Compliant amplifying mechanisms are used widely in high-precision instruments driven by piezoelectric actuators, and the dynamic and static characteristics of these mechanisms are closely related to instrument performance. Although the majority of existing research has focused on analysis of their static characteristics, the dynamic characteristics of the mechanisms affect their response speeds directly. Therefore, this paper proposes a comprehensive theoretical model of compliant amplifying mechanisms based on the multi-body system transfer matrix method to analyze the dynamic and static characteristics of these mechanisms. The effects of the main amplifying mechanism parameters on the displacement amplification ratio and the resonance frequency are analyzed comprehensively using the control variable method. An iterative optimization algorithm is also used to obtain specific parameters that meet the design requirements. Finally, simulation analyses and experimental verification tests are performed. The results indicate the feasibility of using the proposed theoretical compliant amplifying mechanism model to describe the mechanism’s dynamic and static characteristics, which represents a significant contribution to the design and optimization of compliant amplifying mechanisms.

This paper studies the maximum reliability of multi-hop relay UAV, in which UAV provides wireless services for remote users without direct communication link on the ground as a coded cooperative relay. In this paper, the analytical expressions of total power loss and total bit error rate are derived as reliability measures. Firstly, based on the environmental statistical parameters, a LOS probability model is proposed. Then the problem of minimizing the bit error rate of static and mobile UAVs is studied. The goal is to minimize the total bit error rate by jointly optimizing the height, elevation, power and path loss, and subject to the maximum allowable path loss con-straints, transmission power allocation constraints and UAV height and elevation constraints. At the same time the total path loss is minimized to achieve maximum ground communication cov-erage. However, the formulated joint optimization problem is non-convex and generally difficult to solve. Therefore, we decomposed the problem into two subproblems and proposed an effective joint optimization iteration algorithm. Finally, the simulation results are given, and the analysis shows that the optimal height of different reliability measures is slightly different, and using the mobility of UAVs can improve the reliability of communication performance.

The response of boreal vegetation to global warming has shown a weakening trend over the last three decades. However, in previous studies, models of vegetation activity responses to temperature change have often only considered changes in mean daily temperature (Tmean), with the diurnal temperature range (DTR) being neglected. The goal of this study is to evaluate the temporal trends of the relationships between two temperature factors (Tmean and DTR) and vegetation activity across the boreal regions on both annual and seasonal timescales, by simultaneously employing satellite and climate datasets. We found that the interannual partial correlation between growing season (GS) NDVI and Tmean (RNDVI−Tmean) showed a significant decreasing trend over the last 34 years. At the seasonal scale, RNDVI−Tmean shows a significant upward trend in the spring, while in the summer and autumn, RNDVI−Tmean exhibits a significant downward trend. The temporal trend characteristics of the partial correlation between NDVI and DTR (RNDVI−DTR), at both the GS and seasonal scales, are fully consistent with RNDVI−Tmean. The area with a significant decrease in GS RNDVI−Tmean and RNDVI−DTR accounted for approximately 44.40% and 41.21% of the boreal region with the 17-year moving window, respectively. In stark contrast, the area exhibiting a significant increasing trend in GS RNDVI−Tmean and RNDVI−DTR accounted for only approximately 14.65% and 13.59% of the boreal region with the 17-year moving window, respectively. With respect to the seasonal patterns of RNDVI−Tmean and RNDVI−DTR, the area with a significant upward trend in spring was greater than that with a significant downward trend. Nevertheless, more areas had a significant downward trend of RNDVI−Tmean and RNDVI−DTR in summer and autumn than had a significant upward trend. Overall, our research reveals a weakening trend in the impact of temperature on vegetation activity in the boreal regions, and contributes to a deeper understanding of the vegetation response to global warming.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

Lignin is insoluble in water, limiting its use in the synthesis of adhesives. Therefore, in order to increase the amount of lignin raw materials used in the synthesis of adhesives, a kind of aminated lignin compounds was prepared through lignin amination reaction, and conducting structural analysis in this paper. The particle size of the amino lignin is about 100 nm, with the weight average molecular weight of 57,627 g/mol and a water solubility of 0.45g/100ml. The reaction mechanisms were proposed that the phenolic hydroxyl groups of lignin react with ammonia molecules, and thereby successfully introducing amino groups to generate the aminated lignin compounds. Therefore, this article enriches the scientific theory of lignin reactions and provides reference for the widespread application of lignin raw materials in the field of adhesives.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

Two major sample configurations are adopted in all the instruments for fabric hand measurement, flat sample as in KES and FAST types machines, and wrinkled sample as in PhabrOmeter. This paper compares the two sample types to examine which one if any offers a better coverage and reflection of the fabric sensory attributes. Fabrics have unique behaviors of drape, wrinkle and tactile sense which are entirely due to the simultaneous occurrence of both in-plane membrane deformation and out-of-plane bending deformation in multiple curvature. Such singular deformation mode cannot be detected by any machines using flat sample, whereas during a PhabrOmeter test, the fabric sample genuinely produces drape, wrinkle in addition to other related deformations. This paper then introduced the theoretical research pertaining to the measurement. Then a split sample experiment is conducted to demonstrate the importance of the internal connections in fabric during drape and wrinkle processes. As such fabric interconnection will be barely disclosed during tests using flat samples, another important advantage of PhabrOmeter is hence clearly shown.

The hydrodynamic behavior of the air-acetic acid system in a bubble column is studied using a differential pressure transmitter, double probe optical fiber probe, and the electrical resistance tomography (ERT) technique. The superficial gas velocity ranges from 0.016 to 0.094 m/s under ambient temperature and pressure. The influences of viscosity and surface tension on gas holdup, bubble rising velocity, and bubble chord distribution in the column are discussed with different mass fractions of an acetic acid solution. The results show that as the mass fraction of acetic acid increases, the surface tension of the liquid phase decreases, and the viscosity first increases and then decreases. This causes the gas holdup in the column to first increase and then decrease, and reaches the maximum value at an acetic acid mass fraction of 55% to 60%. The rising velocity of the bubbles in the column is high in the central region and has a low-value distribution near the wall. The bubble chord length distribution is concentrated, and the distribution of the bubble chord length in the column becomes narrow with any decrease in surface tension. Studying the hydrodynamic behavior of a bubble column with the air-acid system is of great significance considering the absence of data on air-organic acid systems.

Abstract: Laryngoscopy for tracheal intubation has been developed for many decades. Among various conventional laryngoscopes, videolaryngoscopes (VL) have been applied in different patient populations, including difficult airways. The safety and effectiveness of VL have been repeatedly studied in both normal and difficult airways. The superiority of VL then has been observed and is advocated as the standard of care. In contrast to laryngoscopy, the development of video-assisted intubating stylet (VS, also named as styletubation) has been noticed two dec-ades ago. Since then, sporadic clinical experiences of use have appeared in literature. In this re-view article, we presented our vast use experiences of the styletubation (more than 55,000 pa-tients since 2016). We found this technique is swift (the time to intubate: from 3 s to 10 s), smooth (first-attempt success rate: 100%), safe (no airway complications), and easy (high subjective satis-faction and fast learning curve for the novice trainees) in both normal and difficult airway sce-narios. We therefore propose styletubation technique can be feasibly applied as universal rou-tine use for tracheal intubation.

