehicles (UAVs) has been increasing, and the autonomy of these systems and their capabilities in dealing with uncertainties is crucial. Autonomous landing is pivotal for the success of an autonomous mission of UAVs. This paper presents an autonomous landing system for quadrotor UAVs with the ability to perform smooth landing even in undesirable conditions like obstruction by obstacles in and around the designated landing area and inability to identify or the absence of a visual marker establishing the designated landing area. We have integrated algorithms like version 5 of You Only Look Once (YOLOv5), DeepSORT, Euclidean distance transform, and Proportional-Integral-Derivative (PID) controller to strengthen the robustness of the overall system. While the YOLOv5 model is trained to identify the visual marker of the landing area and some common obstacles like people, cars, and trees, the DeepSORT algorithm keeps track of the identified objects. Similarly, using the detection of the identified objects and Euclidean distance transform, an open space without any obstacles to land could be identified if necessary. Finally, the PID controller generates appropriate movement values for the UAV using the visual cues of the target landing area and the obstacles. To warrant the validity of the overall system without risking the safety of the involved people, initial tests are performed, and a software-based simulation is performed before executing the tests in real life. A full-blown hardware system with an autonomous landing system is then built and tested in real life. The designed system is tested in various scenarios to verify the effectiveness of the system.

Modified mRNAs (modRNAs) are an emerging delivery method for gene therapy. In particular, the modRNA-based COVID-19 vaccines have proven that modRNA is a safe and effective therapeutic tool. Moreover, modRNA has the potential to treat various human diseases including cardiac dysfunction. Acute myocardial infarction (MI) is a major cardiac disorder that currently lacks curative treatment options. MI is commonly accompanied by fibrosis and impaired cardiac function. Our group previously demonstrated that the matricellular protein CCN5 inhibits cardiac fibrosis (CF) and improves cardiac dysfunction. However, it remains elusive whether the early intervention of CF under stress conditions is beneficial or more detrimental due to potential adverse effects such as left ventricular (LV) rupture. To obtain acute CCN5 expression, we used modRNA-mediated gene transfer in a mouse MI model. To evaluate CCN5 activity, we established two independent experimental schemes: 1) preventive intervention and 2) therapeutic intervention. Cardiac function and structural changes were measured by echocardiography and magnetic resonance imaging. Finally, fibrosis and the underlying molecular pathway were analyzed by western blotting, quantitative real-time polymerase chain reaction, and immunohistochemistry. The modRNA-CCN5 gene transfer successfully ameliorated CF and enhanced cardiac function in both preventive and therapeutic interventions without LV rupture or any adverse cardiac remodeling. Conclusively, early intervention in CF by modRNA-CCN5 gene transfer is an efficient and safe therapeutic modality for treating MI-induced heart failure without adverse structural remodeling.

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

Manipulating autophagy is a promising strategy for treating cancer as several autophagy inhibitors shown to induce autophagic cell death. One of these, autophagonizer (APZ), induces apoptosis-independent cell death by binding an unknown target via an unknown mechanism. To identify APZ targets we used a label-free drug affinity responsive target stability (DARTS) approach with a liquid chromatography/tandem mass spectrometry (LC-MS/MS) readout. Of 35 protein interactors, we identified Hsp70 as a key target protein of unmodified APZ in autophagy. Either APZ treatment or Hsp70 inhibition attenuates integrity of lysosomes, which leads to autophagic cell death exhibiting an excellent synergism with a clinical drug, temozolomide, in vitro, in vivo, and orthotropic glioma xenograft model. These findings demonstrate the potential of APZ to induce autophagic cell death and its development to combinational chemotherapeutic agent for glioma treatment. Collectively, our study demonstrated that APZ, a new autophagy inhibitor, can be used as a potent antitumor drug candidate to get over unassailable glioma and revealed a novel function of Hsp70 in lysosomal integrity regulation of autophagy.

Over the few decades, cancer-associated mortalities and morbidities were continuously increased worldwide despite sophisticated technological advancements. Pharmaceutical interventions associated with drugs exhibit a high degree of side effects and toxicities in addition to very high costs. Subsequently, to reduce or to vanish the side effects and high costs, researchers are now exploring natural bioactive compounds such as quercetin in its nanoformulations along with biologics as cargo delivery vehicles. Quercetin along with mesenchymal stromal lineage-derived extracellular vesicles (EVs) possesses an anti-cancer potential that can be explored to treat hepatocellular carcinoma (HCC). Exerting enhanced effect, nano quercetin synergistically with EVs triggers the anti-cancer mechanisms by regulating and dysregulating several signalling mechanisms including NF-κB, p53, JAK/STAT, MAPK, Wnt/β-catenin and PI3K/AKT, in addition to PBX3/ERK1/2/CDK2, and miRNAs modulation. In addition, findings regarding the potential checkpoints of anti-cancer signalling pathways were investigated that offer opportunities to develop engineered EVs incorporated with nano quercetin for the development of novel therapeutics to treat HCC in future. In this present mechanistic review, we abridged the regulation of such signalling mechanisms synergetic approach of nano quercetin and EVs. The regulatory role of EVs in the manifestation of innumerable miRNAs has also been tailed with special context to HCC.

