Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Lectins, characterized by their carbohydrate-binding ability, have an extensive practical application. However, their industrial use is limited by low yields, and few active recombinant lectins have been reported. In this study, the algal lectin BPL-3 (Bryopsis plumosa lectin 3) was successfully produced using a bacterial expression system, BL21(DE3), with an artificial repeated structure (dimeric construct). Recombinant dimeric BPL3 (rD2BPL3) was confirmed by LC-MS/MS spectrometry. Expression efficiency was greater for the construct with the repeat structure (rD2BPL3) than the monomeric form (rD1BPL3). Optimal conditions for expression were 1 mM IPTG at 20 °C. Recombinant lectin was purified under denaturing conditions and refolded by the flash dilution method. Recombinant BPL3 was solubilized in 1× PBS containing 2 M urea. rD2BPL3 showed strong hemagglutination activity using human erythrocytes, similar to that of native BPL3. rD2BPL3 had a similar sugar specificity to that of the native protein, i.e., to N-acetyl-glucosamine (GlcNAc) and N-acetyl-galactosamine (GalNAc). Glycan array results showed that recombinant BPL3 and native BPL3 exhibited different binding properties. Both showed weak binding activity to α-Man-Sp. Native BPL3 showed strong binding specificity to the alpha conformation of amino sugars, and rD2BPL3 had binding activity to the beta conformation. The process developed in this study was suitable for the quality-controlled production of high amounts of soluble recombinant lectins.

The purpose of this paper is to find the time optimal control to a target set for semilinear stochastic functional differential equations involving time delays or memories under general conditions on a target set and nonlinear terms even though the equations contain unbounded principal operators. Our research approach is construct a fundamental solution for corresponding linear systems and establish variations of constant formula of solutions for given stochastic equations. The existence result of time optimal controls for one point target set governed by the given semilinear stochastic equation is also established.

Alzheimer’s disease (AD) is a chronic neurodegenerative disease, and typical pathologic findings include abnormally hyperphosphorylated tau aggregation and neurofibrillary tangles. Insulin resistance and hyperglycemia have been assessed as risk factors for AD development. As the maintenance of optimal blood glucose levels is an important indicator of diabetes mellitus (DM) treatment, diet control is essential. AMPK is a crucial sensor of cellular bioenergetics for controlling anabolic and catabolic metabolism. Diet restriction to achieve euglycemia can increase AMPK activity in the liver and heart. Since AMPK is a direct regulator of tau phosphorylation, we hypothesized that strict diet control to achieve euglycemia affects tau protein phosphorylation through increased AMPK activity in the hippocampus of DM rats. To confirm this hypothesis, we generated insulin-deficient DM rats by subtotal pancreatectomy. Animals were categorized into the restriction (R) group, control (C) group and ad libitum (AL) group according to the diet. We found that tau phosphorylation was significantly increased in the R group compared with the C or AL group. AMPK activity in the R group significantly increased compared to that of the C group or AL group, as expected. Furthermore, the R group showed more critical tau pathology in the hippocampus than the other groups. These results suggest that diet control to achieve euglycemia in insulin-deficient DM conditions is harmful because of the increased possibility of AD development through increased tau phosphorylation by AMPK activation in the hippocampus. We propose that not only hyperglycemia but also euglycemia, which is beneficial in DM patients, must be considered a potential risk factor for AD development, especially when euglycemia is achieved by diet control during insulin deficiency.

The effects of simulated acid rain (SAR) on the photosynthetic performance of subtropical coniferous species have not been thoroughly investigated. In this study, we treated two coniferous species, Pinus massoniana (PM) and Cunninghamia lanceolata (CL), with SAR and then analyzed photosynthetic activities via the simultaneous measurement of prompt fluorescence(PF), delayed fluorescence(DF), and modulated reflection at 820 nm(MR820). Following the low-pH SAR treatment, the I–P phase of the OJIP curves of PM and CL decreased significantly and then the K-band and L-band were detectable. The delayed fluorescence for both PM and CL decreased as the pH of the SAR solution decreased, with a more significant decrease in the I1 peak than in the I2 peak. According to the MR820 curve, the exposure to SAR stress inhibited the rapid decrease and slow increase in the MR820 transients of PM and CL. The gradients of the decreasing and increasing phases were lower for CL than for PM at pH 2.5. In addition, SAR decreased the light energy captured per unit area (ABS/CSm) and the quantum yield of electron transfer per unit area (ETO/CSm), but it increased the accumulation of QA−, thereby decreasing primary photochemical efficiency (TRO/CSm, φPO). These changes in photosystem II (PSII) resulted in a decrease in the maximum quantum yield of PSII (Fv/Fm) and the performance index (PIABS). Moreover, PSII was protected from thylakoid membrane photodamages through the increase in heat dissipation per unit area (DIO/CSm) in response to SAR. The increase in δRO as the pH of the SAR solution decreased was observed for PM, but not for CL. Considered together, the study findings suggest that SAR treatments can decrease chlorophyll contents and damage the OEC in PM and CL, which obstructs the transfer of electrons on the donor and acceptor sides of PSII. However, PM is better able to withstand SAR stress than CL, likely because of the activation of a protective mechanism (reflected by the change in δRO). Therefore, in coniferous forest areas severely affected by acid rain, CL may need to be protected more than PM.

In this research, we developed a wearable temperature-sensing element by dip dyeing threads in poly (3, 4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS) (p-type conducting polymer) solution. The PEDOT:PSS was used to dye the textile and it exhibited negative temperature coefficient characteristics in which the resistance decreases as the temperature increases. The fabricated temperature-detection thread achieved a sensitivity of 167.1 W/°C with 99.8% linearity in the temperature range of -50 to 80 °C. We anticipate that temperature sensors that apply our technology will be made as stitch- or textile-type for wearable devices, and they will be widely adopted for different applications such as in fitness, leisure, healthcare, medical treatment, infotainment, industry, and military applications, among others.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

In this study, to reduce the use of cement and sand, porous feldspar with excellent economic efficiency was used as a substitute in heat storage concrete layer. When cement was replaced with porous feldspar, the compressive strength was approximately 16%–63% higher compared with when cement was replaced with silicate minerals. To compensate for the reduction in strength owing to the decreased cement content, mechanical and chemical activation methods were employed. When the specific surface area of porous feldspar was increased, the unit weight was reduced by approximately 30% and the compressive strength was increased by up to 90%. When chemical activation was applied using a solidifying agent, the strength was increased by approximately 30% even though 70% of the cement content was replaced with porous feldspar. When cement and sand were replaced with porous feldspar, the compressive strength was approximately two times that of ordinary cement mortar. When the heat storage concrete layer material was replaced with porous feldspar in a pilot scale experiment, the thermal conductivity and heat storage characteristics were better than those of ordinary cement mortar, and an energy-saving effect of approximately 57% was observed, confirming the excellent applicability of porous feldspar as a building material.

Background: Inflammasomes recognize cytosolic danger signals, including pathogens, and subsequently induce the secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β. Studying inflammasomes in the red fox (Vulpes vulpes) is crucial from a wildlife veterinary and public health perspective, as it can be used to help control and prevent the transmission of zoonotic pathogens. The understanding of how diversity in inflammasomes across species affects pathogen carriage in the red fox is still limited. Methods: We investigated the activation and intracellular mechanisms of three inflammasomes (NLRP3, AIM2, and NLRC4) in fox peripheral blood mononuclear cells (PBMCs), using established triggers and inhibitors derived from humans and mice. Results: Fox PBMCs exhibited normal activation and induction of IL-1β secretion in response to representative inflammasome triggers (ATP and nigericin for NLRP3, dsDNA for AIM2, flagellin for NLRC4). However, in inhibitor studies, MCC950, a selective NLRP3 inhibitor, suppressed IL-1β secretion mediated by the fox AIM2 and NLRC4 inflammasomes. Conclusions: These findings suggest that NLRP3 may have a common role in dsDNA- and flagellin-mediated inflammasome activation in the red fox. In conclusion, this fox inflammasome biology can be applied to the control of zoonotic infections and the treatment of inflammasome-mediated diseases in the red fox.

The deterioration of soil-cement in corrosive environment leads to the reduction of strength and the increase of permeability. Effective methods of determining deteriorated layer permeability coefficient of soil-cement are currently lacking. A laboratory test method for permeability coefficient of deteriorated layer was proposed using the modified permeability coefficient testing apparatus. According to the proposed method, the permeability coefficient of deteriorated layer can be obtained after testing the permeability coefficient of the soil-cement specimen in curing room and the equivalent permeability coefficient and deterioration depth of the soil-cement specimen in corrosion environment. Taking the marine dredger fill of Jiaozhou Bay for example, the deteriorated layer permeability coefficients of soil-cements with different cement contents were tested. It turned out that the permeability of deteriorated layer increases with the increase of age. At the beginning of curing age, larger cement content leads to smaller permeability coefficient of the deteriorated layer of soil-cement. As the curing age increases, the deteriorated layer permeability coefficient of the soil-cement with larger cement content becomes larger. The evolution of the permeability coefficient of deteriorated layer with age can be formulated as the Logistic function. This study provides a support for anti-permeability designs of soil-cement structures in corrosive environment.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Background and Objectives: Light therapy (LT) is used as an adjunctive treatment for sleep problems. This study evaluates the impact of LT on sleep quality and sleep-related parameters in patients with sleep disorders. Materials and Methods: We performed a pilot randomized, open-label clinical trial. Fourteen patients aged 20–60 years with sleep disorders for more than three months were randomized into the control and LT groups (1:1 ratio). The LT group was instructed to use a device that provides bright LT (6000 K, 380 lux, wavelength 480 nm) for at least 25 minutes before 09:00 am for two weeks. A self-reported questionnaire was used to evaluate circadian preference, mood, and sleep-related parameters. We analyzed serum cortisol levels and clock genes expression. Results: The Epworth Sleepiness Scale (ESS), insomnia severity index, and Pittsburgh Sleep Quality index were significantly improved within the LT group only after the two-week period. When comparing the two groups, only the change in ESS significant was significant (mean difference; control: -0.14 vs LT: -1.43, p=0.021) after adjusting for baseline characteristics. There were no significant differences in serum cortisol or clock genes expression. Conclusions: LT can improve daytime sleepiness in patients with sleep disorders; however, further well-designed studies are warranted to confirm its efficacy.