Abstract: Toxicity of emerging organic pollutants to photosystems of aquatic plants are still not well clarified. This study aimed to develop a novel ecotoxicological experimental protocol based on nanoscale electrochemical mapping of photosynthetic oxygen evolution of aquatic plants by SECM (scanning electrochemical microscopy). The protocol was also checked by confocal laser scanning microscopy (CLSM), the traditional Clark oxygen electrode method and chlorophyll fluorescence technique. The typical persistent organic pollutant 2,4-dichlorophenol (2,4-DCP) in water environment and the common aquatic Microsorium pteropus (M. pteropus) were chosen as the model organic pollutant and tested plant, respectively. It was found that the SECM method could well discriminated the responses of stoma micromorphology and spatial pattens of photosynthetic oxygen evolution on single stoma. The shape of stoma blurred with increasing 2,4-DCP concentration, which was in good agreement with the CLSM images. The dose-response curves and IC50 values obtained from the SECM data were verified by the data measured by the traditional Clark oxygen electrode method and chlorophyll fluorescence test. The IC50 value of single stoma oxygen emission of 24 h exposed plant leave, which was derived from the SECM current data (32535 μg L-1), was close to those calculated from the maximum photosynthetic efficiency (Fv/Fm) measured by chlorophyll fluorescence test (33963 μg L-1), and the Clark oxygen electrode method photosynthetic oxygen evolution rate (32375 μg L-1). The 72 h and 96 h 2,4-DCP exposure data further confirmed the reliability of the nanoscale stoma oxygen emission mapping methodology for ecotoxicological assessment. In this protocol, the procedures for how to collect effective electrochemical data and how to extract useful information from the single stoma oxygen emission pattern were well established. This study showed that SECM is a feasible and reliable ecotoxicological tool for evaluation of toxicity of organic pollutants to higher plants with unique nanoscale visualization advantage over the conventional methods.

3,4-Dihydroquinolin-2(1H)-ones represent a class of valuable bioactive compounds with six-membered nitrogen-containing heterocyclic structures. The development of simple, mild and efficient synthetic methods has been widely concerned by synthetic chemists. In this review, we have summarized a series of different synthetic strategies for the synthesis of dihydroquinoline-2(1H)-ones via catalytic annulation of α,β-unsaturated N-arylamides in the past decade, including covering electrophilic cyclization, radical initiated cyclization and photochemical cyclization reactions. Besides, the substrate scope and mechanistic details are also discussed. This paper will provide a useful reference for the development of diverse synthesis methodologies of 3,4-dihydroquinolin-2(1H)-ones.

With the deepening of the diversification and openness of financial system, financial vulnerability, as an endogenous attribute of financial system, becomes an important measurement of financial security. Based on network analysis, we introduce network curvature indicator improved by Copula entropy as an innovative metric of financial vulnerability. Compared with previous network curvature analysis method, CE-based curvature proposed in this paper can measure market vulnerability and systematic risk with significant advantages.

Earth observation satellites can capture images of specific areas in Earth's orbit based on user requirements. Despite the high demand for satellite imagery, satellites remain a scarce resource. When there are many observation tasks that are large and dense, they may interfere with each other due to satellite mobility. To address this issue, a multi-satellite scheduling algorithm based on a task merging mechanism has been proposed. This paper proposes a two-stage approach to the problem: task merging phase and merging task scheduling phase. The task merging phase introduces two methods based on Mean Shift and Complete Graph to generate the merging task set. In the merging task scheduling phase, a multi-satellite scheduling algorithm based on merging tasks is employed to solve the problem. Finally, certain measurement experiments suggest the effectiveness of the algorithm.

Tuning fork gyroscopes (TFGs) are promising for potential high-precision applications. This work proposes and experimentally demonstrates a novel high-Q dual mass tuning fork microelectro-mechanical system (MEMS) gyroscope utilizing three-dimensional (3D) packaging techniques. Except for two symmetrically-decoupled proof masses (PM) with synchronization structures, a symmetrically-decoupled lever structure is designed to force the antiparallel, antiphase drive-mode motion and basically eliminate the low-frequency spurious modes. The thermoelastic damping (TED) and anchor loss are greatly reduced by the linearly-coupled, momentum- and torque-balanced antiphase sense mode. Besides, a novel 3D packaging technique is used to realize high Q-factors. A composite substrate encapsulation cap, fabricated by through-silicon-via (TSV) and glass-in-silicon (GIS) reflow processes, is anodically bonded to the sensing structures at wafer scales. A self-developed control circuit is adopted to realize loop control and characterize gyro-scope performances. It is shown that a high-reliability electrical connection together with a high-air-impermeability package can be fulfilled with this 3D packaging technique. Furthermore, the Q-factors of the drive and sense modes reach up to 51947 and 49249, respectively. This TFG realizes a wide measurement range of ±1800° /s and a high resolution of 0.1° /s with a scale-factor nonlinearity 720 ppm after automatic mode-matching. Besides, the long-term zero-rate output (ZRO) drift can be effectively suppressed by temperature compensation, inducing a small angle random walk (ARW) of 0.923°/√h and a low bias instability (BI) of 9.270°/h.

With the development of designing and manufacturing level for micro-electromechanical system (MEMS) gyroscopes, the control circuit system becomes a key point to determine their internal performances. Nevertheless, phase delay of electron components may result in some serious hazards. This paper describes a real-time circuit phase delay correction system for MEMS vibratory gyroscopes. A detailed theoretical analysis is provided to clarify the influences of circuit phase delay on the in-phase and quadrature (IQ) coupling characteristics and zero rate output (ZRO) utilizing force-to-rebalance (FTR) closed-loop detection and quadrature correction system. By deducing the relationship between amplitude-frequency, phase-frequency of MEMS gyroscope and the phase relationship of the whole control loop, a real-time correction system is proposed to automatically adjust the phase reference value of phase-locked loop (PLL) and thus compensate for the real-time circuit phase delay. The experimental results show that the correction system can accurately measure and compensate the circuit phase delay in real time. Furthermore, the unwanted IQ coupling can be eliminated and the ZRO is decreased by 755% to 0.095°/s. This correction system realizes a small angle random walk of 0.978°/√h, and a low bias instability of 9.458°/h together with a scale factor nonlinearity of 255 ppm at room temperature. Besides, the thermal drift of ZRO is reduced to 0.0034°/s/°C at a temperature range from -20°C to 70°C.

Sensory evaluation has been widely applied in assessing the quality of many consumer products that directly serve human needs such as food, beverages, clothing, etc. This paper first examined the inherent deficiencies in this approach, due mainly to the essentially subjective nature of human sensory preference. It then argued that instinctively designating certain materials attributes as sensory perceptions is unnecessary; considering every scientific concept is in essence the processed results of our sensory organs/brains, i.e., all quantities were initially human perceptions. Scientific advances have inevitably generated gradual transformation of such human perceptions as warmth and heaviness into objective parameters measurable in physical quantities like temperature and kilograms. Then using existing successful examples, it demonstrated firmly how the sensory attributes can be assessed by more reliable instrumental methods, and envisioned the key steps to turning a perception into scientifically measurable parameter(s).

Cloth wearing seems so natural that everyone is self-deemed knowledgeable and has some expert opinions about it. However to clearly explain the physics involved, and hence to make predictions for clothing design or selection, turns out as demonstrated below to be quite challenging even for experts. Cloth is a multiphased, porous and anisotropic material system and usually in multilayers. Unlike ordinary engineering heat transfer problems, the human body acts as an internal heat source in a clothing situation, thus forming a temperature gradient between body and ambient, and the sign of this gradient often changes as the ambient temperature varies. Our body also perspires and the sweat evaporates, an effective body cooling process via phase change. To bring all the variables into analysis quickly escalates into a formidable task. This work attempts to unravel the problem from a physics perspective, focusing on several rarely noticed yet critically important mechanisms involved so as to offer a clear and accurate depiction of the principles in clothing thermal comfort.