Rice is an important cereal crop worldwide, the growth of which is affected by rice blast disease, caused by the fungal pathogen Magnaporthe oryzae. As climate change increases the diversity of pathogens, the disease-resistance genes (R genes) in plants must be identified. The major blast-resistance genes have been identified in indica rice varieties; therefore, japonica rice varieties with R genes now need to be identified. Because leucine-rich repeat (LRR) domain proteins possess R-gene properties, we used bioinformatics analysis to identify the rice candidate LRR domain receptor-like proteins (OsLRR-RLPs). OsLRR-RLP2, which contains six LRR domains, showed differences in the DNA sequence, containing 43 single-nucleotide polymorphisms (SNPs) in indica and japonica subpopulations. The results of M. oryzae inoculation analysis indicated that indica varieties with partial deletion of OsLRR-RLP2 showed susceptibility, whereas japonica varieties with intact OsLRR-RLP2 showed resistance. oslrr-rlp2 mutant generated using clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) showed increased pathogen susceptibility, whereas plants overexpressing this gene showed pathogen resistance. These results indicate that OsLRR-RLP2 confers resistance to rice, and OsLRR-RLP2 may be useful for breeding resistant cultivars.

Purpose The COVID-19 pandemic, triggered by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has resulted in over 160 million infections and 3.5 million fatalities worldwide. Evidence of SARS-CoV-2 presence in the highly vascularized penile tissue and the established correlation between COVID-19 and subsequent erectile dysfunction (ED) has emerged. Robot-assisted radical prostatectomy (RARP) is a popular procedure for prostate cancer because of its reliability and swift recovery rate. However, the ED prevalence post-surgery is believed to be comparable to open surgery, and postoperative ED significantly affects the patient's quality of life. Our study aimed to explore the effect of COVID-19 on ED recovery in patients undergoing bilateral nerve preservation during RARP. Materials and Methods We conducted a retrospective study on 85 patients who underwent bilateral nerve-sparing RARP (nsRARP) at our institution between December 2017 and May 2021. Chart reviews and the International Index of Erectile Function-5 (IIEF-5) questionnaire facilitated the analysis. Our objective was to contrast ED recovery after surgery between SARS-CoV-2–infected and non-infected patients using preoperative IIEF-5 scores and scores at 6, 12, and 24 months post-surgery. We defined successful ED recovery as an IIEF-5 score of 17 or higher and successful sexual intercourse. We also compared ED recovery rates between the two groups, regardless of the timing of COVID-19 diagnosis. IBM's SPSS version 18.0 assisted in the statistical analysis, with Fisher's exact test and chi-square test used for comparing categorical variables. Independent t-tests determined mean differences between baseline and postoperative IIEF-5 scores. A p-value less than 0.05 was considered statistically significant. Results From December 2017 to May 2021, our institution executed 213 RARP cases, with 185 of these involving nerve preservation. Among these patients, 133 had an IIEF-5 score of 17 or higher during preoperative EF assessment. We included 85 patients with consistent IIEF-5 records before surgery and at 6, 12, and 24 months post-surgery in this study. Of these, 44 and 41 patients comprised the COVID-19–positive and COVID-19–negative groups, respectively. The COVID-19–positive group had a higher proportion of diabetes mellitus (DM) patients (24 (54.55%) vs. 7 (17.07%), p<0.001). There was no significant difference in preoperative IIEF-5 scores or scores up to 6 months after surgery between the two groups. However, the IIEF-5 scores of the COVID-19–positive group were statistically lower after 12 and 24 months post-surgery. Additionally, the COVID-19–negative group showed a more considerable score increase between 6 and 12 months post-surgery, and the EF recovery rate was lower in the COVID-19–positive group starting from the 12th month after surgery. Within the COVID-19–positive group, no statistically significant difference in IIEF-5 scores was found between single infection and multiple reinfection groups. Conclusions Principal component analysis revealed the impact of COVID-19 on ED recovery in patients who underwent nsRARP. The most substantial changes in IIEF-5 scores occurred between 6 and 12 months. From 12 months onwards, the COVID-19–positive group had significantly lower scores, and fewer patients had IIEF-5 scores above 17. However, the number of COVID-19 diagnoses did not significantly affect the IIEF-5 scores.

Xerostomia is a subjective symptom of dry mouth resulting from various causes, including side effects of medication, systemic disorders, radiation, and Sjögren’s syndrome. Recently, the number of patients afflicted with xerostomia has increased due to an increase in the elderly population and patients on medication.; (2) Methods: A systematic approach is required to determine the etiology and management of xerostomia. This review summarizes recent literatures on the diagnosis and management of xerostomia.; (3) Results: A patient with xerostomia experiences difficulty in chewing, swallowing, speaking, tasting, and maintaining oral hygiene. Xerostomia and hyposalivation are uncomfortable side-effects in many patients. Assessing the function of the salivary gland is essential for selecting an appropriate treatment, improving symptoms, and preventing oral complications. Also, a more systematic approach is required to differentiate the subjective symptoms of the patient from the objective hyposalivation.; and (4) Conclusions: Although there is no standardized treatment for xerostomia, doctors need to endeavor and adapt the various treatments of xerostomia, to unearth the optimal treatment required for the patient.

Hepatocellular carcinoma (HCC) is currently the third leading cause of malignancy-related mortalities worldwide. Natural killer (NK) cells are involved in the critical role of first line immunological defense against cancer development. Defects in NK cell functions are recognized as important mechanisms for immune evasion of tumor cells. NK cell function appears to be attenuated in HCC, and many previous reports suggested that NK cells play a critical role in controlling HCC, suggesting that boosting the activity of dysfunctional NK cells can enhance tumor cell killing. However, the detailed mechanisms of NK cell dysfunction in tumor microenvironment of HCC remain largely unknown. A better understanding of the mechanisms of NK cell dysfunction in HCC will help in the NK cell-mediated eradication of cancer cells and prolong patient survival. In this review, we describe the various mechanisms underlying NK cell dysfunction in HCC. Further, we summarize current advances in the approaches to enhance endogenous NK cell function and in adoptive NK cell therapies, to cure this difficult-to-treat cancer.

