Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

There have been several cases of large-scale wind generators (WGs) tripping off caused by untimely fault removing in recent years. Currently, the discoordination between the box-type transformer fuse protection (BTFP) and two-section collecting line current protection (CLCP) brings a security risk to wind farm. In order to ensure the selectivity, the first section (Sec-I) CLCP should be set a enough interval that is longer than the fuse melting time, and another interval is set for the Sec-II CLCP, which weakens the speed of the CLCP. When a fault occurs on the collecting line, there is no doubt that WGs cannot work too long in abnormal operation, which may cause WGs to be placed off the grid. For a power system with high penetration of wind power, large-scale WGs tripping off will cause a great power shortage, and affect the stability of the power system. The selectivity and sensitivity of the CLCP is analyzed in detail to make the CLCP speed better. Considering the fault ride-through ability of WGs, the fault clear time is an important factor to lead to large-scale WGs tripping off. Two main works are done in this paper. The first is to accelerate the speed of the Sec-I CLCP though reducing the protection zone. Another one is introduce the risk assessment module into the CLCP, which not only improve the speed of the CLCP but also ensure the safety of the wind farm during faults. According to the deference in trip-off causes of WGs, the matching functions are created to assess the trip-off risk of WGs on the spot. In the case of fault, the trip-off risk indicators of WGs are timely updated to data sharing center and open to the CLCPs. The set of risk indicators is divided into several subsets according to the risk range. The dynamic changes of the subsets during fault help to improved CLCP scheme. This scheme can accelerate protection speed based on the increasing risk of large-scale WGs tripping off in wind farms. Compared with traditional CLCP, this approach can make the CLCP combines selectivity and speed better based on the analysis of the ride- through ability of WGs.

Cisplatin-based chemotherapy has long been viewed as the first-line chemotherapy for advanced and metastatic urothelial carcinoma (UC). However, many patients with UC have been classified as “cisplatin-ineligible patient”, which requires alternative chemotherapy due to their poor responses. In fact, vast majority of those who initially responded to cisplatin-based chemotherapy eventually progressed. Understanding of UC tumor immunology provided an immunopathogenic bases for immune checkpoint inhibitors, targeting PD-1 and CTLA-4, to treat cisplatin ineligible metastatic UC and patients with platinum-refractory metastatic UC. In 2020, data from the trail further showed that PD-L1 inhibitors benefit prolonged survival and progression-free survival as maintenance therapy. Besides immune-targeting therapies, manipulation of tumor microenvironment via metabolic pathways alternation, such as inhibiting tumor glycolysis, lactate accumulation and exogenous glutamine uptake, has been investigated in the past few years. In this comprehensive review, we started by introducing traditional chemotherapy of UC, and summarized current evidences supporting the use of immune checkpoint inhibitors and highlighted ongoing clinical trials. Lastly, we reviewed the tumor metabolic characteristic and the anti-tumor treatments targeting metabolic pathways.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

The changing of land use and land cover (LULC) are both affected by climate and human activity and affect climate, biological diversity, and human well-being. Accurate and timely information about the LULC pattern and change is crucial for land management decision-making, ecosystem monitoring, and urban planning, especially in developing economies undergoing industrialization, urbanization, and globalization. Biodiversity degradation and urban expansion in eastern China are research hot-spots. However, the influence of LULC changes on the region remains largely unexplored. Here, an object-based and multi-temporal image analysis approach was developed to detect how LULC changes during 1985-2015 in the Tiaoxi watershed (Zhejiang province, eastern China) using Landsat TM and OLI data. The main objective of this study is to improve the accuracy of unsupervised change detection from object-based and multi-temporal images. To this end, a total of seven LULC maps are generated with multi-temporal images. A random stratified sample design was used for assessing change detection accuracy. The proposed method achieved an overall accuracy of 91.86%, 92.14%, 92.00%, and 93.86% for 2000, 2005, 2010, and 2015, respectively. Nevertheless, the proposed method, in conjunction with object-oriented and multi-temporal satellite images, offers a robust and flexible approach to LULC changes mapping that helps with emergency response and government management. Urbanization and agriculture efficiency are the main reasons for LULC changes in the region. We anticipate that this freely available data will improve the modeling for surface forcing, provide evidence of changes in LULC, and inform water-management decision-making.

As the core of intelligent manufacturing, CPS has serious security issues, especially for the communication security of its terminal M2M. In this paper, blockchain technology is introduced to address such a security problem of communications between different types of machines in CPS. According to the principles of blockchain technology, we design a blockchain for secure M2M communications. As a communication system of M2M consists of public network areas, equipment areas and private areas, we design a sophisticated blockchain structure between the public area and private area. For validating our design, we take cotton spinning production as a case study to demonstrate our solution to M2M communication problems under the CPS framework.

Recently, light traps using light-emitting diode (LED) lights have been applied to monitor or control insect pests. The oriental armyworm, Mythimna separata Walker, is an important insect pest that has caused damage to several cereal crops, including corn, wheat and rice. The present study aims to seek out a sensitive wavelength causing high phototactic response in M. separata. The study evaluated the phototactic responses of M. separata moths to several LED lights of different wavelengths and luminance intensities under laboratory condition. Results showed that green (520 nm) LED light resulted in significant phototactic response of M. separata moths compared to LED lights of other wavelengths. Additionally, the highest attraction rate of the moths to green LED light appeared in luminance intensity group of 200 lux compared to the other intensities groups. Experiments under optimum conditions based on the above experiments revealed that the green LED light exhibited the strongest attraction rate (64.44%) among all experimental groups. An experiment performed in a net cage also showed that green LED light resulted in the highest phototactic response of M. separata moths, 1.7 times more than a commercial black light used as control. These findings clearly demonstrate that M. separata moths have a high sensitivity to the green LED light. Therefore, a light trap equipped with green LED light could be useful for monitoring and controlling M. separata moths.

A phenomenological constitutive model is developed to describe the uniaxial transformation ratcheting behaviors of super–elastic shape memory alloy (SMA) by employing a cosine–type phase transformation equation with the initial martensite evolution coefficient that can capture the feature of the predictive residual martensite accumulation evolution and the nonlinear hysteresis loop on a finite element (FE) analysis framework. The effect of the applied loading level on transformation ratcheting are considered in the proposed model. The evolutions of transformation ratcheting and transformation stresses are constructed as the function of the accumulated residual martensite volume fraction. The FE implementation of the proposed model is carried out for the numerical analysis of transformation ratcheting of the SMA bar element. The integration algorithm and the expression of consistent tangent modulus are deduced in a new form for the forward and reverse transformation. The numerical results are compared with those of existing model and the experimental results to show the validity of the proposed model and its FE implementation in transformation ratcheting. Finally, a FE modeling is established for a repeated preload analysis of SMA bolted joint

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Objective: Daratumumab (Dara) is the first-in-class human-specific anti-CD38 mAb approved for treating multiple myeloma (MM). However, DARA-induced depletion of CD38high natural killer (NK) cells results in crippled antibody-dependent cellular cytotoxicity (ADCC), which limits its clinical detection and prediction for Dara efficacy. Therefore, we aimed to explore new NK subsets that could predict Dara efficacy and the underlying mechanism in Dara development. Methods: Multicolour spectral flow cytometry monitored changes in the immune cells of 13 paired RRMM patients. We used machine learning-driven clustering, FlowSOM (Flow Self-Organizing Maps), and dimensional reduction with tSNE (t-distributed Stochastic Neighbour Embedding) to identify unique cell populations pre- and posttreatment. Then, in vitro, fratricide and proliferation assays were performed to explore the function of new NK subsets against MM under Dara treatment. Results: The NK cells were divided into 25 subsets, among which we found that the percentages of KIR-NKP46+ NK cells decreased in paired RRMM patients compared to healthy controls but increased significantly post-Dara treatment. The fold change in KIR-NKP46+ after one dose of Dara treatment can predict whether the best response could be achieved within one month (ROC=0.86, p=0.011). Further in vitro experiments showed that KIR-NKP46+ NK cells are superior to KIR+ NK cells, cooperatively acting with daratumumab to sustainably eradicate MM cells. Meanwhile, apoptosis was significantly decreased, and the proliferation ability was relatively increased post-Dara treatment. Conclusion: In conclusion, the fold change in KIR-NKP46+ NK cell subsets after one dose of Dara treatment can predict the outcome of the curative effect, indicating a putative role of KIR-NKP46+ subsets against MM cells. The mechanism attributed to a relative expansion of the subset due to decreased apoptosis and increased proliferation ability.