With increasing availability of alternative mobility options for city transportation system, it is necessary to better understand how emerging mobility are impacting the travel demand and consumer-social surplus. However, few study has been conducted to evaluate the social welfare effects of the range of vacant trip in mobility oriented development(MOD) mode. This paper identified the vacant trip and loading rate evaluation model under mobility oriented development mode. recommended solutions to enhance the effective operation of the different mobility services under numerical illustrations, which can offer some beneficial guidance and theoretic basis to the efficiency of MOD in planning and management aspects.

Formation avoidance is one of the critical technologies for autonomous underwater vehicle (AUV) formations. To this end, a cooperative obstacle avoidance algorithm based on an improved artificial potential field and a consistency protocol is proposed in this paper. A cooperative obstacle avoidance algorithm based on the improved artificial potential field method and consistency protocol is proposed for the local obstacle avoidance problem of AUV formation. Firstly, for the disadvantage that the traditional artificial potential field method is easy to fall into local minima, an auxiliary potential field perpendicular to the AUV moving direction is designed to solve the problem that AUVs are easy to have zero combined force in the potential field and local minima. Secondly, the control law of AUV formation that keeps the speed and position consistent is designed for the problem that the formation will change during the local obstacle avoidance of the formation system. The control conflict problem of the combined algorithm of the artificial potential field law and the consistency protocol is solved by adjusting the desired formation of the consistency protocol through the potential field force. Finally, the bounded energy function demonstrates system convergence's stability. The simulation verification confirmed that the AUV formation could achieve the convergence of the formation state under local obstacle avoidance.

Management of chronic inflammation and wounds has always been a key issue in the pharmaceutical and healthcare sector. Curcumin (CCM) is an active ingredient extracted from turmeric rhizomes that has antioxidant, anti-inflammatory, and antibacterial activities, thus showing significant effectiveness toward wound healing. However, its shortcomings such as poor water solubility, poor chemical stability and fast metabolic rate limit its bioavailability and long-term use. In this context, hydrogels appear to be a versatile matrix for carrying and stabilizing drugs due to the biomimetic structure, soft porous microarchitecture, and pleasant biomechanical properties. The drug loading/releasing efficiencies can also be controlled by use of highly crystalline and porous metal organic frameworks (MOFs). Here, a flexible hydrogel composed of sodium alginate (SA) matrix and CCM-loaded MOFs was constructed for long-term drug release and antibacterial activity. The morphology and physicochemical properties of composite hydrogels were analyzed by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), ultraviolet visible spectroscopy (UV-Vis), Raman spectroscopy and mechanical property tests. The results showed that the composite hydrogel was highly twistable and bendable to mechanically comply with human skin. The as-prepared hydrogel could capture efficient CCM for slow drug release as well as effective killing of bacteria. Therefore, such composite hydrogel is expected to provide a new management system for chronic wound dressings.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

COVID-19 virus has become a global threat to the human population and society. The virus which originated from China in December, 2019 has swept across continents in the world. Cameroon has been one of the countries with a high infectious rate in the recent period having a majority of the infectious cases in the Littoral region. Lack of awareness play a major role in the rise of COVID-19 cases. This paper examined the perceptions of the existence and spread of the COVID-19 virus in Wouri Division, Littoral Region of Cameroon. The study involved a qualitative survey designed by online questionnaires which were forwarded to the inhabitants of Wouri Division through e-mails and ‘WhatsApp’. The survey included the perception of the origin and existence of the COVID-19 virus, its mode of disease transmission, preventive and control measures. A total of 573 respondents were obtained (317 females and 256 males). From the results, although a greater proportion of the respondents showed knowledge towards the COVID- 19 virus existence, transmission and prevention that could lead to a reduction in the spread of the disease, our findings suggested that there’s more need for public sensitisation of the virus especially its method of transmission, control and prevention.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Persistent land subsidence or uplift can cause serious latent hazards to urban infrastructure. To thoroughly investigate the causes and impacts of land surface deformation, this study examines the case of Wuxi City, focusing on the land fluctuation patterns in the region following the enforcement of the groundwater abstraction prohibition policy in 2005. This research utilizes the PS-InSAR technique to quantify land surface deformations in the Wuxi region from November 2015 to June 2023 and analyzes 100 SAR images to obtain comprehensive spatiotemporal evolution data of the land surface. Furthermore, this study conducts an in-depth analysis of the effects of various factors, including groundwater, precipitation, and soil geology, on the characteristics of land surface deformation. It pioneers the application of the GARCH (Generalized Autoregressive Conditional Heteroskedasticity) model to analyze the time-series displacement in the study area and innovatively introduces the "amplitude factor" index to assess land surface fluctuations. This study investigates the recent land surface deformation patterns and mechanisms in Wuxi City. By integrating the "amplitude factor", it provides a scientific foundation for future urban development and disaster mitigation strategies in Wuxi City, offering valuable insights for related research.

The propagation of electromagnetic waves beyond the line of sight can be caused by atmospheric ducts, which are a significant concerns in the fields of radar and communication. This paper utilizes data from seven automatic stations and five radio-sounding stations to statistically analyze the characteristics of the atmospheric ducts in the northwest region of the South China Sea (SCS). After verifying the practicality of numerical analysis data from NCEP CFSv2 and ERA5 in studying atmospheric ducts using measured data, we analyzed the space-time distribution characteristics of the height of the regional evaporation duct and the bottom height of the elevated duct. Using the parabolic equation model, we simulated electromagnetic propagation loss under different frequencies and radiation elevation angles in both uniform and non-uniform duct environments within a typical atmospheric duct structure. The study found that the NCEP CFSv2 data accurately captures the evaporation duct height and duct occurrence rate in the study area, and the elevated duct bottom height obtained from the inversion of ERA5 and the measured data has a good consistency. The occurrence rate and height of evaporation duct in coastal stations in the northwest of the SCS vary significantly by month, demonstrating clear monthly distribution patterns. Conversely, changes in the Xisha station are minimal, indicating good temporal uniformity. For lower atmospheric ducts, the difference in occurrence rates between 00:00 and 12:00 (UTC) is negligible. The occurrence probability of elevated ducts in the Beibu Gulf area is relatively high, mainly concentrated from January to April, and the Xisha area is dominated by surface ducts without foundation layer, mainly concentrated from June to August. The monsoon plays a critical role in the generation and evolution of atmospheric ducts in the northwest of the SCS, with the height of the evaporation duct increasing and the bottom height of the elevated duct decreasing after the onset of the summer monsoon. Electromagnetic propagation simulations demonstrate that higher frequency and lower elevation angles of radiation sources in the trapping layer of the evaporation duct make it easier to be trapped. As the evaporation duct height decreases, the amplitude of the "sinusoidal fluctuation" of the propagation loss also decreases. Frequency changes of the radiation source in the surface duct environment have minimal impact on electromagnetic propagation loss, but the elevation angle of the radiation source is a critical factor. The frequency of the "sinusoidal fluctuation" in propagation loss is higher in a hybrid duct environment compared to a uniform surface duct. Additionally, the propagation loss increases faster with distance at the height of the evaporation duct, resulting in greater electromagnetic propagation loss.

