Mitochondria are highly dynamic organelles that continuously change their shape. Their main function is ATP production; however, they are additionally involved in a variety of cellular phenomena, such as apoptosis, cell cycle, proliferation, differentiation, reprogramming, and aging. The change in mitochondrial morphology is closely related to the functionality of mitochondria. Normal mitochondrial dynamics are critical for cellular function, embryonic development, and tissue formation. Thus, defect in proteins involved in mitochondrial dynamics that control mitochondrial fusion and fission can affect cellular differentiation, proliferation, cellular reprogramming, and aging. Here we review the processes and proteins involved in mitochondrial dynamics and its various associated cellular phenomena.

The contact materials in high-voltage vacuum interrupter require properties such as high conductivity, high density, and high hardness to minimize arc heat damage. In this study, copper–molybdenum-chromium alloys contact materials are examined for a high voltage contact material. Ball milling process was carried out after analyzing the raw materials of copper, chromium, and molybdenum powders. A green compact was produced using a high press with the mixed powder. Afterwards, composite was produced by sintering method according to temperature and infiltration method according to Cu content in green compact. The composite of sintering method showed a density of 8.55 g/cm3 (relative density 93%) a hardness of 217 HV, and an electrical conductivity of 40.7 IACS% at 1200 °C. The composite of 10 wt.% Cu produced by the Cu infiltration method showed a density of 8.7 g/cm3 (relative density 94%), Hardness of 274HV and electrical conductivity of 39 IACS% at 1300 °C. The measurements of physical properties showed the new possibility of using the Cu–Cr–Mo alloy as a contact material for high-voltage vacuum interrupters.

Mumps is the second-most reported infectious disease in South Korea; however, due to the low pathogen confirmation rate in laboratory diagnoses, we proposed a method for reevaluating the high incidence rate via the laboratory verification of other viral diseases. In 2021, 63 cases of pharyngeal or cheek mucosal swabs of suspected mumps cases in Gwangju, South Korea, were assessed for causative pathogens using massive simultaneous pathogen testing (TaqManTM Array Cards). More than one respiratory virus was detected in 60 cases (95.2%), 44 (73.3%) of which were co-detected. Human rhinovirus was detected in 47 cases, followed by human herpesvirus (HHV)6 in 30; HHV4 (17), human bocavirus (17), HHV5 (10), and human parainfluenza virus 3 (6) were also detected. Our findings suggest the need for further investigations on the pathogenesis of diseases mimicking mumps, which are considered to aid with appropriate public health responses, treatment, and the prevention of infectious disease outbreaks.

In this paper, we examined the temperature variations of key constituents during the operational cycle of a custom-built electric vehicle. The vehicle was made employing a motor of 10kW, a KLS7275D controller, and a lithium-ion battery. Temperature sensors for monitoring was affixed to the motor, controller, and battery, facilitating a comprehensive analysis of thermal behaviors. A controlled 20 minute driving tests encompassing both high and low speeds were executed to scrutinize temperature variations. Our findings reveal that the controller exhibited the most substantial temperature fluctuation compared to the battery and motor. Results shows the importance of thermal management strategies for components to ensure optimal driving performance and component reliability in electric vehicles.

Human Pose Estimation (HPE) is a technique in computer vision and AI for detecting and tracking human body parts and poses from images or videos. Widely used in augmented reality, animation, fitness applications, and surveillance, HPE methods using monocular cameras are highly versatile due to their applicability in standard video and CCTV footage. These methods have evolved from 2D to 3D pose estimation. However, current 3D HPE methods trained on laboratory-based motion capture data encounter challenges such as limited training data, depth perception ambiguity, left/right switching, and issues with occlusions when applied in real-world environments. This study compares two representative 3D HPE methods by assessing their strengths and weaknesses with real-world videos. Then, we propose data processing techniques to eliminate and correct anomalies like left/right inversion and false detections of joint positions in daily life motions. Finally, we obtain joint angle trajectories using an optimization method based on a 3D humanoid simulator, taking as input the joint coordinate data corrected by applying the proposed human joint data processing technique. The efficacy of the proposed 3D HPE method is verified by applying it to three-dimensional freehand gymnastics exercises and comparing the joint angle trajectories during the motion.

Software Defined Networking (SDN) is positioning the standard for the management of networks due to its scalability and flexibility to program the network. The SDN provides many advantages but it also involves some specific security problems take down the controller using cyber attack and in result the whole network will shut down which makes it a single point of failure. In this paper, the DDoS attacks in SDN were detected using AI-enabled, machine and deep learning, models with some specific features for data-set under normal and DDoS traffic. In our approach, initial data-set is collected from 84 features on kaggle and then the 20 top most features are selected using permutation importance algorithm. The data-set were learned and tested with AI-enabled 5 models. Our experimental results showed that the use of machine learning based random forest model has achieved the highest accuracy rate of 99.97%, in DDoS attack detection in SDN. Our contributions through this study are, first, we found highest 20 attacks that absolutely contributed to DDoS attacks. Secondly, it can reduce the time and cost of comparing various learning models and performance required for determining a learning model suitable for DDoS detection. Finally, various experimental methods for evaluating the performance of the learning model are presented so that related researchers can utilize them.

Magnetorheological (MR) fluid is recognized as one of intelligent materials that is widely used for various kinds of controllable devices since its rheological characteristics can be controlled by an external magnetic field (or input current). However, the density mismatch of the compositions between iron particles and carrier oil leads to inevitable sedimentation. Therefore, many works on the sedimentation problem of MR fluids have been carried out to improve the sedimentation stability using appropriate additives, surfactants, nanoparticles, particle coating as well as using several carrier oils with different densities. However, a study on the effect of the current magnitudes and profiles on the sedimentation is considerably rare. This study experimentally investigates the sedimentation behaviors due to the different current magnitudes and different profiles such as square and sine wave. It is shown that average sedimentation rate is 98.61% by applying 1 A of the square wave, while it is 97.83% under the sine type of the current. It is also identified that the higher intensity of the applied current results in stronger electromagnetic which can slow down the sedimentation rate. The results presented in this work are very helpful in designing a controller which provides the input current in terms of the magnitude and profile configuration.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

This study empirically analyzes the effectiveness of resource optimization utilizing artificial intelligence (AI) within cloud computing environments. It compares systems that have been transitioned from a Monolithic structure to Microservices Architecture (MSA) with those adopting a simple Rehost strategy, to validate the operational efficiency of two systems whose resource efficiency has been enhanced compared to traditional legacy systems. The research is based on systems that determined resource efficiency post-cloud migration using APM tools. It points out the limitations of traditional heuristic operation methods in resource optimization, which lead to issues such as application performance degradation, resource over-allocation, and increased operational costs. This study aims to overcome the conventional resource optimization standards that depended on the average peak usage of CPU and memory infrastructure, by introducing AI-based optimization tools, and applying on-premise standards to cloud and container environments to achieve resource optimization. The paper emphasizes the importance of resource optimization through AI-based automation tools, exploring the possibilities of resolving real-world application performance issues in cloud environments, reducing unnecessary resource usage costs, and cutting down on labor risks and operational expenses. Through this, it presents strategic directions on how AI technology can offer financial and operational advantages in managing cloud resources.

Background: This study explored the effects of a virtual reality exercise program on overweight middle-aged women. Methods: This randomized controlled trial included women 4065 years of age with a body mass index (BMI) of 23 kg/m2 or more living in D city. The virtual reality environment was set up by attaching an IoT sensor to an indoor bicycle and linking it with a smartphone, enabling exercise in an immersive virtual reality through a head-mounted display. Results: In the virtual reality exercise group, the BMI was significantly decreased after the 8-week intervention compared with the baseline value (F=100.806, p<.001). The depression scores were significantly different among the three groups, with the intervention effect being more significant in the virtual reality exercise group than in the indoor bicycle exercise and con-trol groups (F=3.462, p<.001). Furthermore, the levels of exercise fun (F=12.373, p<.001) and exer-cise immersion (F=14.629, p<.001) were significantly higher in the virtual reality exercise group than in the indoor bicycle exercise and control groups. Conclusions: The virtual reality exercise program positively affected the BMI and the levels of depression, exercise fun, and exercise im-mersion in overweight middle-aged women. It is an effective home exercise program for obesity management in this population.

Marine yeasts have versatile applications in industrial, medical and environmental fields, but have received little attention compared to terrestrial yeasts and filamentous fungi. In this study, a phylogenetic analysis of 11 marine-derived yeasts was conducted using internal transcribed spacers and nuclear large subunit rDNA, and their bioactivities, such as antioxidant, antibacterial, and tyrosinase inhibition activities, were investigated. The 11 marine-derived yeasts were identified to belong to seven species including Geotrichum candidum, Metschnikowia bicuspidata, Papiliotrema fonsecae, Rhodotorula mucilaginosa, Vishniacozyma carnescens, Yamadazyma olivae, and Yarrowia lipolytica, and three strains of these were candidates for new species of the genera Aureobasidium, Rhodotorula, and Vishniacozyma. Most extracts showed antioxidant activity, whereas seven strains exhibited antibacterial activities against Bacillus subtilis. Only Aureobasidium sp. US-Sd3 among the 11 isolates showed tyrosinase inhibition. Metschnikowia bicuspidata BP-Up1 and Yamadazyma olivae K2-6 showed notable radical-scavenging activity, which has not been reported previously. Among the isolates, Aureobasidium sp. US-Sd3 exhibited the highest antibacterial and tyrosinase inhibitory activities. Overall, our results demonstrate the potential of marine-derived yeasts as a source of bioactive compounds for improving industrial applications.

The blended perfluorinated sulfonic acid ionomers are prepared to have equivalent weight (EW) ~1000, 980, and 830. The catalyst layers (CLs) using blended PFSA ionomers with different side chain lengths and EWs are investigated, compared to the CLs utilizing single ionomers. The IEC results indicate that the blended ionomers have the targeted EWs. As a result, it is found that the blended ionomers exhibit higher ion conductivity than the single ionomers at all temperatures due to higher water uptake of the blended ionomers. Even though they have a similar EW, it implies that the blended ionomers have bulk structure to form competent free volume. The blended ionomers with short side chain (SSC) and low EW can help reduce the activation energy due to the enhanced hydrophobic and hydrophilic segregation. In addition, it is observed that the catalyst layers using the blended ionomer form more porous microstructure to help reduce the resistance of oxygen transport and attributes to lower mass transfer loss. This effect is significantly revealed in the fuel cell operation at not the lower temperature (70 °C) and full humidification (100%) but the elevated temperature (80 °C) and lower relative humidity (50 and 75%). The blended ionomer-based catalyst layers with higher water uptake and porous CL structure result in higher fuel cell performance and better mass transport than the single ionomer-based catalyst layers.

The objective of this study is to design and synthesize substituted η6-chromium tricarbonyl metal complexes carrying o-carborane units as potential boron neutron capture therapy (BNCT) agents. In this study, 1,2-Diphenyl-o-carborane units were used as starting materials to generate biologically active species. We investigated how the structural changes of 1,2-diphenyl-o-carborane substituted with chromium(0) tricarbonyl affect the biological properties; [(CO)3Cr]Ph2C2 (2) and [(CO)3Cr]2Ph2C2 (3) species were produced in moderate yields. The molecular structures of compounds 1–3 were identified and established by infrared (IR), 1H, 11B, and 13C nuclear magnetic resonance (NMR), and X-ray crystallography analyses. Crystal structures of o-carboranyl chromium complexes 1 [a = 10.859(1) Å, b = 24.953(3) Å, c = 13.938(2) Å, β = 111.854(2)º], 2 [a = 10.621(3) Å, b = 17.056(5) Å, c = 12.174(4) Å, β = 106.622(5)º], and 3 [a = 17.540(2) Å, b = 18.060(2) Å, c = 19.484(4) Å, α = 105.746(2)º, β = 110.226(2)º, γ = 91.256(2)º] were obtained. In vitro study using B16 and CT26 cancer cells containing the triphenyl-o-carboranyl chromium (0) complexes Ph3C2BCr2 and Ph3C2BCr3, which we have previously reported, the compounds 2 and 3 accumulated at higher levels than compounds Ph3C2BCr2 and Ph3C2BCr3. However, the phenylated o-carboranyl chromium(0) complexes have been found to be more cytotoxic than p-boronophenylalanine (BPA).

