The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Achieving eco-efficiency in agriculture production at low environmental costs is key to sustainable agriculture. Using the DEA-SBM model, this study evaluated the agricultural eco-efficiency of the 77 counties and districts in China’s Jiangsu province from 1999 to 2018 and analyzed its spatio-temporal evolution pattern and influencing factors. The mains conclusions were as follows: (1) The overall agricultural eco-efficiency and its decomposition terms, pure technology efficiency and scale efficiency, exhibited a fluctuating downward trend. The regional inequality in agricultural eco-efficiency had been widening and exhibited a strong positive spatial association. (2) The agricultural eco-efficiency in Jiangsu province presented a “high south and low north” spatial pattern. High-level agricultural eco-efficiency areas were in the Taihu Plain in Sunan, while low-level agricultural eco-efficiency zones are distributed across Subei City. The High-High-type spatial association pattern is concentrated in the Suzhou-Wuxi-Changzhou region, while the Low-Low areas are mainly in the coastal regions of Subei and Suzhong. (3) The spatial pattern of PTE and SE generally exhibited a “high south and low north” distribution. Areas with positive growth in agricultural eco-efficiency, PTE, and SE, were situated in Xuzhou, Nanjing city, and the bordering regions between Yangzhou and Huai’an, and Changzhou and Wuxi. (4) The excessive redundant use and application of pesticides, chemical fertilizer, agricultural diesel, labor, land, and agricultural carbon emission have been the primary factor affecting Jiangsu's agricultural eco-efficiency. Irrigation had also signficantly impacted agricultural eco-efficiency, while mechanical power and agricultural film had minimal effect. The majority of counties and districts in Subei, Suzhong, and Ningzhen Yang Hilly region have issues regarding their excessive usage of chemical fertilizer, pesticide, chemical fertilizer, agricultural diesel, labor, and land. The findings of this study can contribute towards a better understanding of agricultural eco-efficiency and spatial association effect and can help policymakers increase agricultural eco-efficiency.

In this paper we take China’s one child policy as an example and investigate its environmental impact. We develop a model for an economy using a standard overlapping generation model extended with human capital, endogenous fertility, and changing life expectancy. To model the environmental impact of economic activities, we use a modified IPAT model. We show that China’s one child has a very strong positive impact on the environment, particularly if we consider the whole human legacy.

Cannabinoid metabolites have been reported to be more potent than the parent compounds. Among them, Ajulemic acid (AJA) is a synthetic analogue of Δ9-THC-11-oic which will be a good template structure for discovery of more potent analogues. Herein, we optimized the key allylic oxidation step to introduce the C-11 hydroxy group with high yield. And a series of compounds were prepared with this condition applied including HU-210, 11-Nor-Δ8-Tetrahydrocannabinol-9-carboxylic acid and Δ9-THC-COOH.

In offshore drilling, accidents such as gas invasion, overflow, and kicks are inevitable, and they can escalate into blowouts and other catastrophic events that result in casualties and substantial economic losses. Therefore, maintaining drilling safety requires accurate monitoring of gas invasion and overflow. The majority of overflow monitoring methods currently utilized at drilling sites are threshold-based. However, monitoring parameters acquired during actual drilling operations frequently contain noise signals, making it difficult for threshold-based methods to strike a balance between improving accuracy and minimizing false positives. In this paper, Pattern Recognition-based Kick Detection (PRKD) is proposed as a novel method for diagnosing overflow in offshore drilling. This method utilizes the overflow evolution process by integrating multi-phase flow calculations, data filtering theory, pattern recognition theory, the Bayesian framework, and other theoretical models. The PRKD effectively detects and monitors gas intrusion and overflow based on single parameters by analyzing the shape and wave characteristics of the curves. The case analysis demonstrates that the proposed method for monitoring drilling overflow achieves high precision while maintaining a low false positive rate. By combining advanced computational techniques with pattern recognition algorithms, the PRKD improves the accuracy and reliability of kick detection, enabling proactive responses to potential risks, protecting the environment and human lives, and optimizing drilling operations.

Overhead power transmission line icing (PTLI) disasters are one of the most severe dangers to power grid safety. Automatic iced transmission line identification is critical in various fields. However, existing methods primarily focus on the linear characteristics of transmission lines, employing a two-step process involving edge and line detection for PTLI identification. Nonetheless, these traditional methods are often difficult when confronted with challenges such as background noise or variations in illumination, leading to incomplete identification of the target area, missed target regions, or misclassification of background pixels as foreground. We propose a new iced transmission line identification scheme to overcome this limitation. In the initial stage, we integrate the image restoration method with image filter enhancement to restore the image's color information. This combined approach effectively retains valuable information and preserves the original image quality, thereby mitigating noise presented during the image acquisition. Subsequently, in the second stage, we introduce an enhanced multi-threshold algorithm to separate background and target pixels. After image segmentation, we enhance the image and obtain the region of interest (ROI) through connected component labeling modification and mathematical morphology operations, eliminating background regions. Our proposed scheme achieves an accuracy value of 97.72%, a precision value of 96.24%, a recall value of 86.22%, and the specificity value of 99.48% based on the average value of test images. Through object segmentation and location, the proposed method can avoid background interference, effectively solve the problem of transmission line icing identification, and achieve 90% measurement accuracy compared to manual measurement on the collected PTLI dataset.

HU is the Hypergeometrical Universe Theory (HU)[1-8], proposed in 2006, where the Universe is a Lightspeed Expanding Hyperspherical Hypersurface and Gravitation is an absolute-velocity-dependent, epoch-dependent force. Here we introduce the Big Pop Cosmogenesis and show our calculations associated with the Equation of State of the Universe. This article is the first in a series of articles[9-22] supporting the paradigm shift.

Ferroptosis is an iron-dependent and lipid peroxidation-driven cell death cascade, occurring when there is an imbalance of redox homeostasis in the cell. Nuclear factor E2 related factor 2 (NFE2L2, also known as NRF2) is key for cellular antioxidant responses, which promotes downstream gene transcription by binding to their antioxidant response elements (AREs). Numerous studies suggest that NRF2 assumes an extremely important role in the regulation of ferroptosis, for its various functions on iron, lipid and amino acid metabolism and so on. Many pathological states are relevant to ferroptosis. In cancer cells, ferroptosis is frequently found abnormal suppression. While during tissue damages, ferroptosis is recurrently promoted, resulting in a large number of cell deaths and ultimately loss of the functions of the corresponding organs. Therefore, targeting NRF2-related signaling pathways, to induce or inhibit ferroptosis, has become a great potential therapy for combating cancers, as well as preventing neurodegenerative and ischemic diseases. In this review, a brief overview of the research process of ferroptosis over the past decade will be presented. In particular, the mechanisms of ferroptosis and a focus on the regulation of ferroptosis by NRF2 will be discussed. Finally, the review will briefly list some clinical applications of targeting the NRF2 signaling pathway in the treatment of diseases.

Nucleoid-associated proteins (NAPs) play an architectural role by bending, bridging, and wrapping the DNA along with a regulatory role of controlling various transcriptional units in the cell. Previews reviews have highlighted the role of HU and its paralog IHF plays in intracellular function as a transcriptional regulator, nucleoid bending protein and sometimes also moonlights in other functions. This review highlights along with the canonical functions of HU and IHF which affects genes responsible for translational machineries, cell wall biosynthesis, aerobic respiration and virulence ; other non-canonical roles which HU plays outside the cellular milieu, notably in acting as an adhesin and playing role in host-cell adhesion, its role in biofilm architecture and its association with cationic low complexity region, resembling histone like H1 proteins. HU and IHF thus has evolved as a hub protein performing a vast type of functions which makes it a important drug target for antibacterial therapy.

The phenomenon of missing data can be seen everywhere in reality. Most typical attribute reduction models are only suitable for complete systems. But for incomplete systems, we can’t obtain the effective reduction rules. Even if there are a few reduction approaches, the classification accuracy of their reduction sets still needs to be improved. In order to overcome these shortcomings, this paper firstly defines the similarities of intra-cluster objects and inter-cluster objects based on the tolerance principle and the mechanism of knowledge granularity. Secondly, attributes are selected on the principle that the similarity of inter-cluster objects is small and the similarity of intra-cluster objects is large, and then the knowledge granularity attribute model is proposed under the background of clustering; Then, the IKAR algorithm program is designed. Finally, a series of comparative experiments about reduction size, running time and classification accuracy are conducted with twelve UCI data sets to evaluate the performance of IKAR algorithms, then the stability of Friedman test and Bonferroni-Dunn test are conducted. The experimental results indicate that the proposed algorithms are efficient and feasible.