Urbanization-induced land use transition results in a decline in ecosystem services, which has implications for regional ecological security. In order to explore the relationship between ecosystem services and land use transition, this paper utilizes the InVEST model, geographically weighted regression model to examine the impact of land use transition on ecosystem services in the Dongting Lake area (DLA). The results showed that (1) During the period 2000-2020, the intensity and motivation of land-use transition showed obvious spatial and temporal heterogeneity with the variation of urbanization development. (2) Habitat quality and Carbon sequestrations showed a downward trend. In contrast, food supply followed an upward trend; soil conservation and water yield services initially increased and dropped later. The overall spatial changes in habitat quality and Carbon sequestration appear to be insignificant. Food supply shows significant differences in the plains compared to other areas; while soil conservation and water yield service shows significant changes in places other than the DLA. (3) From 2000 to 2020, land use transition dynamics, population density, GDP density, night lighting and transition intensity had mainly negative effects on ecosystem services. Only the Normalized Vegetation Index (NDVI) showed a positive effect on ecosystem services. The results of the research will provide valuable references for the development and implementation of spatial ecological restoration planning and land use policies in the national territory.

With the rapid development of urbanization and industrialization in China, environmental issues have become a knotty problem, especially issues related to air, water, and solid-waste pollution. These pollutants pose threats to the health of the population and to that of communities and have a vicious influence on the healthcare system. Additionally, pollution also exhibits spill-over effects, which means that pollution in the local region could affect the healthcare services in a neighbouring region. Therefore, it is necessary to explore the relationship between pollution and healthcare. A spatial autocorrelation analysis was conducted and spatial panel econometric models were constructed to explore the characteristics of pollution and healthcare services in China and the relationship between them using data on all 31 provinces over twelve consecutive years (2006-2017). The results showed that the utilization of healthcare services and environmental pollution were not randomly distributed; unsurprisingly, air pollution and solid-waste pollution were mainly found in parts of northern China, while water pollution was highest in southern and coastal China. In addition, environmental pollution exhibited spill-over effects on healthcare services. For example, a 1% increase in solid waste in one specific geographical unit was estimated to increase the inpatient visits per capita in adjacent counties by 0.559%. Specifically, pollution showed different degrees of influence on healthcare services, which means that the impact of environmental pollution on the number of outpatient visits is greater than on the number of inpatient visits. Our results provide the government with evidence for effectively formulating and promulgating policies, especially policies aimed at tackling spill-over effects among different regions.

In recent years, many molecular and environmental factors have been studied to understand how synaptic plasticity is modulated. Sleep, as an evolutionary conserved biological function, has shown to be a critical player for the consolidation and filtering of synaptic circuitry underlying memory traces. Although sleep disturbances do not alter normal memory consolidation, they may reflect fundamental circuit malfunctions that can play a significant role in exacerbating diseases, such as autism and Alzheimer’s disease. Very recently, scientists sought to answer part of this enigma and they identified p75 neurotrophic receptor (p75NTR) as a critical player in mediating impairments in hippocampal-dependent associative plasticity upon sleep deprivation. This paper will review the role of the p75NTR, critically discuss the impact and implications of this research as the bridge for sleep research and neurological diseases.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Scanning electron microscopy (SEM) is a powerful tool in the domain of material science, mining, and geology, owing to its enormous potential to provide unique insights into the micro and nanoscale worlds. This comprehensive review discusses the background development of SEM, basic SEM operation including the specimen preparation and imaging process, and fundamental theoretical calculations underlying the SEM operation. It provides foundational understanding to the engineers and scientists, who never got a chance to dig in-depth into the SEM, to understand the working and development of this robust analytical technique. The present review covers how SEM has been serving as a crucial tool in mineral characterization, with specific discussions on the working and research fronts of SEM-EDX, SEM-AM, SEM-MLA, and QEMSCAN. With automation gaining pace in the development of all spheres of technology, the understanding of uncertainties in SEM measurements is very important. The constraints in mineral phase identification by EDS spectra and sample preparation are conferred. In the end, future research directions for SEM are analyzed with the possible incorporation of machine learning, deep learning, and artificial intelligence tools, for automating the process of mineral identification, quantification, and efficient communication with the researchers, so that the analytical process robustness and objectivity can be improved, and the analysis time and the involved costs can be brought down. This review also discusses the idea of integrating robotics with SEM, to make the equipment portable, so that further mineral characterization insights can be gained not only on earth but also on other terrestrial grounds.

Selective laser melting (SLM) is one of the widely used techniques in metallic additive manufacturing, in which high-density laser powder is utilized to selectively melting layers of powders to create geometrically complex parts. Temperature distribution and molten pool geometry directly determine the balling effect, and concentrated balling phenomenon significantly deteriorates surface integrity and mechanical properties of the part. Finite element models have been developed to predict temperature distribution and molten pool geometry, but they were computationally expensive. In this paper, the three-dimensional temperature distributions are predicted by analytical models using point moving heat source and semi-ellipsoidal moving source respectively. The molten pool dimensions under various process conditions are obtained from the three-dimensional temperature predictions and experimentally validated. Ti-6Al-4V alloy is chosen for the investigation. Good agreements between the predictions and the measurements are observed. The presented models are also suitable for other metallic materials in the SLM process.

Monitoring volatile organic compounds (VOCs) places a crucial role in environmental pollutants control and indoor air quality. In this study, a metal-oxide (MOx) sensor detector (used in a commercially available monitor) was employed to delineate the composition of air containing three common VOCs (ethanol, acetone and hexane) under various concentrations. Experiments with a single component and double components were conducted to investigate how the solvents interact with the metal oxide sensor. The experimental results revealed that the affinity between VOC and sensor was in the following order: acetone > ethanol > n-hexane. A mathematical model was developed, based on the experimental findings and data analysis, to convert the output resistance value of the sensor into concentration values, which in turn can be used to calculate a VOC-based air quality index. Empirical equations were established based on inferences of vapor composition versus resistance trends, and on an approach of using original and diluted air samples to generate two sets of resistance data per sample. The calibration of numerous model parameters allowed matching simulated curves to measured data. As such, the predictive mathematical model enabled quantifying not only the total concentration of sensed VOCs, but also estimating the VOC composition. This first attempt to obtain semi-quantitative data from a single MOx sensor, despite remaining selectivity challenges, is aimed at expanding the capability of mobile air pollutants monitoring devices.

In the face of pressing global challenges, coupling the synergy of dance arts, sustainability, and marketing communications emerges as a potent catalyst for advancing sustainable behavior within society. Although prior research has examined the emotional stimulations raised by dance performance, it has not systematically demonstrated the role of traditional dance as a vehicle for sustainability marketing communications. This study fills this gap by using the AIDA model (Attention, Interest, Desire, Action) as a foundation, conceptualizing dance performance elements into seven dimensions, and incorporating emotional engagement and environmental consciousness to foster sustainable behavior. Collaborating with Taiwanese dance troupe, the research produced a performance titled, ‘The New Dragon Palace Chronicle’, which focuses on the themes of destruction and preservation of underwater life, enriched with cultural and sustainability symbolism. The hypothesis were tested on a sample of 315 Taiwanese audience who watching the performance. The results confirmed that the seven dimensions of the dance elements have substantial validity and reliability, significantly drawing the attention of the audience as preliminary stage of awareness. This attention fosters emotional engagement and amplified environmental consciousness and significantly influences interest, desire, and ultimately, sustainable behavior action. The findings underscore the vital role of dance art performance in nurturing actions that contribute to social sustainability.