The objective of this study was to evaluate the effects of dietary supplementation with bacteriophage and β-mannanase on health and growth performance in calves. Thirty-six pre-weaning male Holstein calves were randomly allocated to one of four dietary treatments: no supplementation, 0.1% β-mannanase, 0.1% bacteriophage, and both 0.1% bacteriophage and β-mannanase supplementation in a starter. The experiment lasted from 2 weeks before weaning to 8 weeks after weaning. Twenty-two calves survived to the end of the experiment. No interaction was observed between the two methods of supplementation. A 1-kg increase in initial BW resulted in a 1.41-fold increase in the odds ratio of survival (p < 0.01). The bacteriophage supplementation tended to increase the odds ratio of survival (p = 0.09). The number of Escherichia coli in feces significantly decreased one week after weaning. β-mannanase supplementation increased the concentrates intake (p < 0.01) and tended to increase the final BW (p = 0.08). Analysis of repeated measures indicated β-mannanase supplementation increased weekly body weight gain (p = 0.018). We conclude that bacteriophage supplementation may have a positive effect on calf survival rate, while β-mannanase supplementation may increase the growth rate and intake of a starter in calves.

Anesthetics reduce cardiac functions and lower blood pressure (BP), potentially causing excessive BP reduction in dehydrated patients or those with heart conditions, such as coronary artery disease (CAD). Considering the increased prevalence of cardiovascular disease with age, anesthesiologists must be cautious about BP reduction during general anesthesia in older adults. In the present case, an undiagnosed CAD patient in a hypovolemic state experienced a significant systolic blood pressure drop to the 50s during propofol and sevoflurane anesthesia. Despite the use of vasopressors, excessive hypotension persisted, leading to anesthesia suspension. Subsequent cardiac examinations, including computed tomography heart angio and calcium score, and coronary angiogram, revealed a near total occlusion of the left main coronary artery and the formation of collateral circulation. After 5 days of hydration and anticoagulation medications and confirmation of normovolemic state, general anesthesia was attempted again and successfully induced; a normal BP was maintained throughout the surgery. Thus, it is important to conduct a thorough cardiac evaluation and maintain normovolemia for general anesthesia in older adults.

A fern, Polypodium aureum, possesses a specialized spore-releasing mechanism like a catapult induced by quick expansion of vaporized bubbles. This study introduces lipid-coated perfluorocarbon droplets to enable repeatable vaporization-condensation cycles, inspired by the repeatable vaporization of Polypodium aureum. Lipid-perfluorocarbon droplets have been considered not to exhibit repeatable oscillations due to bubble collapse by low surface tension of lipid layers. However, a single lipid-dodecafluoropentane droplet with a diameter of 9.17 µm shows expansion-contraction oscillations over 4,000 cycles by changing lipid composition and applying low power of 1.7 MHz ultrasound to induce partial vaporization of droplets. The optimal combinations of shell composition, droplet fabrication, and acoustic conditions can minimize damage on shell structure and quick recovery of damaged shell layers. The highly-expanding oscillatory microbubbles provide a new direction for fuel-free micro or nanobots as well as biomedical applications of contrast agents and drug delivery.

Anxiety disorders affect patient quality of life (QoL). This study aimed to examine the associations between improved QoL and reduced clinical symptoms and Korean medicine (KM) in patients with anxiety disorders. Medical records of patients with anxiety who were treated with KM (acupuncture, Anxiety disorders affect patient quality of life (QoL). This study aimed to examine the associations between improved QoL and reduced clinical symptoms and Korean medicine (KM) in patients with anxiety disorders. Medical records of patients with anxiety who were treated with KM (ac-upuncture, psychotherapy, Chuna therapy, aromatherapy, or herbal medicine) for at least 4 weeks were retrospectively analyzed. Clinical, QoL, and cost outcomes were measured at baseline and at 4 and 12 weeks (Anxiety: State-Trait Anxiety Inventory[STAI X-1(state), X-2(trait)], Beck Anxiety Inventory[BAI]; anger: State-Trait Anger Expression Inventory State[STAXI-S(state), T(trait)], Anger Expression Inventory[AXI-K-I(anger-in), AXI-K-O(anger-out), AXI-K-C(anger-control); depression: Beck Depression Inventory-II[BDI II], QoL: QoL-related instruments Euro Quality of Life 5 Dimensions utility score[EQ-5D], Euro QoL Visual Analog Scale[EQ-VAS]). The quali-ty-adjusted life years (QALYs) and average cost-effectiveness ratio of KM for anxiety were esti-mated. The medical records for 67 patients were evaluated. KM treatments were found to be as-sociated with decreased anxiety (STAI X-1; STAI X-2; BAI, p

Lectins, characterized by their carbohydrate-binding ability, have an extensive practical application. However, their industrial use is limited by low yields, and few active recombinant lectins have been reported. In this study, the algal lectin BPL-3 (Bryopsis plumosa lectin 3) was successfully produced using a bacterial expression system, BL21(DE3), with an artificial repeated structure (dimeric construct). Recombinant dimeric BPL3 (rD2BPL3) was confirmed by LC-MS/MS spectrometry. Expression efficiency was greater for the construct with the repeat structure (rD2BPL3) than the monomeric form (rD1BPL3). Optimal conditions for expression were 1 mM IPTG at 20 °C. Recombinant lectin was purified under denaturing conditions and refolded by the flash dilution method. Recombinant BPL3 was solubilized in 1× PBS containing 2 M urea. rD2BPL3 showed strong hemagglutination activity using human erythrocytes, similar to that of native BPL3. rD2BPL3 had a similar sugar specificity to that of the native protein, i.e., to N-acetyl-glucosamine (GlcNAc) and N-acetyl-galactosamine (GalNAc). Glycan array results showed that recombinant BPL3 and native BPL3 exhibited different binding properties. Both showed weak binding activity to α-Man-Sp. Native BPL3 showed strong binding specificity to the alpha conformation of amino sugars, and rD2BPL3 had binding activity to the beta conformation. The process developed in this study was suitable for the quality-controlled production of high amounts of soluble recombinant lectins.

Gastric cancer is the 5th most common disease in the world and the 4th most common cause of death. It is diagnosed through esophagogastroduodenoscopy with biopsy, however there are limitations in finding lesions in the early stages. Recently, research has been actively conducted to use liquid biopsy to diagnose various cancers, including gastric cancer. Various substances derived from cancer are reflected in the blood. By analyzing these substances, it was expected that not only the presence or absence of cancer but also the type of cancer can be diagnosed. However, the amount of these substances is extremely small, and even these have various variables depending on the characteristics of the individual or the characteristics of the cancer. To overcome these, we collected methylated DNA fragments using MeDIP and compared them with normal plasma to characterize gastric cancer tissue or patient’s plasma. And we attempted to diagnose gastric cancer using the characteristics of cancer reflected in the blood through the cancer tissue and patient’s plasma. As a result, we confirmed that the consistency of common methylated fragments between tissue and plasma was approximately 41.2%, and found the possibility of diagnosing and characterizing cancer using the characteristics of the fragments through SFR and 5'end-motif analysis.

The purpose of this study was to investigate the effect that Glycine max hydrolyzed with enzymes from Bacillus velezensis KMU01 has on dextran sulfate sodium (DSS)-induced colitis in mice. Hydrolysis improves functional health through the bioconversion of raw materials and increase in intestinal absorption rate and antioxidants. Therefore, G. max was hydrolyzed in this study using a food-derived microorganism, and its anti-inflammatory effect observed. Enzymatically hydrolyzed G. max (EHG) was orally administered once daily for four weeks before DSS treatment. Colitis was induced in mice through consumption of 5% (w/v) DSS in drinking water for eight days. Results showed that EHG treatment significantly alleviated DSS-induced body weight loss and decreased the disease activity index and colon length. In addition, EHG markedly reduced tumor necrosis factor-a, interleukin (IL)-1b, and IL-6 production, and increased that of IL-10. EHG improved DSS-induced histological changes and intestinal epithelial barrier integrity in mice. Moreover, we found that the abundance of 15 microorganisms changed significantly; that of Proteobacteria and Escherichia coli, which are upregulated in patients with Crohn’s disease and ulcerative colitis, decreased after EHG treatment. These results suggest that EHG has a protective effect against DSS-induced colitis and is a potential candidate for colitis treatment.

In this study, to reduce the use of cement and sand, porous feldspar with excellent economic efficiency was used as a substitute in heat storage concrete layer. When cement was replaced with porous feldspar, the compressive strength was approximately 16%–63% higher compared with when cement was replaced with silicate minerals. To compensate for the reduction in strength owing to the decreased cement content, mechanical and chemical activation methods were employed. When the specific surface area of porous feldspar was increased, the unit weight was reduced by approximately 30% and the compressive strength was increased by up to 90%. When chemical activation was applied using a solidifying agent, the strength was increased by approximately 30% even though 70% of the cement content was replaced with porous feldspar. When cement and sand were replaced with porous feldspar, the compressive strength was approximately two times that of ordinary cement mortar. When the heat storage concrete layer material was replaced with porous feldspar in a pilot scale experiment, the thermal conductivity and heat storage characteristics were better than those of ordinary cement mortar, and an energy-saving effect of approximately 57% was observed, confirming the excellent applicability of porous feldspar as a building material.

This paper proposes an algorithm for transmitting and reconstructing the estimated point cloud using temporally estimating a dynamic point cloud sequence. When a non-rigid 3D point cloud sequence (PCS) is input, the sequence is divided into groups of point cloud frames (PCF), and a key PCF is selected. After the 3D skeleton is predicted through 3D pose estimation, the motion of the skeleton is estimated by analyzing the joints and bones of the 3D skeleton. For the deformation of the non-rigid human PC, the 3D PC model is transformed into a mesh model, and the key PCF is rigged using the 3D skeleton. After deforming the key PCF into the target PCF utilizing the motion vector of the estimated skeleton, the residual PC between the motion compensation PCF and the target PCF is generated. If there is a key PCF, the motion vector of the target PCF, and a residual PC, the target PCF can be reconstructed. Just as compression is performed using pixel correlation between frames in a 2D video, this paper compresses 3D PCF by estimating the non-rigid 3D motion of a 3D object in a 3D PC. The proposed algorithm can be regarded as an extension of the 2D motion estimation of a rigid local region in a 2D plane to the 3D motion estimation of a non-rigid object (human) in 3D space. Experimental results show that the proposed method can successfully compress 3D PC sequences. If it is used together with a PC compression technique such as MPEG PCC (point cloud compression) in the future, a system with high compression efficiency may be configured.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Lipofibromatous hamartoma, first reported in 1953, is a rare, slowly-progressive soft tissue tumor, characteristics of which include enlargement of the affected nerve by epineurial and perineurial proliferation of adipose and fibrous tissues. Out of previously reported 200 cases of lipofibromatous hamartoma of the median nerve, there have been approximately 40 pediatric cases under the age of 18. Herein, we report a case of lipofibromatous hamatoma of the median nerve in a 3-year-old female patient, who was surgically decompressed by carpal tunnel release only and histologically confirmed. The patient was followed-up on outpatient clinic basis annually along with ultrasonography, and the postoperative 10th year follow-up did not show recurrence or any deficits in motor and sensory functions

Recently, cobalt iron boron (CoFeB) thin films have been widely investigated to apply to magnetic sensors, due to their high magnetic moment, anisotropy, and stability. However, most of these studies are conducted on rigid silicon substrates. For more diverse applications of magnetic sensors and angle sensors, it is important to explore the properties of ferromagnetic thin films grown on non-rigid deformable substrates. Here, using representative deformable substrates such as polyimide (PI), polyethylene naphthalate (PEN) and polydimethylsiloxane (PDMS) that can be bent or stretched, we report experimental comparison of in-plane magnetic field angle-dependent properties of the amorphous Ta/CoFeB/MgO/Ta thin film which is grown on those deformable substrates. We investigate effects of substrate roughness, tensile stress, characteristics of deformable substrates, and sputtering process on the change of magnetic properties like coercive field (Hc), remanence over saturation magnetization (Mr/Ms), and their biaxial characteristics. This work presents unconventional foundations for exploring deformable magnetic sensors capable of detecting magnetic field angle.

