Objectives: Robotic bilateral axillary breast approach (BABA) thyroid surgery began in 2008 and is now one of the most widely used remote-access thyroid surgeries worldwide. This study aimed to analyze the results of 500 robotic BABA thyroid surgeries performed in a single institution in Korea compared with open thyroid surgery. Methods: From December 2018 to March 2020, 502 robotic BABA thyroidectomies (RTs) and 531 conventional open thyroidectomies (OTs) were performed in our institution by a single endocrine surgeon. We retrospectively reviewed patient medical records and performed a comparative analysis of OT and RT. Results: The RT group was younger (43.41±11.41 versus 54.28±13.41 years, p<0.001) and had a higher proportion of females (84.3% versus 69.3%, p<0.001), a lower BMI (24.66±3.97 versus 25.83±4.07 kg/m2), a higher proportion of lobectomies (52.6% versus 45.2%) and a lower proportion of lateral neck dissections (3.4% versus 10.0%, p<0.001). The RT group had a lnger operation time (145.33±40.80 versus 93.39±43.55 minutes, p<0.001) and higher surgical cost. Although the OT group had a larger tumor size and higher proportion of extrathyroidal extension, the numbers of retrieved lymph nodes were not significantly different between the two groups. Additionally, there was no difference in the stimulated thyroglobulin level before radioactive iodine therapy (7.01±35.73 versus 8.39±58.77, p=0.782). The rates of transient vocal cord palsy and transient hypoparathyroidism were significantly lower in the RT group, and those of scar-related complications were higher in the OT group. Conclusion: Robotic BABA thyroid surgery has advantages not only in better cosmetic outcomes but also in lower rates of vocal cord palsy and hypoparathyroidism, with comparable lymph node retrieval and serum thyroglobulin levels.

Cervical cancer, primarily caused by high-risk human papillomavirus (HR-HPV) types 16 and 18, is a major global health concern. Persistent HR-HPV infection can progress from reversible pre-cancerous lesions to invasive cervical cancer, which is driven by the oncogenic activity of human papillomavirus (HPV) genes, particularly E6 and E7. Traditional screening methods, including cytology and HPV testing, have limited sensitivity and specificity. This review explores the ap-plication of p16/Ki-67 dual-staining cytology for cervical cancer screening. This advanced im-munocytochemical method allows for simultaneously detecting p16 and Ki-67 proteins within cervical epithelial cells, offering a more specific approach for triaging HPV-positive women. Dual staining and traditional methods are compared, demonstrating their high sensitivity and negative predictive value but low specificity. The increased sensitivity of dual staining results in higher detection rates of CIN2+ lesions, which is crucial for preventing cervical cancer progression. However, its low specificity may lead to increased false-positive results and unnecessary biopsies. The implications of integrating dual staining into contemporary screening strategies, particularly considering the evolving landscape of HPV vaccination and changes in HPV genotype prevalence are also discussed. New guidelines and further research are necessary to elucidate the long-term effects of integrating dual staining into screening protocols.

Human Pose Estimation (HPE) is a technique in computer vision and AI for detecting and tracking human body parts and poses from images or videos. Widely used in augmented reality, animation, fitness applications, and surveillance, HPE methods using monocular cameras are highly versatile due to their applicability in standard video and CCTV footage. These methods have evolved from 2D to 3D pose estimation. However, current 3D HPE methods trained on laboratory-based motion capture data encounter challenges such as limited training data, depth perception ambiguity, left/right switching, and issues with occlusions when applied in real-world environments. This study compares two representative 3D HPE methods by assessing their strengths and weaknesses with real-world videos. Then, we propose data processing techniques to eliminate and correct anomalies like left/right inversion and false detections of joint positions in daily life motions. Finally, we obtain joint angle trajectories using an optimization method based on a 3D humanoid simulator, taking as input the joint coordinate data corrected by applying the proposed human joint data processing technique. The efficacy of the proposed 3D HPE method is verified by applying it to three-dimensional freehand gymnastics exercises and comparing the joint angle trajectories during the motion.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Hybrid fiber reinforced composites can be controlled by price, weight and various mechanical properties depending on fiber ratio and lamination method. Despite these excellent hybrid properties, there is a disadvantage that inter-laminar fracture due to external impact, which is the biggest weakness of fiber reinforced composite materials, is weak. The test specimens were prepared by using a vacuum bag method, which is manufactured by using an autoclave device. The pre-preg is manufactured in the form of a B-stage. In the process of fabricating the nanoparticle pre-preg, the homogeneizer using an ultrasonic wave was used to disperse the epoxy subject without the curing agent into nanoparticles. The dispersion of the nanoparticles was dispersed by the weight of the epoxy resin. This is to take into account the cohesion of HNT and to understand the range of cohesion of HNT in a matrix with viscosity and its phenomenon. According to the Comparison of the interlayer interfacial properties and mechanical properties of Aramid / Basalt fiber hybrid composites by HNT addition, the fracture toughness, ILSS and bending strength of specimens with HNT content of more than a certain level were decreased because of the aggregation of HNT.