Rotorcrafts operate HUMS for fault diagnosis, but the capabilities of HUMS analysts are important due to the complex mechanical configuration of rotorcraft and the difficulty of analysis. Accordingly, an advanced algorithm is needed to identify faults, and flight data can be used to develop the algorithm. However, flight data contains abnormal or missing data due to problems such as sensor defects, which can be a major problem in algorithm development. Therefore, in this paper, we study a gap filling method using MLP to obtain normal data when there are problems such as abnormal or missing data in rotorcraft flight data. Existing methods typically fill the gap through interpolation or curve fitting using the before and after values of missing data. However, in this study, normal values were estimated using the values of other parameters at the moment of missing or abnormal data occurred. As a result of evaluating the performance of the trained MLP using normal data, it was confirmed that the output of the model well estimates the changing trend of the target. And when abnormal data was applied to the trained model, it was confirmed that point outliers were eliminated and appropriate values were found in the case of missing data.

The research community has shown significant interest in the aqueous synthesis of nanomaterials due to its ability to eliminate the need for complex organic solvents. This synthesis approach aligns with the principles of green chemistry, attracting considerable attention. Aqueous solution technology in fabricating nanostructures has gained recognition for its potential to create ultrasensitive, low-energy, and ultrafast optoelectronic devices. This report focuses on synthesizing lead iodide (PbI2) nanoplates using a water-based solution technique and fabricating a planar photodetector. The photodetectors with a planar type of device structure (ITO/PbI2 NPs/Au) demonstrated a remarkable photosensitivity of 3.9×103 and a photoresponsivity of 0.51 mA/W at a wavelength of 405 nm. Notably, the asymmetrical output properties of ITO/PbI2 NPs/Au detector deliver additional evidence of the effective creation of a Schottky contact. Thus, the photodetector exhibited a photoresponse even at 0 V bias, leading to the realization of self-powered photodetectors. Additionally, the device exhibited a rapid photoresponse of 0.21/0.38 s (−5 V) in the visible range. This study has expanded the horizons for the aqueous-phase synthesis of nanoplate nanostructures, enabling the large-area fabrication of high-performance photodetectors.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Bullying makes learning difficult for nursing students, and using real-life scenarios during training can improve the understanding of workplace bullying. Thus, to mitigate bullying experienced by nurses, this study developed and evaluated a cognitive rehearsal education program that constituted of training nursing students through role-play simulations. A mixed-method research design was used to evaluate 39 nursing students from two universities. A quasi-experimental research design was applied to assess symptoms, knowledge, and perceptions of bullying, and a focus group interview was conducted with six participants. Quantitative analyses revealed that the program improved participants’ knowledge and perceptions, but not their symptoms. The focus group interview revealed that the program improved participants’ coping skills and desire for education. This program could be effective in raising awareness of workplace bullying and increasing relevant coping skills. It can be further developed as part of an overall strategy to manage workplace bullying and its consequences in hospital settings.

This study aimed to learn disturbance information to effectively control multiple small unmanned surface vehicles (USVs) for marine research purposes at sea. The learned disturbance information was used to investigate the control of multiple USV swarms based on the leading–following formation technique. Numerous studies have already been conducted on swarm control using drones in the air; however, there has been a paucity of studies on swarm control in the sea. Contrary to swarm control in aviation, the fluid density of the sea is high, and the environment is constantly changing; thus, a robot system would be significantly affected by disturbances. This ultimately influences the maintenance of swarm formations and the accomplishment of missions [1,2]. Therefore, it is difficult to control numerous moving objects while maintaining a formation at sea by using the existing aerial drone swarm control technology. To solve this problem, we learned a long short-term memory (LSTM) model with time-series marine environmental data to predict maritime disturbances. Thereafter, the model was applied to a mission-based position control algorithm of each USV constituting the swarm to design a marine unmanned floating vessel swarm control system that can be applied to various marine environments. Specifically, to effectively control numerous small USVs for marine research purposes, ocean currents are learned using the LSTM algorithm, and the predicted ocean currents are used to generate a swarm USV control system for USV formations. In this study, a control system model of several small USVs equipped with two rear thrusters and a front lateral thruster was designed. The LSTM algorithm was learned using the previous ocean current data, and the velocity of the following ocean currents was predicted. The predictions were then used as a system disturbance to determine the thrust of the controller. To measure ocean currents in the sea when each USV moves, the velocity, azimuth, and position (latitude, longitude) data from the GPS mounted on the USV were used to measure the velocity and direction of the hull's movement. Further, the flow rate was measured using a flow rate sensor on a small USV. The USV movement and position were controlled using an artificial neural network-PID (ANN-PID) controller. This study entailed a comparative analysis of the designed USV model results and those generated by the simulator, including the behavior control rule of the USV swarm and the path of the actual USV swarm at sea. It was verified that the effectiveness of the USV mathematical model and behavior control rules. By comparing the movement path of the swarm USV with and without the disturbance learning algorithm and ANN-PID control algorithm applied to the designed simulator, the position error and maintenance performance of the swarm formation were analyzed, and the application results were compared.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The way people innovate and create new ideas and bring them to the market is undergoing a fundamental change from closed innovation to open innovation. Why and how do firms perform open innovation? Firms’ open innovation is measured through the levels of firms’ joint patent applications. Next, we analyze network structures and characters of firms’ joint patent applications such as betweenness and degree centrality, structure hole, and closure. From this research, we drew conclusions as follows. First, the structure of collaboration networks has both direct and indirect effects on firms’ innovative performance. Second, in the process of joint patent applications, there is a long tail phenomenon in networks of joint patent applications. Third, the number of patents and International Patent Classification (IPC) subclasses together constitute a meaningful measure of the innovation performance of firms.