Oxidative stress-mediated damage is often a downstream result of Parkinson’s disease (PD), which is marked by sharp decline in dopaminergic neurons within the nigrostriatal regions of the brain, accounting for the symptomatic motor deficits in patients. Regulating the level of oxidative stress may present a beneficial approach in preventing PD pathology. Here, we assessed the efficacy of a nicotinamide adenine phosphate (NADPH) oxidase (NOX) inhibitor, an exogenous reactive oxygen species (ROS) regulator synthesized by Aptabio therapeutics with the specificity to NOX-1, 2, and 4. Utilizing N27 rat dopaminergic cells and C57Bl/6 mice, we confirmed that the exposures of alpha-synuclein preformed fibrils (PFF) induced protein aggregation, a hallmark in PD pathology. In vitro assessment of the novel compound revealed an increase in cell viability and decreases in cytotoxicity, ROS, and protein aggregation (Thioflavin-T stain) against PFF exposure at the optimal concentration of 10nM. Concomitantly, the oral treatment alleviated motor deficits in behavioral tests, such as hindlimb clasping, rotarod, pole, nesting, and grooming test, via reducing protein aggregation, based on rescued dopaminergic neuronal loss. The suppression of NOX-1, 2, and 4 within the striatum and ventral midbrain regions including SNc contributed to neuroprotective/recovery effects, making it a potential therapeutic option for PD.

Suppressing the charge recombination at the interface of photoanode/electrolyte is the crucial way to enhance the photovoltaic performance of quantum dot sensitized solar cells (QDSSCs). In this scenario, ZnS/SiO2 blocking layer was deposited on TiO2/CuInS2 QDs to inhibit the charge recombination at photoanode/electrolyte interface. As a result, the TiO2/CuInS2/ZnS/SiO2 based QDSSCs delivers a power conversion efficiency (η) value of 4.63%, which is significantly higher than the 2.15% and 3.23% observed for QDSSCs with a TiO2/CuInS2 device and TiO2/CuInS2/ZnS, respectively. Electrochemical impedance spectroscopy and open circuit voltage decay analyses indicate that ZnS/SiO2 passivation layer on TiO2/CuInS2 suppress the charge recombination at the photoanode/electrolyte interface and prolongs the electron lifetime.

We reveal the significance of plasmonic nanoparticle’s (NP) shape and its surface morphology en route to an efficient self-assembled plasmonic nanoparticle cluster. A simplified model is simulated in the form of free-space dimer and trimer nanostructures (NPs in shape of sphere, cube, and disk). A ~ 200 % to ~ 125% raise in near field strength (gap mode enhancement) is observed for spherical NPs in comparison with cubical NPs (from 2 nm to 8 nm gap sizes). Full-width three-quarter maximum reveals better broad-spectral optical performance in a range of ~ 100 nm (dimer) and ~ 170 nm (trimer) from spherical NPs as compared to a cube (~ 60 nm for dimer and trimer). These excellent properties for sphere-based nanostructures are merited from its dipole mode characteristics.

To address the challenges of climate change and food security, the establishment of smart farm complexes is necessary. While there have been numerous studies on the productivity and environmental control of individual greenhouses, research on greenhouse complexes is considerably limited. Conducting environmental studies during the design phase of these complexes poses financial constraints and practical limitations in terms of on-site experiments. To identify potential issues that may arise when developing large-scale greenhouse complexes, it is possible to utilize modeling techniques using Computational Fluid Dynamics (CFD) to assess environmental concerns and location issues before constructing the facilities. Consequently, simulating large-scale CFD models that incorporate multiple greenhouses and atmospheric conditions simultaneously presents significant numerical challenges. The objective of this study was to develop a guideline for verifying CFD models for a large-scale Venlo greenhouse, where acquiring field data before construction is not feasible for designing a greenhouse complex. The verification processes of the CFD models were conducted using 2D and 3D iterative simulations of a 2-hectare greenhouse model, using the improved Grid Independence Test (GIT) and wall Y+ approaches. Subsequently, the aerodynamic characteristics were analyzed in a 3D greenhouse model to access its performance when the wind direction was 90° in summer season. The findings revealed that a grid resolution of 0.8 meters and a first layer height of 0.04 meters were suitable for developing large-scale greenhouse models, resulting in a low Root Mean Square Error (RMSE) of 3.9% and a high coefficient of determination (R2) of 0.968. This process led to a significant reduction of 38% in the number of grid cells. These results will serve as design standards for large-scale greenhouses.

Machine learning (ML) is enabling augmented reality (AR) to gain popularity in various fields, including gaming, entertainment, healthcare, and education. ML enhances AR applications in education by providing accurate visualizations of objects. For AR systems, ML algorithms facilitate the recognition of objects and gestures from kindergarten through university. The purpose of this survey is to provide an overview of various ways in which ML techniques can be applied within the field of AR within education. The first step is to describe the background of AR. In the next step, we will discuss the ML models that are used in AR education applications. Additionally, we discuss how ML is used in AR. Each subgroup’s challenges and solutions can be identified by analyzing these frameworks. In addition, we outline several research gaps and future research directions in ML-based AR frameworks for education.

To expand the application scope and increase the demand for non-crimp fabrics (NCFs) as a lightweight vehicle material, the delamination and thermal strain in NCF composites must be restricted. Accordingly, to simultaneously improve the interfacial bonding and thermal stability of the NCF composites, in this study the epoxy resin, in which SiO2 nanoparticles was modified by a silane coupling agent, were infused to the stacked NCFs and between the layers of NCFs through the vacuum-assisted resin infusion molding (VARIM) process.

Lichens are a life form in which algae and fungi have a symbiotic relationship. A lichen has various biological activities, including anti-inflammatory and anti-proliferative activities. Inflammation is a response caused by various factors, such as infection by pathogens or tissue damage; excessive reactions can contribute to the etiology of chronic diseases, such as asthma, brain damage, and serious tissue damage. This study demonstrates the anti-inflammatory effect of ethyl acetate extract from Phlebia sp. on NF-κB and AP-1 pathways in the lipopolysaccharide-treated RAW 264.7 cell. Especially, Phlebia sp. extract inhibits the phosphorylation of AP-1 signaling (c-Fos and c-Jun) and its upstream MKK/MAPKs (MKK4, MKK7 and JNK), which induced a decrease in the production of the inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), and granulocyte-macrophage colony-stimulating factor (GM-CSF) in downstream of AP-1 signaling. Furthermore, Phlebia sp. extract inhibited the production of final inflammatory effector molecules involved in AP-1 signaling, including nitric oxide (NO) and prostaglandin E2 (PGE2). Here, we report that Phlebia sp. extract has the potential to be developed as an anti-inflammatory agent.

In this study, the effect of heat treatment was investigated to influence the occurrence of fracture during manufacturing process of Alloy B steel with boron contents as high as 130 ppm. As the content of boron increases, it affects the phase transformation temperature and texture. The development of {111}<uvw> components in the γ-fiber is affected depending on the austenite fraction after phase transformation. The Alloy B steel indicated that the increase in the boron content increased the α to γ phase transformation temperature such that sufficient transformation did not occur in the normalizing condition. The cracks occurred at the point of the transition from elastic to plastic deformation in the ND direction during the rolling process, thereby resulting in failure. Therefore, it is necessary to avoid the intermediate heat treatment condition in which γ-fiber does not fully develop, i.e., an imperfect normalization.

The inter-subspecific crossing between indica and japonica subspecies in rice have been utilized to improve the yield potential of temperate rice. In this study, a comparative study of the genomic regions in the eight high-yielding varieties (HYVs) was conducted with those of the four non-HYVs. The Next-Generation Sequencing (NGS) mapping on the Nipponbare reference genome identified a total of 14 common genomic regions of japonica-originated alleles. Interestingly, the HYVs shared japonica-originated genomic regions on nine chromosomes, although they were developed through different breeding programs. A panel of 94 varieties was classified into four varietal groups with 38 single nucleotide polymorphism (SNP) markers from 38 genes residing in the japonica-originated genomic regions and 16 additional trait-specific SNPs. As expected, the japonica-originated genomic regions were only present in the japonica (JAP) and HYV groups, except for Chr4-1 and Chr4-2. The Wx gene, located within Chr6-1, was present in the HYV and JAP variety groups, while the yield-related genes were conserved as indica alleles in HYVs. The japonica-originated genomic regions and alleles shared by HYVs can be employed in molecular breeding programs to further develop the HYVs in temperate rice.

Azapeptides have gained much attention due to their ability to enhance the stability and bioavailability of peptide drugs. Their structural preferences, essential to understanding their function and potential applica-tion in the peptide drug design, remain largely unknown. In this work, we systematically investigated the conformational preferences of three azaamino acid residues in tripeptide models, Ac-azaXaa-Pro-NHMe [Xaa= Asn (4), Asp (5), Ala (6)], using the popular DFT functionals, B3LYP and B3LYP-D3. A solvation model density (SMD) was used to mimic the solvation effect on the conformational behaviors of azapep-tides in water. During the calculation, we considered the impact of the amide bond in the azapeptide mod-els on the conformational preferences of models 4-6. We analyzed the effect of the hydrogen bond be-tween the side-chain main chain and main-chain main-chain on the conformational behaviors of azapep-tides 4-6. We found that the predicted lowest energy conformation for the three models differs depending on the calculation methods. In the gas phase, B3LYP functional indicates that the conformers tttANP-1 and tttADP-1 of azapeptides 4 and 5 correspond to the type I of -turn, the lowest energy conformation with all-trans amide bonds, respectively. Considering the dispersion correction, B3LYP-D3 functional predicts the conformers tctANP-2 and tctADP-3 of azapeptide 4 and 5, which contain the cis amide bond preceding the Pro residue, as the lowest energy conformation in the gas phase. The results imply that azaAsx and Pro residues may involve cis-trans isomerization in the gas phase. In water, the predict-ed lowest energy conformer of azapeptides 4 and 5 differs from the gas phase results and depends on the calculational method. For azapeptide 6, regardless of calculation methods and phases, tttAAP-1 (-I turn) is predicted as the lowest energy conformer. The results imply that the effect of the side chain that can form hydrogen bonds on the conformational preferences of azapeptides 4 and 5 may not be negligible. We compared the theoretical results of azaXaa-Pro models with those of Pro-azaXaa models, showing that in-corporating azaamino acid residue in peptides at different positions can significantly impact the folding patterns and stability of azapeptides.

As broiler farming facilities have become larger and more concentrated in response to external environmental changes, there is a possibility of increased concentrations of fine dust and aerosols inside these facilities due to enclosure. In particular, workers are exposed to high concentrations of organic particulate matter and harmful gases while performing their tasks, and as they age, they become more vulnerable to respiratory diseases. It is essential to directly monitor the concen-trations to which workers are exposed, along with the spatial distribution of aerosols inside broiler house. In this study, we analyzed the regional aerosol concentrations using passive samplers in commercial tunnel-ventilated broiler farms. Simultaneously, we employed active samplers at the height of the workers' breathing zones to monitor real-time aerosol concentrations by particle size along their work routes. Spatial aerosol concentrations generally increased from the inlet to the exhaust in the breathing zone. The average aerosol concentrations were TSP -1,042 µg/m³, PM-10 718 µg/m³, and PM-2.5 137 µg/m³. To analyze the workers' exposure environments, we categorized the tasks in the barn into Static work period (SWP) and Moving work period (MWP) based on video analysis. The results showed that during MWP, fine dust concentrations exceeded the standards by up to 214%. Particularly, during MWP, the concentrations were 1.74 times higher for TSP, 1.40 times higher for PM-10, and 1.22 times higher for PM-2.5 compared to SWP. It was observed that during the movement of workers, physical generation of particles around 10 µm, such as feces, feed, and bedding, occurred due to the movement of chicken, which influenced the aerosol concentration.