In Korea, rice is a major staple grain and is mainly cultivated using various agricultural machinery. Air pollutants emitted from agricultural machinery have their origins mainly from the exhaustion of internal combustion engines. In this study, emission characteristics of five main air pollutants by European Environment Agency's Tier 1 method for rice cultivation was analyzed. Diesel is a main fuel for agricultural machinery and gasoline is generally used only for rice transplanters as a fuel in Korea. Tractors consume 46% of total fuel consumption and 56% of diesel fuel consumption. Gasoline used for rice transplanters accounts for 17% of total fuel consumption each year. Tractors and rice transplanters are emitting 82% of all total pollutants. From 2011 to 2019, the total amount of air pollutant emissions was decrease by 15%. That accounted for the reduction of rice cultivation fields in those periods. Rice transplanting operation was in charge of 42% of total emissions. Then, harrowing, harvesting, tilling, leveling, and pest control operations generated 10%, 10%, 8%, 8% and 7% of total emissions, respectively. The contribution of each air pollutant held 54% of CO, 39% of NOx, 5% of NMVOC, and 2% of TSP from the total emission inventory. The three major regions emitting air pollutants from mechanized agricultural practices were Jeollanam-do, Chungcheongnam-do, and Jeollabuk-do, which consume 55% of total fuel usage in rice farming. The total amount of air pollutant emissions from rice cultivation practices in 2019 was calculated as 8,448 Mg in Korea.

Antibiotics’ effect on Mycoplasma pneumoniae (MP) infection still remains controversial. A prospective study of 257 children with MP pneumonia during a recent epidemic (2015-2016) was conducted. All MP pneumonia patients were treated with corticosteroids within 24-36 h after admission. Initially, oral prednisolone (1 mg/kg) or intravenous methylprednisolone (IVMP) (1-2 mg/kg) was administered for mild pneumonia patients, and IVMP (5 -10 mg/kg/day) for severe pneumonia patients. If patients showed persistent fever for 36-48 hours or disease progression, additive IVMP (5 mg/kg or 10 mg/kg) was given. Eighty-five patients received only a broad-spectrum antibiotic without macrolide. The mean age and the male:female ratio were 5.6 ± 3.1 years, respectively. Seventy-four percent of patients (190/257) showed immediate defervescence within 24 h, and 95.7% (246/257) of patients showed defervescence within 72 h with improvements in clinical symptoms. Eight patients who received additive IVMP also showed clinical improvement within 48 h without adverse reactions. There were no clinical or laboratory differences between patients treated with a macrolide (n = 172) and without (n = 85). Early corticosteroid therapy might reduce disease morbidity and prevent disease progression in MP pneumonia patients without side effects, and antibiotics may have limited effects on MP infection.

Fluid flow in human body is generally known to influence a variety of cellular behaviors. Different nanoparticle properties as well as cell type, interaction with other cells and cellular environments also show significant effect on nanoparticle uptake and drug efficacy. The aim of this study was to evaluate the effect of shear stress on cellular behaviors of biocompatible and biodegradable nanoparticles to cancer cells (A549 cell lines) in a biomimetic microfluidic system. We prepared a gelatin-oleic conjugate (GOC) as an amphiphilic biomaterial to prepare self-assembled gelatin-oleic nanoparticles (GON). Coumarin-6 and paclitaxel were used as the fluorescence marker and model drug, respectively, and were loaded into GONs by incubation (C-GONs; PTX-GONs). Additionally, we evaluated the cellular uptake of fluorescence labeled C-GONs and the drug efficacy of PTX-GONs. The cellular uptake of C-GONs by A549 cells in the absence of shear stress revealed that the mean fluorescence intensity was slightly decreased compared to that in the presence of shear stress. The results also indicated that negatively charged PTX-GONs had a lower cancer killing effect under dynamic conditions than that under static conditions. It also suggested that fluidic shear stress did not significantly affect drug uptake and efficiency in case of PTX-GONs. The cellular interactions between nanoparticles and cells in drug delivery should be carefully examined according to the physicochemical properties of nanoparticles such as the type of materials, size and mainly surface charge in a biomimetic microfluidic condition.

Commiphora molmol myrrh resin extracts, which have different physical properties such as polarity and dielectric constant, were prepared by immersion in extraction solvents (hot water, DMSO, hexane, ethanol, and methanol). Methanolic myrrh resin extracts showed broad antibacterial activity against isolated airborne bacteria. Furanoeudesma-1,3-diene and curzerene, as the main terpenoids in the methanolic myrrh resin extract, were analyzed using GC-MS, and the methanolic myrrh resin extracts were found to have antiviral activity (81.2% viral RNA inhibition) against H1N1 influenza virus. Biochars (wood powder-and rice husk-derived) coated with myrrh resin extracts also showed antiviral activity (22.6% and 24.3% viral RNA inhibition), due to the adsorption of terpenoids onto biochar. Myrrh resin extract using methanol as the extraction solvent is a promising agent with antibacterial and antiviral efficacy, and it can be utilized as a novel material via adsorption onto biochar for air filtration processes, cosmetics, fertilizers, drug delivery, and corrosion inhibition.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

Objectives: To assess clinical implications of increased nuchal translucency (INT) in twin pregnancies based on the chorionicity. Methods: This was a retrospective review of the twin pregnancies who underwent first trimester ultrasound with nuchal translucency (NT) measurement at 11-13 weeks of gestation from January 2006 to December 2014. Data were collected using the OB database and the chart review. Pregnancy outcomes including gestational weeks at the delivery, abnormal fetal karyotypes, fetal structural anomalies, twin specific complications were analyzed. Results: A total of 1,622 twin pregnancies with INT≥95th percentile in one or both fetuses were identified. In all twin pregnancies with INT, abnormal fetal karyotypes were identified in 17 (8.6%) patients (odds ratio=13.28, CI=5.990-29.447, P=0.000) and twin-specific complications were identified in 23 (11.6%) patients (odds ratio=2.398, CI=1.463-3.928, P=0.001) compared to those with normal NT. Among the INT group, when the groups were subdivided into monochorionic (MC) and dichorionic (DC) pregnancies, 14.8% and 29.6% of the MC pregnancies had structural anomalies in one or both fetuses (odds ratio=5.774, 95% CI=1.445-23.071, P=0.01) and twin-specific complications (odds ratio=4.379, 95% CI=1.641-11.684, P=0.03), respectively, compared to DC pregnancies. The prevalence of abnormal fetal karyotypes was not statistically different in patients with INT when compared between MC and DC pregnancies (P=0.329). Conclusions: INT was associated with a higher rate of twin-specific complications and fetal structural anomalies in MC twin pregnancies rather than abnormal fetal karyotype. Therefore, NT measurement in MC twin pregnancies can be a useful tool for prediction of adverse pregnancy outcomes. Appropriate counseling and surveillance based on the chorionicity is imperative in prenatal care of twin pregnancies.

The so-called “Chinese pyramids” are huge burial mounds covering the tombs of the Emperors of the Western Han dynasty. If we include also the mounds of the members of the royal families, these monuments sum up to more than 40, scattered throughout the western and the southern outskirts of modern Xi'an. They are mostly unexcavated and poorly known although, taken together, they form a fascinating sacred landscape, which was conceived as a perennial witness of one of the most magnificent Chinese dynasties. This sacred landscape is today encroached by the frenetic urban development of the Xi’an urban area. We discuss and elaborate here some of the results of a recent, new satellite-imagery survey of these monuments, highlighting the aspects which may contribute to solutions for a sustainable and compatible development within this important ancient landscape.

Wool quality and yield are important economic traits of livestock. In this study, the skin tissues of the upper scapula of Super Merino sheep (SM) and Small-Tailed Han sheep (STH) during the growing period were studied. Differentially expressed (DE) long non-coding RNAs (lncRNAs) and messenger RNAs (mRNA) were identified via histopathological observation and high-throughput RNA sequencing. Gene ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) were used to analyze differentially expressed genes. Reverse transcription quantitative Polymerase Chain Reaction (RT-qPCR) was used to verify nine selected DE lncRNAs and five DE mRNAs. Significant differences were found in the expression levels of LOC114113396 (KRTAP15-1), CRABP1, KRT10, KRTAP1-3, KRTAP4.3, KRT2, FGF1, IGF-1, and KIT in SM and STH skin tissues. These results indicate that these mRNAs may play an important role in the growth and development of hair follicles and the regulation of hair fiber traits. Differentially expressed lncRNA target genes and mRNAs were mainly enriched in biological processes and pathways related to skin development and fiber traits, which is consistent with previous studies. LncRNA MSTRG.9225.1, MSTRG.124320.1, MSTRG.96951.1, MSTRG.91685.1, MSTRG.122229.1, MSTRG.89255.1, MSTRG.98769.1, and MSTRG.84658.1 may indirectly participate in the growth and development of sheep hair follicles and the regulation of hair fiber diameter by regulating the expression of their respective target genes. These candidate lncRNAs and mRNAs may provide a basis for the study of sheep hair follicle growth and development and hair fiber traits.

The aim of this paper is to compare the taxonomic composition and species diversity of the macrozoobenthos in Maritsa River (Bulgaria) and Han River (South Korea). Samples were collected at 15 selected sites in each river, including some of their main tributaries in 2020 and 2021. The number of the taxa recorded in Maritsa River was more than twice as great as in Han River: 192 taxa belonging to 19 systematic groups compared to 88 taxa belonging to 18 groups respectively. The order Ephemeroptera had the highest species richness: 31 taxa in the Bulgarian rivers and 26 taxa in the South Korean ones. The macrozoobenthic communities responded and adapted to the various conditions and impacts in the water environment with changes in the species composition and structure. The analysis of the similarity in the taxonomic composition showed low resemblance between all study sites but displayed distinct separations between the rivers and the two years. In general, the species structure of the macrozoobenthic communities in Maritsa River and its studied tributaries was better than in Han River. In both years, high species diversity was recorded at the reference sites in the rivers, characterized by conditions closely resembling natural environments. The species richness and the evenness of macrozoobenthos were very low at sites downstream subjected to considerable anthropogenic pressure. Some of the communities in Han River were almost destroyed completely.