The transition region is a very thin but most peculiar layer in the solar atmosphere, located between the solar chromosphere and the corona. It is a key region for understanding the coronal heating, the solar eruptions triggering, and the origin of solar winds. Here, the gradients of all physical parameters are very high, including plasma density, ionization degree, temperature, and magnetic fields, etc. Therefore, the transition region should be highly dynamic, such as fast energy releasing and transporting, plasma heating, and even particle accelerating. They include two physical aspects: thermal and non-thermal processes. The thermal processes can be observed from the ultraviolet (UV) and extreme ultraviolet (EUV) emission by multi-wavelength images. The non-thermal processes, however, should be related to radio emissions especially at millimeter wavelengths, and the frequency range should span from several GHz to beyond 300 GHz, and the emission mechanism should be highly related to the magnetic fields and variations. The ultra-wide broadband spectral observations at millimeter wavelengths with high spectral resolutions may provide rich dynamic information about the transition region, such as non-thermal energy release and transmission, the flows of plasma and energetic particles, the magnetic fields and their variations, the generation and transportation of various waves, and the formation and evolution of the source regions of solar eruptions. Here, we discussed the spectral characteristics of millimeter-wave emission from the transition region and proposed a new conception of ultra-wide broadband millimeter-wave spectrometers to observe them.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Poor interlaminar fracture toughness has been a major issue in glass fiber-reinforced epoxy resin (GF/EP) laminate composites. In this paper, soft carboxy-terminated liquid nitrile (CTBN) rubber particles and rigid nano-SiO2 are used to toughen the epoxy resin (EP) matrix to improve the interlayer properties of GF/EP laminate composites. The effects of adding two toughening agents on the mechanical and interlayer properties of GF/EP laminates were studied. The results showed that adding the two kinds of particles improved the mechanical properties of the epoxy matrix. When the additional amount of flexible CTBN rubber particles was 8wt%, and the rigid nano SiO2 was 0.5wt%, the fracture toughness of the matrix resin was increased by 215.8%, and the tensile strength was only decreased by 2.3% compared with the pure epoxy resin. On this basis, the effects of two kinds of particles on the interlayer properties of GF/EP composites were studied. Compared with the unmodified GF/EP laminates, the interlayer shear strength and mode Ⅰ interlayer fracture toughness is significantly improved by toughening agent, and the energy release rate GIC of interlayer shear strength and interlayer fracture toughness is increased by 109.2%, and 86.8%, respectively.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The exceptional performance advantages of the fiber optic gyroscope (FOG) position it as a dominant player in middle and high-end inertial navigation systems. To prevent the loss of sensor precision caused by algorithm design and simplify the complex modeling strategy in traditional methods. We gradually demonstrate the significant role of Convolutional Neural Network (CNN) in the navigation system based on FOG, and utilize the particle swarm optimization algorithm (PSO) to expedite the convergence of the network. The experimental results demonstrate that the initial alignment method based on deep learning is more accurate than the traditional method. The attitude angle error is reduced by 81.25%, 92.54% and 36.53% respectively. The research provides support for the future application of deep learning in optical navigation systems.

Malignancy is a fatal disease with an increasing incidence with each passing year, and the early diagnosis of malignancy can significantly improve the cure rate of patients, which has profound implications for saving patients' lives. The changes of miRNA are closely related to the occurrence of malignant tumors. The expression of miRNA in many malignant tumors is obviously different and unique from that in normal tissues. In this study, a strategy for amplifying microRNA (miRNA) signal was designed using duplex specific nuclease (DSN), which was then combined with Peptide nucleic acid (PNA) probe hybridization technology to prepare a sensitive and efficient paper-based lateral flow biosensor (LFB) for the detection of pancreatic cancer (PC) associated microRNA-10b. The performance evaluation results of the LFB showed that the detection limit of miR-NA-10b is 5 nM/mL, and carries demonstrated well specificity, stability, reproducibility. The biosensor prepared in this paper can provide accurate and rapid detection of miRNA-10b. The detection results play a guiding role in the early diagnosis of PC. Meeting the clinical need for largescale screening of individuals at high risk of PC. Providing new avenues to achieve early mass screening in individuals at high risk of PC.

The Yixian Formation (Lower Cretaceous) of China is famous worldwide for its fossils of early angio-sperms, but there is only one record of flower bud hitherto. A previous fossil record of flower bud just showed the appearance and lacked any internal details. Such a lacuna in knowledge of flower buds hin-ders our understanding of the evolution of flowers. Our new specimen was collected from an outcrop of the Yixian Formation (the Barremian-Aptian, Lower Cretaceous) near Dawangzhangzi, Lingyuan, Liao-ning, China. The specimen was observed and photographed using a Sony ILCE-7 digital camera and a Nikon SMZ1500 stereomicroscope, and details were observed using a TESCAN MAIA3 SEM. Our ob-servations document a fossil flower bud, Archaebuda cretaca sp. nov, from the Lower Cretaceous of China. The occurrence of two species of Archaebuda in the Yixian Formation not only confirms the ex-istence of the expected gynoecium (and possible androecium) in a flower bud, but also underscores the occurrence of typical flowers in the Early Cretaceous.

This paper proposed an optimal tracking control scheme through adaptive dynamic programming(ADP) for a class of partially unknown discrete-time nonlinear systems based on radial basis function neural network(RBF-NN). In order to acquire the unknown system dynamics, we use two RBF-NNs, the one is used to construct the identifier, and the another is used to directly approximate the steady-state control input, where a novel adaptive law is proposed to update neural network weights. While the optimal feedback control and the cost function are derived via feedforward neural networks approximating, it is proposed to regulate the tracking error, the critic network and the actor network are then trained online to obtain the solution of the associated Hamilton–Jacobi–Bellman (HJB) equation being built under the ADP framework. Simulations verify the effectiveness of the optimal tracking control technique using the neural networks.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Lead-free copper halide perovskite nanocrystals (NCs) are emerging materials with excellent photoelectric properties. Herein, we present a colloidal synthesis route of orthorhombic Cs2CuCl4 NCs with well-defined cubic shape and an average diameter of 24 ± 2.1 nm. The Cs2CuCl4 NCs exhibit bright deep blue photoluminescence, which is attributed to the Cu(II) defects. In addition, passivating the Cs2CuCl4 NCs by Ag+ can effectively improve the photoluminescence quantum yield (PLQY) and environmental stability.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Cyclin E2, a member of the cyclin family, is a key cell cycle-related protein. This protein plays essential roles in cancer progression, and as such, an inhibitor of cyclin E2 has been approved to treat several types of cancers. Even so, mechanisms underlying how to regulate cyclin E2 expression in cancer remain largely unknown. The current study found that miR-3687 is up-regulated in clinical bladder cancer (BC) tumor tissues, TCGA database and human BC cell lines. Inhibition of miR-3687 expression significantly reduces human BC cell proliferation in vitro and tumor growth in vivo, which are concurrently with the induction of G0/G1 cell cycle arrest and downregulation of cyclin E2 protein expression. Interestingly, overexpression of cyclin E2 reversed the inhibition of BC proliferation induced by miR-3687. Mechanistic studies suggest that miR-3687 could bind to the 3'-UTR of foxp1 mRNA, downregulates FOXP1 protein expression, and in turn promotes the transcription of cyclin E2, thereby promoting the growth of BC cells. Collectively, the current study not only establishes a novel regulatory axis of miR-3687/FOXP1 in regard to regulation of cyclin E2 expression in BC cells, but also provides strong suggestive evidence that miR-3687 and FOXP1 may be potentially promising targets in therapeutic strategies of human BC.