Sinojackia Hu. comprises five to eight Chinese endemic species with high ornamental and medicinal value. However, the generic limits, interspecific relationships and evolutionary history of the genus remain unresolved. In this study, we newly sequenced and assembled three plastomes of S. oblongicarpa and compared them with those of the other congeneric species to explore the taxonomic delimitation of the species and the evolutionary history of the genus. Plastomes structure of Sinojackia species were extremely conserved in terms of number of genes, sequence length and GC content. Codon usage patterns revealed that natural selection may be the main factor shaping codon usage bias. Our phylogenetic tree shows that Sinojackia is monophyletic and can be divided into two clades. Sinojackia oblongicarpa as a distinct species is supported for it is distantly related to S. sarcocarpa. The evolutionary analysis of morphological features indicates that woody mesocarp is an ancestral feature, while mesocarp undeveloped, spongy and fleshy are the later derived. Sinojackia originated in Central-Southeast China during the early Miocene. In this period, it experienced elevated diversification and migrated from the Central-Southeast China to Hunan Province and Sichuan Province with the development of the Asian monsoon and East Asian flora. Sinojackia experienced elevated diversification at intraspecies levels that mainly occurred in the Quaternary. Glacial-interglacial interactions with the monsoon climate may provide favorable expansion conditions for Sinojackia on a small-scale.

As an implementation of inverse Radon transform, the Second-order Divided-difference Back Projection (SDBP) technique has been proposed in this paper, by which the accurate CT reconstruction can be theoretically realized. A computational model for CT reconstruction filter expressions has been derived on the basis of SDBP technique. The method reveals the correlation between the convolution kernel for data restoration and the filter expression. By substituting kernel functions into the computational model, the amplitude sequences of a variety of filters can be calculated. On the proposed filter construction method, the decomposition form of filters has been discovered, where a series of basic filters have been acquired. The properties of any filter depend on the decomposed basic filters. Basic filters can be used to compose filters in actual needs.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

Molecularly imprinted polymers (MIPs) were synthesized and applied for the selective extraction of oblongifolin C (OC) from fruit extracts of Garcinia yunnanensis Hu. A series of experiments and computational approaches were employed to improve the efficiency of screening for optimal MIP systems in the study. The molar ratio (1:4) was chosen at last based on the comparison of the binding energy of the complexes between the template (OC) and functional monomers using density functional theory (DFT) at the RI-PBE-D3-gCP/def2-TZVP level of theory. The binding characterization and the molecular recognition mechanism of MIPs were further explained using the molecular modeling method and NMR and IR spectra data. The reusability of this approach was demonstrated in over 20 batch rebinding experiments. 140.5 mg of OC (>95% purity) was obtained from the 5 g extracts with 2 g of MIPs with the best binding properties through gradient elution program from 35% to 70% methanol-water solution. At the same time, another structural analog, 46.5 mg of guttiferone K (GK) (>88% purity), was also obtained by the gradient elution procedure. Our results showed that the structural analogs could be separated from the crude extracts by the molecularly imprinted solid-phase extraction (MISPE) using a gradient elution procedure for the first time.

The low-temperature environment significantly inhibits the growth and metabolism of denitrifying bacteria, leading to an excessive concentration of ammonia nitrogen and total nitrogen in sewage treatment plants during the cold season. In this study, an efficient denitrifying strain of heterotrophic nitrification–aerobic denitrification(HN-AD) bacteria named HS2 was isolated and screened from industrial sewage of a chemical factory in Inner Mongolia at 8°C. The strain was confirmed to be Achromobacter spiritinus, a colorless rod-shaped bacterium. When cultured with sodium succinate as the carbon source, a carbon-to-nitrogen ratio of 20-30, a shaking rate of 150-180 r/min, and the initial pH of 6-10, the Strain HS2 exhibited excellent nitrogen removal at 8°C. Through the results of whole-genome sequencing, gene amplification, and gas product detection, the Strain HS2 was determined to possess key enzyme genes in both nitrification and denitrification pathways, suggesting a HN-AD pathway of NH4+-N→NH2OH→NO2--N→NO→N2O→N2. At 8°C, the Strain HS2 could completely remove ammonia nitrogen from industrial sewage with an initial concentration of 127.23 mg/L. Microbial species diversity analysis of the final sewage confirmed Achromobacter sp. as the dominant genus, this indicated that the low-temperature denitrifying strain HS2 plays an important role in nitrogen removal of actual low-temperature sewage.

This work compared the performance of three methods for constructing a regional ensemble prediction system (EPS) for wind speed forecasts: dynamical downscaling, breeding of growth modes (BGM), and blending method. The Weather Research and Forecasting (WRF) model was used to downscale the European Centre for Medium-range Weather Forecast (ECMWF) EPS. In addition, as the BGM method needs observation data for generating scaling factors, an alternative method for generating scaling factors was proposed to eliminate dependence on observation data. One-month tests between October 1st and October 30th, 2020, were implemented to evaluate the performance of three methods in the Gansu province of China. The results demonstrate that the blending method outperforms the other two methods. Furthermore, the difference in performance is evident mainly in early forecast lead time and becomes negligible as forecast time increases.

Supplementary lighting is commonly used in high-quality seedling production. In this study, grafted tomato seedlings were grown for 10 days in a glasshouse with a 16-hour daily supplementary lighting at 100 μmol·m⁻²·s⁻¹ PPFD from either high pressure sodium (HPS), metal halide (MH), far-red (FR), white LEDs (W), or mixed LEDs (W₁R₂B₁) to determine which light sources improve the seedling quality. The control did not have any supplementary light. The physiological parameters and the expression of genes related to photosynthesis were analyzed. The results show that the root length, biomass, number of leaves, chlorophyll (SPAD), dry weight to height ratio (WHR) of the scion, and specific leaf weight (SLW) were the greatest for grafted seedlings grown in W₁R₂B₁. The level of root ball formation was the greatest for seedlings grown in W₁R₂B₁, followed by those grown in W, HPS, and MH. Seedlings grown in FR did not fare very well, as they were very thin and weak. Moreover, the expression of two photosynthetic genes (PsaA and PsbA) was significantly increased by W₁R₂B₁ and W, which suggests that the plastid or nuclear genes might be regulated. The overall results suggest that W₁R₂B₁ was the most suitable light source to enhance the quality of grafted tomato seedlings. The results of this study could be used as a reference for seedling production in glasshouses, and provide new insights in the research of lights affecting the development of plants.

Lactobacillus plantarum has been observed to play a crucial role in shaping the sensory properties of chili sauce. However, the specific taste-active metabolites responsible for the desirable flavor profile of chili sauce remain inadequately characterized. This study employed a combination of metabolomics and web-based computational tools analysis to investigate the dynamic changes in taste-active metabolites during chili sauce fermentation. Initially, metabolites were rapidly annotated using a feature-based molecular network, leading to the tentative annotation of 206 metabolites, of which a significant proportion had not been previously reported. Subsequently, the VirtualTaste tool identified dihydrosphingosine, lactic acid, isoleucine, phytosphingosine, and gluconic acid as potential taste markers for quality control. Finally, pathway enrichment analysis revealed that these components were primarily associated with amino acid tRNA, phenylalanine, tyrosine, and tryptophan biosynthesis, as well as sphingolipid metabolism. This study provides valuable insights into the mechanisms underlying the formation of the distinctive flavor of chili sauce.

The research of object classification and part segmentation is a hot topic in computer vision. A considerable number of studies have been carried out about deep learning on 3D point clouds. However,it is challenging to achieve effective feature learning due to sparsity of point clouds. Recently, a variety of Transformers have been adopted to improve point cloud processing and display great potential. Nevertheless, large numbers of Transformer layers tend to incur huge computational and memory costs. PointNet++ is one of the most influential neural architectures for point cloud understanding. Although the accuracy of PointNet++ has been largely surpassed by recent networks, this does not mean that PointNet++ has no potential.Thus, this paper offer two major contributions that significantly improve PointNet++ performance. Firstly, we introduce a novel contextual feature extraction (CFE) block that significantly enhances the feature extraction capabilities of PointNet++ networks. Secondly, to further enhance feature fusion, we seamlessly integrate a mutual learning (ML) block into the network architecture. By embedding these two innovative blocks within each layer of the network, we not only enrich the network's functionality but also impart it with greater robustness and adaptability. The specific experiments were conducted on the S3DIS (6-fold cross-validation) and Modelnet40 datasets with 86.5% and 92.7% accuracy, respectively, which proved that our model is comparable or even better than most existing methods for classification and segmentation tasks.

Abstract: Droughts are complex and gradually evolving conditions of extreme water deficits which can compromise livelihoods and ecological integrity, especially in fragile arid and semi-arid regions that depend on rainfed farming, such as Kitui West in south-eastern Kenya. Against the background of low ground-station density, 10 gridded rainfall products and four gridded temperature products were used to generate an ensemble of 40 calculations of the Standardized Precipitation Evapotranspiration Index (SPEI) to assess uncertainties in the onset, duration and magnitude of past droughts. These uncertainties were driven more by variations between the rainfall products than variations between the temperature products. Remaining ambiguities in drought occurrence could be resolved by complementing the quantitative analysis with ground-based information from key informants engaged in disaster relief, effectively formulating an ensemble approach to SPEI-based drought identification to aid decision making. The reported trend towards drier conditions in Eastern Africa was confirmed for Kitui West by the majority of data products, whereas the rainfall effect on the increasingly dry conditions was more subtle than annual and seasonal declines and greater annual variation, which warrants further investigation. Nevertheless, the effects of increasing droughts are already felt on the ground and warrant decisive action.