This study explored the effects of a comprehensive health care program (CHCP) on blood pressure, blood glucose, body composition, and depression in older adults living alone. We used a quasi-experimental, two-group, pre-posttest design. The CHCP consisted of open lectures, health counseling, exercise classes, nutrition counseling, and self-help group meetings at a local senior welfare center. Fifty-eight subjects participated in this study, with thirty subjects in the experimental group and twenty-eight subjects in the control group. Data were analyzed using the descriptive statistics, χ²-test, and t-test. Comparisons of the pretest and posttest systolic blood pressure (t = - 2.530, p < .016) and blood glucose (t = 3.089, p < .004) between the experimental and control groups showed significant differences. In both the experimental (t = 3.949, p < .001) and control groups (t = 3.816, p < .002), depression symptoms showed a significant decrease post-test, compared with pre-test. Our findings infer that older adults require physical and psychosocial healthcare and that more efforts must be made to improve the general health and wellbeing of this population group.

Background: The world-wide rate of obesity is increasing continuously, representing a serious medical threat since it is associated with a variety of diseases including type 2 diabetes, cardiovascular disease, and numerous cancers. Sophora japonica is used as a traditional herb for medicinal purposes in eastern Asia. However, the anti-obesity effects of S. japonica fruit have not been explored. Objective: The aim of this study is to investigate the inhibition of adipocyte differentiation and adipogenesis by an ethanol extract of S. japonica fruit (EESF) in 3T3-L1 pre-adipocytes. Methods: MTT assay, Oil Red O staining, and Triglyceride contents were used to investigate lipid accumulation in 3T3-L1 cells to clarify adipocyte differentiation. The expression levels of various molecular signals associated with adipogenesis and lipogenesis were examined by western blot analysis. Results: Our results demonstrate that EESF suppressed the terminal differentiation of 3T3-L1 pre-adipocytes in a dose-dependent manner, as confirmed by a decrease in lipid droplet number and lipid content through Oil Red O staining. EESF significantly reduced the accumulation of cellular triglyceride, which was associated with a significant inhibition of the levels of pro-adipogenic transcription factors, downregulated the expression levels of adipocyte-specific proteins. Furthermore, EESF treatment effectively increased the phosphorylation of AMPK and ACC. Conclusions: These results together indicate that EESF has significant effects on the inhibition of adipogenesis and acts by stimulating the AMPK signaling pathway. Further studies will be needed to identify the active compounds in S. japonica.

Erlotinib inhibits epithelial growth factor receptor (EGFR) kinase activity and is used to treat non-small cell lung cancer (NSCLC). Despite its high efficacy, recurrence can occur in patients who become resistant to the drug. To address the underlying mechanism of Erlotinib resistance, we investigated additional mechanisms related to mode-of-drug-action, by multiple protein-binding interactions, besides EGFR by using drug affinity responsive target stability (DARTS) and liquid chromatography-mass spectrometry (LC-MS/MS) methods with non-labeled Erlotinib. DNA polymerase alpha subunit B (POLA2) was identified as a new Erlotinib binding protein that was validated by the DARTS platform, complemented with cellular thermal shift assays. Genetic knock-down of POLA2 promoted the anti-proliferative effect of the drug in the Erlotinib-resistant cell line H1299 with high POLA2 expression, whereas overexpression of POLA2 restored anti-proliferative effects in the Erlotinib-sensitive cell line HCC827 with low POLA2 expression. Importantly, POLA2 expression levels in four NSCLC cell lines were positively correlated with anti-proliferative Erlotinib efficacy, verified by bio-statistical analysis (Pearson correlation coefficient, R=0.9886). These results suggest that POLA2 is a novel complementary target protein of Erlotinib, and could clinically provide validity as a surrogate marker for drug resistance in patients with NSCLC.

Cisplatin induces early-onset ototoxicity, resulting in hearing loss. The exact mechanism by which cisplatin causes ototoxicity remains unclear. The purpose of this study was to identify the involvement of receptor-interacting protein kinase(RIP)3-dependent necroptosis in cisplatin-induced ototoxicity in animal models. Sprague–Dawley rats (SD, 8 week) were treated via intraperitoneal (i.p) injection with cisplatin (16 mg/kg for 1 day), and their hearing thresholds were was measured by the auditory brainstem response (ABR) method. Hematoxylin and eosin (H-E) staining, immunohistochemistry, and western blots were performed to determine the effect of cisplatin-induced ototoxicity on cochlear morphology. H-E stains outlined necroptotic changes in the organ of Cortis (OCs) and spiral ganglion neurons (SGNs). Additionally, immunohistochemistry and western blot analysis showed overexpression of RIP3 in the OCs and SGNs that were treated with cisplatin. These results suggest that RIP3-dependent necroptosis was substantial in cisplatin-induced ototoxicity; inner cochlear regions, the OCs, and SGNs were especially sensitive to necroptosis.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Mesenchymal stem cells (MSCs) showed in vitro mesoderm-lineage differentiation and self-renew capacity. However, no comparative study was reported on the biological characteristics of stem cells derived from skeletal muscle (SM-MSCs), dermal skin (DS-MSCs), and adipose tissues (A-MSCs) from a single donor in camels. The present study aimed to evaluate the influence of MSCs source on stem cell characteristics. We evaluated proliferation capacity and mesoderm-lineage differentiation potential from SM-MSCs, DS-MSCs, and A-MSCs. They showed spindle-like morphology after homogenization. The proliferation ability was no significant difference in all groups. Furthermore, the portion of the cell cycle and expression of pluripotent markers (Oct4, Sox2, and Nanog) were similar in all cell lines at passage 3. The differentiation capacity of A-MSCs into adipocytes was significantly higher than that of SM-MSCs and DS-MSCs. However, the osteoblast differentiation capacity of A-MSCs was significantly lower than that of SM-MSCs and DS-MSCs. Additionally, after osteoblast differentiation, the ALP activity and calcium content was significantly decreased in A-MSCs as compared to SM-MSCs and DS-MSCs. To the best of our knowledge, we primally established MSCs from the single camel and demonstrated their comparative characteristics including expression of pluripotent factors and proliferation, and in vitro differentiation capacity into adipocytes and osteoblasts.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