The Huichang fault Basin in Jiangxi Province exhibits high terrestrial heat flow values and a dense concentration of hot springs. However, existing research is limited to individual geothermal fields without a comprehensive basin-wide analysis of geothermal water origins. This study investigates the source of geothermal water across five representative geothermal fields using hydrochemical components and isotopic analyses. The findings indicate: (1) The hydrochemical type transitions from bicarbonate sulphate-sodium-calcium in the north to bicarbonate sodium-calcium in the south; (2) Major chemical components of the geothermal water derive from evaporative salt rocks (Cretaceous sand conglomerate cover) and siliceous formations (granite/metamorphic rock basement); (3) The recharge elevation for geothermal water is approximately 1 km, sourced from adjacent hills. The central basin's geothermal water has an apparent age of about 26,000 years, with δ¹³C indicating participation in deep circulation; (4) Thermal reservoir temperatures range from 74 to 113℃, with the lowest temperatures at the basin's edges (Anzishan and Shangjin geothermal fields) and higher temperatures towards the center, suggesting increased warming and a circulation depth of 1.5 to 2.5 km; (5) Simulation results of reverse water-rock interaction indicate that mineral precipitation-dissolution processes are governed by the basin's main thermal control structures. The geothermal fields are predominantly influenced by reduction alterations associated with granite and are closely linked to paleo-geothermal waters in the enclosed basin, with the formation of these fields heavily reliant on the heat production or conduction from radioactive elements in granite.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

This paper discovers that current variational principle and Noether theorem for different physics systems with (in)finite freedom systems have missed the double extremum processes of the general extremum functional that both is deduced by variational principle and is necessarily taken in deducing all the physics laws, but these have not been corrected for over a century since Noether's proposing her famous theorem, which result in the crisis deducing relevant mathematical laws and all physics laws. This paper discovers there is the hidden logic cycle that one assumes Euler-Lagrange equations, and then he finally deduces Euler-Lagrange equations via the equivalent relation in the whole processes in all relevant current references. This paper corrects the current key mistakes that when physics systems choose the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current articles, reviews and (text)books. The real physics should be after choosing the variational extreme values of physics systems, the general extremum functional of the physics systems needs to further choose the minimum absolute extremum zero of the general extremum functional, otherwise, the appearing processes of physics systems are still virtual processes. Using the double extremum processes of the general extremum functionals, the crisis and the hidden logic cycle in current variational principle and current Noether theorem are solved. Furthermore, the new mathematical and physical double extremum processes and their new mathematical pictures and physics for (in)finite freedom systems are discovered. This paper gives both general variational principle and general Noether theorem as well as their classical and quantum new physics, which would rewrite all relevant current different branches of science, as key tools of studying and processing them.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Effective biomarkers are essential to the early diagnosis of non-small cell lung cancer (NSCLC). Herein, a retrospective study of 49 newly diagnosed and recurrent NSCLC patients, 31 patients with benign pulmonary disease and 24 healthy volunteers was conducted, to evaluate the diagnostic value of circulating rare cells for NSCLC. The expression of circulating tumor cells (CTCs) and circulating tumor-derived endothelial cells (CTECs) in peripheral blood were measured by subtraction enrichment-immunostaining-fluorescence in situ hybridization (SE-iFISH). The level of CTCs (P＜0.001) and CTECs (P＜0.001) was significantly higher in NSCLC group than that in benign pulmonary disease group. The proportion of small CTCs (P＜0.001) and CTECs (P＜0.0001) significantly increased from benign lung disease individuals to NSCLC patients. The AUC of ROC curves of total CTCs and CTECs were 0.815 (95%CI: 0.722~0.907), 0.739 (95%CI: 0.618~0.860), respectively. The cut-off values for discriminating NSCLC with benign lung disease patients were total CTCs 11.5 units/6ml and total CTECs 10.5 units/6ml, with sensitivity and specificity being 67.3% and 83.9%, 77.6% and 77.4%, respectively. When CTCs and CTECs were combined, predictive value significantly increased to 82.6% as measured by the area under the curve. Small CTCs and triploid CTCs had high positive predictive value (PPV) and positive likelihood ratio (LR+) of the diagnosis of NSCLC in early stage. CTCs and CTECs can not only be used as new biomarkers for the diagnosis of NSCLC, but can also improve diagnostic performance of the early stage NSCLC. Moreover, the combined examination of CTCs and CTECs is be superior to the single.

This paper discovers that current canonical variational principle and canonical Noether theorem of (in)finite freedom systems for different physics systems have neglected doublet extreme value processes of the general extreme value functional that both is derived by variational principle and is necessarily be taken in deriving all ( quantum ) physics laws in phase space, but which have not been done for over one century since Noether's showing her distinguished theorem, which lead to the crisis deriving all (quantum) physics laws (necessary) in phase space. We discover there is the hidden logic cycle that people assume canonical equations, and then they finally deduce canonical equations by the equivalent relation in the whole processes in all current references. We correct the current key mistake concepts that when physics systems take the variational extreme values, the appearing processes of the physics systems are real physics processes, otherwise, are virtual processes in all current references. The real physics should be what after taking the physics systems' variational extreme values, the physics systems' general extremum functional needs to further take the general extremum functional's minimum absolute extremum zero, otherwise, the appearing processes of physics systems still are virtual processes. Conservation current equations and conservation currents, in phase space, of general canonical variational principle and general canonical Noether theorem are, respectively, deduced for the first time. Using the general extremum functionals' doublet extreme value processes, the hidden logic cycle and the crisis in current canonical variational principle and current canonical Noether theorem are solved. Consequently, the new mathematical pictures, classical and quantum new physics in phase space and the new mathematical and physical doublet extremum processes for (in)finite freedom systems are discovered. General canonical variational principle and general canonical Noether theorem naturally are given, which would rewrite all the different sciences in phase space, as key tools of studying and dealing with them.