Traditional methods of non-metallic materials joining for industrial uses are limited to lasers, or induction or conduction heating. The precision and efficiency for large-scale applications are difficult to be achieved at the same time. Here in this paper, we report a precise microwave welding method induced by localized surface plasmon of metallic macro-gaps under microwave excitation. The proposed method utilizes energy from well-developed commercial microwaver, and benefits from the precision of localized surface plasmon, an oscillating electron cloud excited by electromagnetic waves, which is currently under hot investigation only at micro- or nano-scales. The method is applied to the welding of polymers to solve the problems of complex processing equipment and high processing energy consumption in the traditional welding process, so as to cope with the growing energy and environmental crisis. Finite element numerical simulations are used to study the distribution characteristics of electric fields and temperature fields. The results show that the process is a high quality, efficient, low consumption and environmentally friendly green process compared to traditional polymer welding methods.

Flavonoids are major secondary metabolites in plants, which play important roles in maintaining the cellular redox balance in cells. Chalcone synthase (CHS) is the key enzyme in the flavonoids biosynthesis pathway, and has been proved to monitor the changes to drought stress tolerance. In this work, we overexpressed a CHS gene in tobacco (Nicotiana tabacum). The transgenic tobacco plants were more tolerant than the control plants to drought stress. The transcription levels of the key genes involved in the flavonoids pathway and the contents of seven flavonoids were also significantly raised in the transgenic tobacco plants. In addition, overexpression of the CHS gene lead to a lower concentration of the oxidative stress product malondialdehyde. Overall, the NtCHS gene studied in this work was considered as a candidate gene for genetic engineering to enhance drought tolerance of plants and improve response to oxidative stress.

Effective biomarkers are essential to the early diagnosis of non-small cell lung cancer (NSCLC). Herein, a retrospective study of 49 newly diagnosed and recurrent NSCLC patients, 31 patients with benign pulmonary disease and 24 healthy volunteers was conducted, to evaluate the diagnostic value of circulating rare cells for NSCLC. The expression of circulating tumor cells (CTCs) and circulating tumor-derived endothelial cells (CTECs) in peripheral blood were measured by subtraction enrichment-immunostaining-fluorescence in situ hybridization (SE-iFISH). The level of CTCs (P＜0.001) and CTECs (P＜0.001) was significantly higher in NSCLC group than that in benign pulmonary disease group. The proportion of small CTCs (P＜0.001) and CTECs (P＜0.0001) significantly increased from benign lung disease individuals to NSCLC patients. The AUC of ROC curves of total CTCs and CTECs were 0.815 (95%CI: 0.722~0.907), 0.739 (95%CI: 0.618~0.860), respectively. The cut-off values for discriminating NSCLC with benign lung disease patients were total CTCs 11.5 units/6ml and total CTECs 10.5 units/6ml, with sensitivity and specificity being 67.3% and 83.9%, 77.6% and 77.4%, respectively. When CTCs and CTECs were combined, predictive value significantly increased to 82.6% as measured by the area under the curve. Small CTCs and triploid CTCs had high positive predictive value (PPV) and positive likelihood ratio (LR+) of the diagnosis of NSCLC in early stage. CTCs and CTECs can not only be used as new biomarkers for the diagnosis of NSCLC, but can also improve diagnostic performance of the early stage NSCLC. Moreover, the combined examination of CTCs and CTECs is be superior to the single.

As matrix representations of magic labelings of related hypergraphs, magic squares and their various variants have been applied to many domains. Among various subclasses, trimagic squares have been investigated for over a hundred years. The existence problem for trimagic squares with singly even orders and orders 16n has been solved completely. However, very little is known for the existence of trimagic squares with other even orders except for the only three examples and three families. We construct normal trimagic squares by using product constructions, row-square magic rectangles, and trimagic pairs of orthogonal diagonal Latin squares. We give a new product construction: For positive integers p, q, and r having the same parity other than 1, 2, 3, 6, if normal p × q and r × q row-square magic rectangles exist, then a normal trimagic square with order pqr exists. As its application, we construct normal trimagic squares of orders 8q^3 and 8pqr for all odd integers q not less than 7 and p,r ∈ {7, 11, 13, 17, 19, 23, 29, 31, 37}. Our construction can easily be extended to construct multimagic squares.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

Positioning based on wireless signals such as mobile communication networks has become an important means to provide high-precision location services in environments where satellite signals are blocked. In complex environments such as indoor and underground, wireless signal propagation is obstructed and non-line-of-sight (NLOS) phenomena appears due to serious occlusion and reflection. The time delay caused by NLOS effects has little impact on communication system but can significantly increase positioning errors in positioning systems. Therefore, effective suppression of NLOS errors is crucial to improving 5G positioning accuracy. To address the insufficient feature extraction of existing NLOS error suppression methods, the neglect of residual NLOS measurement errors, and poor stability of position estimation results, this paper innovatively proposes a NLOS mitigation and location estimation method for 5G positioning terminals. Simulation and experimental test results demonstrate that the proposed method outperforms the comparative methods both theoretically and practically, achieving an average positioning accuracy of 1.85 meters in complex indoor NLOS environments. The method proposed in this paper provides a new strategy for NLOS error suppression in indoor 5G positioning, which can significantly contribute to high-precision location services based on commercial 5G networks.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Reliable methods to confirm the diagnosis of COVID-19 are essential to the successful management and containment of the virus. Current diagnostic options are limited in type, supply, and reliability. This article explores the controversial unreliability of existing diagnostic methods and maintains that more reliable diagnostic methods, combinations, and sequencing are necessary to effectively assist in reducing the occurrence of discharge of the patient on false negative test results. This reduction would in effect reduce transmission of the disease.

Along with the rapid development and wide application of Artificial Intelligence (AI), discussions regarding AI Sustainability have emerged. Employing a systematic mapping study, this paper reviews research about AI Sustainability from diverse fields and viewpoints, including three dimensions economic, social, and environmental. Our analysis indicates a transformative shift in research focus, evolving from fragmented approaches to a more holistic understanding of AI Sustainability. This maturation is reflected in the interplay between multiple dimensions and the integration of both "AI as a tool for sustainability" and "Sustainability of AI" perspectives. As the field continues to mature, researchers should embrace a comprehensive and unbiased exploration of AI Sustainability across all dimensions and approaches, ensuring a well-rounded foundation for future advancements in this rapidly evolving domain.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The reduction in rheological parameters and dissolution rate of precursors in geopolymer coatings during early hydration significantly contributes to sagging. This study aims to improve the sag resistance of these coatings by incorporating diatomite filler. Rheological testing was conducted to assess the impact of diatomite and its concentration on yield stress, plastic viscosity, and thixotropy of the geopolymer coatings. The results indicated that diatomite's large specific surface area and high reactivity have a significant influence on the rheological parameters and early dissolution rate of precursors. With a diatomite concentration of 1.1%, the coating exhibited a yield stress of 2.749 Pa and a plastic viscosity of 0.921 Pa·s, maintaining stability, homogeneity, and no sagging at a thickness of 600 μm. Furthermore, the highly active SiO2 in diatomite participates in the secondary hydration reaction of the geopolymer materials, leading to the formation of substantial C-(A)-S-H gel. This gel enhances internal interconnectivity within the coating, thereby improving its rheological and mechanical properties.

The fractional reduced differential transform method is a finite iterative method based on infinite fractional expansions. The result obtained is the approximation of the real value. There are few reports on the approximate error and the applicable condition. In this paper, according to the fractional expansions, we study the factors related to the approximate errors. Our research shows that the approximate errors relate not only to fractional order but also to time $t$ and increase rapidly with time $t$. This method can only be applied within a certain time range and the time range is relevant to fractional order and fractional expansions. Then, many obtained achievements may be incorrect if the applicable conditions are not satisfied. Some examples presented in this paper verify our analysis.

The global usage of veterinary antibiotics is significant. These antibiotics can be released into the aquatic environment and exert toxic effects on non-target organisms. To explore the physiological effects of tetracycline antibiotics on aquatic life, the growth characteristics of and toxin release from the cyanobacterium Microcystis aeruginosa (M. aeruginosa) were studied. Results showed that the toxicity order of the three target antibiotics was TC (tetracycline) > CTC (chlortetracycline hydrochloride) > OTC (oxytetracycline) in terms of inhibition occurrence time and the EC₁₀ and EC₂₅ values. Further, the target antibiotics regulated the production of MC-LR (microcystin-LR) to different degrees. CTC destroyed the M. aeruginosa cells and resulted in a decreased MC-LR release but stimulated the ability to synthesise MC-LR. OTC had a relatively weaker toxicity compared with CTC, while TC was the most toxic among the three antibiotics. Therefore, TC is friendly to the aquatic environment because it simultaneously reduced the intracellular and extracellular MC-LR content. These results aid our understanding of the effects of tetracycline antibiotics on Microcystis aeruginosa, which is important for environmental evaluation and protection. These results are also helpful for guiding the application of veterinary antibiotics in agricultural settings.