Suitable soil structure and nutrient security are important for plant growth and development, characteristics of soil fractal dimension and distribution of physical and chemical properties and their interactions play an important role in studying the stability of soil structure and water and fertilizer cycles. As a sustainable management model, intercropping has positive benefits for erosion control, spatial optimization of resources, as well as improving system productivity. The effects of four intercropping methods on soil fractal dimension and physicochemical properties were investigated by intercropping Salvia miltiorrhiza with forage and S. miltiorrhiza with forest under typical karst rock desertification habitats in Guizhou. The results showed that soil nutrient content of intercropping was significantly higher than that of monoculture, the organic carbon content of soil grown under forest is higher than other treatments, and there was a non-significant change in soil water content of intercropping compared with monoculture. The soil fine-grained matter of intercropping was significantly higher than that of monoculture, while the soil fractal dimension showed a tendency to become larger with the increase of fine-grained matter. The intercropping planting, due to its component types and spatial and temporal configurations, leads to differences in soil water and fertilizer interactions, which can be combined with other ecological restoration measures to optimize the composite model and jointly promote the restoration and development of ecologically fragile areas.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Colorectal cancer (CRC) patients experienced multiple chemotoxicity affecting treatment compliance, survival, and quality of life (QOL). Prior research shows clinician-reported chemotoxicity (i.e., grading scales or diagnostic codes) predicts rehospitalization and cancer survival. However, a comprehensive synthesis of clinician-reported chemotoxicity is still lacking. Objectives: We conducted a systematic review and meta-analysis to determine the chemotoxicity's prevalence and risk factors in CRC. Methods: A systematic search from 2009 to 2024 yielded 30 studies for review, with 25 included in the meta-analysis. Results: Pooled prevalences of overall, non-hematological, and hematological moderate-to-severe toxicities were 45.7%, 39.2%, and 25.3%, respectively. The most common clinician-reported chemotoxicities were gastrointestinal (GI) toxicity (22.9%) and neuropathy or neutropenia (17.9%). Significant risk factors at baseline were malnutritional status, frailty, impaired immune or hepato-renal functions, short telomere lengths, low gut lactobacillus levels, age, female sex, aggressive chemotherapy, and low QOL. Age was associated with neutropenia (β: -1.44) and GI toxicity (β:1.85) (Ps 65 y.o.) had higher prevalences of overall (OR: 1.14) and GI (OR: 1.65) toxicities, but a lower prevalence of neutropenia (OR: 0.65) than younger adults (Ps

Dengue hemorrhagic fever is an arboviral infectious disease that has occurred frequently as an extraordinary event due to its fast spread and lethal potential in Indonesia. The vector Aedes aegypti is sensitive to climate variability. This study determines the relationship between climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia from 2009 to 2017. This study used the monthly dengue hemorrhagic fever incidence obtained from the Surabaya Health Office and the monthly climate variability parameters (average temperature, rainfall, humidity) obtained from the Indonesian Agency for Meteorology, Climatology and Geophysics and website www.worldweatheronline.com. Data analysis was done using One-Sample Kolmogorov Smirnov Test and Spearman non-parametric correlation test. The results showed a correlation between all three climate variability parameters with dengue hemorrhagic fever incidence (average temperature p<0.05, r=-0.603; rainfall p<0.05, r=0.407; humidity p<0.05, r=0.7). Average temperature is negatively correlated to dengue hemorrhagic fever incidence, while rainfall and humidity are positively correlated to dengue hemorrhagic fever incidence. This study shows preliminary evidence on the correlation of climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia.

Dengue hemorrhagic fever is an arboviral infectious disease that has occurred frequently as an extraordinary event due to its fast spread and lethal potential in Indonesia. The vector Aedes aegypti is sensitive to climate variability. This study determines the relationship between climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia from 2009 to 2017. This study used the monthly dengue hemorrhagic fever incidence obtained from the Surabaya Health Office and the monthly climate variability parameters (average temperature, rainfall, humidity) obtained from the Indonesian Agency for Meteorology, Climatology and Geophysics and website www.worldweatheronline.com. Data analysis was done using One-Sample Kolmogorov Smirnov Test and Spearman non-parametric correlation test. The results showed a correlation between all three climate variability parameters with dengue hemorrhagic fever incidence (average temperature p<0.05, r=-0.603; rainfall p<0.05, r=0.407; humidity p<0.05, r=0.7). Average temperature is negatively correlated to dengue hemorrhagic fever incidence, while rainfall and humidity are positively correlated to dengue hemorrhagic fever incidence. This study shows preliminary evidence on the correlation of climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This paper uses the spatial analysis software GeoDa as a tool, takes GRP (Gross regional product) of Sichuan Province in 2012 and 2018 as the dependent variable, and takes the city (autonomous prefecture) factor-driven, investment-driven and innovation-driven indicators as the dependent variable to explore the impact of innovation activities on regional economic development and the spatial distribution characteristics of regional economy. Through the comparison of the global correlation and local correlation, this paper explores the crux of the regional economic polarization and unbalanced development, and puts forward some measures to solve the existing economic development problems, such as cultivating and improving the regional industrial dependence, accelerating the regional transportation accessibility and convenience, and constructing the regional collaborative innovation system, So as to achieve the strategic goal of the construction of innovative Province in Sichuan Province.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Tracked vehicles play a vital role in accessing challenging terrains, offering stability, traction, and versatility for various applications, including deep-sea exploration. However, the seafloor and sediment contain valuable but poorly understood resources, making it a significant challenge for tracked vehicles during exploration. Consequently, it is imperative to conduct comprehensive studies before considering these terrains for off-road purposes. In this study, we developed a rigid, flexible track vehicle equipped with various sensors, focusing on monitoring pressure sinkage. Cohesive soils like Bentonite and Diatom soil, particularly when combined with sand and gravel mixtures, were used for the investigation and assessed for ground pressure, bearing capacity, and sinkage in rigid-flexible tracked vehicles on these characterized terrains under varying moisture conditions. Our findings indicated that increased moisture content in bentonite soil resulted in significantly higher track slippage and sinkage compared to diatomaceous earth soil. Regarding soil behavior, diatom soil exhibited notable compaction and sinkage characteristics compared to bentonite soil. These significant variations between these two soil types under changing moisture conditions highlight the complexity of such terrains. Therefore, understanding the soil and its physical properties is crucial before applying them to natural terrains. Furthermore, this study emphasizes the importance of precision in assessing the physical properties of natural terrains for the development of tracked vehicles for off-road exploration. This knowledge contributes to better vehicle design and a deeper comprehension of terrain mechanics.

In the field of engineering, tracked vehicles play a significant role in accessing challenging terrains. Maintaining trafficability is of the utmost importance when it comes to tracked vehicles traversing rugged terrains; it provides stability, traction, and adaptability for a wide range of applications, including deep-sea exploration. The terrain characteristics pertain to the interactions that determine the mobility of tracked vehicles. Traditional Terramechanics models are in-adequate in depicting the correlation between tracks and soil. An important issue is the lack of consideration for the moisture content in the soil and the rate at which sinking occurs in these models. Examining sinkage speed helps describe the ability of tracked vehicles to move at high speeds. The focus is on the critical factors influencing the mobility of tracked vehicles, precisely the sinkage speed and its relationship with pressure. Experimental tests in a soil bin, utilizing Bentonite/Diatom sediment soil, aim to measure these terrain factors. The study introduces a rubber-tracked vehicle, pressure, and moisture sensors to monitor pressure sinkage and moisture, evaluating cohesive soils (Bentonite/Diatom) in combination with sand and gravel mixtures. Findings reveal that higher moisture content in Bentonite soil leads to increased track slippage and sinkage compared to Diatom soil. Regarding soil behavior, diatom soil exhibited notable compaction and sinkage characteristics in contrast to bentonite soil. The distinct behaviors of these soils underscore the complexity of terrains, emphasizing the need for a meticulous understanding of soil properties before applying them in natural environments. Furthermore, this study contributes precision in assessing natural terrains, enhancing tracked vehicle design, and advancing terrain mechanics comprehension for off-road exploration. This knowledge contributes to better vehicle design and a deeper comprehension of terrain mechanics.