Magnetoelectric (ME) sensor is a new type magnetic sensor with ultrahigh sensitivity, low power consumption, and suitable for the measurement of low frequency weak magnetic field. In this study, metglas/PZT-5B ME sensor with a mechanical resonance frequency f_res of 60.041 kHz was prepared. It is interesting to note that its magnetic field resolution reaches 0.20 nT at f_res and 0.34 nT for DC field, respectively. In order to measure the ultralow frequency AC magnetic fields, a frequency upconversion technique was employed. Under this technique, a limit of detection (LOD) of AC magnetic field lower than 1 nT at 8 Hz is obtained, and the minimum LOD of 0.51 nT is achieved at 20 Hz. The high resolution ME sensor with sub-pT level is promising in the field of low frequency weak magnetic field measurement technology.

In order to reduce the large damage caused by train derailment, protective facilities of various shapes and conditions can be installed on railroad tracks. These protective facilities are referred to as derailment containment provisions (DCPs) and three different types are used worldwide. However, there are no clear standards for DCPs design such as installation location, size, and design load, and performance verification of DCPs installed in the actual railway field is not sufficiently performed. In this paper, the functionality of DCPs is analyzed through the full-scale derailment test. In order to propose a method for estimating the collision load acting on the DCP type I after derailment, the experimental results and simulation results are compared. The function of DCP type I according to the change of the vehicle's center of gravity is identified through comparative analysis of the post derailment behavior.

UAV cooperative control has been an important issue in UAV-assisted sensor network, thanks to the considerable benefit obtained from cooperative mechanism of UAVs being applied as a flying base station. In coverage scenario, the tradeoff between coverage performance and transmission performance often makes deployment of UAVs fall into a dilemma, since both indexes are related to the distance between UAVs. To address this issue, UAV coverage and data transmission mechanism is analyzed in this paper, then an efficient multi-UAV cooperative deployment model is proposed. The problem is also modeled as a coalition formation game (CFG). The CFG with Pareto order is proved to have a stable partition. Then, an effective approach consisting of coverage deployment and coalition selection is designed, wherein UAVs can decide strategies cooperatively to achieve better coverage performance. Combining analysis of game approach, a coalition selection and position deployment algorithm based on Pareto order (CSPDA-PO) is designed to execute coverage deployment and coalition selection. Finally, simulation results are shown to validate the proposed approach based on efficient multi-UAV cooperative deployment model.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

The purpose of this study is to develop and evaluate a self-microemulsifying drug delivery system (SMEDDS) to improve the oral absorption of poorly water-soluble Olaparib. Through the solubility test of Olaparib in various oils, surfactants and co-surfactants, pharmaceutical excipients for use in SMEDDS manufacturing were selected. Self-emulsifying regions were identified by mixing the selected materials at various ratios, and a pseudoternary phase diagram was constructed by synthesizing these results. Various physicochemical properties of microemulsion incorporating Olaparib were confirmed by investigating the particle morphology, particle size, zeta potential, drug content and stability. In addition, the improved dissolution and oral absorption of Olaparib were also confirmed through a dissolution test and a pharmacokinetic study. An optimal microemulsion was generated in the formulation of Capmul MCM EP/NF 10%, Labrasol 80% and PEG 400 10%. Fabricated nano-sized microemulsions were well-dispersed in aqueous solutions, and it was also confirmed that it was maintained well without any problems of either physical or chemical stability. The 5 min initial dissolution of Olaparib in fabricated formulations was improved by 10.6 times (pH1.2), 14.8 times (pH6.8) and 14.8 times (distilled water) compared to the values of Olaparib powder. The dissolution at 120min was 45.4±4.0%(pH1.2), 53.5±1.1% (pH6.8) and 58.1±1.00% (distilled water) in Olaparib powder but has been significantly improved by 1.7 times (74.8±1.9%), 1.6 times (84.2±0.3%) and 1.5 times (81.2±0.7%) in SMEDDS. Associated with the high dissolutions of Olaparib in fabricated microemulsions, the pharmacokinetic parameters were also greatly improved. The Cmax and AUCinf of Olaparib in the prepared microemulsion were increased 4.2- and 3.2-fold, respectively, compared to powder. Taken together with the results mentioned above, the microemulsion system could be an effective tool as an oral delivery formulation for Olaparib. Additionally, our results demonstrate that the SMEDDS systems comprising Capmul MCM, Labrasol and PEG 400 could be a useful option for improvement of several other poorly water-soluble drugs with physico-chemical properties similar to Olaparib.

In an effort to enhance the efficiency and safety of open-pit mines, this study explores the optimization of end slope road parameters and slope structures, specifically focusing on unmanned driving lanes.A significant aspect of the study is the development of a truck trajectory offset model, which considers the different reaction times between automated sensors and human drivers in adapting to environmental changes. To test these concepts, the study uses numerical simulations to confirm the stability of the proposed end slope designs. Using Victory West Mine No. 1 as a case study, the research determines the optimized width for unmanned driving lanes and the maximum angle for safe steepening of end slopes. The findings indicate that the optimized unmanned lane width for NTE240 mining dump trucks is 1743 mm, allowing for a 2-degree increase in the slope angle at the south end slope. This optimization leads to a steep mining stripping volume of 3.2735 million m³ and a coal output of 2.49628 million tons, maintaining a stripping ratio of 1.31m³/t. These results demonstrate that the unmanned driving road width optimization not only ensures slope safety but also significantly boosts the economic benefits of steep mining in open-pit mines.

A fern, Polypodium aureum, possesses a specialized spore-releasing mechanism like a catapult induced by quick expansion of vaporized bubbles. This study introduces lipid-coated perfluorocarbon droplets to enable repeatable vaporization-condensation cycles, inspired by the repeatable vaporization of Polypodium aureum. Lipid-perfluorocarbon droplets have been considered not to exhibit repeatable oscillations due to bubble collapse by low surface tension of lipid layers. However, a single lipid-dodecafluoropentane droplet with a diameter of 9.17 µm shows expansion-contraction oscillations over 4,000 cycles by changing lipid composition and applying low power of 1.7 MHz ultrasound to induce partial vaporization of droplets. The optimal combinations of shell composition, droplet fabrication, and acoustic conditions can minimize damage on shell structure and quick recovery of damaged shell layers. The highly-expanding oscillatory microbubbles provide a new direction for fuel-free micro or nanobots as well as biomedical applications of contrast agents and drug delivery.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

Falls, highly common in the constantly increasing global aging population, can have a variety of negative effects on their health, well-being, and quality of life, including restricting their capabilities to conduct Activities of Daily Living (ADLs), which are crucial for one’s sustenance. Timely assistance during falls is highly necessary, which involves tracking the indoor location of the elderly during their diverse navigational patterns associated with ADLs to detect the precise location of a fall. With the decreasing caregiver population on a global scale, it is important that the future of intelligent living environments can detect falls during ADL.s while being able to track the indoor location of the elderly in the real world. Prior works in these fields have several limitations, such as – the lack of functionalities to detect both falls and indoor locations, high cost of implementation, complicated design, the requirement of multiple hardware components for deployment, and the necessity to develop new hardware for implementation, which make the wide-scale deployment of such technologies challenging. To address these challenges, this work proposes a cost-effective and simplistic design paradigm for an Ambient Assisted Living system that can capture multimodal components of user behaviors during ADLs that are necessary for performing fall detection and indoor localization in a simultaneous manner in the real world. Proof of concept results from real-world experiments are presented to uphold the effective working of the system. The findings from two comparison studies with prior works in this field are also presented to uphold the novelty of this work. The first comparison study shows how the proposed system outperforms prior works in the areas of indoor localization and fall detection in terms of the effectiveness of its software design and hardware design. The second comparison study shows that the cost for the development of this system is the least as compared to prior works in these fields, which involved real-world development of the underlining systems, thereby upholding its cost-effective nature.

The objective of this study was to assess the effects of parity and lactation stage on the content and conversion rate of DHA in milk from dairy cows fed ruminally protected algae powder. A total of 800 cows were blocked by parity and divided into eight groups (n = 100, three groups of primiparous cows and five groups of multiparous cows) in a six-month experimental period. The lactation period was divided into three stages: 16 – 100 d, 101 – 200 d, and 201–305 d. All cows were fed 100 g of DHA-rich algae powder twice a day, with the DHA content > 13%. Milk samples were collected monthly, and daily milk yield and dry matter intake were recorded. Using infrared spectroscopy, we determined the content of protein, fat, lactose, and total solids in milk and calculated the DHA conversion rate. The results showed that parity and lactation stage had no significant effects on milk composition. However, milk yield and dry matter intake were higher in multiparous cows than in primiparous cows. The DHA content and conversion rate in milk were not significantly different between parity groups but were positively correlated with lactation stage and negatively correlated with milk fat content.

In this paper, the sol−gel method was used to synthesize powders of LaMnO3 (LMO), La0.85Ca0.15MnO3 (LCM), and La0.85Sr0.15MnO3 (LSM). We investigated the impact of substituting Ca and Sr at the A−site on the perovskite crystal structure and electrochemical capabilities of LMO. LCM retained its orthogonal structure in comparison to the parent LMO components, whereas LSM transitioned to a rhombic structure. At 0.5 A/g, the specific capacitance of LCM and LSM electrodes is 185.5 F/g and 248 F/g, respectively.The specific capacitance of LCM was more three times than that of the LMO electrode. Among the three samples (LMO, 22.25 m2 g−1; LSM, 31.56 m2 g−1), the LCM sample exhibited the highest specific surface area of 38.79 m2 g−1. The charge transfer resistances of the LMO, LCM, and LSM are 0.48 Ω, 0.36 Ω, and 0.38 Ω, correspondingly. The LCM electrode exhibits the greatest capacitance performance due to its more refined morphology, increased concentration of oxygen vacancy, and more complete utilization of the perovskite bulk structure. The above results demonstrate that Ca or Sr substitution of A−site compounds has great potential for supercapacitor applications.