Many farms utilize closed-type livestock systems to enhance productivity and facilitate effective environmental management. However, the confined nature of these closed spaces poses an increased risk of exposure to harmful gases and organic dust for both workers and livestock. Additionally, the introduction of outside air through ventilation systems can lead to temperature fluctuations within the breeding environment, resulting in potential productivity issues. This research paper employs computational fluid dynamics (CFD) to develop ventilation operation management plans that address both the working environment and the breeding environment simultaneously. The proposed plans are designed to be easily implemented in practical farm settings. The findings of this study, based on simulation analysis, indicate that while ventilation is effective in reducing harmful gases and improving the working environment, its efficiency decreases after the initial 3 minutes of operation. Furthermore, uncontrolled ventilation can cause sudden temperature changes, which may adversely affect the well-being of the livestock. However, when upgraded ventilation structures are implemented, significant improvements in the working environment (an average of 27.3% improvement) can be achieved while maintaining temperature stability for the livestock. These results highlight the importance of referring to the provided ventilation operation management table before commencing work, as it enables workers to improve the working environment while minimizing the potential impact of ventilation on the breeding environment.

We report the use of four-layer graphene (4LG) as a highly reliable transparent conductive electrode (TCE) for polymer-dispersed liquid crystal (PDLC)-based smart window devices. The adhesion between 4LG and the substrate was successfully improved through a water-induced interface-cleaning (WIIC) process. We compared the performance of a device with a WIIC-processed 4LG electrode with that of devices with a conventional Indium tin oxide (ITO) electrode and a 4LG electrode without a WIIC. With the application of the WIIC process, the PDLC smart window with a 4LG electrode exhibited reduced turn-on voltage and haze compared to 4LG without the WIIC process and characteristics comparable to those of the ITO electrode. Based on our observations, we conclude that 4LG with WIIC is a promising TCE for flexible smart windows.

Agriculture (crop production, land use, and livestock) is the second most important greenhouse gas (GHG) emitting sector after the energy sector. Agriculture is also recognized as the source and sink of GHGs. Evidence demonstrates that the application of high amounts of nitrogen-rich fertilizers enhances methane (CH4) and nitrous oxide (N2O) emissions, which are potent GHGs with a high global warming potential (GWP). Considering its global contribution to the climate crisis, reducing GHG emissions in agriculture would considerably lower its share of the global GHG emission records, which may lead to enormous benefits for the environment and food production systems. Several diverging and controversial views questioning the actual role of plants in the current global GHG budget continue to nourish the debate globally. We must acknowledge that considering the beneficial roles of major GHGs to plants at a certain level of accumulation, implementing GHG mitigation measures from agriculture is indeed a complex task. This review seeks to provide key approaches for GHG mitigation in the literature (environmentally friendly crop cultivation and residue management practices, improvement of plants nutrients/fertilizer use efficiency, exploring the genetic diversity for low GHG emission, soil methane-producing bacteria, integrated soil fertility management, improved livestock feeding efficiency, and production, etc.). This work gathers key approaches from 275 peer-reviewed publications, including experimental research papers, review articles, and books, discussing greenhouse gas emissions mechanisms and mitigation to unravel effective strategies for GHG mitigation, proven to be effective or carry the potential to mitigate GHG generation from agriculture. This review also discusses in depth the significance and the dynamics of strategies regarded as game changers with a high potential to enhance, in a sustainable manner, the resilience of agricultural systems. Agricultural GHG mitigation approaches discussed in this work can serve as game changers in global efforts to reducing GHG emissions and alleviating the impact of climate change through sustainable agriculture and informed-decision making.

Non-alcoholic steatohepatitis (NASH) is diagnosed by the occurrence of fat buildup, inflammation, and fibrotic changes within the liver. NASH has the capacity to proceed to the advancement of decompensated cirrhosis and carcinoma by inflammation and oxidative stress. Although Agrimonia pilosa has traditionally been used medicinal purposes, its effects on the liver remains incompletely elucidated. In this research, we assessed the therapeutic outcomes of Agrimonia pilosa extract (APE) on free fatty acid (FFA)-treated HepG2 cellular hepatic steatosis and in a choline-deficient, L-amino acid-defined, high-fat diet with 0.1% methionine (CDAHFD)-induced NASH mouse model. In FFA-treated cells, APE inhibited intracellular lipid accumulation, and regulated the mRNA and protein expressions of modulators of fatty acid (FA) synthesis as well as FA oxidation proteins, through down-regulation of the AMP-activated protein kinase/sirtuin 1 signaling pathway. In the CDAHFD-induced NASH mouse model, APE significantly enhanced liver histology and serum levels of liver damage. APE also significantly attenuated hepatic expression of mRNA and proteins related to FA synthesis, inflammation, and fibrosis. Furthermore, APE mitigated the expression levels of oxidative stress and endoplasmic reticulum stress. Overall, these discoveries indicate that Agrimonia pilosa has the potential to treat NASH by regulating hepatic lipid metabolism, alleviating inflammation, and mitigating oxidative stress.

Poly(acrylic acid) (PAAc) hydrogels possess good bioadhesive properties and allow enhanced penetration of drugs. In addition, it is possible to localize the absorption site of the drug in the hydrogel and increase the drug residence time. As opposed to other cross-linking processes radiation-induced polymer cross-linking can be easily and rapidly carried out without the use of cross-linking agents and other chemical additives. In this study, we fabricated metronidazole (MD) containing PAAc hydrogel (MD/PAAc) with different MD contents (0.1, 0.25, 0.5 wt%) using varying radiation doses (25, 50, 75 kGy) by gamma-irradiation. The physical and thermal properties were determined by gel content analysis, swelling ratio measurements, compressive strength measurements, differential scanning calorimetery, and thermogravimetric analysis. The properties of the hydrogel degraded due to the crystalline nature of MD. The properties of the hydrogel degraded due to the crystalline nature of MD. Cumulative release observed after 50 min in the case of 0.5MD/PAAc and 0.1MD/PAAc was 50% and 10%, respectively. Our findings suggest that MD/PAAc could be a suitable drug delivery carrier for use with radiation-based techniques.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

In order to reduce the large damage caused by train derailment, protective facilities of various shapes and conditions can be installed on railroad tracks. These protective facilities are referred to as derailment containment provisions (DCPs) and three different types are used worldwide. However, there are no clear standards for DCPs design such as installation location, size, and design load, and performance verification of DCPs installed in the actual railway field is not sufficiently performed. In this paper, the functionality of DCPs is analyzed through the full-scale derailment test. In order to propose a method for estimating the collision load acting on the DCP type I after derailment, the experimental results and simulation results are compared. The function of DCP type I according to the change of the vehicle's center of gravity is identified through comparative analysis of the post derailment behavior.

This study was conducted to improve the white index (WI) by preparing thermally expandable microspheres (TEMs) for wallpaper. The thermal properties, foam expansion ratio and WI were studied depending on the particle size of colloidal silica in the preparation of TEMs. As a result, the TEMs with small particles of colloidal silica showed the best results for whiteness and yellowing. Additionally, TGA results indicated that it was highly possible that colloidal silica with small particle sizes was physically or chemically attached to the surface of the TEMs that led to an improvement in whiteness at high temperatures.

Rice, as a staple crop feeding billions, faces constant threats from various diseases jeopardizing global food security. Precise understanding of disease resistance mechanisms is crucial for developing resilient rice varieties. Traditional genetic mapping methods, such as QTL mapping, provide valuable insights into the genetic basis of diseases. However, the complex nature of rice diseases demands a holistic approach to gain accurate knowledge of it. Omics technologies, including genomics, transcriptomics, proteomics, and metabolomics, enable a comprehensive analysis of biological molecules, uncovering intricate molecular interactions within the rice plant. Integration of various mapping techniques using multi-omics data has revolutionized our understanding of rice disease resistance. By overlaying genetic maps with high-throughput omics datasets, researchers can pinpoint specific genes, proteins, or metabolites associated with disease resistance. This integration enhances the precision of disease-related biomarkers with better understanding of their functional roles in disease resistance. Improvement of rice breeding for disease resistance through this integration represents a significant stride in agricultural science because better understanding of the molecular intricacies and interactions underlying disease resistance architecture leads to more precise and efficient development of resilient and productive rice varieties. In this review, we explore how the integration of mapping and omics data can give a transformative impact on rice breeding for enhancing disease resistance.

Purpose: Social responsibility has been accepted as a core value of nursing profession, particularly in the area of health disparity, but it seems to be difficult to understand for what is meant by social responsibility. The purpose of this study was to explore ways to define the concept of social responsibility of nursing in order to understand the meaning of social responsibility in the field of nursing profession. Methods: The concept analysis process by Walker and Avant was used to clarify the meaning of social responsibility of nursing. Results: Defining attributes of social responsibility of nursing included praxis, as approach to strategizing for social and structural change of inequity, care for an oppressed group which is under social suffering caused by the privilege and power, and action for health policy change in social and political unequal contexts. The antecedents of social responsibility of nursing included reflectivities in identifying personal characteristics, taking seriously the perspective of other vulnerable population, recognizing social environmental status quo (‘fair or unfair’), developing competences in ethical and moral reasoning with social issues. Consequences of social responsibility of nursing were achieving social justice, as equal access to basic human health need in societal level, equal access to effective nursing practice delivery system and development of health promotion policy for world health administrative practices (“health for all”) in nursing. Conclusion: This study provides a guidance to direct future studies through the procedure of identifying conceptual attributes in the context of social responsibility of nursing. Future studies are suggested to develop instruments for social responsibility as well as development of educational programs to promote social responsibility competences in nursing students and nurses.

A recent systematic review for 19 selected articles after searching through to 30 September 2017 showed vitamin D deficiency was associated with ischemic stroke (IS), not hemorrhagic stroke (HS). But a heterogeneity would be introduced with comparing the lowest and highest category of vitamin D. The aim of this article was to conduct an updated meta-analysis (UMA) with searching through to 31 March 2019. An interval collapsing method as information extraction was applied in order to decrease a heterogeneity among studies. Additional articles were selected from cited lists from 19 selected articles using citation discovery tools. Random effect model was applied if I-squared value was over 50%. A funnel plot and Egger’s test were used to detect a publication bias. After 5 new studies were added, the summary RRs [and their 95% confidence intervals] (I-squared value) were 1.52 [1.33–1.74] (0.0%) in IS, and 2.44 [1.34–4.46] (69.7%) in HS. This UMA supported the hypothesis that serum vitamin D deficiency was associated with an increased risk of HS as well as IS. Diverse public health programs against vitamin D deficiency status would be needed for higher risk group, especially elderly people.

Although global life expectancy has increased over the past 20 years due to improvements in managing infectious diseases, one in five people still succumbs to infections. Humanity is tirelessly working towards developing vaccines and antimicrobial agents in response to this ongoing threat. However, pathogens continue to acquire numerous resistance mechanisms and proliferate. Meanwhile, the COVID-19 pandemic has prompted us to recognize that focusing solely on the killing strategies of immunology and microbiology in complex and multisystemic infectious diseases is insufficient for understanding survival. In essence, there is a need for a treatment approach centered on disease tolerance, capable of alleviating pathology and/or promoting physiological functions in conjunction with the existing strategies of host immune response and pathogen destruction. Against this backdrop, this narrative review comprehends and introduces microbiome therapeutics, which recently garnered attention as next-generation treatments regarding two defense strategies against infectious diseases. First, we delineate the application of existing probiotics and then the microbiome in infectious diseases. Subsequently, we expand this concept to encompass host microbiome crosstalk and present related microbiome therapeutics' current status and direction. Ultimately, the review presents a fresh perspective on understanding microbiome therapeutics in infectious diseases based on a cooperative defense system.

β-apopicropodophyllin (APP), a derivative of podophyllotoxin (PPT), has been identified as a potential anti-cancer drug. This study tested whether APP acts as an an-ti-cancer drug and can sensitize colorectal cancer (CRC) cells to radiation treatment. APP had an anti-cancer effect against the CRC cell lines HCT116, and DLD-1, SW480 and COLO320DM with IC50 values of 7.88 nM, and 8.22 nM, 9.84 nM and 7.757 nM, respec-tively induction of DNA damage. Colonogenic and cell counting assays indicated that the combined treatment of APP and γ-ionizing radiation (IR) showed greater retardation of cell growth than either alone, suggesting that APP sensitizes CRC cells to IR. Annexin V-propidium iodide (PI) assays and immunoblot analysis showed that the combined treatment of APP and IR increased apoptosis in CRC cells compared with either APP or IR alone. Results obtained from the xenograft experiments also indicated that the combination of APP and IR enhanced apoptosis in in vivo animal model. Apoptosis induction by the combined treatment of APP and IR resulted from reactive oxygen species (ROS). Inhibition of ROS by N-acetylcysteine (NAC) restored cell viability and decreased the induction of apoptosis by APP and IR in CRC cells. Taken together, these results indicate that a combined treatment of APP and IR might promote apoptosis by inducing ROS in CRC cells.