Host immunological pathways have been proposed including TH1, TH2, TH3, TH9, TH17, TH22, TH1-like, and THαβ immune reactions. Besides TH2 and TH9 immune responses which are against multicellular parasites, host immunological pathways against viruses, intracellular micro-organisms (bacteria, protozoa, and fungi), and extracellular micro-organisms can use programmed cell death pathways to trigger immune reactions or to execute effective strategies to eliminate these pathogens. These programmed cell deaths include apoptosis, autophagic death, pyroptosis, ferroptosis, necroptosis, and NETosis. Apoptosis is related to host anti-virus eradicable THαβ immunity. Autophagic death is related to host anti-virus tolerable TH3 immunity. Pyroptosis is related to host anti-intracellular micro-organism eradicable TH1 immunity. Ferroptosis is related to host anti-intracellular micro-organism tolerable TH1-like immunity. Necroptosis is related to host anti-extracellular micro-organism eradicable TH22 immunity. NETosis is related to host anti-extracellular micro-organism tolerable TH17 immunity.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The tumor microenvironment plays a pivotal role in the behavior and development of solid tumors as well as shaping the immune response against them. As the tumor cells proliferate, the space they occupy and their physical interactions with the surrounding tissue increases. The growing tumor tissue becomes a complex dynamic structure, containing connective tissue, vascular structures, and extracellular matrix that facilitates stimulation, oxygenation, and nutrition, necessary for its fast growth. Mechanical cues such as stiffness, solid stress, interstitial fluid pressure, matrix density, and microarchitecture influence cellular functions and ultimately tumor progression and metastasis. In this fight, our body is equipped with T cells as its spearhead against tumors. However, the altered biochemical and mechanical environment of the tumor niche affects T cell efficacy and leads to their exhaustion. Understanding the mechanobiological properties of the tumor microenvironment and their effects on T cells is key for developing novel adoptive tumor immunotherapies.

In this paper we re-investigated the relationship between the symmetry of inertial systems and the Lorentz transformation. We found that when we just follow the following three principles: (1)we can define the time in the whole space with a prescribed clock synchronization, (2)the time-space is uniform and the space is isotropic and (3)all the inertial systems are equivalent, then we can totally construct a general coordinate transformation to meet the symmetry of inertial systems, and with a special assumption on the speed of light, we can construct a non-Lorentz transformation between inertial systems to make the particle’s energy have a limited value, which is similar to the rainbow model. Similar to the usual Lorentz violating models, the non-Lorentz transformation in this paper lead to a new modified disperse relation. We applied the obtained disperse relation to analyze the photon’s arrival time lag effect in astronomy and found that the "maximum energy" derived in our model is somewhat related to the "maximum energy" assumed in the rainbow model.

Adipose tissue composition contributes greatly to the quality and nutritional value of meat. Transcriptomic and lipidomic techniques were used to investigate the molecular mechanism of fat deposition difference among Ningxiang, Berkshire and F1 pigs. Transcriptomic analysis identified 680, 592 and 380 differentially expressed genes (DEGs) by comparing the groups of Ningxiang pigs vs Berkshire pigs, Berkshire pigs vs F1 pigs, Ningxiang pigs vs F1 pigs. Lipidomic analysis screened 423, 252, and 50 significantly changed lipids (SCLs) by comparing the groups of Ningxiang pigs vs Berkshire pigs, Berkshire pigs vs F1 pigs, Ningxiang pigs vs F1 pigs. Lycine, serine and threonine metabolism pathway, fatty acid biosynthesis and metabolism related pathways were siginificant enriched in the groups of Berkshire pigs vs Ningxiang pigs and Berkshire pigs vs F1 pigs. The DEGs (PHGDH, LOC110256000) and the SCLs (Phosphatidylserines) may have a great impact on lycine, serine and threonine metabolism pathway. Moreover, the DEGs (FASN, ACACA, CBR4, SCD, ELOV6, HACD, CYP3A46, CYP2B22, GPX1, GPX3) and the SCLs (palmitoleic acid, linoleic acid, arachidonic acid, icosadienoic acid) play important role in fatty acid biosynthesis and metabolism. Thus, the fat deposition difference among Ningxiang, Berkshire and F1 pigs may be caused by the difference of the expression pattern of key genes in multiple enrichment KEGG pathways. The research presented multiple lipids that were potentially available biological indicator and screened key genes that were potentially gene targets for molecular design breeding. The research also explored the molecular mechanisms of fat deposition difference among Ningxiang, Berkshire and F1 pigs and provides insight into the selection of backfat thickness and fat composition of adipose tissue for future breeding strategies.

By using the particle swarm optimization algorithm for crystal structure prediction, we reveal a newly orthorhombic Cmcm structure of HfB4, which is more energetically superior to the previously proposed YB4-, ReP4-, FeB4-, CrB4-, and MnB4-type structures in the considered pressure range. The phonon dispersion and elastic constants calculations confirm that the new phase is dynamically and mechanically stable. The calculated large shear modulus (240 GPa) and high hardness (45.7 GPa) imply that the predicted Cmcm-HfB4 is a potential superhard material. Meanwhile, the directional dependences of the Young's modulus, bulk modulus, and shear modulus for HfB4 are systematically investigated. Further analyses of the density of states and electronic localization function indicate that the strong B-B and B-Hf covalent bonds greatly contribute to its high hardness and stability.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This article obtains data through questionnaire survey, and then uses the Multiple Indicators Multiple Causes (MIMIC) Model to establish the Taoyuan City’s quality of life quantifying framework in a city-level community context. Statistical test results show that the reliability of overall model is high and is suitable for policy analysis. There are thirteen variables in the structural model that significantly affect the quality of life as well as eleven indicators in the measurement model that can significantly measure the quality of life. Then, half of the observations are substituted back to calculate the quality of life. Via ArcGis operation, it finds that the quality of life of Longtan District is the best as well as Dayuan District is the worst one. LISA cluster of quality of life illustrates hot spots areas are distributed in Longtan, Daxi, and Pingzhen Districts.

This paper applies conceptualization from Paulo Freire, Tracey Nicholls, and bell hooks to develop a framework to understand art- and media-based communication of knowledge. Increasing use of art and digital media in research and formal educational settings emphasize knowledge-communication intent, and the theory attempts to rationalize why individuals potentially devalue, discard, or misconstrue messaging. Drawing upon two case studies: children’s literature, and existing scholarship on true crime as a media genre, the framework proposes art and media consumption based on perceived task-applicability of art and media. Stemming from the complex nature of socially-imposed, self-determined, and art- & media-instated tasks that an individual may face throughout their lifetime, an individual may be drawn to Freirean power and privilege - even fictional depictions - as societal structures can grant power and privilege with universal task-applicability. Potential usage of this framework towards participatory, qualitative inquiries conclude the paper, in attempt to support future art and media designed with knowledge-communication intent.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Regulatory T cells are key immune cells to initiate tolerable immune responses. TGFβ is the key cytokine of regulatory T cells. TGFβ is also the master cytokine to stimulate tissue fibrosis. Systemic sclerosis is an autoimmune disease related to overt organ fibrosis. Thus, systemic sclerosis is a disease related to regulatory T cell over-representation. Besides, many end stage organ failures including heart failure, liver cirrhosis, uremia, and pulmonary fibrosis also related to tissue fibrosis. Thus, TGFβ producing regulatory T cells are also involved in the pathogenesis of these end stage organ failure. Once we know the significance of TGFβ and it induced tolerable immune reactions in the pathophysiology of end organ failure, we can develop better prevention or therapeutic strategies to combat these detrimental disorders.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Drone imagery has the potential to enrich urban planning and preservation, especially where it converges with the growing creation and use of 3D models. The authors have conducted a systematic literature review of articles published between 2002 and 2022, drawing from reputable academic repositories including Science Direct, Web of Science, and China National Knowledge Infrastructure (CNKI), to identify current gaps in existing research in the application of UAVs to the creation of 3D models in urban planning and preservation. Findings indicate five research shortcomings: limited participation of planning experts, research focus imbalance, lack of usage for special scenarios, lack of integration with smart city planning, and limited interdisciplinary collaboration. The study also acknowledges current limitations with UAV applications and discusses possible countermeasures as well as future prospects.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In order to overcome the limitation of the traditional adaptive Unscented Kalman Filtering (UKF) algorithm in noise covariance estimation for statement and measurement, we propose a hybrid adaptive UKF algorithm based on combining Maximum a posteriori (MAP) criterion and Maximum likelihood (ML) criterion, in this paper. First, to prevent the actual noise covariance deviating from the true value which can lead to the state estimation error and arouse the filtering divergence, a real-time covariance matrices estimation algorithm based on hybrid MAP and ML is proposed for obtaining the statement and measurement noises covariance, respectively; and then, a balance equation the two kinds of covariance matrix is structured in this proposed to minimize the statement estimation error. Compared with the UFK based MAP and based ML, the proposed algorithm provides better convergence and stability.