This study reports the preparation of silica and nano-fructosome encapsulated Candida antarctica lipase B particles (CalB@NF@SiO2) and demonstration of their enzymatic hydrolysis and acylation. CalB@NF@SiO2 particles were prepared as a function of TEOS concentration (3-100 mM). Their mean particle size was 185 nm by TEM. Enzymatic hydrolysis was performed to compare catalytic efficiencies of CalB@NF and CalB@NF@SiO2. Catalytic constants (Km, Vmax, and Kcat) of CalB@NF and CalB@NF@SiO2 were calculated with Michaelis-Menten equation and Line-weaver Burk plot. Optimal stability of CalB@NF@SiO2 was found at pH 8 and temperature of 35 ℃. Moreover, CalB@NF@SiO2 particles were reused for seven cycles to evaluate their reusability. In addition, enzymatic synthesis of benzyl benzoate was demonstrated by an acylation reaction with benzoic anhydride. The efficiency of CalB@NF@SiO2 for converting benzoic anhydride to benzyl benzoate by the acylation reaction was 97%, indicating that benzoic anhydride was almost completely converted to benzyl benzoate. Consequently, CalB@NF@SiO2 particles are better than CalB@NF particles for enzymatic synthesis. In addition, they are reusable with high stability at optimal pH and temperature.

We consider Pisot family substitution tilings in $\R^d$ whose dynamical spectrum is pure point. There are two cut-and-project schemes(CPS) which arise naturally: one from the Pisot family property and the other from the pure point spectrum respectively. The first CPS has an internal space $\R^m$ for some integer $m \in \N$ defined from the Pisot family property, and the second CPS has an internal space $H$ which is an abstract space defined from the property of the pure point spectrum. However it is not known how these two CPS's are related. Here we provide a sufficient condition to make a connection between the two CPS's. In the case of Pisot unimodular substitution tiling in $\R$, the two CPS's turn out to be same due to [5, Remark 18.5].

Cardiac hypertrophy is an adaptive response to various pathological insults including hypertension. However, sustained hypertrophy can cause impaired calcium regulation, cardiac dysfunction, and remodeling, accompanied by cardiac fibrosis. Our previous study identified miR-25 as a regulator of SERCA2a, and that inhibition of miR-25 improved cardiac function and reduced fibrosis by restoring SERCA2a expression in a murine heart failure model. However, the precise mechanism underlying the reduction of fibrosis by miR-25 inhibition remains unclear. Therefore, we postulate that miR-25 may have additional targets that contribute to regulating cardiac fibrosis. Using in silico analysis, Krüppel-like factor 4 (KLF4) was identified as an additional target of miR-25. Further experiments confirmed that KLF4 was directly targeted by miR-25 and that its expression was reduced by long-term treatment with Angiotensin II, a major hypertrophic inducer. Subsequently, treatment with a miR-25 inhibitor alleviated the cardiac dysfunction, fibrosis, and inflammation induced by Angiotensin II. These findings indicate that inhibiting miR-25 not only enhances calcium cycling and cardiac function via SERCA2a restoration but also reduces fibrosis by restoring KLF4 expression. Therefore, targeting miR-25 may be a promising therapeutic strategy for treating hypertensive heart diseases.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Cesium lead iodide (CsPbI3) perovskite nanocrystals (NCs) are a promising material for red light-emitting diodes (LEDs) due to their excellent color-purity and high luminous efficiency. However, small-sized CsPbI3 colloidal NCs, such as nanocubes, used in LEDs suffer from confinement effects, negatively impacting their photoluminescence quantum yield (PLQY) and overall efficiency. Here, we introduced YCl3 into the CsPbI3 perovskite, which formed anisotropic, one-dimensional (1D) nanorods. This was achieved by taking advantage of the difference in bond energies between Cl− and I− ions, which caused YCl3 to promote the anisotropic growth of CsPbI3 NCs. The YCl3-based nanorods improved the PLQY and storage stability by passivating the defects reducing the nonradiative recombination rates. When the YCl3-substituted CsPbI3 nanorods are applied to the emissive layer in LEDs, we achieve an external quantum efficiency of ~3.16% which is 1.86-fold higher than the pristine CsPbI3 NCs (1.69%) based LED. Notably, the ratio of horizontal transition dipole moments (TDMs) in the anisotropic YCl3:CsPbI3 nanorods was determined to be 75%, which is higher than the isotropically oriented TDMs in CsPbI3 nanocrystals (67%). This increased TDM ratio led to higher light outcoupling efficiency in nanorods-based LEDs. Overall, the results suggest that YCl3-substituted CsPbI3 nanorods could be promising for achieving high-performance perovskite LEDs.