Osteoporosis, often linked to increased osteoclast activity due to menopause or aging, was the focus. In this study, the inhibitory effects of Salicornia europaea L. (SE) water extract of desalted SE (WSE) were investigated on osteoclast differentiation and bone loss in ovariectomized mice. The findings revealed that WSE effectively inhibited RANKL-induced osteoclast differentiation, as evidenced by TRAP staining, and also suppressed bone resorption and F-actin ring formation in a dose-dependent manner. Gene expressions related to osteoclast differentiation, including NFATc1, TRAP, cathepsin K, and DC-STAMP, were downregulated by WSE. Oral administration of WSE improved bone density and structural parameters in ovariectomized mice. Dicaffeoyl quinic acids (DCQAs) and saponins in WSE were detected, with 3,4-, 3,5-, and 4,5-DCQA isolated and identified. All tested DCQAs, including the aforementioned types, inhibited osteoclast differentiation, bone resorption, and the expression of osteoclast-related genes. Furthermore, WSE and DCQAs reduced ROS production mediated by RANKL. These results indicate the potential of WSE and its components, DCQA, as preventive or therapeutic agents against osteoporosis and related conditions.

Ovarian cancer poses a significant therapeutic challenge owing to the lack of specific targets for treatment. New treatment strategies are needed to improve patient outcomes and reduce the toxicity of existing therapies. This study aimed to investigate the synergistic effects of recombi-nant human apurinic/apyrimidinic endonuclease 1/redox factor 1 (rhAPE1/Ref-1) and aspirin on PEO14 and CAOV-3 ovarian cancer cells and human umbilical vein endothelial cells (HUVECs). Specifically, this study examined the mechanisms underlying the effect of rhAPE1/Ref-1 and as-pirin on cell death and the associated pathways. Cell viability was assessed using the MTT assay, and flow cytometry analysis and caspase-3/7 activity assays were conducted to determine apop-tosis. Western blotting was performed to evaluate the cleavage of poly(ADP-ribose) polymerase (PARP). Exposure to aspirin (3 mM) for 24 h did not affect cell viability in PEO14. Co-incubation of aspirin with rhAPE1/Ref-1 in PEO14 cells led to rhAPE1/Ref-1 acetylation and intracellular hyperacetylation. Co-treatment with aspirin (3 mM) and rhAPE1/Ref-1 induced a rhAPE1/Ref-1 concentration-dependent increase in cell death, particularly in PEO14 cells, as well as apoptosis, caspase-3/7 activation, and PARP cleavage. Furthermore, this combination treatment significantly increased paclitaxel-induced PEO14 cell death. Therefore, co-administration with rhAPE1/Ref-1 and aspirin is a potential strategy for ovarian cancer treatment.

The dynamic and surface manipulation of the M13 bacteriophage meeting application demands enable a pathway to design efficient applications with high selectivity and responsivity rate. Herein, we report the role of the M13 bacteriophage thin film layer deposited on an optical nanostructure involving gold nanoparticles/SiO2/Si and its influence on optical and geometrical properties. The thickness of the M13 phage layer was either controlled by varying the concentration or humidity exposure levels, and optical studies were conducted. We designed a standard and dynamic model based upon three-dimensional finite-difference time-domain (3D FDTD) simulations distinguishing the necessity of each model under variable conditions. As seen from the experiments, the origin of respective peak wavelength positions is addressed in detail with the help of simulations. The importance of the dynamic model was noted when humidity-based experiments were conducted. Inexpensive, multi-wavelength optical characteristics from a single structure, reproducibility, and reversible properties are significant advantages of involving M13 bacteriophage. We believe this work will provide fundamental insight into understanding and interpreting the geometrical and optical properties of the nanostructures involving M13 bacteriophage.

Background: Relatively little is known and inconclusive about social inequality in human papillomavirus (HPV) vaccination among teenagers in the United States. This study aims to investigate whether there is a social disparity in HPV vaccination among teenagers and if so, whether it can differ by the source of teen vaccination information (parental reports and provider records). 
Methods: We used the data from the 2019 National Immunization Survey-Teen (NIS-Teen; 42,668 teenagers, aged 13-17) including parental reported vaccination status. Among them, 18,877 teenagers had adequate provider reported vaccination records. Two socioeconomic status (SES) measures were used: mother’s education and annual family income. Multivariate logistic analyses were conducted. 
Results: False negatives of parental reports against provider records were more than two times higher (p < 0.001) in low SES teens than in high SES teens. In both SES measures, the proportion of HPV unvaccinated teenagers were lowest in the highest SES level in analyses with parental reports. However, it was the opposite in analyses with provider records. Interestingly, regardless of vaccination information source, the HPV unvaccinated rate was highest in the middle SES teens (>12 years, non-college graduates; and above poverty level, but not > $75K). 
Conclusion: A significant social inequality in HPV vaccination among teenagers exists in the United States. The pattern of social inequality in HPV vaccination can be distorted when only parent reported vaccination information is used.

Various therapeutic approaches have been developed for neglect. Many studies have demonstrated the effect of Digital therapeutics(DTx) on neglect. By contrast, only a few studies have reported on the effects of DTx on egocentric and allocentric neglect. In this article, seven studies on DTx of egocentric and allocentric neglect were reviewed. DTx, which was employed in these studies, could be classified as follows: 1) software adaptation in traditional treatment, 2) VR game using the head-mount display as treatment, and 3) development of new digital program like ReMoVES. In addition, more studies and effective results were reported on egocentric neglect than allocentric neglect. In future studies, each effect on egocentric and allocentric neglect should be identified in detail through the appropriate use of differential evaluation and long-term application of independent digital therapeutics.

Perilla frutense var. acuta (Lamiaceae) has been used to treat indigestion, asthma, and allergies in traditional medicine. In this study, luteolin 7-O-diglucuronide (1), apigenin 7-O-diglucuronide (2), and rosmarinic acid (3) were isolated from the leaves of P. frutescens var. acuta. Various approaches were performed to investigate the anti-inflammatory activity of the isolated compounds (1-3) and their working mechanisms. In silico docking simulation demonstrated that 1-3 would work as a PPAR-α/δ/γ agonist, and in vitro PPAR-α/δ/γ transcriptional assay showed that the Perilla extract and 3 increased PPAR-α luciferase activity [1.71 and 1.61 times of the control (PPAR-α + PPRE, p < 0.001)]. In the NF-κB luciferase assay, 1 suppressed NF-κB activity the most (56.83 % at 5 µM; 74.96 % at 10 µM; 79.86 % at 50 µM). In addition, 1 and 2 inhibited the mRNA expression of NF-κB target genes, including Il6, Mcp1, and Tnfa, at 50 µM, and 3 suppressed the genes at the mRNA level in a dose-dependent manner. We report that 1 and 2 exert anti-inflammatory effects through NF-κB inhibition, and PPAR-α/NF-κB signaling pathway is related to the anti-inflammatory activity of 3.

We propose that the high energy Cosmic Ray particles around the spectral turn-down commonly called the {\it knee} and up to the upturn, commonly called the {\it ankle}, mostly come from Blue Super Giant star explosions. At the upturn, i.e. the {\it ankle}, Cosmic Rays probably switch to another source class, most likely extragalactic sources. To show this we recently compiled a set of Radio Supernova data to list the magnetic field, shock speed and radius scale (Biermann et al. 2018) \cite{Biermann18}. Using particle acceleration theory at shocks, those numbers can be transformed into characteristic {\it knee} and {\it ankle} energies. Without adjusting any free parameters both of these observed energies are directly indicated by the supernova data. We now proceed to the next step in the argument, and use the Supernova Remnant data of the starburst galaxy M82. Assuming that they are Blue Supergiant star explosions, the shock will race to their outer edge with a magnetic field that follows ${B (r) \, r \, \sim \, const.}$. We argue that the shock runs through the entire magnetic plasma wind region at full speed all the way out to the wind-shell, which is of order parsec scale. The speed is observed to be $\sim \, 0.1 \, c$ at about ${10^{16} \, {\rm cm}}$ radius in the plasma wind. This demonstrates how Blue Supergiant star explosions can provide the Cosmic Ray particles across the {\it knee} and up to the {\it ankle} energy range. The data from the CREAM (Cosmic Ray Energetics and Mass Experiment) mission will test this cosmic ray concept which is reasonably well grounded in two independent radio supernova data sets. The next step in developing our understanding is to obtain accurate Cosmic Ray data near to the {\it knee}, and use unstable isotopes of Cosmic Ray nuclei at high energy to probe the "piston" driving the explosion. We plan to combine these data with the physics of the budding black hole which is probably forming in each of these stars to learn more.

The increasing prevalence of methicillin-resistant S. aureus (MRSA) in the dairy industry has become a fundamental concern. Endolysins are bacteriophage-derived peptidoglycan hydrolases that induce the rapid lysis of host bacteria. We investigated endolysin candidates with lytic activity against MRSA and evaluated the lytic activity of the endolysin candidate against S. aureus and MRSA. To identify endolysins, we used the following bioinformatic strategy: (1) retrieval of genetic information, (2) annotation, (3) selection of MRSA, (4) selection of endolysin candidates, and (5) evaluation of protein solubility. We then characterized the endolysin candidate under various conditions. Approximately 67% of S. aureus was detected as MRSA and a total of 114 putative endolysins were found. The 114 putative endolysins were divided into three groups based on their combination of conserved domains. Considering the protein solubility, we selected putative endolysins 177 and 117. Putative endolysin 117 was successfully overexpressed and renamed LyJH1892. LyJH1892 lysed approximately 85% of S. aureus. LyJH1892 showed more potent lytic activity against MRSA than normal S. aureus (relative lytic activity &gt; 125%). LyJH1892 showed broad lytic activity against coagulase-negative Staphylococci (CNS). In conclusion, These findings provide a rapid and useful strategy for the development of specific endolysins against antibiotic-resistant bacterial strains.

A detection system, modeled in a graph, uses "detectors" on a subset of vertices to uniquely identify an "intruder" at any vertex. We consider two types of detection systems: open-locating-dominating (OLD) sets and identifying codes (ICs). An OLD set gives each vertex a unique, non-empty open neighborhood of detectors, while an IC provides a unique, non-empty closed neighborhood of detectors. We explore their fault-tolerant variants: redundant OLD (RED:OLD) sets and redundant ICs (RED:ICs), which ensure that removing/disabling at most one detector guarantees the properties of OLD sets and ICs, respectively. This paper focuses on constructing optimal RED:OLD sets and RED:ICs on the infinite king's grid, and presents the proof for the bounds on their minimum densities; [3/10, 1/3] for RED:OLD sets and [3/11, 1/3] for RED:ICs.

While previous research has shown the use of attachable air-caps on windows to efficiently reduce a building’s energy consumption, the air-caps considered had to be attached to the entire window’s surface, thus limiting the occupants’ view and creating the inconvenience of needing to detach and attach the air-caps. In this study, a window-mounted air-cap roller module using Velcro tape that may be easily attached, detached, and rolled up or down was developed and performance tested in a full-scale test bed. It was found that as the area of the air-caps attached on a window increased, the required indoor lighting energy increased. However, the window insulation improved, thus reducing the cooling and heating energy needed. Attaching the air-caps to the entire window surface effectively reduced the building’s energy consumption, but views through the window may be disturbed. Thus, the developed window-mounted air-caps enable an occupant to reduce the building energy consumption and maintain their view according to their need. The findings of this study may contribute to a reduction in building energy consumption without sacrificing a pleasant indoor environment. Further studies may be needed to verify their efficacy under varying indoor and outdoor conditions.