MicroRNAs (miRNAs) play a pivotal role in important biological processes by regulating posttranscriptional gene expression and exhibit differential expression patterns during development, immune responses, and stress challenges. The diamondback moth causes significant economic damage to crops worldwide. Despite substantial advancements in understanding the molecular biology of this pest, our knowledge regarding the role of miRNAs in regulating key immunity-related genes remains limited. In this study, we leveraged whole transcriptome resequencing data from P. xylostella infected with Metarhizium anisopliae to identify specific miRNAs targeting the prophenoloxidase-activating protease1 (PAP1) gene through bioinformatic analysis. Seven miRNAs (pxy-miR-375-5p, pxy-miR-4448-3p, pxy-miR-279a-3p, pxy-miR-3286-3p, pxy-miR-965-5p, pxy-miR-8799-3p and pxy-miR-14b-5p) were identified and validated. Luciferase reporter assays confirmed that pxy-miR-279a-3p binds to the open reading frame (ORF) and pxy-miR-965-5p to the 3’ untranslated region (3’ UTR) of PAP1. Our experiments demonstrated that injecting a pxy-miR-965-5p mimic significantly reduced PAP1 expression in P. xylostella larvae, suppressing PO activity and increasing larval mortality rate. Conversely, the injection of inhibitors obtained opposite results. Furthermore, we identified four LncRNAs (MSTRG.32910.1, MSTRG.7100.1, MSTRG.6802.1, and MSTRG.22113.1) that potentially interact with pxy-miR-965-5p. Interference assays using antisense oligonucleotides (ASO) revealed that silencing MSTRG.7100.1 and MSTRG.22113.1 increased the expression of pxy-miR-965-5p. These findings shed light on the potential role of pxy-miR-965-5p in the immune response of P. xylostella to M. anisopliae infection and provide a theoretical basis for biological control strategies targeting the immune system of this pest.

Eurotium is the teleomorph genus associated with section Aspergillus. Eurotium comprises approximately 20 species, which are widely distributed in nature and human environments. Eurotium is usually the key microorganism for the ferment ation of traditional food, such as Fuzhuan brick tea, Liupao tea, Meju, and Karebushi, thus Eurotium is an important fungus in food industry. Eurotium has been extensively studied because they contain a series of interesting, structurally diverse, and biologically important secondary metabolites, including anthraquinones, benzaldehyde derivatives, and indol diketopiperazine alkaloids. These secondary metabolites have shown multiple biological activities, including antioxidative, antimicrobial, cytotoxic, antitumor, insecticidal, antimalarial, and anti-inflammatory activities. This study presents an up-to-date review of the phytochemistry and biological activities of all Eurotium species. This review will provide the recent advances on the secondary metabolites and their bioactivities in genus Eurotium for the first time and serve as a database for future research and drug development from the genus Eurotium.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This paper gives both a general canonical quantum gravity theory and the general canonical quantum gravity theories of the Universe and general black hole, and discovers the relations reflecting symmetric properties of the standard nonlinear gravitational Lagrangian, which are not relevant to any concrete metric models. This paper concretely shows the general commutation relations of the general gravitational field operators and their zeroth, first, second and third style, respectively, of high order canonical momentum operators for the general nonlinear system of the standard gravitational Lagrangian, and then has finished all the four styles of the canonical quantization of the standard gravity.

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

The research on the excavation mechanical properties of underpass tunnels has already had certain results, but fewer of them consider the effects of dynamic and static loads on the excavation mechanical properties of underground tunnels at the same time, especially the lack of research cases of double-line highway tunnels with angled underpasses of existing railway tunnels. In this paper, based on the tunnel project of the new double-line Shiqian Highway Tunnel passing under the Hurong Railway at an oblique angle, the mechanical parameters of the rock body in the cross-tunneling area under the influence of static and dynamic load coupling are obtained by using the disturbance quantification coefficients and the Hoek-Brown criterion based on the method of over-advanced geological prediction and the investigation of the surrounding rock on the palisade face, and the engineering-scale finite element model is constructed and the mechanical characteristics of the excavation in the tunnel of the double-lane highway tunnel passing under the existing railroad under the influence of the static and dynamic loads are analyzed. The results show that: the new tunnel rock movement law for the top of the arch sinking, bottom plate bulging, side wall to move outward, the height and width of the arch and bottom plate arch with the tunnel excavation and increase, the side wall rock displacement effect is smaller; left and right lines of the tunnel disturbed area of the rule of change is similar; the existing tunnel bottom plate displacement is more than the top plate and the left and right side walls by the excavation of the time step influence is larger. Typical profile displacement is mainly determined by the distance from the excavation surface; the new tunnel in the four types of calculation conditions of the rock disturbance angle is the same; the existing tunnel roof and side wall Von Mises stress extreme occurs in the tunnel structure, the bottom plate there are pressure relief and pressure-bearing areas; based on the displacement control criteria, the recommended upper and lower step blasting method.

This paper gives solutions to puzzles of double Wheeler’s delayed choice experiments, a photon’s passing two paths simultaneously and wave collapse velocity measure, and shows new quantum control, new quantum oscillation and new controlling photon oscillator (that can be arranged in quantum computer and quantum network as their classical correspondences) in experiments. Furthermore, this paper obtains the measured attractive state and the new useful key technology of altering state’s evolving paths for quantum systems. We discover the reason and the technological way for the present changes the past, further show their feasible experiments of new quantum control, new quantum oscillation and new quantum oscillator. Finally, this paper achieves the collapse response time t of wave, further concretely deduces the measured collapse velocity of quantum system. In the past, the collapse velocity cannot be objectively deduced and experimentally measured.

Due to the impacts from climate change, the allocation of water resources must urgently be optimized worldwide to ensure that the needs of both water managers and farmers are balanced. In this study, manager-oriented and farmer-oriented assessment models were developed for irrigation water optimization and allocation. The distance from water sources and hydraulic head were the main factors in the manager-oriented assessment model; crop value, water demand of crops, and soil type were additional factors in the farmer-oriented assessment model. The developed assessment models were used to assess irrigation water allocation in five villages in Neimen District. Cadasters at high elevation were discovered to not be suitable for cultivation of crops because of the difficulties in constructing irrigation facilities and the loss of irrigation water during transportation. The result obtained from the manager-oriented assessment system was related to the costs involved in the construction and maintenance of irrigation facilities, which indicated that cadasters located at long distances from water sources and at high elevation are unsuitable for cultivation. By contrast, the result obtained from the farmer-oriented assessment system was related to the profits of farmers and revealed that more cadasters would be suitable for cultivation if suitable crops were chosen.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

This paper uncovers that quantum uncertain principle makes the single particle with global property have no certain path, and then wave of quantum particle can simultaneously do pass the double slits. The two subwaves after passing Young’s double slits are entanglement, they may form interference of subwaves. Consequently, we find a kind of quantum probabilistic entanglements with Wheeler's delayed choice. Quantum particles such as photons, electrons, neutrons, protons etc mean that wave of the quantum particle can simultaneously do pass through Young's double slits, rather than individual quantum particle may pass through Young's double slits at the same time. When considering wave property, we cannot consider particle property (Just as in the photoelectric effect, considering the particle nature of the system, people cannot consider wave property, otherwise the photoelectric effect cannot appear). Therefore, this paper discovers that the ability of single photon to hit electrons out in photoelectric effect is complementarily equivalent to the ability of wave of the single photon to simultaneously pass through Young's double slits in wave-particle duality. Objective criteria for distinguishing classical and quantum particles are discovered and objectively give the applicable realm of quantum mechanics for the first time. The crisis of the single particle’s simultaneously passing through Young's double slits, which has been plaguing physicists in the whole world up to now for decades, is solved, in which the studies are classified as classical and quantum particles, the classical particle and quantum particle wave cannot and can pass the Young’s slits, respectively. This paper discovers both the new physics mechanism of passing the double slits of the wave with the amplitude of 4-dimensional momentum representation wave function reflecting particle nature and the principle of self-adaptive emergence of wave-particle duality, and then using the principle, this paper gives both direct explanations to the current experiments and new predictions of new some experiments for wave-particle duality. All the deduced results here are consistent with all relevant physics experiments.