Background: The Stability Index estimation algorithm was derived and applied to develop and implement a balance ability diagnosis system that can be used at daily life. Methods: The system integrated an approach based on sensory function interaction, called the clinical test of sensory interaction with balance (CTSIB). The piezo-resistive force mat was fabricated, and a Stability Index prediction algorithm was developed and applied using the center of pressure (CoP) variables. The Stability Index prediction algorithm derived a CoP variable for 103 elderly people by Nintendo Wii Balance Board (WBB) to predict the Stability Index of the Balance System (Biodex SD). And, the accuracy was confirmed through the correlation between the real and predicted value. Results: As a result of testing with the test-set, the linear regression model confirmed that the r value ranged between 0.943 to 0.983. To confirm the similarity between the WBB and flexible force mat, each measured CoP value was input and calculated into the developed regression model, and the result of the correlation coefficient validation ​​confirmed an r value of 0.96. Conclusion: The system developed in this study will be applicable to the daily life of the home in the form of a floor mat.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Resistance of tumor cells to anticancer drugs is a major obstacle in tumor therapy. In this study, we investigated the mechanism of cordycepin-mediated resensitization to cisplatin inT24R2, a derived T24 cell line. Treatment with cordycepin or cisplatin (2 g/ml) alone could not induce cell death of T24R2, but combination treatment of these drugs significantly induced apoptosis of the cells through mitochondrial pathway including depolarization of mitochondrial membrane, decrease of anti-apoptotic proteins, Bcl-2, Bcl-xL, and Mcl-1, and increase of pro-apoptotic proteins, Bak and Bax. . High expression of MDR1 was the cause of cisplatin resistance in T24R2, and cordycepin significantly reduced MDR1 expression through inhibition of MDR1 promoter activity. MDR1 promoter activity was dependent on a transcription factor, Ets-1, in T24R2 cells. Although there is a correlation between MDR1 and Ets-1 expression in bladder cancer patients, active Ets-1, Thr-38 phosphorylated form (pThr-38), was critical to induce MDR1 expression. Cordycepin decreased pThr-38 Ets-1 level through inhibition of AKT, which reduced MDR1 transcription and induced the resensitization of T24R2 to cisplatin. The results suggest that cordycepin effectively resensitizes cisplatin-resistant bladder cancer cells to cisplatin, thus serving as a potential strategy for treatment of anti-cancer drug resistant patients.

Aims TRAIL is a promising anticancer agent that has the potential to sensitize a wide variety of cancer or transformed cells by inducing apoptosis. However, resistance to TRAIL is a growing concern. Current manuscript aimed to employing combination treatment to investigate resveratrol induced TRAIL sensitization in NSCLC. Method A549 and HCC-15 cells were used in experimental design. Cell viability was determined by morphological image, crystal violet staining and MTT assay. Apoptosis was evaluated by LDH assay, Annexin V and DAPI staining. Autophagy and apoptosis indicator protein were examined by western blotting. TEM and puncta assay were carried out to evaluate the autophagy. MTP and ROS activity were evaluated by JC-1 and H₂DCFDA staining. Findings Resveratrol is a polyphenolic compound capable of activation of tumor suppressor p53 and its pro-apoptotic modulator PUMA. Herein, we showed the p53-independent apoptosis by decrease the expression of phosphorylated Akt-mediated suppression of NF-κB that is also substantiated with the downregulation of anti-apoptotic factors Bcl-2 and Bcl-xl in NSCLC, resulting in an attenuation of TRAIL resistance in combined treatment. Furthermore, apoptosis was induced in TRAIL-resistant lung cancer cells with a co-treatment of resveratrol and TRAIL assessed by the loss of MMP, ROS generations which resulting the translocation of cytochrome c from the mitochondria into the cytosol due to mitochondrial dysfunction. Moreover, autophagy flux was not affected by resveratrol-induced TRAIL-mediated apoptosis in NSCLC. Significance Overall, targeting the NF-κB (p65) pathway via resveratrol attenuates TRAIL resistance and induces TRAIL-mediated apoptosis which could be the effective TRAIL-based cancer therapy regimen.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Mitochondria are highly dynamic organelles that continuously change their shape. Their main function is ATP production; however, they are additionally involved in a variety of cellular phenomena, such as apoptosis, cell cycle, proliferation, differentiation, reprogramming, and aging. The change in mitochondrial morphology is closely related to the functionality of mitochondria. Normal mitochondrial dynamics are critical for cellular function, embryonic development, and tissue formation. Thus, defect in proteins involved in mitochondrial dynamics that control mitochondrial fusion and fission can affect cellular differentiation, proliferation, cellular reprogramming, and aging. Here we review the processes and proteins involved in mitochondrial dynamics and its various associated cellular phenomena.