Tuning fork gyroscopes (TFGs) are promising for potential high-precision applications. This work proposes and experimentally demonstrates a novel high-Q dual mass tuning fork microelectro-mechanical system (MEMS) gyroscope utilizing three-dimensional (3D) packaging techniques. Except for two symmetrically-decoupled proof masses (PM) with synchronization structures, a symmetrically-decoupled lever structure is designed to force the antiparallel, antiphase drive-mode motion and basically eliminate the low-frequency spurious modes. The thermoelastic damping (TED) and anchor loss are greatly reduced by the linearly-coupled, momentum- and torque-balanced antiphase sense mode. Besides, a novel 3D packaging technique is used to realize high Q-factors. A composite substrate encapsulation cap, fabricated by through-silicon-via (TSV) and glass-in-silicon (GIS) reflow processes, is anodically bonded to the sensing structures at wafer scales. A self-developed control circuit is adopted to realize loop control and characterize gyro-scope performances. It is shown that a high-reliability electrical connection together with a high-air-impermeability package can be fulfilled with this 3D packaging technique. Furthermore, the Q-factors of the drive and sense modes reach up to 51947 and 49249, respectively. This TFG realizes a wide measurement range of ±1800° /s and a high resolution of 0.1° /s with a scale-factor nonlinearity 720 ppm after automatic mode-matching. Besides, the long-term zero-rate output (ZRO) drift can be effectively suppressed by temperature compensation, inducing a small angle random walk (ARW) of 0.923°/√h and a low bias instability (BI) of 9.270°/h.

With the development of designing and manufacturing level for micro-electromechanical system (MEMS) gyroscopes, the control circuit system becomes a key point to determine their internal performances. Nevertheless, phase delay of electron components may result in some serious hazards. This paper describes a real-time circuit phase delay correction system for MEMS vibratory gyroscopes. A detailed theoretical analysis is provided to clarify the influences of circuit phase delay on the in-phase and quadrature (IQ) coupling characteristics and zero rate output (ZRO) utilizing force-to-rebalance (FTR) closed-loop detection and quadrature correction system. By deducing the relationship between amplitude-frequency, phase-frequency of MEMS gyroscope and the phase relationship of the whole control loop, a real-time correction system is proposed to automatically adjust the phase reference value of phase-locked loop (PLL) and thus compensate for the real-time circuit phase delay. The experimental results show that the correction system can accurately measure and compensate the circuit phase delay in real time. Furthermore, the unwanted IQ coupling can be eliminated and the ZRO is decreased by 755% to 0.095°/s. This correction system realizes a small angle random walk of 0.978°/√h, and a low bias instability of 9.458°/h together with a scale factor nonlinearity of 255 ppm at room temperature. Besides, the thermal drift of ZRO is reduced to 0.0034°/s/°C at a temperature range from -20°C to 70°C.

Background The purpose of this study was to evaluate the prevalence of velamentous cord insertion (VCI) and the actual association between pathologically confirmed VCI and perinatal outcomes in twins based on the chorionicity. Methods All twin pregnancies who received prenatal care at a specialty clinic for multiple pregnancies, from less than 12weeks of gestation until delivery in a single institution between 2015 and 2018 were included in this retrospective cohort study. Results A total of the 941 twins were included in the study. The prevalence of VCI in dichorionic (DC) twins and monochorionic diamniotic (MCDA) twins was 5.8% and 7.8%, respectively (p=0.251). In all study population, the prevalence of vasa previa and placenta accreta were higher in VCI group compared to that of non-VCI group (p=0.008 and 0.022). In MCDA twins with VCI, birth weight, 1 and 5-minute Apgar score were lower compared to DC twins with VCI (p=0.010, 0.002 and 0.000). There was no significant association between VCI and selective fetal growth restriction (p=0.708), twin-to-twin transfusion syndrome (p=0.400) and birth-weight discordance (>20% and >25%) (p= 0.378 and 0.161) in MCDA twins. Conclusion VCI in twins was not a risk factor for adverse perinatal outcomes and twin-specific complications.

Highly photoluminescent C-Dots are prepared by hydrothermal reaction of citric acid and piperazine as dual reason in both hydrolysis and surface passivation agent along with the N-doping agent. The resulting C-Dots without external passivation showed PL enhancement by electron transfer from C-Dots-donor to piperazine-acceptor with the maximum emission yields of more than 84%. After mixing the prepared C-Dots with the mixture of EtOH and acetone (1:1 vol %), a novel washing process was performed by centrifugation to remove the precursors and by-products. The resulting C-Dots showed much better stability than dialysis. For evaluating the possible application of the C-Dots as a fluorescent biological probe which possess the wide dosing window and multicolor properties. The C-Dots were localized in perinuclear vacuole-like structures with granular pattern in cytoplasm sparing the nucleus. No signs of any morphological deterioration like nuclear shrinkage were observed.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

This paper presents the findings of an exploratory study on the continuously generating Big Data on Twitter related to the sharing of information, news, views, opinions, ideas, knowledge, feedback, and experiences about the COVID-19 pandemic, with a specific focus on the Omicron variant, which is the globally dominant variant of SARS-CoV-2 at this time. A total of 12028 tweets about the Omicron variant were studied, and the specific characteristics of tweets that were analyzed include - sentiment, language, source, type, and embedded URLs. The findings of this study are manifold. First, from sentiment analysis, it was observed that 50.5% of tweets had the ‘neutral’ emotion. The other emotions - ‘bad’, ‘good’, ‘terrible’, and ‘great’ were found in 15.6%, 14.0%, 12.5%, and 7.5% of the tweets, respectively. Second, the findings of language interpretation showed that 65.9% of the tweets were posted in English. It was followed by Spanish or Castillian, French, Italian, Japanese, and other languages, which were found in 10.5%, 5.1%, 3.3%, 2.5%, and <2% of the tweets, respectively. Third, the findings from source tracking showed that “Twitter for Android” was associated with 35.2% of tweets. It was followed by “Twitter Web App”, “Twitter for iPhone”, “Twitter for iPad”, “TweetDeck”, and all other sources that accounted for 29.2%, 25.8%, 3.8%, 1.6%, and <1% of the tweets, respectively. Fourth, studying the type of tweets revealed that retweets accounted for 60.8% of the tweets, it was followed by original tweets and replies that accounted for 19.8% and 19.4% of the tweets, respectively. Fifth, in terms of embedded URL analysis, the most common domains embedded in the tweets were found to be twitter.com, which was followed by biorxiv.org, nature.com, wapo.st, nzherald.co.nz, recvprofits.com, science.org, and other URLs. Finally, to support similar research and development in this field centered around the analysis of tweets, we have developed an open-access Twitter dataset that comprises tweets about the SARS-CoV-2 omicron variant since the first detected case of this variant on November 24, 2021.

Citrus peel has been used in Asian traditional medicine for the treatment of cough, asthma, and bronchial disorders. However, the anti-inflammatory effect of quercetogetin (QUE), a polymethoxylated flavone isolated from the peel of citrus unshui is poorly understood. We investigated the anti-inflammatory effect and the molecular mechanisms of QUE in lipopolysaccharide (LPS)-induced RAW264.7 cells. QUE inhibited the production of NO and prostaglandin E2 by suppressing the LPS-induced expression of inducible nitric oxide synthase and cyclooxygenase-2 at both the mRNA and protein levels. QUE suppressed the production of proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α. QUE also inhibited the translocation of the nuclear factor kappa B subunit, p65, into the nucleus by interrupting the phosphorylation of IκB-α in LPS-induced RAW 264.7 cells. Based on the finding that QUE significantly decreased p-ERK protein expression in LPS-induced RAW264.7 cells, we confirmed that suppression of the inflammatory process by QUE was mediated through the MAPK pathway. This is the first report on the strong anti-inflammatory effects of QUE, which is a compound that can potentially be used as a therapeutic agent for inflammatory diseases.

The roots, leaves, and other parts of American ginseng contain ginsenosides and polyphenols, among other bioactive components. So far, reports on exploring the changes in bioactive components within its leaves after heat treatment have been limited. In the present study, we investigated the effects of far-infrared irradiation (FIR) heat treatment from 160 to 200 ℃ on the deglycosylation and dehydration rates of the bioactive components in American ginseng leaves. As the temperature was increased, the amounts of constant ginsenosides decreased while those of rare ginsenosides increased. After FIR heat treatment of the American ginseng leaves at an optimal 190 ℃, the highest total polyphenolic content and kaempferol content were detected, the antioxidant activity was significantly enhanced, and the amounts of rare ginsenosides F4, Rg6, Rh4, Rk3, Rk1, Rg3, and Rg5 were 41, 5, 37, 64, 222, 17, and 266 times higher than those in the untreated leaves, respectively. Moreover, the radical scavenging rates for 2,2-diphenyl-1-picrylhydrazyl and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the reducing power of the treated leaf extract, were 2.17, 1.86, and 1.77 times higher, respectively. Hence, optimal FIR heat treatment at 190 ℃ is an efficient method for producing beneficial bioactive components from American ginseng leaves.

Perilla frutense var. acuta (Lamiaceae) has been used to treat indigestion, asthma, and allergies in traditional medicine. In this study, luteolin 7-O-diglucuronide (1), apigenin 7-O-diglucuronide (2), and rosmarinic acid (3) were isolated from the leaves of P. frutescens var. acuta. Various approaches were performed to investigate the anti-inflammatory activity of the isolated compounds (1-3) and their working mechanisms. In silico docking simulation demonstrated that 1-3 would work as a PPAR-α/δ/γ agonist, and in vitro PPAR-α/δ/γ transcriptional assay showed that the Perilla extract and 3 increased PPAR-α luciferase activity [1.71 and 1.61 times of the control (PPAR-α + PPRE, p < 0.001)]. In the NF-κB luciferase assay, 1 suppressed NF-κB activity the most (56.83 % at 5 µM; 74.96 % at 10 µM; 79.86 % at 50 µM). In addition, 1 and 2 inhibited the mRNA expression of NF-κB target genes, including Il6, Mcp1, and Tnfa, at 50 µM, and 3 suppressed the genes at the mRNA level in a dose-dependent manner. We report that 1 and 2 exert anti-inflammatory effects through NF-κB inhibition, and PPAR-α/NF-κB signaling pathway is related to the anti-inflammatory activity of 3.

Preproenkephalin (PPE) is a precursor molecule for multiple endogenous opioid peptides Leu-enkephalin (ENK) and Met-ENK, which are involved in a wide variety of modulatory functions in the nervous system. Despite the functional importance of ENK in the brain, the effect of brain-derived factor(s) on PPE expression is unknown. We report the dual effect of neural epidermal growth factor (EGF)-like-like 2 (NELL2) on PPE gene expression. In cultured NIH3T3 cells, transfection of NELL2 expression vectors induced an inhibition of PPE transcription intracellularly, in parallel with downregulation of protein kinase C signaling pathways and extracellular signal-regulated kinase. Interestingly, these phenomena were reversed when synthetic NELL2 was administered extracellularly. The in vivo disruption of NELL2 synthesis resulted in an increase in PPE mRNA level in the rat brain, suggesting that the inhibitory action of intracellular NELL2 predominates the activation effect of extracellular NELL2 on PPE gene expression in the brain. Biochemical and molecular studies with mutant NELL2 structures further demonstrated the critical role of EGF-like repeat domains in NELL2 for regulation of PPE transcription. These are the first results to reveal the spatio-specific role of NELL2 in the homeostatic regulation of PPE gene expression.