Density distribution function of classical statistical mechanics is generally generalized as a product of a general complex function and its complex Hermitian conjugate function, and the average of classical statistical mechanics is generalized as the average of the quantum mechanics. Furthermore, this paper derives three ones of the five axiom presumptions of quantum mechanics, e.g., deduces Schrȍdinger equation by two general ways, makes the three axiom presumptions into three theorems of quantum mechanics, not only solves the crisis to hard understand, but also gets new theories and new discoveries, e.g., this paper solves the crisis of the origin of the wave-particle duality, derives operators, eigenvalues and eigenstates, deduces commutation relations for coordinate and momentum as well as the time and energy, and discovers quantum mechanics is just a generalization ( mechanics ) theory of the complex square root of ( real density function of ) classical statistical mechanics. Quantum mechanics being just a generalization theory of the complex square root of classical statistical mechanics is both new physics and revolutionary discovery, which are affecting people’s deep philosophical thinking for modern physics development, solve all the crisises of quantum mechanics, quantum information and so on, and make quantum mechanics have scientific solid bases being checked and both no basic axiom presumption and no all the quantum strange incomprehensible properties, because classical statistical mechanics and the complex square root of classical statistical mechanics have the scientific solid bases being checked. In addition, this paper discovers the reason no taking the time derivative of space coordinates in Schrȍdinger equation. Therefore, this paper gives solution to the crisis of the first quantization origin, and mainly deduces quantum physics no all the quantum current strange incomprehensible properties.

The reduction in rheological parameters and dissolution rate of precursors in geopolymer coatings during early hydration significantly contributes to sagging. This study aims to improve the sag resistance of these coatings by incorporating diatomite filler. Rheological testing was conducted to assess the impact of diatomite and its concentration on yield stress, plastic viscosity, and thixotropy of the geopolymer coatings. The results indicated that diatomite's large specific surface area and high reactivity have a significant influence on the rheological parameters and early dissolution rate of precursors. With a diatomite concentration of 1.1%, the coating exhibited a yield stress of 2.749 Pa and a plastic viscosity of 0.921 Pa·s, maintaining stability, homogeneity, and no sagging at a thickness of 600 μm. Furthermore, the highly active SiO2 in diatomite participates in the secondary hydration reaction of the geopolymer materials, leading to the formation of substantial C-(A)-S-H gel. This gel enhances internal interconnectivity within the coating, thereby improving its rheological and mechanical properties.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

This paper derives measurement and identical principles, then makes the two principles into measurement and identical theorems of quantum mechanics, plus the three theorems derived earlier, we deduce the axiom system of current quantum mechanics, the general quantum theory no axiom presumptions not only solves the crisis to understand in current quantum mechanics, but also obtains new discoveries, e.g., discovers the velocities of quantum collapse and entanglement are instantaneously infinitely large. We deduce the general Schrȍdinger equation of any n particles from two aspects, and the wave function not only has particle properties of the complex square root state vector of the classical probability density of any n particles, but also has the plane wave properties of any n particles. Thus, the current crisis of the dispute about the origin of wave- particle duality of any n microscopic particles is solved. We display the classical locality and quantum non-locality for any n particle system, show entanglement origins, and discover not only any n-particle wave function system has the original, superposition and across entanglements, but also the entanglements are of interactions preserving conservation or correlation, three kinds of entanglements directly give lots of entanglement sources. This paper discovers, one of two pillars of modern physics, quantum mechanics of any n particle system is a generalization ( mechanics ) theory of the complex square root ( of real density function ) of classical statistical mechanics, any n particle system’s quantum mechanics of being just a generalization theory of the complex square root of classical statistical mechanics is both a revolutionary discovery and key new physics, which are influencing people’s philosophical thinking for modern physics, solve all the crisises in current quantum theories, quantum information and so on, and make quantum theory have scientific solid foundations checked, no basic axiom presumption and no all quantum strange incomprehensible properties, because classical statistical mechanics and its complex square root have scientific solid foundations checked. Thus, all current studies on various entanglements and their uses to quantum computer, quantum information and so on must be further updated and classified by the new entanglements. This and our early papers derive quantum physics, solve all crisises of basses of quantum mechanics, e.g., wave-particle duality & the first quantization origins, quantum nonlocality, entanglement origins & classifications, wave collapse and so on.Key words: quantum mechanics, operator, basic presumptions, wave-particle duality, principle of measurement, identical principle, superposition principle of states, entanglement origin, quantum communication, wave collapse, classical statistical mechanics, classical mechanics

Hydro generator sets serve as the peak and frequency regulation of the power system,and play a very important role in maintaining system stability and improving power quality.Based on the internal characteristics model of a specific type of hydro generator,this paper constructs a hydroelectric coupling model for hydropower units,studies the influence of the regulation system of hydropower units on low-frequency oscillations under different load conditions,and adopts variable speed reaching law and fuzzy sliding mode control strategy to improve the regulation quality of the system and ensure the stable operation of the units.Results of simulation and water turbine set under different load conditions show that varible speed reaching law can effectively improve the power-angle oscillation behavior of the hydropower set and suppress the occurrence of low-frequency oscillations of the system when the system is subject to power disturbance,which provide a new theoretical basis and solution for the vibration analysis and control optimization of hydraulic turbine units.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Lake sediment records are of great importance for understanding the evolution of watershed environments. Various studies have been carried out to constrain the depositional ages of lake sediments and examine their physical, chemical, and biological characteristics, aiming to construct historical vegetation, environment and climate patterns in Chinese lake watersheds. In this study, we obtained relevant literature on lake sediment records by searching the key word 'age-depth' from the databases – Web of Science and China National Knowledge Infrastructure (CNKI, the largest Chinese academic database). We analyzed the literature based on its type (published in a Chinese/English journal or as a Master’s/PhD thesis), period of publication, journal (if published in a journal), key authors, study area, dating scale, and main aims. The results suggest that the lakes in the plateau regions are the most popular research topic typically covering 100–200 years (short-term) and 500–30,000 years (long-term). The literature focuses on a wide range of topics, from past environmental evolution in the watershed to lake ecology, and provides a solid foundation for better understanding regional climate change and the preservation of lake environments and ecosystems. In the future, resulting data from environmental reconstruction with lake sediments will be needed to integrate with emerging information processing technologies (e.g., artificial intelligence and meta-analysis), to disentangle the complex interplay between Earth surface processes and global climate change; furthermore, strengthening interdisciplinary collaboration will deepen our comprehension of man-land relationship and promote the sustainable management of lake ecosystems in the context of global climate change.