Developing countries, including Small Island Developing States (SIDS) and Least Developed Countries (LDCs), are exceptionally vulnerable to climate change due to their distinct geographical and environmental characteristics. The impacts of climate change extend across their ecosystems, water resources, and vital economic sectors, such as food systems, health, education, and energy. Escalating sea levels and heightened salinity levels imperil freshwater reserves, while warmer ocean temperatures and acidification disrupt water demand, tourism, health services, and fisheries. Furthermore, developing countries bear the brunt of water shortages, flooding, and deteriorating water quality. Alarmingly, nearly two-thirds of the global population experience severe water scarcity for at least one month annually, with the majority residing in developing countries. By 2025, half of the world's population could inhabit areas grappling with water scarcity, predominantly concentrated in developing nations. In this context, innovative adaptation strategies, notably transformative wastewater projects, are imperative for fostering sustainability and resilience in these regions. However, significant barriers impede progress, creating a stark disparity between current financing capabilities and the imperative to fund water security initiatives. Compounding these challenges, developing countries find themselves ensnared in a burgeoning debt crisis, marked by escalating interest rates and inflation, which threatens to impede developmental progress and curtail investments in adaptation and mitigation endeavors. Consequently, there arises a critical necessity to harness innovative financial mechanisms to transform these debts into assets that facilitate climate action. This paper meticulously explores the potential of debt-for-climate swaps as a catalyst for advancing transformative wastewater projects, with a focused lens on their strategic deployment to underpin critical initiatives. Through rigorous examination of case studies and empirical evidence, the paper elucidates how debt-for-climate swaps can effectively bolster sustainable wastewater management systems in developing countries. Furthermore, it delineates best practices for leveraging these mechanisms to fortify environmental sustainability and resilience. Additionally, the paper delineates the roles and responsibilities of key stakeholders, including governments, policymakers, the private sector, communities, and climate financial institutions. By amalgamating theoretical insights with tangible examples, this paper furnishes a comprehensive framework for harnessing debt-for-climate swaps to enhance water security and resilience in developing countries. It endeavors to furnish actionable strategies for policymakers, practitioners, and stakeholders to navigate the complex terrain of climate change and engender sustainable development.

In this study, reinforcement learning (RL) was used in factory simulation to optimize storage devices for use in Industry 4.0 and digital twins. First, we defined an RL environment, modeled it, and validated its ability to simulate a real physical system. Subsequently, we introduced a method to calculate reward signals and apply them to the environment to ensure the alignment of the behavior of the RL agent with the task objective. The stocker simulation model was used to validate the effectiveness of RL. The model is a storage device that simulates logistics in a manufacturing production area. The results revealed that RL is a useful tool for automating and optimizing complex logistics systems and increase the applicability of RL in logistics. We proposed a novel method for creating an agent through learning using the proximal policy optimization algorithm, and the agent was optimized by configuring various learning options. The application of reinforcement learning resulted in an effectiveness of 30% to 100%, and methods can be expanded to other fields.

This paper presents a low-cost C-band frequency-modulated continuous wave (FMCW) radar system for use in indoor through-wall metal detection. Indoor remote-sensing applications, such as through-wall detection and positioning, are essential for the comprehensive realization of the internet of things or super-connected societies. The proposed system comprises a two-stage radio-frequency power amplifier, a voltage-controlled oscillator, circuits for frequency modulation and system synchronization, a mixer, a 3-dB power divider, a low-noise amplifier, and two cylindrical horn antennas (Tx/Rx antennas). The antenna yields gain values in the 6.8 ~ 7.8 range when operating in the 5.83 ~ 5.94 GHz frequency band. The backscattered Tx signal is sampled at 4.5 kHz using the Arduino UNO analog-to-digital converter. Thereafter, the sampled signal is transferred to the MATLAB platform and analyzed using a customized FMCW radar algorithm. The proposed system is built using commercial off-the-shelf components, and it can detect targets within a 56.3 m radius in indoor environments. In this study, the system could successfully detected targets through a 4-cm-thick ply board with a measurement accuracy of less than 10 cm.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

VE is a powerful technique for analyzing a design with a focus on functionality, reducing costs, and increasing value. However, in order to proceed with the design of VE, the theoretical basis for the VE target selection process, which must be preceded in the preparation stage, is lacking, and as a result, it is difficult to verify the most effective target selection. Thus, a theoretical basis is needed. In this study, we intend to quantify the WORTH value of the COST TO WORTH technique and present an objective model of the target selection method using the derived Value Index (VI). For this purpose, cost worth (WORTHC) was calculated based on the performance data of 1,008 cases of 15 building types provided by the Domestic Public Procurement Service and the share of 83 detailed processes in 7 fields. Then, a survey was conducted targeting the ordering companies, and the final worth (WORTHF) was calculated by multiplying the derived customer value (WORTHV ) weight for each detailed work type. We calculated the Value Index (VI) by comparing COST and WORTHF for each detailed construction type of the VE project and developed a model to select construction types that exceed the VI standard value derived using the standard error of the population. Both cost experts and non-cost experts can use the developed model to specify the VE target selection criteria in order to easily select the key target, objectively sort the values that serve as the basis for calculating the value index and make it possible to more easily select the VE target selection criteria based on theoretical evidence. Also, the model can be used to obtain effective detailed design VE results.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by swelling in at least one joint. Owing to an overactive immune response, extra-articular manifestations are observed in certain cases, with interstitial lung disease (ILD) being the most common. Rheumatoid arthritis-associated interstitial lung disease (RA-ILD) is characterized by chronic inflammation of the interstitial space, which causes fibrosis and the scarring of lung tissue. Controlling inflammation and pulmonary fibrosis in RA-ILD is important because they are associated with high morbidity and mortality. Pirfenidone and nintedanib are specific drugs against idiopathic pulmonary fibrosis and have shown efficacy against RA-ILD in several clinical trials. Immunosuppressants and disease-modifying antirheumatic drugs (DMARDs) with antifibrotic effects have also been used to treat RA-ILD. Immunosuppressants moderate the overexpression of cytokines and immune cells to reduce pulmonary damage and slow the progression of fibrosis. DMARDs with mild antifibrotic effects target specific fibrotic pathways to regulate fibrogenic cellular activity, extracellular matrix homeostasis, and oxidative stress levels. Therefore, specific medications are required to effectively treat RA-ILD. In this review, the commonly used RA-ILD treatments are discussed based on their molecular mechanisms and clinical trial results. In addition, a computational approach is proposed to develop specific drugs for RA-ILD.