This work compared the performance of three methods for constructing a regional ensemble prediction system (EPS) for wind speed forecasts: dynamical downscaling, breeding of growth modes (BGM), and blending method. The Weather Research and Forecasting (WRF) model was used to downscale the European Centre for Medium-range Weather Forecast (ECMWF) EPS. In addition, as the BGM method needs observation data for generating scaling factors, an alternative method for generating scaling factors was proposed to eliminate dependence on observation data. One-month tests between October 1st and October 30th, 2020, were implemented to evaluate the performance of three methods in the Gansu province of China. The results demonstrate that the blending method outperforms the other two methods. Furthermore, the difference in performance is evident mainly in early forecast lead time and becomes negligible as forecast time increases.

Species have shown their habital variations in responding to climate change, especially during the spring and summer spawning seasons. The species distribution model (SDM) is considered the most favorable tool to study the potential effects of climate change on species distribution. Therefore, we developed the ensemble SDM to predict the changes in species distribution of Portunus trituberculatus among different seasons in 2050 and 2100 under the climate scenarios RCP4.5 and RCP8.5. The results of SDM indicate that the distribution of this species will move northward and have obviouse seasonal variations. Meanwhile, the suitable habitat for the species will be significantly reduced in summer, with loses rates ranging from 45.23% (RCP4.5) to 88.26% (RCP.8.5) by 2100s. Habitat reduction will mainly occur in the East China Sea and southern part of the Yellow Sea, while there will be a small increase in the northern Bohai Sea. These findings will be important to manage the ecosystem and fishery, provide an information forecast of this species in the future, and maintain species diversity if the seawater temperature rises.

Although numerous citrus varieties have recently been developed to enhance their quality, information on their quality characteristics is limited. We assessed the quality characteristics of Yellowball, a novel citrus variety, by evaluating its appearance, storability, sensory properties, functionality, and metabolite profiles and comparing these characteristics with those of its parent varieties: Haruka and Kiyomi. The metabolite profiles between the citrus varieties differed significantly, resulting in distinct physicochemical and functional qualities. The storability of Yellowball was significantly increased compared with that of its parent varieties owing to its strong antifungal activity and unique peel morphology, including the stoma and albedo layers. While we did not investigate the volatile compounds, overall functional activities, and detailed characteristics of each metabolite, our data provide valuable insights into the relationship between citrus metabolites, peel morphology, physicochemical properties, and storability and demonstrate the potential of Yellowball as a promising variety in the citrus industry.

In this study, ozone oxidation experiment was carried out for the removal of fluorescent whitening agent which is widely used in textile dyeing and paper industry. The stilbene fluorescent whitening agent has been industrialized since the earliest, and the amount of current production is the highest. Due to the characteristics of the fluorescent whitening agent that cannot be removed by conventional wastewater treatment methods, the fluorescent whitening agent in wastewater treatment has difficulty in using as recycled water in the process. Pre-treatment ozone oxidation experiment was conducted prior to the introduction of Membrane Bio Reactor (MBR) treatment process by converting biodegradable materials into biodegradable materials. The removal efficiencies of fluorescent whitening agents, a diaminostilbene disulfonic acid derivative by ozone oxidation were evaluated by UV254 Scan, COD, T-N and color using a synthetic wastewater sample (COD=433.0 mg/ℓ) and paper and paper mill wastewater (COD=157.2 mg/ℓ).

In this study, effluent water was produced through Submerged Membrane Bio-Reactor (SMBR) process, which is a simple system and decomposes organic matter contained in wastewater with biological treatment process and performs solid-liquid separation, Especially, ozone oxidation treatment process is applied to effluent water containing fluorescent whitening agent, which is a trace pollutant which is not removed by biological treatment, and influences the quality of reused water. The concentration of COD in the SMBR was 449.3 mg/ℓ-COD, and the concentration of permeate water was 100.3 mg/ℓ-COD. The removal efficiency was about 70.1%. The amount of ozone re- quired for the removal of the fluorescent whitening agent in the permeated water in SMBR was 6.67 g-O3/min, and the amount of ozone required to remove COD relative to the permeate water was calculated to remove 0.997 mg-COD for 1 mg of O3.

During the high-speed flight of a vehicle in the atmosphere, surface friction with the air generates aerodynamic heating. The aerodynamic heating phenomenon can create extremely high temperatures near the surface. These high temperatures impact material properties and the structure of the aircraft, so thermal deformation measurement is essential in aerospace engineering. This paper revisits high-temperature deformation measurement using the digital image correlation (DIC) technique under high-intensity blackbody radiation with a precise speckle pattern fabrication and a heat haze reduction method. The effect of speckle pattern on the DIC measurement has been thoroughly studied at room temperature, but high-temperature measurement studies have not reported such effects so far. We found that the commonly used methods to reduce the heat haze effect could produce incorrect results. Hence, we propose a new method to mitigate heat haze effects. An infrared radiation heater was employed to make an experimental setup that could heat a specimen up to 950 ℃. First, we mitigated image saturation using a short-wavelength bandpass filter with blue light illumination, a standard procedure for high-temperature DIC deformation measurement. Second, we studied how to determine the proper size of the speckle pattern under a high-temperature environment. Third, we devised a reduction method for the heat haze effect. As proof of the effectiveness of our developed experimental method, we successfully measured the deformation of stainless steel 304 specimens from 25 ℃ to 800 ℃. The results confirmed that this method can be applied to the research and development of thermal protection systems in the aerospace field.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

Diastolic dysfunction, a prevalent condition characterized by impaired relaxation and filling of the left ventricle, significantly contributes to heart failure with preserved ejection fraction (HFpEF). Galectin-3, a β-galactoside-binding lectin, has garnered attention as a potential biomarker and mediator of fibrosis and inflammation in cardiovascular diseases. This comprehensive review investigates the impact of galectin-3 on diastolic dysfunction. We explore its molecular mechanisms, including its involvement in cellular signaling pathways and interaction with components of the extracellular matrix. Evidence from both animal models and clinical studies elucidates galectin-3's role in cardiac remodeling, inflammation, and fibrosis, shedding light on the underlying pathophysiology of diastolic dysfunction. Additionally, we examine the diagnostic and therapeutic implications of galectin-3 in diastolic dysfunction, emphasizing its potential as both a biomarker and a therapeutic target. This review underscores the significance of comprehending galectin-3's role in diastolic dysfunction and its promise in enhancing diagnosis and treatment approaches for HFpEF patients.

The Giant Babax, an endemic bird in China and a nationally protected wildlife species of Class Ⅱ, is primarily distributed in southern and southeastern Tibet. To investigate the factors influencing nesting site selection, this study conducted research on nest characteristics and nesting site preferences at four sample sites around Lhasa from March to October 2023y, using systematic search methods, tracking methods, and sampling methods. The research findings are as follows: (1) The average nest depth was (7.70±1.47)cm, nest height was (19.58±2.97)cm, inner diameter was (10.64±1.73)cm, outer diameter was (24.65±4.8)cm, average weight was (162.3±13.5)g, and average nest spacing within the plot was 396.93m. (2) The nests of Giant Babax were predominantly found on vegetation such as Salix longistamina (38%), Hippophae gyantsensis (20%), Rosa sericea Lindl. (14%), and Populus szechuanica Schneid(11%). They showed a preference for artificial secondary forests as nesting sites. (3) Giant Babax exhibited a preference for habitats with robust trees that had high canopies while being distant from houses and roads, but close to water sources; moreover, the canopy of the nesting tree played a crucial role in their choice of nesting sites. (4) The reproductive success rate reached 76%, with key factors affecting it being the canopy coverage of the nesting tree and the number of helpers. These research results provide fundamental data support for population conservation efforts and ecological resource management strategies concerning the Giant Babax.

Aim: We estimated the correlation between serum bilirubin concentrations and insulin resistance in advanced maternal age without diabetes mellitus. Method: The cross-sectional study involved consecutive 50 women of advanced maternal age without diabetes mellitus, and insulin resistance (IR) was diagnosed according to the homeostatic model assessment insulin resistant (HOMA-IR) formula and the cut-off point was set to more than 2.5. Serum bilirubin and HOMA-IR were compared between the IR (+) and IR (-) groups. Results: We found that serum bilirubin levels in the IR subjects were significantly decreased compared to those without IR (p = 0.0252). Serum bilirubin concentrations were negatively correlated with the weight and the fasting insulin concentrations in all subjects (r=−0.282, p=0.047, r=-0.424, p=0.002). Additionally, serum bilirubin had a negatively correlation with HOMA-IR (r = -0.410, p = 0.003) in all subjects. The multiple linear regression analysis found that serum total bilirubin levels were independently correlated with HOMA-IR (beta = -0.392, p= 0.015) in these subjects. Conclusions: The study demonstrated that serum bilirubin concentrations had negatively correlation with insulin resistance in advanced pregnant women without diabetes mellitus, and decreased serum bilirubin may forebode increased gestational diabetes mellitus risk in our study population.