As a fundamental, overall, and strategic issue facing human society, human migration is a key factor affecting the development of countries and cities given constantly changing population numbers. The fuzziness of the spatiotemporal attributes of human migration limits the pool of open-source data for human migration prediction, leading to a relative lag in human migration prediction algorithm research. This study expands the definition of human migration research, reviews the progress of research into human migration prediction, and classifies and compares human migration algorithms based on open-source data. It also explores the critical uncertainty factors restricting the development of human migration prediction. Given the effect of human migration prediction, in combination with artificial intelligence and big data technology, the paper concludes with specific suggestions and countermeasures aimed at enhancing human migration prediction research results to serve economic and social development and national strategy.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The human mandible's cancellous bone, which is characterized by its unique porosity and directional sensitivity to external forces, is crucial for sustaining biting stress. Traditional CAD models fail to fully represent bone's anisotropic structure and thus depend on simple isotropic assumptions. For our research, we use the latest versions of nTopology and Creo Parametric software to make biomimetic Voronoi lattice models that accurately reflect the complex geometry and mechanical properties of trabecular bone. The porosity of human cancellous bone is accurately modeled in this work using biomimetic Voronoi lattice models. The porosities range from 70% to 95%, which can be achieved by changing the pore sizes to 1.0 mm, 1.5 mm, 2.0 mm, and 2.5 mm. Finite element analysis (FEA) was used to examine the displacements, stresses, and strains acting on dental implants with a buttress thread, abutment, retaining screw, and biting load surface. The results show that the Voronoi model accurately depicts the complex anatomy of the trabecular bone in the human jaw, compared to standard solid block models. The ideal pore size for biomimetic Voronoi lattice trabecular bone models is 2 mm, taking into account both the von Mises stress distribution over the dental implant, screw retention, cortical bone, cancellous bone, and micromotions. This pore size displayed balanced performance by successfully matching natural bone's mechanical characteristics. Advanced finite element analysis (FEA) improves biomechanical understanding of how bones and implants interact by creating more accurate models of biological problems and dynamic loading situations. This makes biomechanical engineering better.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The correlation and comorbidity between depression and chronic pain have been observed for a long time. Generally, it is considered that the two conditions reinforce each other, whereas the causal relationship between them is not clear. However, some evidence suggested that chronic pain may reverse the progression of depression in some cases. This article presents a selective review of clinical and pharmacological relationship between depression and pain, and their interactions at neurochemical and neurobiological levels. In addition, we open a discussion on a recent case report of repeated success of using short but continuous pain (SCP) during meditation as the only treatment for depression, compared to initial success but no remission with other conventional antidepressants on the same patient. Together this review proposes an updated model for depression and its various treatments that is based on synaptic and system homeostasis. More importantly, it suggests that SCP may benefit depression recovery through its properties that are different from either acute or chronic pain and represents a novel research area that has been largely neglected to date.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

This study investigated whether reciprocal collaborative pedagogy significantly impacts Indonesian electrical engineering polytechnic students in reducing reading anxiety and improving self-efficacy in ESP reading comprehension skills. Fifty Polytechnic students were equally assigned to two groups. Control groups learned in the traditional reciprocal teaching method individually. Experimental group engaged in reciprocal collaborative pedagogy. Each group received a 6-week reading strategy training. E-learning platforms were used in this study as a complementary tool to distribute ESP reading materials, announcements, and the experiment details being taught. The quantitative and qualitative results demonstrated that the tasks in reciprocal collaborative pedagogy positively affects Indonesian electrical engineering polytechnic students' learning experience and outcomes. This pedagogy promotes a productive learning environment through peer interaction, active engagement, and peer group discussions of the whole learning activities, reducing feelings of anxiety and building confidence in ESP-specialized text.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Complex models have received significant interest in recent years and are being increasingly used to explain the stochastic phenomenon with upward and downward fluctuation such as the stock market. Different from existing semi-variance methods in traditional integer dimension construction for two variables, this paper proposes a simplified multi-factorized fractional dimension derivation with the exact Excel tool algorithm involving the fractional center moment extension to covariance, which is a complex parameter average that is a multi-factorized extension to Pearson covariance. By examining the peaks and troughs of gold price averages, the proposed algorithm provides more insight into revealing underlying stock market trends to see who is the financial market leader during good economic times. The calculation results demonstrate that the complex covariance is able to distinguish subtle differences among stock market performances and gold prices for the same field that the two variable covariance may overlook. We take the London, Tokyo, Shanghai, Toronto and Nasdaq as the representative examples.

Existing research indicates that mineralization of Carlin-type gold deposit is related to geological structures, but current studies mostly focus on the qualitative association, and lack quantitative analysis of the relationship between mineralization and structural features, which limits the potential for predictive mineral exploration. In this study, the Nibao Carlin-type gold deposit was selected as the research area to conduct three-dimensional geological modeling, spatial analysis, and three-dimensional prospectivity modeling. Spatial analysis revealed that the majority of gold ore bodies are situated near the main fault, with gold mineralization primarily occurring within a spatial range of approximately -80 meters to 20 meters from the main fault plane. This spatial distribution predominantly aligns in a SW-NE direction. Spatial characteristic extraction of fault slope indicators suggests that the slope angles are conducive to the migration and accumulation of ore-forming hydrothermal fluids, with ore body metal content rapidly increasing within an angle range of approximately 20° to 60°. The shape analysis of the mainfault indicates that the principal spaces of mineralization enrichment are within -10m to 20m of the fault plane undulations, where gold resources are concentrated in a relatively flat area. However, the degree of mineralization is more pronounced in the protruding sections than in the depressed areas. The areas with significant dip changes in faults display higher variations in orebody attitudes, with mineralization noticeably weaker in areas where the fault steepness changes markedly. Ore-bearing units exhibit significantly higher grades within the -17° to 3° interval of fault steepness transition. This interval also sees a rapid accumulation of gold resources. The Nibao gold mine's mineralization is derived from deep, ore-bearing hydrothermal fluids ascending along major fractures, precipitating, and accumulating in favorable ore-hosting spaces (faults, anticline cores) and lithological combinations (sedimentary tuffs, tuffs). Three deep potential gold targets were identified, highlighting the deep western edge of the F1 fault and the deep southeast-trending lower plate as prospective areas for future exploration. This study underscores the effectiveness of 3D prospective modeling as an indispensable tool for elucidating the spatial distribution of fault-controlled Carlin-type gold deposits and their tectonic determinants.

Using data from the China Family Panel Studies, this study examines the socioeconomic characteristics of Internet users, as well as the relationships between the dynamics of different forms of online activities and the subjective well-being of urbanites and rural migrants in urban China. The study finds that online behaviour may clearly reflect differences in individuals’ personal traits and socioeconomic positions. Patterns of the association between online activities and subjective well-being tend to differ among rural migrants and urbanites, especially in terms of depression. A difference-in-differences model is employed to estimate the impact of intensified engagement in online activities on depression and life satisfaction from 2010 to 2016. The results show that increased frequency of online entertainment exhibits a comparatively positive effect on depression and life satisfaction. Spending more time on online social networking has a similar impact on rural migrants, but not on urbanites. These findings suggest that the rapid development of urban China’s online community has important implications for residents’ subjective well-being.

In the process of climate change mitigation and adaptation, the focus on climate risk driven by transition innovations has received widespread attention from governments, regulators, and investors. Based on the identification of low-carbon patents through the Green and Low-carbon Technology Inventory in China, this study constructs low-carbon innovation measurements of listed firms in China from 2015 to 2021. Then, an empirical model is used to investigate the impact and mechanism of climate transition innovations on the default risk. The baseline regression model shows that low-carbon innovations can mitigate the default risk of listed firms. Moreover, our findings are supported by instrumental variable regressions that use the time costs of innovation. Finally, the mediation effect demonstrates that investor attention, total factor productivity, and technology spillovers are paths through which transition innovations can affect the default risk. This study reveals that low-carbon technological advances have a positive effect on climate transition risks.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

The collapsible loess will rapidly soften and lose its bearing capacity when soaked in water. Under a mild condition (20°C), the biomimetic inorganic agent, Diammonium phosphate (DAP), reacts with calcite in the collapsible loess, producing a stronger bonding material, hydroxyapatite (HAP), to modify and stabilize the soil. Uniaxial compression, permeability tests and morphological analysis using XRD and SEM/EDX microscopy were carried out to assess the effectiveness of DAP stabilization on the collapsible loess. The results indicated that HAP improved the inter-particle bonding within loess, filled the pores within particles, reduced the permeability, and consequently mitigated collapsibility of loess. The compressive strength of DAP-treated loess increased as DAP concentration increased. Following 28-days curing, the compressive strength of the loess treated with a 3.0 mol/L DAP solution was six times greater than that of the untreated group. DAP's reinforcement effect on loess was superior to that of cement. The compressive strength of DAP-treated loess was about double that of cement-treated loess and the permeability coefficient was reduced by more than 50% at equivalent solid content. Furthermore, DAP generated 68% fewer carbon emissions compared to Portland cement. Considering eco-friendly and sustainable development, DAP offers a more competitive alternative for modification and stabilization of loess.