Spectral image analysis has the potential to replace traditional approaches for assessing plant responses to different types of stress including herbicide, through non-destructive and high-throughput screening (HTS). Therefore, this study was conducted to develop a rapid bioassay method using a multi-well plate and spectral image analysis for diagnosis of herbicide activity and mode of action. Crabgrass (Digitaria ciliaris) as a model weed was cultivated in multi-well plates and subsequently treated with 6 herbicides with different modes of action when they reached the 1-leaf stage, using only a quarter of the recommended dose. To detect plant response to herbicides, plant spectral images were acquired after herbicide treatment using RGB, infrared (IR) thermal, and chlorophyll fluorescence (CF) sensors and analyzed for diagnosing herbicide efficacy and mode of action. Principal Component Analysis (PCA) using all spectral data successfully distinguished herbicides and clustered depending on their modes of action. The performed experiments have shown that the multi-well plate assay combined with spectral image analysis can be successfully applied for herbicide bioassay. In addition, the use of spectral image sensors, especially in CF image, would facilitate HTS by enabling rapid observation of herbicide response, as early as 3 hours after herbicide treatment.

(1) Background: This study, drawing from the theoretical framework of the Theory of Planned Behavior (TPB), examines the structural relationship among attitudes, subjective norms, perceived behavioral control (PBC), and behavioral intention. The study focuses on investigating how the perceived risk associated with particulate matter moderates the relationships between 'attitudes and behavioral intention,' 'subjective norms and behavioral intention,' and 'PBC and behavioral intention' within the context of individuals engaged in outdoor sports; (2) Methods: The data were collected from outdoor sports gatherings facilitated through a popular South Korean sports meetup application. Confirmatory factor analysis was employed to establish the construct validity of the measurement scale, assess factor loadings, averaged variance extracted (AVE), and construct reliability (CR). We also ensured the reliability of the measurement scale through Cronbach's α analysis. To achieve our research objectives, we utilized structural equation modeling with maximum likelihood estimation to examine the positive relationships under investigation. Additionally, we performed moderation analysis using the statistical software Jamovi.; (3) Results: The findings demonstrate the significant impacts of attitudes, subjective norms, and PBC on behavioral intention and reveal that perceived risk acts as a moderator, influencing the relationship between PBC and behavioral intention.; (4) Conclusions: Therefore, the government will need to exert substantial efforts to mitigate particulate matter levels.

At the LHC, the process of a Higgs boson decaying into bottom or charm quarks produced in association with a pair of top quarks, tt¯H, allows for an empirical exploration of the heavy-flavor quark Yukawa couplings to the Higgs boson. Accordingly, the cross sections for the tt¯ + heavy-flavor production without the appearance of the Higgs boson have been measured at the LHC in various phase spaces using data samples collected in pp collisions at s = 7, 8 and 13 TeV with the ATLAS and CMS experiments. Flavor ratios of cross sections of tt¯ + additional jets processes with different flavors are also measured. In this paper, the measured cross sections and ratios are reviewed and the prospects with more data are presented.

Caries is a prevalent oral disease that primarily affects children and teenagers. Advances in ma-chine learning have caught the attention of scientists working with decision support systems to predict early tooth decay. Current research has developed machine learning algorithm for caries classification and reached high accuracy especially in ML for image data. Unfortunately, most studies on dental caries only focus on classification and prediction tasks, meanwhile dental carries prevention is more important. Therefore, this study aims to design an efficient feature for decision support system machine learning based that can identify various risk factors that cause dental caries and its prevention. The data used in the research work was obtained from the 2018 Korean Children's Oral Health Survey, which totaled nine datasets. The experimental results show that combining the mRMR and GINI Feature Importance methods when training with the GBDT model achieved the optimum performance of 95%, 93%, 99%, and 88% for accuracy, F1 score, precision, and recall, respectively. So, the proposed method has provided effective predictive model for dental caries prediction.

This study examined the effects of group art therapy on depression, burden, and self-efficacy in primary family caregivers of patients with brain injuries. This was a quasi-experimental, nonequivalent control group and a pre- and post-test design. This study was carried out in one national rehabilitation hospital targeting 41 primary family caregivers of patients with brain injuries. Group art therapy intervention was carried out three days per week for 12 times over four consecutive weeks. The experimental group (n = 20) received group art therapy, whereas the control group (n = 21) did not. We used a time difference method to minimize the risk of contaminating the control group by sampling sequentially. The experimental group showed a significantly greater decrease in burden (t = 2.462, p = 0.020) and significantly greater improvement in self-efficacy (t = −6.270, p &lt; 0.001) than the control group. Group art therapy may be an effective nursing intervention for primary family caregivers of patients with brain injuries.

The collaboration of multimodal transport documents is the foundation for conducting multimodal transport operations. Blockchain technology can effectively address trust issues and information sharing difficulties in current multimodal transport document collaboration. However, in current blockchain-based electronic document research, the bottleneck problem lies in the collaboration of multiparty in multimodal transport under the "one-bill coverage system". We design a blockchain platform architecture for multimodal transport, reshaping collaboration processes for different modes of transport based on the blockchain platform. It proposes a collaboration model for multimodal transport under the "one-bill coverage system" and performs model solving and case analysis. The obtained collaboration strategies are embedded into the platform's application layer. Finally, using Solidity language, it writes smart contracts related to multimodal transport under the "one-bill coverage system " and deploys and executes them on the Remix platform.