This study analyzes the effect of economic growth and income distribution on health inequality using data from the Organization for Economic Cooperation and Development (OECD). A panel analysis was conducted by combining 21 years of data (from 2000 to 2020) from 38 OECD countries. Life expectancy and avoidable mortality were set as the dependent variables; gross domestic product and poverty gap were set as the independent variables; body mass index, consumption, smoking rate, healthcare personnel, number of beds in health service facilities, national medical expenses, and unemployment were set as control variables. First, economic growth and poverty gap significantly affect life expectancy and avoidable mortality. It has been confirmed that to resolve health inequality, growth during growth and distribution must be prioritized. Second, it has been confirmed that as the poverty gap increases, life expectancy increases and the avoidable mortality rate decreases. A mechanism different from the existence of a medical security system targeting the lowest class or an increase in the welfare of society worked. In conclusion, as a policy proposal to alleviate health inequality, this study suggests that policy intervention is necessary to block or alleviate the negative impact of income inequality in health care policies.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The critical period (CP) phenomenon in language development ranks among the 125 conundrums facing scientists in the 21st century, according to Science. While the phenomenon itself has been noncontroversial in first language acquisition, it still warrants an adequate explanation. Predicated on language acquisition as a complex process, questions among the first to be raised include: How do children accomplish this remarkable feat in such a short amount of time? And how do nature and nurture come together to influence language learning? In second language acquisition, however, both the notion of CP, albeit popular, and its empirical evidence have remained contested to this date - among the questions, whether the observed evidence counts as CP-specific and/or whether or not it warrants an isomorphic attribution to maturational constraints. Entwined in this debate are two well-established facets of inter-learner differential attainment. The first is that there exists a stark difference in ultimate attainment between younger and older learners. A second facet is the vast differences in ultimate attainment among older learners. In this article, adopting a social physics approach, we mathematically establish both the relationship between nature and nurture contributions and the presence of a critical period, and, at once, tender a parsimonious and probable theory for the twin phenomena of inter-learner differential attainment.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

Concrete cracks and local damage can affect the bond performance between concrete and steel bars, thereby reducing the durability of reinforced concrete structures. Compared with general concrete crack repair methods, biomineralization repair not only has effective bonding capabilities but is also particularly environmentally friendly. In view of this, this study aimed to apply biomineralization technology to repair damaged fiber-reinforced lightweight aggregate concrete (LWAC). Two groups of LWAC specimens were prepared. The control group used lightweight aggregates (LWAs) without bacterial spores and nutrient sources, and the experimental group used LWAs containing bacterial spores and nutrient sources. These specimens were first subjected to compression tests and pull-out tests, respectively, and thus were damaged. After the damaged specimen healed itself in different ways for 28 days, secondary compression and pull-out tests were conducted. The self-healing method of the control group involved placing the specimens in an incubator. The experimental group was further divided into experimental group I and experimental group II. The self-healing method of experimental group I was the same as that of the control group. The self-healing method of experimental group II involved soaking the specimen in a mixed solution of urea and calcium acetate for two days, and then taking it out and placing it in an incubator for two days, with a cycle of four days. The test results showed that, compared with the control group specimens, the relative bond strength ratio of the experimental group II specimens increased by 17.9%. Moreover, the EDS and XRD analysis results confirmed that the precipitate formed at the crack was calcium carbonate, which improved the compressive strength and bond strength after self-healing. This indicates that the biomineralization maintenance method used in experimental group II is more effective.

Large terrestrial carnivores play a crucial role in top-down control within terrestrial ecosystems, maintaining ecosystem stability and biodiversity. However, intense interspecific competition often arises among sympatric large carnivores, leading to population reductions or even extinctions. Spatial partitioning through divergent habitat selection helps mitigate such competition. In Xinlong County, Sichuan Province, we used 293 infrared cameras for monitoring from September to May 2016 and March to October 2022. By employing the Generalized Linear Model (GLM) and the Maximum Entropy Model (MaxEnt), we developed an ensemble model predicting the suitable habitat distribution of leopards (Panthera pardus) and wolves (Canis lupus). We analyzed the main environmental factors influencing habitat selection and the fragmentation of suitable habitats. We found that suitable habitat distribution differed significantly between them. Both species preferred areas with gentle slopes close to settlements. While leopards' habitat selection primarily depended on the distance from settlements, the slope was predominant for wolves. Suitable habitats displayed aggregation, yet wolves exhibited higher fragmentation and more complex patch shapes, indicating greater susceptibility to human activities. These results suggest that sympatric large carnivores, such as leopards and wolves, can reduce spatial competition intensity and promote spatial partitioning by selecting divergent suitable habitats, thereby facilitating species coexistence.

Mycophenolate mofetil was reported to have broad in vitro activity against different viruses and had been tried in combination with IFN-β in treating MERS infection. We tested the pharmacological activity of mycophenolate mofetil using SARS-CoV-2 infected Vero cells. The half-maximal effective concentration (EC₅₀) of mycophenolate mofetil against SARS-CoV-2 was 0.47 μM while that of remdesivir was 0.77 μM. Molecular docking results of mycophenolate mofetil to potential target proteins of COVID-19 suggested that mycophenolate mofetil might inhibit SARS-CoV-2 mainly by interacting with DHODH and IMPDH2. Furthermore, mycophenolate mofetil as an immunosuppressant may be a good therapeutic option for the management of hyperinflammation in patients with severe COVID-19. Based on its high potency against SARS-CoV-2 in Vero E6 cells, its good pharmacokinetics and clinical safety profile, mycophenolate mofetil deserves further exploration as potential treatment for COVID-19.

Until now, crystalline NiCo2S4 and its composites have demonstrated improve performances in supercapacitor applications, compared to their oxide analogous, due to their relatively higher electrical conductivity, and multifaceted redox reaction. However, amorphous phase materials have recently shown promise in electrochemical energy storage systems. In this work, urea-assisted amorphous NiCo2S4 on nickel foam (referred to as aNCS) with high nitrogen atom% content, was obtained via hydrothermal method. In comparison to the crystalline NiCo2S4 (referred to as cNCS), aNCS exhibited superior electrochemical performance with specific capacitance of ~3506 F g-1 which is higher than cNCS specific capacitance of ~2185 F g-1 at 2 A g-1. Additionally, aNCS in two-electrode asymmetry supercapacitor exhibited specific capacitance and energy density of ~196 F g-1 and 56 Wh kg-1, respectively.

Radio-dynamic therapy (RDT), as an emerging cancer treatment method, has attracted attention due to its remarkable therapeutic efficacy using low-dose, high-energy radiation (such as X-rays), and has shown significant potential in cancer treatment. The RDT system typically consists of scintillators and photosensitizers. Scintillators absorb X-rays and convert them to visible light, activating nearby photosensitizers to generate cytotoxic reactive oxygen species (ROS). Challenges faced by the two-component strategy, including low loading capacity and inefficient energy transfer, hinder its final effectiveness. In addition, the tumor microenvironment (TME) with hypoxia and immunosuppression limits the efficacy of RDTs. Recent advances introduce one-component RDT systems based on nanomaterials with high-Z metal elements, which effectively inhibit deep-seated tumors. These novel RDT systems exhibit immune enhancement and immune memory, potentially eliminating both primary and metastatic tumors. This review comprehensively analyzes recent advances in the rational construction of RDTs, exploring their mechanisms and its application in the treatment of deep-seated tumors. Aimed at providing a practical resource for oncology researchers and practitioners, the review offers new perspectives for potential future directions in RDT research.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Since large articulated vehicles have uncertainties in trailer articulation angle as well as dynamic complexity, it is not easy to accurately establish a reliable motion plan. In this paper, two geometric path plans constructed based on the empirical rules of driving experts are presented so that articulated vehicles can automatically perform perpendicular parking on a reverse path. By analyzing the empirical parking methods of professional drivers, these path plans were constructed by appropriately combining several standardized simple basic motions to facilitate implementation in real vehicles. In addition, path plans included appropriate complementary motions to effectively respond to uncertainties arising from articulation angles, etc. The complementary motions developed in this study are based on the results of qualitative analysis on the behavior of articulated vehicles. The usefulness of the proposed articulated vehicle parking method has been proven through hundreds of experimental tests using a 1:10 ratio model automated vehicle.

Demand for development of the convergence industry, research studies on electrical conductivity, thermal characteristics, semiconductors, motors, and batteries using special materials have come to the fore. Meanwhile, molybdenum (Mo) exhibits relatively small inorganic qualities, and the thermal conductivity rate is applied to various fields. In this study, in-depth characteristics were considered regarding the concentration of thermal characteristics, IR car terminal characteristics, and IR ve-hicles. This study calculated each phase temperature of the molybdenum sputtered specimens in the steady state according to the heat transfer theory. When the molybdenum-sputtered fabric’s metal layer pointed to the outside air, the heat transfer rate (Q) was high at 5748.3W, In contrast, if the molybdenum sputtered film’s metal layer of the pointed toward the heat source, the heat transfer rate (Q) was low at 187.1W. As a result of measuring the IR transmittance, the infrared transmit-tance of the molybdenum sputtering-treated sample was significantly reduced compared to the untreated sample. In the case of untreated samples, the transmittance ranged from 92.7 to 42.0%. When only the cross part was treated with molybdenum sputtering and the molybdenum surface was directed toward the IR irradiator, the IR transmittance was 66.8~0.7%. It is believed that the molybdenum sputtering polyamide samples produced in this study can be applied to multifunc-tional military wear, biosignal detection sensors, semiconductor products, batteries, etc., by utilizing excellent electrical properties, stealth functions, IR blocking properties, and lightness for infrared thermal imaging detectors.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

In this letter we investigate if SARS-CoV-2 RNA is involved in the increased ageing of alveolar cells. Our in silico study is explorative. With the results we are able to outline experiments with AEC2 repair of bleomycin damaged alveolar cells. If AEC2 repair capability is diminished by spike RNA then perhaps this result provides a first step on a route to treat immortal lung cancer cells.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Frequently Asked Questions (FAQs) systems rely on semantic symmetry similarity measuring between two sentences. To address the challenges of insufficient training data and limited domain-specific understanding in low-resource FAQs, this paper proposes a general framework, PDAMF-FAQ, to solve these issues. Firstly, we propose a paraphrasing-based data augmentation model that integrates syntactic information and edit vectors. Using a rule-based approach, it retrieves template sentences from a corpus and masks relevant words with special characters. Edit vectors between the original and paraphrase sentences are added to a pre-trained model's encoding layer to enhance the model's ability to learn the differences between the original and reference paraphrase sentences. Additionally, this paper presents a mixed-feature semantic matching model based on SimBERT. The model extracts keyword features from the text, replacing these keywords with special characters to construct intent features. These intent features, along with the user question and keyword features, are then concatenated to form the model's input. Experiments were conducted respectively on the paraphrasing-based data augmentation model, mixed-feature semantic matching model and their comprehensive application in a low-resource domain-specific FAQ. The experimental results show that the proposed framework effectively improve the performance of domain-specific FAQ system.