Demand response flexible loads can provide fast regulation and ancillary services as reserve capacity in power systems. This paper proposes a joint optimization dispatch control strategy for source-load system with stochastic renewable power injection and flexible thermostatically controlled loads (TCLs) and plug-in electric vehicles (PEVs). Specifically, the optimization model is characterized by a chance constraint look-ahead programming to maximal the social welfare of both units and load agents. By solving the chance constraint optimization with sample average approximation (SAA) method, the optimal power scheduling for units and TCL/PEV agents can be obtained. Secondly, two demand response control algorithms for TCLs and PEVs are proposed respectively based on the aggregate control models of the load agents. The TCLs are controlled by its temperature setpoints and PEVs are controlled by its charging power such that the DR control objective can be fulfilled. The effectiveness of the proposed dispatch and control algorithm has been demonstrated by the simulation studies on a modified IEEE 39 bus system with a wind farm, a photovoltaic power station, two TCL agents and two PEV agents.

Ultra-high temperature oxidation-resistant alloys (UTORAs) have received a lot of attention due to the increased research demand for deep space exploration around the world. But UTORAs have the disadvantages of easy oxidation and chalking. So, in this study, a UTORA was prepared by hot-press sintering on VZrHfNbTa (HEA) substrate coated with hafnium. The bonding mechanism, resistance to high-temperature oxidation, and hardness of the sample tests were carried out. The results show that zirconium in the matrix will diffuse into the hafnium coating during the high-temperature sintering process and form the HfZr alloy transition layer, the coating thickness of the composite is about 120 μm, and the diffusion distance of zirconium in the hafnium coating is about 60 μm, this transition layer chemically combines the hafnium coating and the HEA substrate into a monolithic alloy composite. The results of high-temperature oxidation experiments show that the oxidation degree of the hafnium-coated VZrHfNbTa composite material was significantly lower than that of the VZrHfNbTa HEA after oxidation in air at 1600 °C for 5 h. The weight gain of the coated sample after oxidation is 56.56 mg/cm2, which was only 57.7 % compared to the weight gain of the uncoated sample (98.09 mg/cm2 for uncoated), and the surface of the uncoated HEA showed obvious dents, oxidation, and pulverization occurred on the surface and interior of the sample. In contrast, the coated composite alloy sample mainly underwent surface oxidation sintering to form a dense HfO2 protective layer, and the internal oxidation of the hafnium-coated VZrHfNbTa composite alloy was significantly lower than that of the uncoated VZrHfNbTa HEA.

Diffuse large B cell lymphoma (DLBCL), the most frequent type of non-Hodgkin lymphoma in adulthood, remains challenging clinical issues. Despite enhanced remission rates can be achieved, there are one-third of patients who will not respond to current treatment or will relapse with resistant disease, necessitating ongoing efforts on effective treatment strategies and agents. The vacuole H+-ATPase inhibitor bafilomycin A1 is broadly used to block late stage of autophagy flux at high concentration. In this study, we show that, to our surprise, bafilomycin A1 effectively inhibited and killed DLBCL cells at nanomolar concentrations (5nM). Bafilomycin A1 targeted cell cycle regulators cyclin D1 and cyclin E2 to induce cell cycle arrest in G0/G1 phase. Meanwhile, it induced caspase-dependent apoptosis with concomitant cleaved caspase-3 and Parp. Furthermore, we found that bafilomycin A1 inhibited autophagy flux at both early and late stages of the autophagy flux through activating ERK and mammalian target of rapamycin signaling, as well as by inhibiting the degradation of autolysosomes. We speculated that bafilomycin A1 as autophagy inhibitor might enhance the effect of DLBCL chemotherapeutic drug rituximab. Accordingly, our results provided evidence that the combination of bafilomycin A1 with rituximab enhanced the inhibition of DLBCL cells notably. Taken together, our data suggest that bafilomycin A1 may be a promising candidate drug in the therapy of diffuse large B cell lymphoma.

Catalase, an antioxidant enzyme widely produced in mammalian cells and bacteria, is crucial in mitigating oxidative stress in a hostile environment. This function enhances the intracellular survivability of various intracellular growth pathogens, including Brucella abortus. In this study, to determine whether the inhibition of catalase can inhibit the intracellular growth of Brucella (B.) abortus, we employed 3-amino-1,2,4-triazole (3-AT), a catalase inhibitor, in both RAW 264.7 macrophage cells and an ICR mouse model during Brucella infection. The intracellular growth assay indicated that 3-AT exerts growth-inhibitory effects on B. abortus within macrophages. Aside from that, it contributes to the accumulation of reactive oxygen species and the formation of nitric oxide. Notably, 3-AT diminishes the activation of the nucleus transcription factor (NF-κB) and modulates cytokine secretion within infected cells. In our mouse model, the administration of 3-AT reduced B. abortus proliferation within the spleen and liver of infected mice. This reduction was accompanied by a diminished immune response to infection, as indicated by lowered levels of TNF-α, IL-6, IL-10, and altered CD4+/CD8+ T-cell ratio. These results suggest the protective and immunomodulatory effects of 3-AT treatment against Brucella infection.

The mechanism of immune activation and de-activation is very important. Host should trigger effective immunity against pathogen infection. And, host cannot trigger immunity against self-antigens that will lead to detrimental autoimmune disorders. Spleen and liver have opposite roles in mediating immune responses. Spleen is the organ involving in immune activation, and liver is the organ involving in immune de-activation. Sympathetic nerve system and parasympathetic nerve system have opposite roles in mediating immune responses. Sympathetic nerve system is involving in pro-inflammatory, and parasympathetic nerve system is involving in anti-inflammatory. ACTH and glucocorticosteroid have opposite roles in mediating immune responses. ACTH is involving in activating adaptive immunity with inhibiting innate immunity, and glucocorticosteroid is involving in activating innate immunity with inhibiting adaptive immunity. The molecular chaperons, heat shock proteins, which are induced by fever, have the vital roles in immune activation. On the contrary, IgD B cells and gamma-delta T cells are causing immune de-activation via the mechanism of clonal anergy. These mechanism can help us the know the work of immunological pathways better for better control of infectious diseases and autoimmune disorders.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

To achieve user retention through multifactor synergy, Internet enterprises must reduce costs and increase efficiency and sustainable development. In response to the dilemma that Internet compa-nies are experiencing increasingly high user acquisition costs and serious user churn, this paper uses a sample of 46,695 user reviews of nine product series from Xiaomi Ecological Chain. Case studies and qualitative comparative analysis are used to explore the influence mechanisms of quality of experience, brand trust, and brand attachment on users' retention intentions. Our find-ings are as follows. (1) Brand attachment alone is not necessary for high user retention intention, but user perception, cognition, and brand trust are necessary. (2) Quality of experience positively impacts brand trust, attachment, and user retention intention. Therefore, improving user perception and cognition is critical in generating high user retention intention. (3) Five configuration paths can achieve high user retention intention, three configuration paths lead to low user retention intention, and there is an asymmetric relationship between these paths. Among them, the role of quality of experience-driven configuration paths in generating user retention intention is the most prominent. (4) In the substitution relationship between configuration paths, user perception, and cognition can substitute with brand trust and attachment. Our findings have important theoretical and practical implications for revealing the realization paths of high user retention intention in Internet companies and provide a new perspective for future research.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The metrological performance of FBG strain sensing systems is a critical premise for the precision of plastics water support pipeline structural deformation measurement, but the strain transfer loss of FBG attached on the plastics pipe subjected by dynamic force is unclear. This paper presents the first study on the effects of strain transfer between FBG, and acrylate polymer blended with poly resin (ABR)pipe sheets loaded by static and dynamic force. Theoretical methods of dynamic strain transfer theory combine with the exponentially decaying sinusoidal shock force time course is deduced and various dynamic parameters sensitivities studies are carried out, as well as that of the geometric parameters. The result of the dynamic theory is compared with the calibration test outcomes, while the ASTR of FBG attached on ABR sheet is compared with distributed optical fiber sensors (DOFS) and other pipe materials such as PVC, concrete, and steel. Results show that the ASTR of FBG is more accurate than that of the DOFS, and the grows of ASTR depending on the paste length of FBG, the Young's modulus of the middle materials, the thickness of the middle materials and attenuation coefficient. Paste length produced the largest increase, yet the magnitude and loading speed of the external force has unexpectedly little effect on ASTR. FBG seem low error, insensitive with dynamic force and independent with the material of matrix, and this demonstrates benefits that are stronger across the board than DOFS. This is not currently recognized by standards or by most reported studies.