In this paper, our goal is to establish the relationship between solutions of local sharp vector variational type inequality and sharp efficient solutions of vector optimization problems, also Minty local sharp vector variational type inequality and sharp efficient solutions of vector optimization problems, under generalized approximate $\eta$-convexity conditions for locally Lipschitzian functions

BRAF is one of the most frequently mutated oncogenes, with an overall frequency of about 50%. Targeting BRAF and its effector mitogen-activated protein kinase kinase 1/2 (MEK1/2) is now a key therapeutic strategy for BRAF-mutant tumors, and therapies based on dual BRAF/MEK inhibition showed significant efficacy in a broad spectrum of BRAF tumors. Nonetheless, BRAF/MEK inhibition therapy is not always effective for BRAF tumor suppression, and significant challenges remain to improve its clinical outcomes. First, certain BRAF tumors have an intrinsic ability to rapidly adapt to the presence of BRAF and MEK1/2 inhibitors by bypassing drug effects via rewired signaling, metabolic, and regulatory networks. Second, almost all tumors initially responsive to BRAF and MEK1/2 inhibitors eventually acquire therapy resistance via an additional genetic or epigenetic alteration(s). Overcoming these challenges requires identifying the molecular mechanism underlying tumor cell resistance to BRAF and MEK inhibitors and analyzing their specificity in different BRAF tumors. This review aims to update this information.

The geometry of Poincare disk itself is interpreted without any mapping to dierent spaces. Our approach might be one of the shortest and is intended for educational contribution.

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation &lt; 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

In this study, a novel flexible ethanol gas sensor was created by the deposition of CoFe2O4 (CFO) thin film was on a thin mica substrate using pulsed laser deposition. Transition electron microscopy (TEM) investigations clearly demonstrated the successful growth of CFO on the mica, where a well-defined interface was observed. Ethanol gas-sensing studies showed optimal performance at 200 °C, with the highest response, 19.2, to 100 ppm ethanol. Operating the sensor in self-heating mode under 7 V applied voltage, which was corresponds to a temperature of approximately 200 °C, produced a maximal response to ethanol of 19.2. This aligned with the highest responses observed during testing at 200 °C, confirming the sensor’s accuracy and sensitivity to ethanol under self-heating conditions. In addition, the sensor exhibited good selectivity to ethanol and excellent flexibility; maintaining its high performance after bending and tilting up to 5000 times. As this is the first report on flexible self-heated CFO gas sensors, we believe that this research holds great promise for the future development of high-quality sensors based on this approach.

The chelating aluminum complex [2-(Me2NCH2)C2B10H10]AlX2 (X = Br 3, CH3 4) was synthesized using 2-dimethylaminomethyl-o-carboranyl lithium (2) with aluminum tribromide or dimethylaluminum bromide, resulting in a modest yield. Compound 4 was obtained by reacting compound 3 with CH3Li in toluene. All compounds were characterized by infrared (IR) spectroscopy, 1H, 11B, 13C nuclear magnetic resonance (NMR) spectroscopy, and X-ray crystallography. X-ray structural studies of CabNAlBr2 (3) and CabNAlMe2 (4) indicated that the Al atom was located at the center of a distorted tetrahedron. Crystal structures of the CabNAlBr2 (3) [a = 8.9360(3) Å, b = 12.0358(9) Å, c = 14.7730(4) Å, α = β = γ = 90°] and the CabNAlMe2 (4) [a = 8.9551(3) Å, b = 11.9126(9) Å, c = 14.7711(4) Å, α = β = γ = 90°] were obtained. The reactivity of aluminum complexes 3 and 4 with Lewis bases, such as H2O, pyridine, alkylamines, and arylamines, confirmed their rapid decomposition.

Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power wasted for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power conversion efficiency (PCE) of 90.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding PCE of 74.6%. The result shows that the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.

The study of the effect of corporate entrepreneurship(CE) which is a key indicator of success in corporate innovation performance(IP) is a central research topic. However, an empirical study on whether various types of government support(GS) have a moderating effect between these two variables is of new interest. This study empirically analyzed the effects of CE on IP and analyzed the indirect effects of GS on CE and IP based on 4000 Korean manufacturing firms. The results showed that all five factors of CE (innovativeness, risk-taking, proactiveness, autonomy, and competitive aggressiveness) had a positive effect on IP. In addition, the moderating effect of GS on the relationship between CE and IP was validated in seven categories: taxation, subsidies, financial support, human resources, technology, certification, and procurement. The results showed that five types of GS, other than financial support and technical support, strengthened the effect of CE on IP. This study provides a basis for establishing a strategy for strengthening organizational entrepreneurship and for selecting and focusing on various types of GS. It can be concluded that for more effective government support policies, direct government financial support or technical support should be more elaborately implemented.

Metal oxide based electrodes play a crucial role in various as a transparent conductive oxide (TCO). One of the metal oxides, nickel oxide is a promising electrical conductive material. Here, we display that incorporation of vanadium in NiO lattice significantly improve both electrical conductivity and hole extraction. Also, vanadium doped nickel oxide exhibits a lower crystalline size compared to pristine nickel oxide, which maintains the reduction of surface roughness. These results indicating that the vanadium is an excellent dopant for NiO.

The conventional well placement was done manually by using a numerical reservoir simulator, and it required a lengthy trial-and-error process. It required great experience and expertise to manipulate the variables and uncertainties that lie on the reservoir to determine the best placement of the well. In addition, the traditional gradient-based methods such as Line-search and Trust-region were not viable in terms of maximum results obtained. Gradient-based methods were too dependent on the surface gradient of the solution and may only converge to local optima instead of global optima. Complex reservoirs have rough surfaces with high uncertainties, which hinders the traditional gradient-based method from converging to global optima. Thus, genetic algorithms were utilized to automate the manual trial-and-error process and to overcome the limitations of the traditional gradient-based method. The objectives of this study were to analyse the effect of different initial well placement distributions, the number of random solution sizes, and the crossover rate on cumulative oil production. A synthetic reservoir model built using CMG Builder was used as the testing platform for the optimization problems. Well-placement parameterization and optimization set-up were carried out using the CMG CMOST optimization tool. The integration of CMG IMEX and CMOST optimized cumulative oil production based on the objectives of the study. The results obtained showed that the higher number of random solutions used resulted in higher cumulative oil production, with more generations needed to reach the optimum solution. It can be concluded that the larger number of random solutions used increased the probability of reaching the optimum solution, but will take more generations.

Background: Patients with burn scars often suffer from a ‘vicious cycle’ in which their skin becomes dry and pruritus. This greatly reduces patients' quality of life, but there is no well-known mechanism yet, and the development of drugs for effective treatment is necessary. Objective: This study evaluated the efficacy and safety of cosmetic formulation containing arginine glutamate ion pair (named as RE:pair) on epidermal barrier function and reducing pruritus. Materials and Methods: A total of 20 patients [15 male and 5 female; average age 48.35 ± 13.13 years] participated in evaluating the effectiveness of using the RE:pair formula topically twice daily for up to 4 weeks after burn pruritus. Treatment efficacy was evaluated by Numerical Rating Scale (NRS) for itching and pain, transepidermal water loss (TEWL), skin hydration, Vancouver Scar Scale (VSS) evaluation, and the patient’s overall satisfaction. Results: This formula was well-tolerated, with significant relief of NRS for itching and pain score after 2nd weeks and 4th weeks of application (p &lt; 0.05). The itching score was high in some patients, and overall, it decreased significantly after 4 weeks compared to before application. Also, the personal pain score decreased after 4th weeks. Overall TEWL showed 35 % improvement after 4th week, and 52 % improvement was confirmed in arms and 19 % in legs. The overall improvement effect of skin hydration was also 45 % (p = 0.0012), and the improvement effect was 40 % (p = 0.0371) in areas including arms and 54 % (p = 0.0313) in areas including legs. All patient satisfactory evaluations were "excellent". Conclusions: RE:pair formula was safe and effective in improving skin barrier and itch relief, and if further studies are conducted, it can be used as an excellent topical treatment for post-burn scar that strengthens the skin barrier.

Manipulating autophagy is a promising strategy for treating cancer as several autophagy inhibitors shown to induce autophagic cell death. One of these, autophagonizer (APZ), induces apoptosis-independent cell death by binding an unknown target via an unknown mechanism. To identify APZ targets we used a label-free drug affinity responsive target stability (DARTS) approach with a liquid chromatography/tandem mass spectrometry (LC-MS/MS) readout. Of 35 protein interactors, we identified Hsp70 as a key target protein of unmodified APZ in autophagy. Either APZ treatment or Hsp70 inhibition attenuates integrity of lysosomes, which leads to autophagic cell death exhibiting an excellent synergism with a clinical drug, temozolomide, in vitro, in vivo, and orthotropic glioma xenograft model. These findings demonstrate the potential of APZ to induce autophagic cell death and its development to combinational chemotherapeutic agent for glioma treatment. Collectively, our study demonstrated that APZ, a new autophagy inhibitor, can be used as a potent antitumor drug candidate to get over unassailable glioma and revealed a novel function of Hsp70 in lysosomal integrity regulation of autophagy.

During the high-speed flight of a vehicle in the atmosphere, surface friction with the air generates aerodynamic heating. The aerodynamic heating phenomenon can create extremely high temperatures near the surface. These high temperatures impact material properties and the structure of the aircraft, so thermal deformation measurement is essential in aerospace engineering. This paper revisits high-temperature deformation measurement using the digital image correlation (DIC) technique under high-intensity blackbody radiation with a precise speckle pattern fabrication and a heat haze reduction method. The effect of speckle pattern on the DIC measurement has been thoroughly studied at room temperature, but high-temperature measurement studies have not reported such effects so far. We found that the commonly used methods to reduce the heat haze effect could produce incorrect results. Hence, we propose a new method to mitigate heat haze effects. An infrared radiation heater was employed to make an experimental setup that could heat a specimen up to 950 ℃. First, we mitigated image saturation using a short-wavelength bandpass filter with blue light illumination, a standard procedure for high-temperature DIC deformation measurement. Second, we studied how to determine the proper size of the speckle pattern under a high-temperature environment. Third, we devised a reduction method for the heat haze effect. As proof of the effectiveness of our developed experimental method, we successfully measured the deformation of stainless steel 304 specimens from 25 ℃ to 800 ℃. The results confirmed that this method can be applied to the research and development of thermal protection systems in the aerospace field.

Detection of formaldehyde is very important in terms of life protection, as it can cause serious injury to eyes, skin, mouth and gastrointestinal function if indirectly inhaled and hence researchers are putting effort in developing novel and sensitive device. In this work, we have fabricated an electro-chemical sensor in the form of a field effect transistor (FET) to detect formaldehyde over wide range (10 nM to 1 mM). For this, ZnO nanosheets (NS) were first synthesized by hydrothermal method with in-situ deposition on cleaned SiO₂ coated Si (100) substrate. The synthesized materials were characterized for morphology and purity and surface area (31.718 m²/g). The developed device was tested for formaldehyde detection at room temperature that resulted in a linear response with concentration (96%), sensitivity value of 0.27 mA/M/cm² and a low detection limit of 210 nM, and a high 0.93194 return.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The development of technology that combines supercapacitors and lithium-ion batteries by externally connecting them in parallel is ongoing. This study examines the correlation between the volume ratio and electrical characteristics of a cell made by internally connecting a battery capacitor with Li4Ti5O12 as the anode active material and a supercapacitor in parallel. It was found that increasing the volume occupied by the battery capacitor in the cell led to increased cell energy and resistance, resulting in decreased output characteristics. Conversely, increasing the volume occupied by the supercapacitor in the cell led to a decrease in the IR drop during discharge and cell temperature when evaluating cycle characteristics with a current of 20C. The study also examined the behavior of the current distributed during the charging and discharging process based on the volume ratio of the supercapacitor and the battery capacitor. Analyzing the correlation between the volume ratio and electrical characteristics of supercapacitors and battery capacitors could potentially lead to the development of a new type of energy storage device.

The order Mucorales, the largest in number of species within the Mucoromycotina, comprises typically fast-growing saprotrophic fungi. During a study of the fungal diversity of undiscovered taxa in Korea, two novel mucoralean strains, CNUFC-GWD3-9 and CNUFC-EGF1-4, were isolated from specific habitats including freshwater and fecal samples, respectively, in Korea. On the basis of their morphological characteristics and sequence analyses of internal transcribed spacer (ITS) and large subunit (LSU) of 28S ribosomal DNA regions, the CNUFC-GWD3-9 and CNUFC-EGF1-4 isolates were confirmed to be Gilbertella persicaria and Pilobolus crystallinus, respectively. It is ecologically, pathologically and mycologically significant to find such rare zygomycetous fungi in such specific habitats.