Zearalenone is one of the most prevalent estrogenic mycotoxins produced mainly by Fusarium family fungi, and harmed the heath of animals. Zearalenone hydrolase is an important enzyme capable of degrading zearalenone into a non-toxic compound. Although previous research has investigated the catalytic mechanism of zearalenone hydrolase, information on its dynamic interaction with zearalenone remains unknown. This study aimed to develop a pipeline for identifying the allosteric pathway of zearalenone hydrolase. Using an identity analysis, we identified hub genes whose sequences can generalize a set of sequences in a protein family. We then utilized a neural relational inference (NRI) model to identify the allosteric pathway of the protein throughout the entire molecular dynamics simulation. The production run lasted 1 microsecond, and we analyzed residues 139-222 for the allosteric pathway using the NRI model. We found that the cap domain of the protein opened up during catalysis, resembling a hemostatic tape. We used umbrella sampling to simulate the dynamic docking phase of the ligand-protein complex and found that the protein took on a square sandwich shape. Our energy analysis using both MMPBSA and PMF analysis showed discrepancies, with scores of -8.45 kcal/mol and -1.95 kcal/mol, respectively. MMPBSA, however, obtained a similar score to that of a previous report.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Resistance of tumor cells to anticancer drugs is a major obstacle in tumor therapy. In this study, we investigated the mechanism of cordycepin-mediated resensitization to cisplatin inT24R2, a derived T24 cell line. Treatment with cordycepin or cisplatin (2 g/ml) alone could not induce cell death of T24R2, but combination treatment of these drugs significantly induced apoptosis of the cells through mitochondrial pathway including depolarization of mitochondrial membrane, decrease of anti-apoptotic proteins, Bcl-2, Bcl-xL, and Mcl-1, and increase of pro-apoptotic proteins, Bak and Bax. . High expression of MDR1 was the cause of cisplatin resistance in T24R2, and cordycepin significantly reduced MDR1 expression through inhibition of MDR1 promoter activity. MDR1 promoter activity was dependent on a transcription factor, Ets-1, in T24R2 cells. Although there is a correlation between MDR1 and Ets-1 expression in bladder cancer patients, active Ets-1, Thr-38 phosphorylated form (pThr-38), was critical to induce MDR1 expression. Cordycepin decreased pThr-38 Ets-1 level through inhibition of AKT, which reduced MDR1 transcription and induced the resensitization of T24R2 to cisplatin. The results suggest that cordycepin effectively resensitizes cisplatin-resistant bladder cancer cells to cisplatin, thus serving as a potential strategy for treatment of anti-cancer drug resistant patients.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The aim of this study was to examine oxidative stress and low level of alpha-1-antitrypsin (A1AT) in primary Sjögren's syndrome (pSS), and evaluate the associated autoreactivity against unmodified and their 4-hydroxy-2-nonenal (HNE)-modified peptides with pSS. Two differentially expressed proteins, alpha-1-acid glycoprotein 1 (A1AG1) and A1AT, exhibited 2-fold differences, and their HNE modifications were identified by depleted-albumin and immunoglobulin G (IgG) serum protein, in-solution digestion, in-gel digestion, and nano-LC-MS/MS from pSS patients and age-matched healthy controls (HCs). Furthermore, levels of proteins, confirmation of HNE modifications, HNE-protein adducts and autoreactivity against unmodified and their HNE-modified peptides were further validated. Levels of the HNE-protein adduct and A1AG1 were significantly higher in pSS patients than HCs, but levels of A1AT were significantly lower in pSS patients compared to HCs. Only the HNE modification of A1AT was confirmed. Further, concentrations of anti-A1AT^50-63 IgG and anti-A1AT^50-63 HNE IgA were significantly lower in pSS patients than HCs. Our study suggests that elevated HNE-protein adduct, oxidative stress, level [odds ratio (OR) 4.877, p = 0.003], lowered A1AT level (OR 3.910, p = 0.010) and a decreased level of anti-A1AT^50-63 IgG (OR 3.360, p = 0.010) showed an increased risk in pSS patients compared to HCs, respectively.

The Huichang fault Basin in Jiangxi Province exhibits high terrestrial heat flow values and a dense concentration of hot springs. However, existing research is limited to individual geothermal fields without a comprehensive basin-wide analysis of geothermal water origins. This study investigates the source of geothermal water across five representative geothermal fields using hydrochemical components and isotopic analyses. The findings indicate: (1) The hydrochemical type transitions from bicarbonate sulphate-sodium-calcium in the north to bicarbonate sodium-calcium in the south; (2) Major chemical components of the geothermal water derive from evaporative salt rocks (Cretaceous sand conglomerate cover) and siliceous formations (granite/metamorphic rock basement); (3) The recharge elevation for geothermal water is approximately 1 km, sourced from adjacent hills. The central basin's geothermal water has an apparent age of about 26,000 years, with δ¹³C indicating participation in deep circulation; (4) Thermal reservoir temperatures range from 74 to 113℃, with the lowest temperatures at the basin's edges (Anzishan and Shangjin geothermal fields) and higher temperatures towards the center, suggesting increased warming and a circulation depth of 1.5 to 2.5 km; (5) Simulation results of reverse water-rock interaction indicate that mineral precipitation-dissolution processes are governed by the basin's main thermal control structures. The geothermal fields are predominantly influenced by reduction alterations associated with granite and are closely linked to paleo-geothermal waters in the enclosed basin, with the formation of these fields heavily reliant on the heat production or conduction from radioactive elements in granite.

We describe a novel system for online prediction of lead seizures from long-term intracranial electroencephalogram (iEEG) recordings for canines with naturally occurring epilepsy. This study adopts new specification of lead seizures, reflecting strong clustering of seizures in observed data. This clustering results in fewer lead seizures (~7 lead seizures per dog), and hence new challenges for online seizure prediction, that are addressed in the proposed system. In particular, machine learning part of the system is implemented using the Group Learning method suitable for modeling sparse and noisy seizure data. In addition, several modifications for the proposed system are introduced to cope with non-stationarity of noisy iEEG signal. They include: (1) periodic re-training of SVM classifier using most recent training data; (2) removing samples with noisy labels from training data; (3) introducing new adaptive post-processing technique for combining many predictions made for 20-second windows into a single prediction for 4 hr segment. Application of the proposed system requires only 2 lead seizures for training the initial model, and results in high prediction performance for all four dogs (with mean 0.84 sensitivity, 0.27 time-in-warning, and 0.78 false-positive rate per day). Proposed system achieves accurate prediction of lead seizures during long-term test periods, 3–16 lead seizures during 169–364 days test period, whereas earlier studies did not differentiate between lead vs. non-lead seizures and used much shorter test periods (~few days long).

In recent years, there has been a notable rise in the incidence of breast cancer among young patients, who exhibit worse survival outcomes and distinct characteristics compared to the intermediate and elder patients. Therefore, it’s imperative to identify identify the specific features unique to young patients, which could offer insights into potential therapeutic strategies and improving survival outcomes. In our study, we performed an integrative analysis of bulk transcriptional and genomic data from extensive clinical cohorts to identify prognostic factors. Additionally, we analyzed the single-cell transcriptional data and conducted in vitro experiments. Our work confirmed that young patients exhibited higher grading, worse disease-free survival (DFS), a higher frequency of mutations in TP53 and BRCA1, a lower frequency of mutations in PIK3CA, and upregulation of eight metabolic pathways. Notably, galactose metabolism pathway showed upregulation in young patients and was associated with worse DFS. Further analysis and experiments indicated that galactose metabolism pathway may regulate the stemness of cancer cells and ultimately contribute to worse survival outcomes. In summary, our finding identified distinct clinicopathological, transcriptional, and genomics features and revealed a correlation between galactose metabolism pathway, stemness, and poor disease-free survival of breast cancer in young patients.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

A number of epidemiological studies have implicated elevated iron levels with higher risks of cardiometabolic diseases, including the metabolic syndrome (MetS). MetS is a pathologic clustering of metabolic derangements characterized by central obesity, insulin resistance, hypertension, and dyslipidemia, which can all lead to increased cardiovascular disease morbidity and mortality. However, it remains unclear whether a causal association exists between higher iron status and MetS and its associated risk components. Using the data from the Taiwan Biobank (TWB) (19,012 males; 42,340 females) and of the European Whites from the UK Biobank (UKB) (128,549 males; 142,817 females), we first constructed ethnic- and sex-specific hemoglobin-polygenic risk scores (Hb-PRS) as instrumental variable (IV) for iron status with the Hb-associated SNPs we previously identified from genome-wide association studies (GWAS). We then conducted Mendelian randomization (MR) analyses to elucidate the causal role of elevated iron (either Hb-PRS quintiles or continuous Hb-PRS) on various metabolic components. MR-Egger regressions determined the potential pleiotropic effects of the constructed Hb-PRSs, while the causal relationship of Hb-PRS with anemia served as a control in the analyses. The mean Hb concentration range corresponding to the Hb-PRS quintiles is relatively narrow in both UKB (14.91-15.21 g/dL for males and 13.39-13.71 g/dL for females) and TWB (14.79-15.28 g/dL for males and 12.78-13.21 g/dL for females). In these windows of Hb-PRSs, we found differential associations of Hb-PRS with diabetes (T2D) or hyperglycemia (HGY) as compared to other MetS components. The highest quintiles of Hb-PRSs were causally associated with greater risks of hypertension (HTN) and hypertriglyceridemia (DLP) (i.e., [Taiwanese HC males: Q5 vs. Q1 ORHTN = 1.10 (1.00–1.21), p = 0.0473, Q4 vs. Q1 ORDLP = 1.10 (1.00–1.22), p = 0.0485; European White males: ORHTN = 1.05 (1.01–1.09), p = 0.0194, ORDLP = 1.04 (1.00–1.08), p = 0.0468]). Interestingly, we obtained a consistent negative causal association between increasing Hb-PRS quintiles and T2D or HGY risk across all sex subgroups (i.e., [Taiwanese HC females: ORHGY = 0.89 (0.84–0.95), 0.88 (0.83–0.94), 0.87 (0.82–0.93), 0.86 (0.81–0.92) from Q2 to Q5; European White females: ORHGY = 0.92 (0.87–0.98), 0.91 (0.86–0.97), 0.93 (0.87–0.98), 0.87 (0.82–0.93) from Q2 to Q5; all p &lt; 0.05]. The positive causal relationships between Hb-PRSs and diastolic blood pressure (DBP) and triglycerides (TG) but inverse causal association with glucose (GLU) and glycated hemoglobin (HbA1c) further corroborated such findings. There is, however, a lack of causal association with central obesity (CO), while a U-shaped type of causality was observed for gout (GT) or hyperuricemia (HUA). Sensitivity analyses, which excluded subjects based on self-reports of health conditions or medications and hospital episode statistics data, revealed similar results. Our MR studies confirm a modest causal relationship between propensity of elevated iron status and increased risk of HTN and DLP. We have further observed that modestly lower iron levels causally contribute to the development of T2D. Further validation and elucidation of the underlying biological mechanisms are highly warranted.