In this work, a series of compounds in the CaO-½Er2O3-CoOz ternary oxide system were synthesized in air at 885℃ using high temperature solid-phase synthesis method. Phase boundary of each solid solution region in the CaO-½Er2O3-CoOz system was determined by X-ray powder diffraction technique. The phase diagram of the CaO-½Er2O3-CoOz system at 885℃ includes three series of ternary oxide solid solutions : (Ca3-xErx)Co4O9-z (0≤x≤0.9), (Ca3-xErx)Co2O6-z (0≤x≤1.25) and (Er1-xCax)CoO3-z (0≤x≤0.33). Four three-phase regions and five solid solution tie-line regions were obtained. The structure of perovskite solid solution (Ca3-xErx)Co2O6-z has been analyzed by Rietveld refinements. With the increase of Er content, the cell parameters of (Ca3-xErx)Co2O6-z exhibit an decreasing trend in a and b directions and an increasing trend in c direction.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In this paper, we propose a method for the generation of simulation test scenarios for autonomous driving. Based on the requirements of standard regulatory test scenarios, we can generate virtual simulation scenarios and functional scenario libraries for autonomous driving, which can be used for simulation verification of different ADAS functions. Firstly, the design operation domain (ODD) of the functional scenario is selected and the weight values of the ODD elements taken are calculated; then a combination test algorithm based on parameter weights is improved to generate autonomous driving virtual simulation test cases for the ODD elements, which can effectively reduce the number of generated test cases compared with the traditional combination test algorithm; then the traffic participant elements under each test case are Then, the values of the subelements under the traffic participant element in each test case are sampled and clustered to obtain hazard specific scenarios. Finally, the specific scenarios are applied to the automatic emergency braking (AEB) system on the model-in-the-loop (MIL) testbed to verify the effectiveness of this scenario generation method.

Rapid and accurate prediction of residual stress in metal additive manufacturing processes is of great importance to guarantee the quality of the fabricated part to be used in a mission-critical application in the aerospace and automotive industries. Experimentation and numerical modeling are valuable tools for measuring and predicting the residual stress; however, to-date conducting experimentation and numerical modeling is expensive and time-consuming. Thus, herein, a physics-based thermomechanical analytical model is proposed to predict the residual stress of the additively manufactured part rapidly and accurately. A moving point heat source approach is used to predict the temperature field by considering the effects of scan strategies, heat loss, and energy needed for solid-state phase transformation. Due to the high temperature gradient in this process, part experiences a high amount of thermal stress following solidification which may exceed the yield strength of the material. The thermal stress is obtained using Green’s function of stresses due to the point body load. The Johnson-Cook flow stress model is used to predict the yield surface of the part under repeated heating and cooling. As a result of the cyclic heating and cooling and the fact that the material is yielded, the residual stress build-up is predicted based on incremental plasticity and kinematic hardening behavior of the metal according to the property of volume invariance in plastic deformation in coupling with the equilibrium and compatibility conditions. The computational methodology is realized with the laser powder fusion of maraging steel 350 as a material of example. The validation of the predictive models has been presented in terms of the comparison of predicted and measured scan-direction and build-direction residual stress distributions along depth of build under various process parameter combinations. Moreover, for the first time, the Jonson-Cook parameters of maraging steel 350 are predicted using analytical modeling of machining forces and non-linear optimization techniques.

Current instrumental technology in evaluating performance of skin care creams is still rather limited and there are no industrial standard testing equipment, method and performance specifications for it. In this paper, we report our attempt in using an instrument called PhabrOmeter for this purpose. PhabrOmeter is a commercialized instrument for sensory performance evaluation of textiles, leather, paper and nonwoven and has been designated by American Association of Textile Chemists and Colorists (AATCC) as a standard test method for textiles, AATCC TM 202 in 2013. By adopting artificial skin samples treated with skin care creams, we have developed a procedure to apply this instrument for evaluation of skin care creams from sample preparation, measurement to data analysis and interpretation. The results using commercial skin care creams to demonstrate the feasibility and advantages of this instrument are provided.

It is demonstrated in this study that PhabrOmeter creates genuine wrinkle on fabrics comparable to that in AATCC specifications, and measures fabric wrinkle recovery values fast with repeatable and reliable results with high resolution, over wide range of fabric types. It thus provides an appealing alternative to the existing test methods that are known to be slow, insensitive and unreliable. In addition, with enormous varieties of fabrics, we used a new criterion termed fabric linear density λ so that fabrics can in general be divided into relatively homogeneous groups for further study. The calculation and application of this parameter are showed in this report.

With huge varieties of fabrics, the first challenge for any performance evaluation is to categorize the vast types of the products into fewer, more homogeneous and thus akin groups. Classification or sorting is arguably the first step of any scientific investigation, and comparison of product quality is meaningful only when conducted within a group of comparable products. A new criterion termed fabric linear density λ is first proposed in this paper so that fabrics can in general be divided into 4 groups. The derivation and validation of this parameter are provided. The importance of fabric drape is almost self-evident, but there is still no effective ways to measure this fabric attribute. The Cusick Drapemeter suffers from its low repeatability and low sensitivity, and is hence not widely or frequently used. The PhabrOmeter, along with the fabric linear density λ, is proposed and demonstrated in this study as a much more efficient alternative for fabric drape test. By actually testing 40 various fabrics, the principle, procedure and results of this method is presented in this paper.

The traditional receiver employs scalar tracking loops, resulting in degraded navigation performance in weak signal and high dynamic scenarios. An innovative design of a vector tracking receiver based on nonlinear Kalman filter (KF) tracking loops is proposed in this paper, which combines the strengths of both vector tracking and KF tracking loops. Firstly, a comprehensive description of the vector tracking receiver model is presented, and unscented Kalman filter (UKF) is applied to nonlinear tracking loop. Secondly, to enhance the stability and robustness of the KF tracking loop, we introduce square root filtering and an adaptive mechanism. The tracking loop based on square root UKF (SRUKF) can dynamically adjust its filtering parameters based on signal noise and feedback Doppler error. Finally, the proposed method is implemented on a software-defined receiver (SDR), and the field vehicle experiment demonstrates the superiority of this method over other receivers in complex dynamic environments.

This study aimed to identify miRNA editing sites during adipose tissue development in Ningxiang pigs and analyze their characteristics and functions. Based on the small RNA-seq data from subcutaneous adipose tissue samples of Ningxiang pigs at four stages (30, 90, 150 and 210 days), we constructed a developmental atlas of the miRNA editome in adipose tissue of Ningxiang pigs. The characteristics and functions of this editome were further explored through bioinformatics analysis. The findings revealed that a total of 505 miRNA editing sites were identified with C-to-U editing types being the most prevalent, followed by U-to-C, A-to-G and G-to-U. Importantly, these four types of miRNA editing exhibited a base preference. The number of editing sites showed obvious differences among age groups, with the highest occurrence of miRNA editing events observed at 90 days of age and the lowest at 150 days of age. In the miRNA seed region, a total of 9 miRNA editing sites were identified with significant differences in editing levels (P &lt; 0.05), and located in ssc-miR-23a, ssc-miR-27a, ssc-miR-30b-5p, ssc-miR-15a, ssc-miR-497, ssc-miR-15b, and ssc-miR-425-5p, respectively. Target gene prediction and enrichment analysis revealed that the editing of miR-497 may potentially regulate fat deposition by inhibiting adipose synthesis via influencing target binding. These results provide new insights into the regulatory mechanism of pig fat deposition.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