A simple design of an ultrathin six-band polarization-insensitive terahertz perfect metamaterial absorber (PMMA) composed of a metal cross-cave-patch resonator (CCPR) placed over a ground plane was proposed and investigated numerically. The numerical simulation results demonstrate that the average absorption peaks are up to 95% at six resonance frequencies with high quality-factors (>65). In addition, the absorption properties can be kept stability for both normal incident transverse magnetic (TM) and transverse electric (TE) waves. The physical mechanism behind the observed high level absorption is illustrated by the electric and power loss density distributions. The different absorption mainly originates from the higher order multipolar and multipolar plasmon resonance of the structure, which are sharp different to the most previous studies of the PMMAs. Furthermore, the resonance absorption of the PMMA can be tunable by varying the geometric parameters of the unit cell.

A simple design of an ultrathin six-band polarization-insensitive terahertz perfect metamaterial absorber (PMMA) composed of a metal cross-cave-patch resonator (CCPR) placed over a ground plane was proposed and investigated numerically. The numerical simulation results demonstrate that the average absorption peaks are up to 95% at six resonance frequencies with high quality-factors (>65). In addition, the absorption properties can be kept stability for both normal incident transverse magnetic (TM) and transverse electric (TE) waves. The physical mechanism behind the observed high level absorption is illustrated by the electric and power loss density distributions. The different absorption mainly originates from the higher order multipolar and multipolar plasmon resonance of the structure, which are sharp different to the most previous studies of the PMMAs. Furthermore, the resonance absorption of the PMMA can be tunable by varying the geometric parameters of the unit cell.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Cesarean Section (CS) is one of the most frequently executed surgical procedures in gynecology and obstetrics. After a cesarean section, surgical site infection (SSI) increases hospital stay, lengthens maternal morbidity, and upsurges treatment costs. The current study determines the prevalence and risk factors for surgical site infection following cesarean section in China. A retrospective study was conducted on 23 cases of pregnant women who underwent cesarean section and incision severe infection and detection from March 2017 to January 2020 at Wuhan Maternal and Child Healthcare Hospital in China as the study group, and 20 cases of uninfected cesarean section during the same period were selected as the control group. Data were compared with the controls based on study variables and the presence of SSI. The mean age was 31±2.6. High fever and blood loss were observed in serous SSI-infected patients. The incidence rate of severe surgical site infection was 0.15 %. SSI was observed to be expected in pregnant women who had premature rupture of membrane before surgery (p < 0.001), who underwent postoperative antibiotic therapy (p < 0.001), and the patients who had gestational diabetes mellitus (p <0.001) and hematoma (p < 0.001) during surgery. Hence, following a cesarean section, surgical site infection is common. This research discovered several modifiable risk factors. SSI is associated with multifactorial rather than a single one. The development and strict implementation of a procedure by all health care practitioners can successfully reduce and prevent infection rates following cesarean section.

In this paper we report a new development on the numerical model for aluminum-steam combustion. This model is based on diffusion flame of continuum regime and the thermal equilibrium between the particle and the flow field, which can be used to calculate the aluminum particle combustion model for two phase calculation conditions. The model prediction is in good agreement with the experimental data. A new type of vortex combustor was proposed for the combustion of aluminum and steam, and the mathematical model of the two phase reacting flow with in this combustor was established. The turbulence effects are modeled using the Reynolds Stress Model (RSM) with Linear Pressure-Strain approach, and the Eddy-Dissipation model is used to simulate the gas phase combustion. Aluminum particles are injected into the vortex combustor and form a swirling flow around the chamber and their trajectories are traced using the Discrete Phase Model (DPM). The simulation results show that the vortex combustor can achieve high efficient combustion of aluminum and steam. The influencing factors, such as the eccentric distance of the inlet of aluminum particles, particle size and steam inlet diameter, etc., are studied. The work described in this paper represents an attempt to the design of a vortex combustor in order to increase aluminum combustion efficiency.

With the increasingly online exposure of urban public spaces, the new concept of "Internet-celebrity cities" has emerged in China. The online internet-famous sites are the main characteristics of "Internet-celebrity cities". To fully understand online users' preferences in such kind of public spaces, this article took 27 typical riverfront internet-famous sites (RIFS) in Changsha city (China), as an example. Through the online images and review comments on social media platform "Xiaohongshu", the study analyzed users’ perception of RIFS specially on visual and emotional preferences. It revealed the following findings:(1) The popularity of RIFS had a significant head effect and there were far more positive emotions than neutral and negative emotions in review comments. (2) According to 5 different categories of RIFS: modern buildings with river views, restaurants with strong visual impact became the main attractions on commercial RIFS. The art exhibition RIFS attracted visitors to experience traditional culture and highlight their aesthetic pursuits. In the historical and cultural RIFS, people preferred to see the historical buildings with surrounding natural environment, as well as river and mountains views. Ecological Recreational RIFS showed the similar results with the uncultivated RIFS, for the main focus was on the ecological environment, a broader vision and the specific atmosphere. Moreover, the uncultivated RIFS showed more diversified attraction points. This study can provide a new perspective on the waterfront vitality and can offer a targeted and attractive manner for waterfront regeneration that are different from traditional methods.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Macadamia nut plantings in China are expanding year by year. In order to further promote the superior varieties, this study analyzed the effects of different varieties of rootstock and scion on the survival rate as well as the effects of 18 different ratios of substrate composition on seedling growth were analyzed. The results showed that: The survival rate of HAES788 varieties as rootstock and Guire No.1 as scion was the highest, reaching 96%. The optimal grafting time in December was better than that in March. Substrate formulations 12, 13, 15 and 16 had agglomerated soil and well-developed root systems compared to the controls. Plant height, stem diameter, leaf length, leaf width, and dry weight of aboveground and underground parts were significantly higher than those of the control. In addition, the substrate formulations 12, 13, 15 and 16 significantly improved the organic matter, total nitrogen, and total potassium content of the substrate soils, but little on total phosphorus content. All in all, macadamia grafting times are best in December, with HAES788 and Guire No.1 being the best rootstock and scion. Substrate formulations 12, 13, 15 and 16 are the optimal formula. This study provides a solid foundation to produce high-quality macadamia seedlings.

A friction loss model for brake testing platform is constructed to revise the braking force test results, which can largely improve the accuracy of automotive brake performance testing. Specifically, the influence of tire pressure, vehicle axle load, placement angle and vehicle speed on the friction loss is tested and analyzed on a wheelbase adjustable automotive anti-force brake testing platform. The friction loss model for the platform is constructed based on the defined relative slip and placement angle, which is validated through actual tests on four types of vehicles. The results showed that the maximum relative error between the values of the model calculated simulation and the measured was 2.2%, indicating the friction loss model is valid and can provide a basis for revising the braking force of automotive brake. Meanwhile, the maximum braking force increases from 3982 N to 4772 N, increased by 19.8%, when the placement angle increased from 36.9° to 47.0°. Accordingly, in order to improve the accuracy of detection results of the automotive anti-force rolling brake testing platform, the friction loss caused by the change in the placement angle should be revised, and then braking rate of the vehicle should be judged according to GB 7258-2017 and GB 38900-2020.