Hashimoto’s thyroiditis (HT) is a common autoimmune disease, with its prevalence rapidly increasing. Both genetic and environmental risk factors contribute to the development of HT. Recently, viral infection has been suggested to act as a trigger of HT by eliciting the host immune response and subsequent autoreactivity. We analyzed features of HT through bioinformatics analysis so as to identify markers of HT development. We accessed public microarray data of HT patients from the Gene Expression Omnibus (GEO) and obtained differentially expressed genes (DEGs) under HT. Gene Ontology (GO) and KEGG pathway enrichment analyses were performed for functional clustering of our protein-protein interaction (PPI) network. Utilizing ranked gene lists, we performed Gene Set Enrichment Analysis (GSEA) using the clusterprofiler R package. By comparing the expression signatures of the huge perturbation database with the queried rank-ordered gene list, connectivity map (CMap) analysis was performed to screen potential therapeutic targets and agents. The gene expression profile of the HT group was in line with general characteristics of HT. Biological processes related to the immune response and viral infection pathways were obtained for the upregulated DEGs. GSEA results revealed activation of autoimmune disease-related pathways and several viral infection pathways. Autoimmune disease and viral infection pathways were highly interconnected by common genes, while the HLA genes which are shared by both were significantly upregulated. CMap analysis suggested that perturbagens, including SRRM1, NLK, and CCDC92, have the potential to reverse the HT expression profile. Several lines of evidence suggested that viral infection and the host immune response are activated during HT. Viral infection is suspected to act as a key trigger of HT by causing autoimmunity. SRRM1, an alternative splicing factor, which responds to viral activity, might serve as potential marker of HT.

Rice production is a significant contributor to methane emissions, accounting for ap-proximately 11% of global anthropogenic emissions. However, methane emissions in rice fields could effectively be reduced by implementing proper management practices and careful cultivar selection. The impact of nitrogen fertilizers on methane emissions is mul-tifaceted, as these fertilizers enhance crop growth and influence the activity of me-thane-producing (methanogens) and methane-consuming microbes (methanotrophs), leading to complex outcomes in methane emissions. In this study, we used qPCR to quan-tify methanogens and methanotrophs using mcrA (methanogenesis-related gene) and pmoA (methane oxidation-related gene) primer sets under different nitrogen levels (0, 50, and 100%) and rice varieties. The results revealed that higher nitrogen input led to higher methanogen inhabitation in the rhizosphere. Additionally, the abundances of methano-gens and methanotrophs varied among the different rice varieties. Furthermore, it was observed that there may be an additive effect between the rice variety and nitrogen level used. These findings suggest that future breeding efforts should involve screening for me-thane-related microbes in rice cultivars adapted to low-nitrogen conditions. By identifying and selecting rice varieties that promote lower methanogen levels and higher metha-notroph inhabitation, significant steps can be taken to mitigate greenhouse gas emissions from rice cultivation.

Abstract: Rice production is a significant contributor to methane emissions, accounting for approximately 11% of global anthropogenic emissions. However, there is potential for effectively reducing methane emissions from rice fields through the implementation of proper management practices and careful cultivar selection. The impact of nitrogen (N) fertilizers on methane (CH4) emissions is multifaceted, as these fertilizers not only en-hance crop growth but also influence the activity of methane-producing microbes (Meth-anogens) and methane-consuming microbes (Methanotrophs), leading to complex out-comes in CH4 emissions. In this study, we utilized qPCR to quantify methanogens and methanotrophs using mcrA (methanogenesis-related gene) and pmoA (methane oxida-tion-related gene) primer sets under different nitrogen levels (0, 50, 100%) and rice varie-ties. The results revealed that higher nitrogen inputs led to higher methanogen inhabita-tion in the rhizosphere. Additionally, the abundances of methanogens and metha-notrophs varied among different rice varieties. Furthermore, through the analysis of two-way ANOVA, it was observed that there may be an additive effect between rice variety and nitrogen level. Furthermore, enhancing agronomic traits related to yield can reduce methanogen inhabitation. These findings suggest that future breeding efforts should in-volve the screening of methane-related microbes in rice cultivars adapted to low nitrogen conditions. By identifying and selecting rice varieties that promote lower methanogen lev-els and higher methanotroph inhabitation, we can take significant steps towards mitigating greenhouse gas emissions from rice cultivation.

Climate change is increasing air temperatures and altering the precipitation and hydrological re-gime on a global scale. Challenges arise when assessing the impacts of climate change on the local scale for water resources management proposes, especially for low mountain headwater catch-ments that not only serve as important water towers for local communities, but also have distinct hydrological characteristics. Until now, no low flow or hydrological drought studies have been carried out on the Lauter River. This study is unique in that it compares the Lauter River, a transboundary Rhine tributary with a nearby station on the River Rhine just below its confluence at the French-German border. The Lauter catchment is a mostly natural, forested catchment, however, its water course has been influenced by past and present cultural activities. Climate change disturbances cascade through the hydrologic regime right down to the local scale. As we are expecting more low flow events, the decrease in water availability could cause conflicts be-tween different water user groups in the Lauter catchment. However, the choice of different methods for identifying low flow periods may cause confusion for local water resources manag-ers. Using flow rate time series of the Lauter River between 1956 and 2022 we compare for the first time three low flow identification methods: the variable threshold method (VT), the fixed threshold method (FT), and the Standardized Streamflow Index (SSI). Similar analyses are applied and compared to the adjacent Maxau station on the Rhine River for the same time period. This study aims at 1) interpreting the differences amongst the various low flow identification methods and 2) revealing the differences in low flow characteristics of the Lauter catchment compared to the Rhine River. It appears that the FT reacts faster to direct climate or anthropogenic impacts whereas VT is more sensitive to indirect factors such as decreasing subsurface flow which is typical for small headwater catchments, such as the Lauter where flow dynamics react faster to flow disturbances. Abnormally low flow during the early Spring in tributaries such as the Lauter can help predict low flow conditions of the Rhine River during the following half year and espe-cially for the summer. The results could facilitate Early Warning of hydrological droughts and drought management for water users in the Lauter catchment and further downstream along some of the Rhine.

This study was conducted to investigate the prevalence of Coxiella burnetii infection according to cattle breeds and growth types. A total of 491 cattle [cattle breed: 216 dairy cattle and 275 beef cattle; according to growth type: indoor housing (n = 294) and grazing (n = 197)] were tested for the presence of C. burnetii DNA and antibodies against C. burnetii using a commercial enzyme-linked immunosorbent assay (ELISA). Overall, 10.8% and 8.8% of the cattle were positive by PCR and for C. burnetii antibodies, respectively. The prevalence of C. burnetii was significantly higher in beef cattle than in dairy cattle using PCR (13.6% vs 7.4%; P = 0.032) and ELISA (14.6% vs 1.4%; P = 0.000), respectively. The overall infection rate of C. burnetii was significantly high in grazing cattle (PCR: 24.9%, ELSIA: 21.3%; P = 0.000) compared with housing cattle (PCR: 1.4%, ELISA: 0.3%). The results indicate that beef cattle have a significantly higher risk of contracting C. burnetii infection compared with dairy cattle (21.5% vs. 7.9%, χ2 = 5.82, P = 0.000, odds ratio = 3.197, 95% CI: 1.80-5.67). In addition, the infection of C. burnetii was significantly associated with grazing (P = 0.000). Moreover, a risk of contracting C. burnetii infection in grazing cattle was increased by 32.57-fold (95% CI: 12.84-82.60, P = 0.000) compared with indoor housed cattle. The phylogenetic analysis based on the IS111 gene revealed that our isolates were grouped together with humans, ticks, goats, and cattle isolates found in several countries. C. burnetii isolates circulating in the Republic of Korea exhibit genetic variations. Consequently, our results suggest that cattle are potential reservoirs for C. burnetii infection and most importantly, grazing acts as a high risk factor for the occurrence and transmission of this infection.

This study compared condylar volume, length, and articular eminence (AE) characteristics in normal individuals and those with unilateral and bilateral juvenile idiopathic osteoarthritis (JOA). The 116 patients were divided into four groups: control (n=16), affected condyle of unilateral JOA (Aff-Uni) (n=36), non-affected condyle of JOA (NonAff-uni) (n=36), and bilateral JOA (Bi-JOA) (n=28). Volume and length differences in the condyle and AE were analyzed using ANOVA and Bonferroni post hoc tests. The results showed that Bi-JOA had significantly different condylar volume, especially in the condylar head (p&lt;0.01), specifically the middle, anterior, and medial parts (p&lt;0.05). Condylar length also differed among the groups, with differences observed between the control group and the other three groups, as well as between the bilateral group and the other three groups (p&lt;0.01). AE total volume differed between the control group and Aff-Uni. In the detailed comparison, Aff-Uni and NonAff-Uni were smaller than the control group in the posterior, lateral, and medial sections (p&lt;0.05). In conclusion, depending on the involvement of unilateral or bilateral JOA, there were differences in condylar volume and AE compared to the normal control group. Therefore, prognosis should be evaluated by distinguishing between patients with unilateral and bilateral JOA.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Numerous structures at the nano- and microscale manifest distinctive properties with far-reaching implications across diverse fields, including electronics, electricity, medicine, and surface engi-neering. Established methods such as nanoimprint lithography, photolithography, and self-assembly play crucial roles in the fabrication of nano- and microstructures; however, they exhibit limitations in generating high-aspect-ratio structures when utilizing high-viscosity pho-tocurable resins. In response to this inherent challenge, we propose a highly cost-effective ap-proach facilitating the direct replication of high-aspect-ratio structures, specifically nanowires, through the utilization of anodized aluminum substrates. This study elucidates the streamlined fabrication process for multiscale porous surfaces achieved through the evaporation-induced in-tegration of solid nanowires printed with high-viscosity photocurable resin.

Erlotinib inhibits epithelial growth factor receptor (EGFR) kinase activity and is used to treat non-small cell lung cancer (NSCLC). Despite its high efficacy, recurrence can occur in patients who become resistant to the drug. To address the underlying mechanism of Erlotinib resistance, we investigated additional mechanisms related to mode-of-drug-action, by multiple protein-binding interactions, besides EGFR by using drug affinity responsive target stability (DARTS) and liquid chromatography-mass spectrometry (LC-MS/MS) methods with non-labeled Erlotinib. DNA polymerase alpha subunit B (POLA2) was identified as a new Erlotinib binding protein that was validated by the DARTS platform, complemented with cellular thermal shift assays. Genetic knock-down of POLA2 promoted the anti-proliferative effect of the drug in the Erlotinib-resistant cell line H1299 with high POLA2 expression, whereas overexpression of POLA2 restored anti-proliferative effects in the Erlotinib-sensitive cell line HCC827 with low POLA2 expression. Importantly, POLA2 expression levels in four NSCLC cell lines were positively correlated with anti-proliferative Erlotinib efficacy, verified by bio-statistical analysis (Pearson correlation coefficient, R=0.9886). These results suggest that POLA2 is a novel complementary target protein of Erlotinib, and could clinically provide validity as a surrogate marker for drug resistance in patients with NSCLC.