The reservoir water level fluctuation zones (RWLFZs) and the natural riparian zones (NRZs) are two riparian ecosystems with the dramatically opposite hydrological rhythms which notably influence the plant guilds. However, little is known about the discrepancy of functional traits and niche characteristics of plant guilds in the RWLFZ and NRZ under different flooding rhythms. Here the RWLFZs (degraded riparian zones) and NRZs were chosen in the Xiangxi River Basin of the Three Gorges Reservoir (TGR) to investigate the variation in plant community structure, the spatial patterns of diversity, key functional traits and niche characteristics of dominant plant populations. The results showed that a total of 78 vascular plant species were identified in the riparian zones of Xiangxi River Basin. Most of the dominant species were annual herbs in the two riparian ecosystems and the percentage of annual dominant species increased from 65.79% in the NRZ to 67.34% in the RWLFZ. Compared with the NRZ, the specific leaf area, vegetation coverage and the aboveground biomass in the RWLFZ significantly increased by 74%, 27% and 19.6% respectively, while the water use efficiency of the RWLFZ decreased by 59.6% and there was no significant difference in the net photosynthetic rate between them, which showed that annuals in the RWLFZ adopt the R adaptation strategy with fast-growing, short lifespan and quickly acquiring and investing resources by altering leaf morphology such as expanding leaf area. The Simpson dominance index of RWLFZ was significantly higher than that of NRZ. Thus counter-seasonally hydrological alterations had the significant effects on functional traits of dominant species in the RWFLZ. Moreover, the highly adaptable and widely distributed species with larger niche breadths and high important values usually had a higher niche overlap value in the RWLFZ than in the NRZ, which showed that the competition in the plant community after experiencing anti-seasonal flooding was much more intraspecific than interspecific and would facilitate the expansion of species niches. And the distribution of the plant community was mainly driven by elevation (flooding depth), flooding duration and TK in the WLFZs. Our findings imply that the species with large niche breadths and high important values should be prioritized in ecological restoration efforts in the newly formed hydro-fluctuation zone of the TGR.

The high-quality development of urban-rural integration is a vital component of China's economy, serving as a strategic response to the in-depth deployment of new urbanization and rural revitalization strategies. This integration is underscored by the promotion of entrepreneurship in agriculture, rural areas, and among farmers, which acts as a driver for fostering high-quality development in urban-rural areas through market competition. The resulting influx of resources and commodities with similar characteristics plays a crucial role in bridging the urban-rural divide. To maintain objectivity, it is important to adopt a balanced approach and refrain from using biased language. This study delves into the connotation and internal mechanism of the high-quality development of urban-rural integration, centering on the principle of 'quality'. Specifically, it examines the role of entrepreneurship in agriculture, rural areas, and among farmers, and evaluates its direct impact and transmission mechanism. The research employs balanced panel data from 41 cities in the Yangtze River Delta region spanning from 2003 to 2021. The findings reveal that entrepreneurship in agriculture, rural areas, and among farmers serves as a catalyst for promoting high-quality urban-rural development through the construction of a virtuous cycle, whereby resource factors and commodity services are exchanged. Moreover, this deep integration yields diverse effects across economic, spatial, demographic, social, and ecological domains, underscoring the necessity of continued support for entrepreneurship in agriculture, rural areas, and among farmers to facilitate a seamless urban-rural economic cycle and fully realize the benefits of high-quality development.

Feedback trading theory is one of the most primitive theories about financial market. But for a long time，researches and modelings on this topic are rarely seen. The model in this paper shows the effects of sentiment shocks on asset prices in a market characterized by feedback trading in the long run. We find that，generally，feedback trading will lead to cognitive bias effect and trading inducement effect. Cognitive bias effect increases with the feedback trading parameter ( FTP) . In our model，the abnormal volatility of asset prices is captured by cognitive bias effect，sentiment shock effect and trading inducement effect．

Background: The COVID-19 outbreak has accelerated the huge difference between medical care and disease prevention in Chinese medical institutions. This study aimed to investigated the relationship between the symbiotic units, environments, models, and effects of the integration of medical and disease prevention. Methods: This cross-sectional study involved 762 employees of public hospitals in 11 cities in Zhejiang Province by random stratified sampling. We analyzed the influence paths of elements in the mechanism of integration of medical and disease prevention and the mediating effect of symbiotic models among symbiotic units, symbiotic environments, and effects for on this integration. Results: The path coefficient of symbiotic unit on the symbiosis model was 0.46 (p<.001), the path coefficient of symbiotic environment on symbiosis model was 0.52 (p<.001). The path coefficient of the symbiotic unit and environment was 0.91 (p<.001). The symbiotic models exhibited a partial mediation effect between symbiotic units and the effect of this integration. Sobel test = 3.27, β = 0.152, and the mediating effect accounted for 34.6%. Conclusions: It is suggested that Health policy-makers and public hospital managers should provide sufficient symbiotic units, establish collaborative symbiotic models, and improve the effects of integration of medical and disease prevention in public hospitals.

The commercial oxygen-free copper sheets were cold-rolled with reduction rates ranging from 20% to 87% reduction rate and annealed at 400, 500 and 600 °C. The microstructure and texture evolution during cold-rolling and annealing processes were studied using optical microscopy (OM), the scanning electron microscopy (SEM) and the electron back-scattered diffraction (EBSD). The results show that the deformation textures of {123} (S) , {112} (Copper) and {110} (Brass) were continuously enhanced with the increase of cold-rolling reduction. The orientations along the α-oriented fiber converged towards Brass and the orientation density of β fiber obviously increased when the rolling reduction exceeded 60%. The recrystallization texture was significantly affected by the cold-rolling reduction. After 60% cold-rolling reduction, Copper and S textures components gradually decreased and {011} recrystallization texture component formed with the increase of annealing temperature. After 87% cold-rolling reduction, a strong Cube texture formed and other textures were inhibited with the increase of annealing temperature. The strong Brass and S deformation texture was conducive to the formation of a strong Cube annealing texture. The density of annealing twin boundary decreased with the increase of annealing temperature, and more annealing twin boundaries formed in the oxygen-free copper sheets with the increase of cold rolling reduction.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

African swine fever has damaged the foundation of China’s hog industry, caused a serious decline in hog production, highlighted the contradiction between supply and demand in the pork market, and led to major economic and social impacts. This study measured the industrial resilience of 31 Chinese provinces which faced the African swine fever shock and its spatial and temporal differentiation characteristics from 2018-2021 in terms of the two dimensions of resistance and recoverability. Using Geodetector, the study explored the key factors influencing the resilience of China’s hog industry. The results showed that 2018-2019 and 2020-2021 were the resistance and recovery periods of the hog industry under the African swine fever shock, respectively, with poor resilience characterizing the resistance period and improved resilience exemplifying the recovery period. At the early stage of the African swine fever outbreak, Tianjin, Shanxi, Guangxi and Yunnan had robust resistance in the hog industry, and the slaughter rate, economic level, mortality rate, carcass weight and culling rate showed the highest explanation for the resistance. At the most severe stage of the outbreak, the resistance of the hog industry in all provinces was generally poor, and the slaughter rate, per capita consumption and scale level showed the highest explanation for the resistance. In the period of rapid recovery of hog production, the recoverability of each province was very strong, and the industrial structure, culling rate, economic level and resource carrying capacity showed the highest explanation for the recoverability. In the reasonable adjustment period of hog production capacity, the recoverability based on the breeding sow inventory in 13 provinces, including Henan, Shandong and other large hog breeding provinces, was negative, and the scale level, slaughter rate, per capita consumption and resource carrying showed the highest explanation for the recoverability. It is recommended to take measures to enhance the resilience of the hog industry, strengthen the prevention and control of hog epidemics, improve the monitoring and early warning mechanism, and strive to enhance the ability of the hog industry to cope with major animal epidemics.

In this paper, under the symmetric entropy and the scale squared error loss functions, we consider the maximum likelihood (ML) estimation and Bayesian estimation of the Shannon entropy and Rényi entropy of the two-parameter inverse Weibull distribution. In the ML estimation, the dichotomy is used to solve likelihood equation. In addition, the approximation confidence interval is given by the Delta method. Because the form of estimation results is more complex in the Bayesian estimation, the Lindley approximation method is used to achieve the numerical calculation. Finally, Monte Carlo simulations and a real data set are used to illustrate the results derived. By comparing the mean square error between the estimated value and the real value, it can be found that the performance of ML estimation of Shannon entropy is better than that of Bayesian estimation, and there is no significant difference between the performance of ML estimation of Rényi entropy and that of Bayesian estimation.

The scheme to realize high speed (~250Gb/s) all-optical Boolean logic gates using semiconductor optica amplifiers with quantum-dot (QD-SOA) is introduced and analyzed in this review. Numerical simulation method was presented by solving the rate equation and taking into account nonlinear dynamics including carrier heating and spectral hole-burning. Binary phase shift keyed (BPSK) signal and on-off keyed signal are used to generate high speed all-optical logic gates. The applications based on all-optical logic gates such as, all-optical latches, pseudo random bit sequence (PRBS) generation and all-optical encryption, are also discussed in this review. Results show that the scheme based on QD-SOA is a promising method for the realization of high speed all-optical communication system in the future.