In this paper, an adaptive technology and the interconnection and damping assignment passivity-based control method are combined to solve the stabilization problem for underactuated mechanical systems with uncertainties (including matched and unmatched). Uncertainties include unknown friction coefficients and unknown terms in kinetic energy and potential energy. A novel adaptive interconnection and damping assignment passivity-based control scheme is proposed and an adaptive stabilization controller is designed to make the closed-loop system locally stable. Verification is conducted on the ball and beam system, taking into account uncertainties of friction coefficients, kinetic energy, and potential energy. The locally asymptotic stability is demonstrated using the LaSalle’s invariance principle and approximate linearization. The effectiveness of the proposed control law is verified through numerical simulations.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Few-shot object detection (FSOD) aims to address the challenge of requiring a substantial amount of annotations for training in conventional object detection, which is very labor-intensive. However, existing few-shot methods achieve high precision with the sacrifice of time-consuming for exhaustive fine-tuning, or take poor performance in novel-class adaptation. We presume the major reason is that the valuable correlation feature among different categories is insufficiently exploited, hindering the generalization of knowledge from base to novel categories for object detection. In this paper, we propose Few-Shot object detection via Correlation-RPN and Transformer Encoder-Decoder (CRTED), a novel training network to learn object-relevant features of inter-class correlation and intra-class compactness while suppressing object-agnostic features in the background with limited annotated samples. And we also introduce a 4-way tuple-contrast training strategy to positively activate the training progress of our object detector. Experiments over two few-shot benchmarks (Pascal VOC, MS-COCO) demonstrate that, our proposed CRTED without further fine-tuning can achieve comparable performance with current state-of-the-art fine-tuned works. The codes and pre-trained models will be released.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

To address the problems of insufficient semantic fusion between text and questions and the lack of consideration of global semantic information encountered in machine reading comprehension models, we proposed a machine reading comprehension model called BERT_hybrid based on BERT and hybrid attention mechanism. In this model, BERT is utilized to separately map the text and questions into the feature space. Through the integration of Bi-LSTM, attention mechanism, and self-attention mechanism, the proposed model achieves comprehensive semantic fusion between text and questions. The probabilities distribution of answers is computed using Softmax. Experimental results on the public dataset DuReader demonstrate that the proposed model achieves improvements in BLEU-4 and ROUGE-L scores compared to existing models. Furthermore, to validate the effectiveness of the proposed model design, we analyze the factors influencing the model’s performance.

The recent outbreak of coronavirus disease 2019 caused by the new coronavirus, SARS-CoV-2, has become an international emergency. Since there is no effective therapy for the treatment of this disease, drugs or vaccine that can prevent or cure the SARS-CoV-2 infection are urgently needed. The viral 3-chymotrypsin-like cysteine protease (3CLpro), which plays a key role in the replication of coronavirus, is a potential drug target for the development of anti-SARS-CoV-2 drugs. With the crystal structure of 3CLpro, we performed virtual screening from a small chemical library of a Traditional Chinese Medicine recipe- FuFang Zhenzhu Tiaozhi (FTZ). Five compounds with the best scores were screened and could be considered as potential hit compounds to be investigated further with bioassays for their anti-virus effects.

We have previously discussed the pathological characteristics, clinical characteristics, detection methods, pathogenesis, and treatment of Epstein–Barr virus (EBV)-positive gastric cancer, but we have not discussed the unique immune microenvironment in EBV-positive gastric cancer. Here, we reviewed studies on the immune microenvironment in EBV-positive gastric cancer and found that CD8+ T lymphocytes and a small number of CD204+ macrophages infiltrate the immune microenvironment in EBV-positive gastric cancer. Moreover, immune checkpoints, such as IDO1 and PD-L1, are expressed at high levels in EBV-positive gastric cancer. Lastly, we also analyzed the mechanisms underlying the formation of the immune microenvironment in EBV-positive gastric cancer. Our findings and conclusions have significance in clinical guidance and provide research direction for basic experiments.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Climate and its fluctuations have wide-ranging impacts on the tourism industry. High temperatures, as a typical meteorological and climatic factor, influence tourists' travel intentions and spatial behavior. This study conducted a descriptive analysis and market trend analysis of Chinese tourism during periods of high temperatures, revealing several key findings. Firstly, tourists seeking respite from summer heat exhibit a preference for short-distance trips and resource-rich destinations. Secondly, heat-escape tourism products undergo changes over time, gradually shifting towards mountainous areas and waterfront locations. Furthermore, taking Shanghai Disneyland as a case study demonstrates that the holiday system holds greater significance than temperature constraints. Despite experiencing a significant decline in the quality of their tourist experience in high-temperature environments, long-distance travelers are not deterred from choosing pre-booked tourism products by sudden bouts of hot weather.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The Internet's core network, crucial for key services, lacks a clear definition, hindering Internet development and security research. This study analyzes important Autonomous Systems (ASes) and proposes a rule-filtering, top-down method to infer the Internet's core network. It identifies two core memberships: Tier-1 ASes and Regional Tier-1 ASes. Despite a gap, Regional Tier-1 ASes show potential to join the core. Our proposed core structure, unlike traditional methods that randomly select TOP-K nodes, offers improved rationality and interpretability. Historical data analysis reveals the Internet's core structure as a tightly interconnected network of large provider ASes. Despite some changes, this structure shows remarkable stability and growing influence, potentially encouraging other ASes to establish direct connections with the core ASes, accelerating the trend towards a flattened Internet structure. Furthermore, the core structure may be evolving from a majority to a more minority-centric structure.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Electric heating and solid thermal storage system (EHSTSS) is widely used in district clean heating and the flexibility adjustment of combined heat and power (CHP) unit. It has been an effective way to absorb renewable energy. Aiming at the thermal design calculation and experimental verification of EHSTSS, the thermal calculation and the heat transfer characteristics of the EHSTSS are investigated in this paper. Firstly, a thermal calculation method for the EHSTSS is proposed in the paper. The calculation flow and calculation method for key parameters of heating system, heat storage system, heat exchange system and fan-circulating system in the EHSTSS are studied. Then, the instantaneous heat transfer characteristics of the thermal storage system (TSS) in the EHSTSS are analyzed, and the heat transfer process of ESS is simulated by FLUENT software. The uniform temperature distribution in the heat storage and release process of the TSS verifies the good heat transfer characteristics of the EHSTSS. Finally, EHSTSS test verification platform is built, and the historical operation data of the EHSTSS is analyzed. During the heating and release thermal process, the maximum temperature standard deviation of each temperature measurement point is 28.3℃ and 59℃respectively. The correctness of the thermal calculation of the EHSTSS is verified.

Immune checkpoint inhibitors (ICI) have been widely used in melanoma, but to identify melanoma patients with survival benefit from ICI is still a big challenge. There is an urgent need for prognostic signatures improving the prediction of immunotherapy responses of cancer patients. We used data from EMBL-EBI database and analyzed RNA-seq information and clinical profiles in melanoma. Weighted gene co-expression network analysis (WGCNA) was used to identify the key module, then nonnegative matrix factorization (NMF) was conducted to cluster patients into two different cluster and compared them regarding overall survival (OS) and progression-free survival (PFS). Subsequently, the differentially expressed genes (DEGs) between different clusters were identified, and their function and pathway annotation were performed. 91 melanoma biopsies with complete survival information were included in our analyses and we first identified the key module (magenta) by WGCNA, then identified nine prognostic lncRNAs (ENSG00000258869, ENSG00000179840, ENSG00000206344, ENSG00000226777, ENSG00000205018, ENSG00000204261, ENSG00000163597, ENSG00000197536, and ENSG00000263069) signature that predicted for OS and PFS in patients treated with ICI by NMF. Finally, enrichment analysis showed that the functions of DEGs between two consensus clusters were mainly related to the immune process and treatment. In summary, the nine lncRNAs signature is a novel effective predictor for OS and PFS in melanoma patients treated with ICI.