Aromatic azo compounds have -N=N- double bonds as well as larger π electron conjugation system, which endows aromatic azo compounds with wide applications in the fields of functional materials. The properties of aromatic azo compounds are closely related to the substituents on their aromatic rings. However, traditional synthesis methods, such as the coupling of diazo salts, have a great limitation on the structural design of aromatic azo compounds. Therefore, many scientists have devoted their efforts to developing new synthetic methods. Moreover, recent advances in the synthesis of aromatic azo compounds led to the improvement of design and preparation of light-response materials at molecular level. This review summarizes the important synthetic progress of aromatic azo compounds in recent years, with an emphasis on the pioneering contribution of functional nanomaterials in the field.

Prunus tenella is a rare and precious relict plant in China. It is an important genetic resource for almond improvement and an indispensable material in ecological protection and landscaping. However, the research of molecular breeding and genetic evolution has been severely restricted, due to the lack of genome information. In this investigation, we created a chromosome-level genomic pattern of P. tenella, 231Mb in length with a contig N50 of 18.1 Mb by Hi-C techniques and high-accuracy PacBio HiFi sequencing. The present assembly predicted 32088 protein-coding genes, and an examination of the genome assembly indicated that 94.7% among all assembled transcripts were alignable to the genome assembly; most (97.24%) were functionally annotated. By phylogenomic genome comparison, we found that P. tenella is an ancient group that diverged approximately 13.4 million years ago (Mya) from 13 additional closely related species and about 6.5 Mya from the cultivated almond. Collinearity analysis revealed that P. tenella is highly syntenic and has high sequence conservation with almond and peach. However, this species also exhibit many presence/absence variants. Moreover, a large inversion at the 7,588 kb position of chromosome 5 was observed, which may have a significant association with phenotypic traits. Lastly, population genetic structure analysis in eight different populations indicated a high genetic differentiation among the natural distribution of P. tenella. This high-quality genome assembly provides critical clues and comprehensive information for the systematic evolution, genetic characteristics, and functional gene research of P. tenella. Moreover, it provides a valuable genomic resource for in-depth study in protecting, developing, and utilizing P. tenella germplasm resources.

Anesthetics reduce cardiac functions and lower blood pressure (BP), potentially causing excessive BP reduction in dehydrated patients or those with heart conditions, such as coronary artery disease (CAD). Considering the increased prevalence of cardiovascular disease with age, anesthesiologists must be cautious about BP reduction during general anesthesia in older adults. In the present case, an undiagnosed CAD patient in a hypovolemic state experienced a significant systolic blood pressure drop to the 50s during propofol and sevoflurane anesthesia. Despite the use of vasopressors, excessive hypotension persisted, leading to anesthesia suspension. Subsequent cardiac examinations, including computed tomography heart angio and calcium score, and coronary angiogram, revealed a near total occlusion of the left main coronary artery and the formation of collateral circulation. After 5 days of hydration and anticoagulation medications and confirmation of normovolemic state, general anesthesia was attempted again and successfully induced; a normal BP was maintained throughout the surgery. Thus, it is important to conduct a thorough cardiac evaluation and maintain normovolemia for general anesthesia in older adults.

Background and Objectives: This study aimed to evaluate the effects of subtalar joint axis-based balance exercises on the anterior talofibular ligament (ATFL) thickness, ankle strength, and ankle stability after an arthroscopic modified Broström operation (AMBO) for chronic ankle instability (CAI). Materials and Methods: The study included 47 patients diagnosed with CAI who underwent AMBO and were randomly divided into three groups: control (n=11), general balance exercise (n=17), and subtalar joint axis balance exercise (n=19), regardless of the affected area. Participants in the exercise rehabilitation group performed exercises for 60 min twice a week for 6 weeks, starting 6 weeks after AMBO. ATFL thickness, ankle strength, and ankle dynamic stability were measured using musculoskeletal ultrasonography, Biodex, and Y-balance test, respectively, before and after treatment. Results: Compared with the remaining groups, the subtalar joint axis balance exercise group had reduced ATFL thickness (p = 0.000), improved ankle strength for eversion (p = 0.000) and inversion (p = 0.000), and enhanced ankle stability (p = 0.000). Conclusions: The study results suggests that subtalar joint axis-based balance exercises may contribute to the early recovery of the ankle joint after AMBO.

In this study, a case of acute cattle death was investigated. The pathogen was identified, and its molecular characteristics and vector were analysed. This study provides a reference for the prevention and control of babesiosis and the healthy breeding of cattle. In this study, unengorged and engorged Rhipicephalus microplus ticks were collected from the Chongqing area. The unengorged ticks were cultured on cattle under laboratory conditions, and the engorged ticks were cultured to lay eggs. In the process, the cattle suddenly died at 12 days from the bite of an unengorged R. microplus tick. In addition, the larvae hatched from R. microplus eggs, which were cultured on the other cattle, and the experimental cattle died in approximately 14 days. Blood was collected from a second dying and stored at 4 ℃ for one week. Two millilitres of anticoagulated blood was injected subcutaneously into the third cow without piriformis infection. On the fourth day, the body temperature rose to 41 ℃ with slight lymphadenopathy. On the fifth day, the cow suddenly fell and died approximately 4 hours later. DNA was extracted from the blood of all dead cattle and amplified by PCR with piriformis universal primers. The results showed that the cattle were infected with Babesia bovis. The phylogenetic tree based on 18S rRNA showed that the Chongqing strain of B. bovis, which caused the death of cattle, was closely related to the Yunnan strain in China and had the same taxonomic status as the Spanish strain. This case report will draw people's attention to B. bovis once again, and positive control measures should be taken to reduce the losses of farmers to achieve the goal of healthy breeding.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Objective: To study the factors affecting the time of umbilical cord shedding in premature infants.Methods: A total of 151 premature infants who were born in the obstetrics department of a Class III hospital in Hefei from November 2020 to June 2021 were selected as subjects. All premature infants and their families met the complete inclusion criteria. A total of 33 related factors from 3 aspects, including the birth situation of premature infants, the condition of premature infants in hospital and the condition of pregnant mothers, were collected for univariate analysis and multiple Logistic regression analysis. The relevant factors affecting the umbilical cord shedding time of premature infants were screened through the univariate analysis results, and the main factors affecting the umbilical cord shedding time of premature infants were screened through the multiple Logistic regression analysis results.it was found that the weight, gestural age, admission age, whether the premature infants were combined with NRDS, the use of antibiotics, the duration in the warm box, the initial temperature in the warm box, the duration of light therapy, the degree of Apgar for 1 minute, the maternal education level had an effect on the time of umbilical cord shedding of premature infants (P < 0.05). Through Logistic multiple regression analysis, it was screened that the duration of premature infants in the incubator was the main factor affecting the umbilical cord shedding time of premature infants (P < 0.05).Conclusion: Factors such as premature infants' weight, gestural age, admission age, whether they are combined with NRDS, antibiotic use, duration in the incubator, initial temperature in the incubator, duration of phototherapy, Apgar level of 1 minute, and maternal education level will affect the umbilical cord shedding time of premature infants. Among them, duration in the incubator is the main factor affecting the umbilical cord shedding time of premature infants.

Although natural products are an important source of drugs and drug leads, identification and validation of their target proteins have proven difficult. Here, we report the development of a systematic strategy for target identification and validation employing drug affinity responsive target stability (DARTS) and mass spectrometry imaging (MSI) without modifying or labeling natural compounds. Through a validation step using curcumin, which targets aminopeptidase N (APN), we successfully standardized the systematic strategy. Using label-free voacangine, an antiangiogenic alkaloid molecule as the model natural compound, DARTS analysis revealed vascular endothelial growth factor receptor 2 (VEGFR2) as a target protein. Voacangine inhibits VEGFR2 kinase activity and its downstream signaling by binding to the kinase domain of VEGFR2, as was revealed by docking simulation. Through cell culture assays, voacangine was found to inhibit the growth of glioblastoma cells expressing high levels of VEGFR2. Specific localization of voacangine to tumor compartments in a glioblastoma xenograft mouse was revealed by MSI analysis. The overlap of histological images with the MSI signals for voacangine was intense in the tumor regions and showed colocalization of voacangine and VEGFR2 in the tumor tissues by immunofluorescence analysis of VEGFR2. The strategy employing DARTS and MSI to identify and validate the targets of a natural compound as demonstrated for voacangine in this study is expected to streamline the general approach of drug discovery and validation using other biomolecules including natural products.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

Music therapy has served as complementary and alternative medicine for various neurological disorders. Five Phases Music Therapy (FPMT) employs the theory of five phases and five music scales or tones (宫Gong (do), 商Shang (ri), 角Jue (mi), 徵Zhi (so) and 羽Yu (la)) to analyze and treat mind-body illness. In Chinese Medicine (CM), the five music scales are used to connect the human body and the universe, interpret personalities and constitution and analyze the influences of climatic changes on health. FPMT has a self-contained theory and routine of practice application. Large amounts of clinical and fundamental reports have been available and clinical benefits have been obtained. However more systemic clinic research esp. evidence-based and random controlled trials must be performed to validate and optimize its routines and biological and neurological mechanism must be further explored. It’s reasonable to believe that the effective music therapy will attract more attention from the world outside China with the introduction of FPMT.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

This study examines Tim Rowett's YouTube channel, "Grand Illusions," which captures and maintains positive viewer engagement in the digital domain. Through a comprehensive YouTube channel analysis, this paper identifies key factors contributing to its success, including collaboration and influence, educational impact, legacy and continuity, personal style, and community engagement. Rowett, known for his extensive toy collection and in-depth knowledge of their mechanics and history, employs an educational and engaging presentation style that fosters a positive and inclusive online community. His approach entertains and educates, making him a valuable digital resource that inspires viewers of all ages. This research proposes the CECCE (Collaboration, Education, Continuity, Community Engagement) model as a framework for content creators seeking to replicate the success of "Grand Illusions." The study emphasizes the potential of tailored, passionate content to cultivate healthy digital communities and underscores the significant role of digital content creators in shaping online culture. The proposed framework will guide creators to achieve similar success.