Acinetobacter baumannii is a multidrug-resistant and invasive pathogen associated with the etiopathology of both an increasing number of nosocomial infections and of relevance to poultry production systems. Multidrug-resistant Acinetobacter baumannii has been reported in connection to severe challenges to clinical treatment, mostly due to an increase rate of resistance to carbapenems. Amid the possible strategies aiming to reduce the insurgence of antimicrobial resistance, phage therapy has gained particular importance for the treatment of bacterial infections. This review summarises the different phage-therapy approaches currently in use for multiple-drug resistant Acinetobacter baumannii, including single phage therapy, phage cocktails, phage -antibiotic combination therapy, phage coding Acinetobacter baumannii and the novel phage enzyme treatment. Although phage therapy represents a potential treatment solution for multidrug-resistant Acinetobacter baumannii, further research is needed to unravel some unanswered questions especially in regard to its in vivo applications, before possible routine clinical use.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Plants are subjected to abiotic stresses throughout their developmental period. Abiotic stresses include drought, salt, heat, cold, heavy metals, nutritional element and oxidative stresses. Improving plant response to various environmental stresses is critical for plant survival and perpetuation. The WRKY transcription factors have special structure (WRKY structural domains), which enable WRKY transcription factors to have different transcriptional regulatory functions. The WRKY transcription factors can not only regulate abiotic stresses response and plant growth and development by regulating phytohormone signalling pathways, but also promote or suppress the expression of downstream genes by binding to the W-box [TGACCA/TGACCT] in the promoters of their target genes. In addition, WRKY transcription factors not only interact with other families of transcription factors to regulate plant defence responses in abiotic stresses, but also self-regulate by recognizing and binding to W-boxes in their own target genes to regulate their defence responses to abiotic stresses. However, in recent years, research reviews on the regulatory roles of WRKY transcription factors in higher plants are scarce and shallow. In this review, we focus on the structure and classification of WRKY transcription factors, as well as the identification of their downstream target genes and molecular mechanisms involved in the response to abiotic stresses, which can improve the tolerance ability of plants in abiotic stress and we also look forward to their future research directions, with a view to providing theoretical support for the genetic improvement of crop abiotic stresses tolerance.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

Alzheimer's disease (AD) is a progressive and evolving neurodegenerative disease with an insidious onset that can lead to memory loss and cognitive impairment. There is no effective treatment for this disease. However, early diagnosis plays an important role in treatment planning to slow down its progression, as treatment has the greatest impact in the early stages of the disease. Neurological images obtained through different imaging techniques provide powerful information and help diagnose the disease. With the wide application of deep learning techniques in disease diagnosis, especially the prominence of Convolutional Neural Networks (CNNs) in computer vision and image processing, more and more studies are proposing the use of this algorithm for the diagnosis of AD. In this paper, we first systematically introduce the impact of AD on people, detailing the biomarkers, early clinical symptoms, and risk factors of this disease. Secondly, it goes on to detail the development of CNNs, their form, and methods to help diagnose AD. It is proposed that CNNs can help diagnose AD by analyzing medical imaging data, particularly structural brain scans such as magnetic resonance imaging (MRI) and functional scans such as positron emission tomography (PET). Finally, it is concluded that CNNs are of great importance for the diagnosis of AD and that they are likely to play an increasingly important role in the early detection of the disease, the understanding of disease mechanisms, and ultimately, in the development of effective AD therapies and interventions. CNNs are playing an increasingly important role in the Their potential impact on healthcare emphasizes the importance of continued research and innovation in neural networks and medical imaging.

This article presents a new theory on redshift of light from celestial bodies. Lately it has been found that the Hubble constant calculated from different methods discord so much that calls arise for new physics to explain. Also, in addition to many unsolved puzzles like dark matter and source of expansion force, we shall show in this article that the current theory of redshift implies a few hidden, unreasonale assumptions. By assuming photon has temperature and its thermal energy is fully converted to wave energy, this article shows that photon can have a new redshift called Temperature Redshift, which not only is more significant for remote stars or galaxies, but also better fits the observational data, including those used in Hubble constant calculation. As such, if true, this new theory not only adds to our new understanding of photons, but may totally change our current understanding of the Universe, i.e., the Big Bang theory.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Repairing of small and isolated delamination area in carbon fiber reinforced polymer (CFRP) without significantly altering the composite structure is studied in this research. A small drilled hole was introduced at the center of the delamination section of CFRP, providing the channel for epoxy infill of sharp delamination cracks. The pressureless infill repair was achieved through the capillary action of an acetone-diluted resin solution (without hardener) with CNT reinforcement, e.g., 89 m/m% of acetone, 10 m/m% of resin and 1m/m% of CNT. Such an acetone-rich resin pre-coating (RPC) solution is easy to prepare and apply to the drilled hole area. Curing of CNT-toughened resin infill was induced by filling the small-drilled hole with a resin-hardener mixture toughened by CNT/Aramid pulp. The effectiveness of delamination repair with curing periods of two weeks and three months were compared. Flexural strength measurements indicated that 77% (potentially 100%) of the restoration was achievable.

Given a stream of depth images with a known cuboid reference object present in the scene, we propose a novel approach for accurate camera tracking and volumetric surface reconstruction in real-time. Our contribution in this paper is threefold: (a) utilizing a priori knowledge of the cuboid reference object, we keep drift-free camera tracking without explicit global optimization; (b) we improve the fineness of the volumetric surface representation by proposing a prediction-corrected data fusion strategy rather than simple moving average, which enables accurate reconstruction of high-frequency details such as sharp edges of objects and geometries of high curvature; (c) we introduce a benchmark dataset CU3D containing both synthetic and real-world scanning sequences with ground-truth camera trajectories and surface models for quantitative evaluation of 3D reconstruction algorithms. We test our algorithm on our dataset and demonstrate its accuracy compared with other state-of-the-art algorithms. We release both our dataset and code as opensource1 for other researchers to reproduce and verify our results.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Systemic lupus erythematosus (SLE) is a prevalent autoimmune condition, yet its alignment with a specific host immunological pathway remains unclear. The THαβ host immunological pathway, recognized for its defense against viruses and prions, has recently emerged as a response to DNA, RNA, and protein pathogens. SLE patients often produce anti-double strand DNA antibodies and anti-nuclear antibodies, suggesting a potential association with the THαβ host immune reaction. Throughout the course of SLE, elevated levels of type 1 interferons, type 3 interferons, interleukin-10, IgG1, and IgA1 are commonly observed. These cytokines and antibody isotypes are indicative of the THαβ host immunological pathway. Similarly, Myasthenia gravis, Grave’s disease, Graft versus host disease, autoimmune hemolytic anemia, immune thrombocytopenia, dermatomyositis, and Sjogren’s syndrome are also linked to THαβ-related type 2 hypersensitivities. Considering the potential association of these diseases with dysregulated THαβ immune responses, therapeutic strategies such as anti-interleukin-10 or anti-interferons α/β could be explored to manage these disorders effectively.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Multimodal medical image fusion is a fundamental but challenging problem in the fields of brain science research and brain disease diagnosis, and it is challenging for sparse representation (SR)-based fusion to characterize activity level with single measurement and no loss of effective information. In this paper, the Kronecker-criterion-based SR framework is applied for medical image fusion with a patch-based activity level integrating salient features of multiple domains. Inspired by the formation process of vision system, the spatial saliency is characterized by textural contrast (TC), which is composed of luminance and orientation contrasts to promote more highlighted texture information to participate in the fusion process. As substitution of the conventional l1-norm-based sparse saliency, a metric of sum of sparse salient features (SSSF) is used for promoting more significant coefficients to participate in the composition of activity level measure. The designed activity level measure is verified to be more conducive to maintain the integrity and sharpness of detailed information. Various experiments on multiple groups of clinical medical images verify the effectiveness of the proposed fusion method on both visual quality and objective assessment. Furthermore, the research work of this paper is helpful for further detection and segmentation of medical images.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

Seeds stored for a prolonged period are subject to aging and reduction in germination potential (GP), which will negatively affect seed sales. Rare-earth elements have a synergistic effect on the improvement of seed GP. In this study, we examined the effects of neodymium on biochemical components, the antioxidant protective system, and metabolism-related enzymes during germination of naturally and artificially aged seeds of three wheat cultivars. Seed germination indices, biochemical substance contents, and enzyme activities decreased after seed aging. Soaking seeds in neodymium nitrate solution revived aged wheat seeds at an optimal concentration of 20 µmol/L for 8 h. Soaking in neodymium nitrate solution increased the GP (by 2.25%–60.9%), germination index (by 1.69%–29.2%), and vigor index (by 3.36%–18.7%) of aged seeds. Compared with non-soaked seeds, soaking significantly changed the contents of biochemical substances, and the activities of antioxidant protective enzymes and metabolic enzymes in seedlings were increased. Soaking with neodymium may revive aged seeds by regulating the synthesis of soluble sugars, soluble proteins, chlorophyll, and carotenoids, and decomposing malondialdehyde, in the germinating seed. Root dehydrogenase and amylase showed different responses to the aging modes. The differential responses of root dehydrogenase and amylase may reflect differences in the resistance of enzymes to long-term mild seed aging and short-term severe environmental aging.