In this study, the preparation of the composite 3% Au/graphite-C3N4 (3% Au/g-C3N4) sensing material was prepared by doping 3% Au onto the surface of graphitic carbonitride (C3N4) for detection pimobendan. By the way of sensing materials characterization, the X-ray diffraction analysis (XRD) and transmission electron Microscope (TEM) were performed. The cyclic voltammetry (CV) was used to measure the concentration and redox properties of pimobendan. It can be seen that when the voltage value is 0.05 V, and a reduction peak was appeared and the pimobendan concentration (0 to 55 μM) has a relationship with the reduction current value. At low concentrations of pimobendan concentration from 0.0 to 0.8 μM, the linearity R2 = 0.9642 with a detection limit of 0.28 μM. A possible pimobendan sensing mechanism on 3% Au/g-C3N4 was proposed.

Civic engagement refers to the ways in which citizens participate in the life of a community to help shape its future or improve conditions for others. While it might have been shaped by the COVID-19 pandemic recovery, this study explored how college students perceive civic engagement on selected campuses that were partially locked down. We sampled 1036 student volunteers from six universities in Taiwan by using a self-designed module of civic engagement and transferable capabilities. The Student’s t-test, ANOVA, regression, factor analysis, and structural equation modeling (SEM) were used to interpret the differences and relationships among these variables. This study provides a more detailed example of the current status of civic engagement and its relative to transferable capabilities in a higher education setting. The related programs and institutes should take responsibility for enhancing students’ civic engagement and transferable capabilities during the pandemic. How to ameliorate the situation? The findings suggest that it should consider a student’s academic major, learning experiences in the department, and time spent on related activities during the pandemic recovery. The findings might prove useful to various campuses for enhancing ongoing practices.

To date, viral RNA detection is almost the only way to confirm SARS-CoV-2infectionin practice.However, variousreasons can cause low sensitivity for RNA detection, and thisposes aserious challenge to disease control. We tested the performance of detecting total antibody(Ab) and IgM levels in serum by the methods of chemiluminescence, enzyme-linked immunosorbent assay (ELISA), and colloidal golddetection. The datashowed that the sensitivity and specificity for detecting total Ab and IgM levels were high by all three methods, and the sensitivity was higher for detecting total Ab than for detecting IgM. Evidence from studieshas shown thatviral RNA testingcombinedwith serological testing could increase the diagnostic sensitivity while maintaining a high specificity. Specific serology testsfor SARS-CoV-2 havegreat value for clinical practice and public health.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

The latest emergence of a novel coronavirus (COVID-19) had caused an outbreak of respiratory virus infections in Wuhan, China, and other countries so that the world health organization (WHO) declared the COVID-19 epidemic as a Public Health Emergency of International Concern (PHEIC) on January 31, 2020. At present, it is the fact that we have identified the bats as the host, the route of respiratory droplets, contact, and aerosol can accelerate the transmission from person to person. However, it is not well known about the intermediator and other approaches. Identifying and characterizing the origin and host(s) of COVID-19 can help us to evaluate the potential risk of COVID-19 for transmission among humans or cross-species.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

The aim of our present study was to investigate the effects of Gln supplementation on liver inflammatory responses and protein synthesis and degradation in muscle of LPS-challenged broilers. A total of 120 1d-old male broilers (Arbor Acres Plus) were randomly arranged in a 2 × 2 factorial design with five replicates per treatment and six broilers per replicate, containing two main factors: immune challenge (injected with LPS in a dose of 0 or 500 µg/kg of body weight) and dietary treatments (supplemented with 1.22% alanine or 1% Gln). After feeding with alanine or Gln diet for 15 days, broilers were respectively administrated with LPS or saline injection at 16 and 21 d. The results showed that Gln supplementation significantly reversed the adverse effects of LPS administration on growth performance, as evidenced as the increased ADFI and ADG, as well as the lowered F/G. Furthermore, Gln supplementation alleviated the increased mRNA expression of interleukin-6, interleukin-1β and tumor necrosis factor-α in liver induced by LPS. Moreover, the increased activities of aspartate aminotransferase, combined with the decreased expression of glutaminase in muscle, were observed by Gln addition. In addition, in comparison with saline treatment, LPS challenge altered signaling molecules mRNA expressions associated with protein synthesis and degradation. However, Gln supplementation reversed the negative effects on protein synthesis and degradation in muscle of LPS-challenged broilers. Taken together, Gln supplementation had benefit effects on improving growth performance, alleviating inflammatory responses, promoting protein synthesis and inhibiting protein degradation of LPS-challenged broilers.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In numerical simulations, achieving high accuracy without significantly increasing computational costs is often challenging. To address this, this paper presents an improved finite volume weighted essentially non-oscillatory (WENO) scheme tailored for applicability in computational fluid dynamics (CFD) and implemented in the flow solver NUAA-Turbo for simulating turbomachinery flows using both RANS and RANS/LES coupling. Firstly, the new WENO scheme is validated against classic numerical test cases to assess its stability and reliability in handling discontinuities, the Double problem, and Raleigh-Taylor (RT) instability issues. Compared to the original format, this enhanced finite volume WENO scheme demonstrates superior stability near discontinuities and resolves flow features with the same grid resolution more effectively. Next, for engineering applications related to turbomachinery, such as compressor and turbine characteristics, computations are performed using RANS, and the results obtained using WENO-ZQ3 and WENO-JS3 are compared. Finally, the new fifth-order WENO scheme is applied to RANS/LES coupled simulations of turbine wakes and film cooling. The results show that the enhanced finite volume WENO scheme offers improved stability and accuracy in engineering applications, allowing for high-precision calculations with fewer grid points to capture more detailed flow physics, thereby reducing computational costs in aerodynamic applications.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

Melon pest management relies on the excessive application of pesticides. Reducing pesticide spraying has become a global issue for environmental sustainability and human health. Therefore, developing a new cropping system that is sustainable and eco-friendly is important. This study found that melon seedlings irrigated with ultrafine water containing H2 and O2 (UFW) produced more root hairs, increased shoot height, and produced more flowers than the control irrigated with reverse osmosis (RO) water. Surprisingly, we also discovered that UFW irrigation significantly reduced aphid infestation in melon. Based on cryo-scanning electron microscope (cryo-SEM) observations, UFW treatment enhanced trichome development and prevented aphid infestation. To investigate whether it was H2 or O2 that helped to deter insect infestation, we prepared UF water enrichment of H2 (UF+H2) and O2 (UF+O2) separately and irrigated melons. Cryo-SEM results indicated that both UF+H2 and UF+O2 can increase the density of trichomes in melon leaves and petioles. RT-qPCR showed that UF+H2 significantly increased the gene expression level of the trichome-related gene GLABRA2 (GL2). We planted melons in a plastic greenhouse and irrigated them with ultrafine water enrichment of hydrogen (UF+H2) and oxygen (UF+O2). The SPAD value, photosynthetic parameters, root weight, fruit weight, and fruit sweetness were all better than the control without ultrafine water irrigation. UFW significantly increased trichome development, enhanced insect resistance, and improved fruit traits. This system thus provides useful water management for pest control and sustainable agricultural production.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.