Cisplatin induces early-onset ototoxicity, resulting in hearing loss. The exact mechanism by which cisplatin causes ototoxicity remains unclear. The purpose of this study was to identify the involvement of receptor-interacting protein kinase(RIP)3-dependent necroptosis in cisplatin-induced ototoxicity in animal models. Sprague–Dawley rats (SD, 8 week) were treated via intraperitoneal (i.p) injection with cisplatin (16 mg/kg for 1 day), and their hearing thresholds were was measured by the auditory brainstem response (ABR) method. Hematoxylin and eosin (H-E) staining, immunohistochemistry, and western blots were performed to determine the effect of cisplatin-induced ototoxicity on cochlear morphology. H-E stains outlined necroptotic changes in the organ of Cortis (OCs) and spiral ganglion neurons (SGNs). Additionally, immunohistochemistry and western blot analysis showed overexpression of RIP3 in the OCs and SGNs that were treated with cisplatin. These results suggest that RIP3-dependent necroptosis was substantial in cisplatin-induced ototoxicity; inner cochlear regions, the OCs, and SGNs were especially sensitive to necroptosis.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

On October 18, 2017, Chinese President Xi Jinping presented the blueprint for building a modernized socialist nation through the realization of the Xiao Kang (Every nation enjoys a peaceful and affluent life, it is meaningless to eliminate the poor) social construction at the 19th Congress of China. Subsequent to the 2008 financial crisis, the world has moved on to the new economic status of the New Normal. China has also entered the era of “Xinchang Thai,” which is moving from the high-growth to the moderate-growth phase. Therefore, the government of China emphasizes privatization, liberalization, and deregulation. China is also influenced by government policies due to the nature of socialism. This study confirms China’s current stage of economic development based on Barro’s theory. Thus, we use a quantile regression model and examine the correlation between economic growth and functional classification of government expenditure during Xi Jinping's term of office. Furthermore, we selected Korea as a comparative country as the two countries have common features.

Clinical trials for Alzheimer’s disease (AD) face multiple challenges, such as the high screen failure rate and even allocation of heterogeneous participants. Artificial intelligence (AI), which has become a potent tool of modern science with the expansion in the volume, variety, and velocity of biological data, offers promising potential to address these issues in AD clinical trials. In this review, we introduce the current status of AD clinical trials and topic of machine learning. Then, a comprehensive review is focused on the potential applications of AI in the steps of AD clinical trials, including the prediction of AD biomarkers and differential diagnosis of AD in the prescreen during eligibility assessment and the likelihood stratification of patients who will progress to AD dementia and fast cognitive decline group from the slow decline group in randomization. Finally, this review provides challenges, developments and the future outlook on the integration of AI into AD clinical trials.

Hydrogen energy is regarded as an auspicious future substitute to replace fossil fuels, because of its environmentally friendly characteristics and high energy density. In the pursuit of clean hydrogen production, there has been a significant focus on the advancement of effective electrocatalysts for the process of water splitting. Although noble metals like Pt, Ru, Pd and Ir are superb electrocatalysts for the hydrogen evolution reaction (HER), they have limitations for large-scale applications, mainly high cost and low abundance. As a result, non-precious transition metals have emerged as promising candidates to replace their more expensive counterparts in various applications. This review focuses on recently developed transition metal phosphides (TMPs) electrocatalysts for the HER in alkaline media due to the cooperative effect between the phosphorus and transition metals. Finally, we discuss the challenges of TMPs for HER.

Among the electrochemical energy storage (EES) technologies, rechargeable batteries (RBs) and supercapacitors (SCs) are the two most desired candidates for powering a range of electrical and electronic devices. The RB operates on Faradaic processes, whereas the underlying mechanisms of the SC vary as non-Faradaic in the electrical double layer capacitors (EDLCs), Faradaic at the surface of the electrodes in the pseudo capacitors (PCs), and a combination of both non-Faradaic and Faradaic in the hybrid capacitors. The EDLCs offer high power density but low energy density. The hybrid capacitors take advantage of the Faradaic process without compromising their capacitive nature. Unlike batteries, supercapacitors provide high power density and numerous charge-discharge cycles; however, their energy density lags that of batteries. Here, we review recently published critically selected articles on supercapatteries, a generic term that refers to EES devices that can combine the merits of EDLCs and RBs. Also discussed are the properties, design strategies, and future perspectives of supercapatteries.

To identify gender- and age-related associations between adult dental checkups and unmet dental care needs, we analyzed data of 14,000 participants, ages ≥ 19, from the 7th Korea National Health and Nutrition Examination Survey (2016–2018) (KNHANES VII). Data was collected via self-report questionnaires and interviews. Complex sample chi-square test and multiple logistic regression analysis indicated 31.7% of participants had unmet dental care needs; in the prior 12months, 67.1% had not utilized dental services, and 43.3% had not received dental checkups. Odds ratios (ORs) for dental checkups and unmet dental needs were 8.87 (CI:7.80–10.09, p < 0.001) for those who used dental services and 1.28 (CI: 1.13–1.44, p < 0.001) for those who had not. Significant age-dependent associations between those not receiving dental checkups and the rate of unmet dental care include men and women aged 50–59 years (OR: 1.77; CI = 1.22–2.58 and OR: 1.43; CI: 1.02–2.02; p = 0.040, respectively) and women ≥ 70 years (OR = 1.79, CI = 1.20–2.66, p = 0.004). Reducing unmet dental care needs requires greater public health promotion and education regarding regular dental checkups; additional practical strategies could enhance dental checkup compliance.

The aim of this work was to classify the business incubators in Spain according to the four phases of startups incubation. Taking into account that the graduation rate implies greater survival and business success of the incubated companies, they have been identified at each stage of the incubation (spread of entrepreneurship, pre-incubation, advanced incubation, and graduation). The activities that present higher impacts on the success of the incubated companies and the activities carried out by the incubator that have a greater relevance on the graduation of the companies have concretely been considered. Principal component (PC) cluster analysis have been applied. All the incubation variables were used simultaneously, reducing their number, and grouping them into factors, finally the cases were grouped according to these latent variables. Principal components analysis reduced dimensionality to 8 factors with a 74 % of explained variance. Factor 1 was positively related to pre-incubation variables, factor 2 was linked to training and collaboration variables within the entrepreneurship diffusion phase. Factor 3 called activity monitoring and control and was related to phase 3 or basic incubation variables. Clusters analysis facilitates the grouping of incubators into three clusters: Group 1 (16 % of the total), incubators with strong deficits in incubation phases 1, 2 and 3. They are small Business Incubators, often located in rural areas or cities and low graduation rate. Group 2 (30 %), business incubators with very high graduation rate, and strongly positive values in factor 1 and 2. Factor 3 although positive is susceptible to improvement. They are the largest incubators and usually located in industrial and technological parks. Group 3 (54 %) is the majority, with values close to cluster 2 and 3.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

(1) Background: The CEO message of hospital homepage contain various contents such as the hospital's future vision, promises with customers, upgraded services and public activities. The CEO’s message of the homepage includes non-financial information as well as financial information of corporates. Also, it provides useful information for not only company's goals and vision but also firm performance and strategies for the future. This study aims to investigate associations between CEO’s message of hospitals homepages and financial status. We used the balanced scorecard frame to analyze what content on the hospital's homepage is related to the hospital's various financial ratios. (2) Methods: We adopt a text mining method to extract significantly repeated keywords from the CEO’s message of hospital website. And we classify these keywords by a balanced scorecard frame. To examine the relationship between keywords of CEO’s message of the hospital homepage and hospital’s financial ratio, T-test is conducted for the difference in the TF-IDF (Term Frequency is Divided by Inverse Document Frequency) mean of the home page contents and its relationship with the views of the balanced scorecard framework. (3) Results: According to empirical results on 65 samples collected from local hospitals, there are some significant relationship between the qualitative content of the hospital's homepage and the quantitative financial ratio that indicates profitability, activity, leverage, liquidity, and transfer to essential business fund (EBF) income. (4) Conclusions: The introduction section of a homepage is most accessible to customers, containing the aims and ideals of hospitals and reflecting their values and visions [1]. In addition, in view of financial status, they can either emphasize financial strength or focus on other areas to mask weakness of financial information. This study reminds us of the importance of hospital website’s disclosure, and it can be inferred from the financial status of the hospital. It also highlights the need for harmonization between quantitative data, financial statements, and qualitative data, CEO’s messages. (5) Implications: To our best knowledge, this paper is the first research attempting to investigate the relation between text of hospital homepage and financial ratio of hospital through text mining technique and balanced scorecard frame. Hospitals take a crucial part in a country’s welfare and healthcare backbone industry. Nevertheless, in many countries, hospital organization sectors tend to remain a source of critical fiscal deficits due to its ineffective and sloppy management. We expect that the result of this paper can provide hospital managers to useful information.

Quantum amplitude estimation is a numerical integration technique and a candidate for the first operationally used quantum algorithm providing a quantum advantage in the NISQ era. Its main metric is the generated Fisher information per second, as it describes the accuracy of the numerical integration. The development of this metric can be coupled to the quantum volume of the used quantum processor with a phenomenological noise model. Since the increase of the quantum volume seems to follow an exponential pattern, insight in the integration power of quantum amplitude estimation for the upcoming years can be obtained. This shows that quantum amplitude estimation as a numerical integration technique will not provide an advantage for functions without significant improvements to the connectivity, reliability and speed of quantum processors. Beyond that, this method may be used the estimate the development of many more NISQ era algorithms.

Consumer products contain the chemical substances that threaten human health. The modeling methods and experimental methods have been used to estimate the inhalation exposure concentration by the consumer products. The model and measurement methods have the spatial property problem and time/cost consuming problem, respectively. For solving the problems due to the conventional methodology, this study performed the feasibility of applying CFD for evaluation of inhalation exposure by comparing the experiment results and the zero-dimensional results with CFD results. To calculate the aerosol concentration, the CFD was performed by combined the 3D Reynolds averaged Navier Stoke’s equation and discrete phased model using ANSYS FLUENT. As a result of comparing the three methodologies performed under the same simulation/experimental conditions, we found the zero-dimensional spray model shows approximately 5 times underestimated inhalation exposure concentration when compared with the CFD results and measurement results in near field. Also, the results of the measured concentration of aerosols at five locations and the CFD results at the same location were compared to show the possibility of evaluating inhalation exposure at various locations using CFD instead of experimental method. The CFD results according to measurement positions can predict rationally the measurement results with low error. In conclusion, in the field of exposure science, a guideline for exposure evaluation using CFD was found that complements the shortcomings of the conventional methodology, the zero-dimensional spray model and measurement method.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This paper investigates calendar anomalies, volatility patterns, and the best forecasting model for predicting volatility in the cryptocurrency market, focusing on ten prominent cryptocurrencies: Binance USD, Bitcoin, Binance Coin, Cardano, Dogecoin, Ethereum, Solana, Tether, USD Coin, and Ripple. Spanning from January 2016 to December 2023, the study utilizes sophisticated statistical models such as GARCH (p,q), EGARCH (p,q), and GJR-GARCH (p,q) to analyze precise changes in market dynamics and the impact of day-of-week fluctuations on cryptocurrency returns. Empirical evidence reveals significant findings regarding the persistence of volatility, positive and negative news effects on volatility, and day-of-week effects on cryptocurrency returns. Post-COVID-19, Sunday emerges as the least volatile day for cryptocurrencies, while Thursdays and Tuesdays exhibit greater volatility. Binance, Ethereum, Dogecoin, and Tether show anomalies where returns on Tuesday and Thursday significantly differed from those on other days of the week. Many other currencies, like the USD coin, Cardano, and Ripple, show anomalies only in the pre-COVID-19 period. The findings highlight the best forecast model for volatility for each top cryptocurrency, offering practical implications for investors, traders, regulators, and policymakers. These insights emphasize the importance of understanding and addressing calendar anomalies in the cryptocurrency market for informed decision-making, trading strategies, regulatory frameworks, and market stability.

The CRISPR/Cas9 gene editing system has enormous potential in the treatment of multiple genetic disorders. To fully harness this potential, it is essential to deliver CRISPR-Cas9 components safely and effectively into the nuclei of target cells. In this study, we tested the amphipathic cell-penetrating peptide LAH5, previously used for DNA delivery, to intracellularly deliver spCas9: sgRNA ribonucleoprotein (RNP) and RNP/single-stranded homology-directed repair (HDR) template. We discovered that the LAH5 peptide effectively formed nanocomplexes with both RNP and RNP/HDR cargo, and that these nanocomplexes were taken up by cells effectively. Peptide/RNP nanocomplexes were characterized for size and charge, and nanocomplexation with RNP and RNP/HDR cargo was demonstrated via an electrophoretic mobility shift assay. Various ratios of peptide/RNP nanocomplexes were functionally screened on fluorescent reporter cell lines for gene editing and HDR-mediated gene correction. Additionally, targeted gene editing of the CCR5 gene was demonstrated in various cell lines. This LAH5-based delivery strategy paves the way for the development of therapeutic delivery systems for CRISPR/Cas-based genomic engineering.