Wind energy is a kind of renewable energy with great potential for development. This study mainly investigated the application of shock waves generated by high-pressure gases (wind energy) for generating energy. In this study, we designed a new supersonic shock wave generator that can be reused without disassembling and assembling bolts and developed a supersonic shock wave monitoring system. This system monitored the velocity of the generated shock waves, which was Mach 3-5, and the output pressure was more than 100 times higher than the input pressure of the shock wave generator tank.Then, we developed a power generation system driven by supersonic shock waves based on the characteristics of the new shock wave generator, which can generate high-pressure and high-speed blast waves and can be reused. The shock wave generator can repeatedly generate high-pressure waves to drive the Tesla turbine and then the magnetic energy generator for power generation. We established a complete control process for power generation driven by shock waves by controlling the valve stem. The system can detect the tank pressure, output pressure, gas flow, rotation speed, voltage, and current during the control process for the performance analysis of power generation.

China is experiencing rapid urbanization. The focus on health issues has shifted from the treatment of diseases to passive or active prevention. Diseases caused by the deterioration of the urban environment, such as cardiovascular disease, diabetes, obesity and other chronic diseases and mental illness, have gradually become the main threat to public health. Studies have confirmed that urban green spaces (UGS) can help residents relieve mental stress, improve mood, reduce mental fatigue and restore attention, which has a positive effect on people's physical and mental health. In this study, the relationship between the quantity and quality factors of UGS and the physical and mental health of urban residents in Xihu District of Hangzhou is examined, and on this basis, UGS design strategies are proposed to promote the physical and mental health of residents. This study is of great significance for the future construction of UGS that are beneficial to the health of residents and the promotion of a healthy China and healthy city construction.

Two sufi women take part in activities related to sufism and create an attraction point in the secular side in Turkey.The most striking point is that both women do not wear headscarves although they are muslim women. This article attempts to show how sufi women Cemalnur Sargut and Hayatnur Artıran have idealized a Muslim woman's identity, the work they are doing to achieve this ideal, their attidue toward Rebublic values, and the effects of these attidues on their followers. This article was created from my doctoral thesis and based on Qualitative research which has been established on the basis of 2-year long participant observation and data obtained from in-depth and focus interviews. 31 women and 20 men were interviewed in depth and focus interviews.The main conclusions of my qualitative research are that the influence of theese sufi women is related with process of modernization by accelerating the establishment of the republic in Turkey. It seems that a perception has established concerning that “public apparency’’ of woman will disappear if the “apparency of body’’ disappears and the woman will return to its role which had relapsed into silence for centuries. Besides not using the headscarf, religious conversation have been created by theese sufi women in the balance of religion, philosophy and science and the fact that they are conducting their works under secular institutions such as foundations and associations have also been observed to have a very important effect on seculer side.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Accurately estimating shrub biomass in arid and semi-arid regions is critical for understanding ecosystem productivity and carbon stocks at both local and global scales. However, capturing the shrub biomass accurately by satellite observations is challenging due to the short and sparse features of shrubs. In this study, we presented a framework to estimate shrub biomass at a 10m spatial resolution by integrating ground in-situ data, unmanned aerial vehicle (UAV), Sentinel-2, and Sentinel-1 observations. The pilot study was conducted in the Helan mountains of Ningxia province, China. First, the spatial distribution map of shrubland and other land cover types was generated in 2023. Then, a prediction model of shrub biomass was developed in a Random Forest Regression (RFR) approach driven by different predicted variable datasets based on in-situ measurements, UAV, and satellite images. Finally, the developed model was used to produce the biomass map of shrubland in 2023. The uncertainty was characterized by creating a standard deviation (SD) map using the Leave-One-Out Cross-Validation (LOOCV) method in the shrub biomass estimates. The resultant shrubland distribution map in 2023 has an F1 score of 0.92. The shrub biomass model driven by spectral bands and vegetation indices (R2= 0.62) demonstrated superior performance than that only driven by spectral bands (R2=0.33) or vegetation indices (R2=0.55). The uncertainty of the estimated biomass was lower than 4%, with the lowest values (<2%) happening in the high shrub coverage (>30%) and biomass production (>30kg/m2) regions. Furthermore, the findings show that the magnitude of shrub biomass was affected by the aridity and precipitation significantly in the study region. This study provides a workflow to accurately monitor the biomass of shrublands in a complicated environment based on remote sensing images from multi-platform observations.

In March 2013, a novel avian influenza A H7N9 virus was emerged in China, which cause rapidly progressive pneumonia and with a high fatality rate. Serologic studies to evaluate neutralizing antibodies of infected patients and birds are invaluable tools for immunogenicity research of H7N9 and epidemiological investigation. Conventional neutralization assays are laborious and time-consuming which also hampered by biosafety requirement. In this study, We construct and produce pseudovirus bearing the full-length hemagglutinin (HA) of H7N9 virus in the Env-defective, luciferase-expressing HIV-1 backbone. The production of lentiviral pseudovirus was analysed by HA gene specific real-time reverse-transcription PCR, transmission electron microscopy (TEM), and Western Blot assay to prove the nucleic acid replication, the morphology of virus, and the expression of HA protein in pseudovirus. After that pseudovirus based inhibition assay was established to detect neutralizing antibodies of a panel of serum samples. Our results demonstrated that H7N9 pseudovirus which had single-cycle infection was generated. By comparing the neutralization antibody titers, pseudovirus based neutralization test could be recognized as an alternative of conventional microneutralization (MN). Hence, we conclude that it is possible to use pseudovirus inhibition assay to screen sera samples, as well as evaluate vaccine-induced neutralizing antibodies against H7N9 virus.

The rise of data science in biology stimulates interdisciplinary collaborations to address fundamental questions. Here, we report the outcome of the first SINFONIA symposium focused on revealing the mechanisms governing plant reproductive development across biological scales. The intricate and dynamic target networks of known regulators of flower development remain poorly understood. To analyze development from the genome to the final floral organ morphology, high-resolution data that capture spatiotemporal regulatory activities are necessary and require advanced computational methods for analysis and modeling. Moreover, frameworks to share data, practices and approaches that facilitate the combination of varied expertise to advance the field are called for. Training young researchers in interdisciplinary approaches and science communication offers the opportunity to establish a collaborative mindset to shape future research.

Alternative fertilizations are essential to minimize the deteriorating effects of chemical fertilizers on soil and water quality/health. Accordingly, the present work investigated the effects of combined organic-inorganic fertilization (COIF) on wheat and rice yields, soil nutrients, and soil Cd accumulation. Hence, seven different treatments were set up: control (CK); conventional fertilization (CF); optimized fertilization (OF); organic fertilizer replacing 25% (T1) and 50% (T2) of OF; and organic nitrogen (N) replacing 25% (M1) and 50% (M2) of OF-N. Overall, significant increases occurred in the yields of COIF crops. Compared with the CF, the highest wheat and rice yields happened in M1 treatment (approximately by18.5%) (P &lt; 0.05). COIF slightly alleviated soil acidification, and improved the cation exchange capacity (CEC) of the study soils. Besides, COIF treatments significantly increased the contents of total phosphorus, total potassium, available phosphorus, and available potassium by 6.35 to 16.9 %, 3.17 to 10.9 %, 5.53 to 28.7 %, and 2.6 to 12 %, respectively (P &lt;0.05). Nevertheless, negligible increases took place in Cd content of COIF soils compared with the CK. Altogether, our results concluded on 25% replacement of OF-N by organic N (M1) to effectively improve the fertility/ecological sustainability of the study soils.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The conceptualisation of happiness varies across different cultures. In Chinese culture, happiness is not only inclusive of oneself, but also hinges on the people is related to and society. Chinese social development have influenced psychological traditionality and modernity and individual's happiness. In Experienment1, 450 participants were recruited and surveyed to examine the levels of happiness amongst Chinese undergraduates with diverse cultural values. The results showed that individuals with both traditional and modern psychological orientations had high levels of happiness. Those with higher psychological traditionality showed more satisfaction with family relationships and social happiness, while those with higher psychological modernity demonstrated a higher level of relational happiness. In Experienment2, 280 participants were recruited, and a "happiness token distribution" and "happiness importance survey" were employed to draw a 'happiness circle' for Chinese undergraduates. The results revealed that those with a higher degree of psychological traditionality assigned a greater proportion of their happiness to ascribed relationships. In contrast, those with a higher degree of psychological modernity allocated a larger share of their happiness to interactive relationships and social relationships. Individuals with lower values of both traditionality and modernity perceived themselves as the most important component in their happiness circle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.