Apurinic/apyrimidinic endonuclease 1 (APE1), also known as redox factor-1 (Ref-1), is a multifunctional protein which is widely existing in living organisms. It can specifically recognize and cleave the DNA in apurinic/apyrimidinic (AP) site in the base excision repair (BER) pathway, as well as regulate the expression of genes to activate some transcription factors. The abnormal ex-pression and disruptions in the biological functions of APE1 are linked to a number of diseases, including inflammation, immunodeficiency, and cancer. Hence, it is extremely desired to monitor the activity of APE1, acquiring a thorough understanding of the healing process of damaged DNA and making clinical diagnoses. Thanks to the advent of DNA nanotechnology, some nanodevices are used to image the activity of APE1 with great sensitivity and simplicity. In this review, we will summarize DNA nanotechnology-empowered fluorescence imaging in the past years for APE1 activity according to the types of DNA probe, which are classified into linear DNA probes, composite DNA nanomaterials and three-dimensional (3D) DNA nanostructures. We also highlight the future research directions in the field of APE1 activity imaging.

Mechanical ventilation (MV), used in patients with acute lung injury (ALI), induces diaphragmatic myofiber atrophy and contractile inactivity, termed ventilator-induced diaphragm dysfunction. Phosphoinositide 3-kinase- (PI3K-) is crucial in modulating fibrogenesis during the reparative phase of ALI; however, the mechanisms regulating the interactions among MV, myofiber fibrosis, and PI3K- remain unclear. We hypothesized MV with or without bleomycin treatment would increase diaphragm muscle fibrosis through the PI3K- pathway. Five days after receiving a single bolus of 0.075 units bleomycin intratracheally, C57BL/6 mice were exposed to 6 or 10 mL/kg MV for 8 h after receiving 5 mg/kg of AS605240 intraperitoneally. In wild-type mice, bleomycin exposure followed by MV 10 mL/kg prompted significant increases in disruptions of diaphragmatic myofibrillar organization, transforming growth factor-1, oxidative loads, Masson’s trichrome staining, extracellular collagen levels, positive staining of -smooth muscle actin, PI3K- expression, and myonuclear apoptosis (P &lt; 0.05). Decreased diaphragm contractility and peroxisome proliferator activated receptor- coactivator-1 levels were also observed (P &lt; 0.05). MV-augmented bleomycin-induced diaphragm fibrosis and myonuclear apoptosis were attenuated in PI3K-γ-deficient mice and through AS605240-induced inhibition of PI3K- activity (P &lt; 0.05). MV-augmented diaphragm fibrosis after bleomycin-induced ALI is partially mediated through PI3K-γ. Therapy targeting PI3K-γ may ameliorate MV-associated diaphragm fibrosis.

This study presents a novel approach for quantifying the dynamics of monthly hydraulic geometry relationships in the Jingjiang reach of the Yangtze River by integrating leaf area index (LAI) data as an indicator of riparian vegetation. A comprehensive system of ordinary differential equations (ODEs) couples traditional power-law hydraulic geometry equations with LAI, capturing the influence of erosion control on channel morphology. The periodic delayed response theory and automatic differentiation techniques are employed to enhance the modeling framework's capabilities. Calibration and verification demonstrate the models' effectiveness in capturing overall trends in discharge, width, and depth dynamics, outperforming traditional constant-parameter approaches. However, model predictive abilities are limited under extreme climate conditions due to training on normal climate data. Key assumptions, including the periodic delayed response theory's neglect of peak discharges, simplified representation of artificial cut-offs, and reliance on remotely sensed data with limited local validation, introduce uncertainties. The proposed modeling framework shows potential for broader application to other river systems with appropriate adjustments. Future research could incorporate additional environmental factors, integrate models across scales, couple with advanced simulation techniques, and expand stability assessments beyond the riverbed index. By addressing related challenges, this integrated approach lays a foundation for enhancing understanding of river morphodynamics and channel stability.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

The basic oxygen furnace slag (BOF) was wide used in road construction, but there was a lack of characteristics in different asphalt mixtures. This study investigates the properties of hot-mixed asphalt (HMA) containing stone mastic asphalt (SMA), porous asphalt (PA) and dense-graded BOF as a partial substitution for natural aggregates. The purpose of this study is to evaluate various BOF slag contents in the asphalt mixtures would affect the cooling behavior after compaction. Asphalt mixture specimens contained 0%, 20%, 40% and 60% BOF slag, respectively, as coarse aggregate. Test results showed that BOF slag has a lipophilic property, so it can be adsorbed by asphalt cement, thereby reducing the cost of asphalt. The stability value of all asphalt mixtures increases with the proportion of BOF slag replacement. In addition, the voids in the mineral aggregate (VMA) value variable exhibited significant differences among asphalt mixtures, and could determine the deviation of the cooling trend of asphalt mixtures. Furthermore; it was found that the cooling procedure of the BOF slag used in dense-graded asphalt mixture takes about 100 min, and that the temperature tends to be moderate; however, it took about 120 min of cooling the SMA and PA mixture with BOF slag. In addition, the voids distribution of dense asphalt mixture was not uniform. It would result in various locations of thermal energy temperature on asphalt mixtures that were inconsistent.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

ITRF input data which are integrated by GNSS, SLR, VLBI, DORIS combination centers are considered to be relatively high-quality and accurate solutions. However, when utilizing these inputs, one still needs to identify outliers, rescale inaccurate covariance matrix and evaluate the precision of the observed datum information. To achieve the above-mentioned objectives, we propose a terrestrial reference frame (TRF) stacking approach to establish the single technical reference frameworks for the ITRF2014 and ITRF2020 datasets of all four technologies. As a result, roughly 0.5% or less of the SLR observations are identified as outliers, while the ratio of DORIS, GNSS, and VLBI observations are below 1%, around 2%, and ranging from 1% to 1.2%, respectively. The post-rescaling covariance scale factors are 25.07, 27.25, 18.84, 6.98 for GNSS, SLR, VLBI, and DORIS in ITRF2014 datasets, and 8.95, 14.9, 16.8, 7.78 in ITRF2020 datasets, respectively. It is shown that the consistency between the SLR scale and ITRF has improved, increasing from around -5mm in ITRF2014 datasets to approximately -1mm in ITRF2020 datasets. The scale velocity derived from fitting the VLBI scale parameter series with all epochs in ITRF2020 datasets differs by approximately 0.21mm/year from the velocity obtained by fitting the data up to 2013.75 because of the scale drift of VLBI at around 2013. The decreasing standard deviations of the Polar motion parameter (XPO, YPO) offsets between Stacking TRFs and 14C04 (20C04) indicating an improvement in the precision of polar motion observations for all of the four techniques. From the perspective of the Weighted Root Mean Square in station coordinates, the measurement precision of GNSS, SLR, and DORIS techniques has improved, while VLBI shows no significant change.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

An accurate, economical, and reliable device for detecting falls in persons ambulating with the assistance of an orthopedic walker is crucially important for the elderly and patients with limited mobility. Existing wearable devices such as wristbands are not designed for walker users, and patients may not wear them at all times. This research proposes a novel idea of attaching an internet-of-things (IoT) device with an inertial measurement unit (IMU) sensor directly to an orthopedic walker to perform real-time fall detection as well as activity logging. A dataset is collected and labeled for walker users in four activities, including idle, motion, step, and fall. Classic machine learning algorithms are evaluated using the dataset by comparing their classification performance. Deep learning with convolutional neural network (CNN) is also explored. Furthermore, the hardware prototype is designed by integrating a low-power microcontroller for onboard machine learning, an IMU sensor, a rechargeable battery, and Bluetooth wireless connectivity. The research results show the promise of improved safety and well-being of walker users.