Our previous studies demonstrated that quercetin (Q) could be ingested and metabolized by macrophages and exerted prophylactic immuno-stimulatory activity and therapeutic anti-inflammatory effects on lipopolysaccharide (LPS)-treated macrophages ex vivo. To further clarify its possible anti-inflammatory mechanism, Q was selected to treat mouse peritoneal macrophages that obtained from female BALB/c mice exposed to LPS i.p. for 12 h. Relative gene expression of pro-/anti-inflammatory (TNF-α/IL-10) cytokines and components of inflammation-related intracellular signaling pathways (TLR2, TLR4, NF-κB, JAK2 and STAT3) was analyzed using two-step reverse transcription (RT) and real-time quantitative polymerase chain reaction (qPCR). STAT3 protein phosphorylation was determined using an in-cell ELISA method. As a result, Q and its metabolite quercetin-3-O-β-D-glucuronide (Q3G) decreased TNF-α gene expression amounts and ratios of pro-/anti-inflammatory (TNF-α/IL-10) cytokine gene expressions, but increased IL-10 gene expression amounts in activated inflammatory macrophages, supporting a substantial anti-inflammatory potential of Q and Q3G treatments. However, Q3G had lower effects than those of Q. Importantly, Q inhibited TLR2 gene expression and phosphorylation of STAT3 protein in the inflamed cells. Our results are the first report to suggest that Q inhibits LPS-induced inflammation ex vivo through suppressing TLR2 gene expression and STAT3 protein phosphorylation in activated inflammatory macrophages. Q has potential to further apply for treating inflammation-associated diseases.

The wind observations for multiple levels (40–200 m) have been conducted for a long time (2016–2020) on Jeju Island of South Korea. This study aims at understanding the vertical and temporal characteristics of lower atmosphere. Jeju Island is a region located at mid-latitude and is affected by seasonal monsoon wind. The maximum wind speed appears in the lower layer during day time and is delayed in the upper layer during latter time in diurnal cycle. In summer season, the surface layer increases up to 160 m during day time via dominant solar radiation effect, which is higher than those for other seasons. However, the maximum wind speed in winter season appears irregularly among altitudes, and the surface layer is ~100 m, which is lower than that in summer season. It can be attributed to the increase in the mean wind speed in diurnal cycle caused by the strong northwestern wind for winter season. These results imply that the relationship between near-surface and higher altitudes is primarily affected by solar radiation and seasonal monsoon winds. These results are expected to contribute to site selection criteria for wind farms and to the assessment concerning planetary boundary layer modeling.

Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

This research was conducted to manufacture thermally expandable microspheres (TEMs) for vehicles’ underbody coating and to apply them on an industrial scale. TEMs heat resistance was studied depending on the ratios of a cross-linking agent and an initiator. This research focused on the content of a cross-linking agent and how it affected the results. The TEMs’ outer shell was thickened to solve the problem of the foam expansion ratio’s reduction that occurred due to the shrinkage after the maximum expansion (Tmax) was reached. After foaming, the cross-sectional thickness and surface of the sample with thickened outer shell were observed. The TEMs with the thickened shell showed the least shrinkage, which indicated excellent shrinkage stability, even after prolonged exposure to heat.

This research was conducted to manufacture thermally expandable microspheres (TEMs) for vehicles’ underbody coating and to apply them on an industrial scale. TEMs heat resistance was studied depending on the ratios of a cross-linking agent and an initiator. This research focused on the content of a cross-linking agent and how it affected the results. The TEMs’ outer shell was thickened to solve the problem of the foam expansion ratio’s reduction that occurred due to the shrinkage after the maximum expansion (Tmax) was reached. After foaming, the cross-sectional thickness and surface of the sample with thickened outer shell were observed. The TEMs with the thickened shell showed the least shrinkage, which indicated excellent shrinkage stability, even after prolonged exposure to heat.

In this study, to reduce the use of cement and sand, porous feldspar with excellent economic efficiency was used as a substitute in heat storage concrete layer. When cement was replaced with porous feldspar, the compressive strength was approximately 16%–63% higher compared with when cement was replaced with silicate minerals. To compensate for the reduction in strength owing to the decreased cement content, mechanical and chemical activation methods were employed. When the specific surface area of porous feldspar was increased, the unit weight was reduced by approximately 30% and the compressive strength was increased by up to 90%. When chemical activation was applied using a solidifying agent, the strength was increased by approximately 30% even though 70% of the cement content was replaced with porous feldspar. When cement and sand were replaced with porous feldspar, the compressive strength was approximately two times that of ordinary cement mortar. When the heat storage concrete layer material was replaced with porous feldspar in a pilot scale experiment, the thermal conductivity and heat storage characteristics were better than those of ordinary cement mortar, and an energy-saving effect of approximately 57% was observed, confirming the excellent applicability of porous feldspar as a building material.

The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

3D printing is a non-traditional additive manufacturing process. It is different from the traditional subtractive manufacturing process. It offers exceptional rapid prototyping capabilities and results that traditional subtractive manufacturing methods cannot attain, especially in applications involving curved or intricately shaped components. Despite its advantages, metal 3D printing will face porosity, warpage, and surface roughness issues. These issues will affect the future practical application of the parts indirectly, for example, the structural strength and the parts assembly ca-pability. Therefore, this study compares the qualities of the warpage, weight, and surface rough-ness after milling and grinding processes under the same materials (316L stainless steel) between general rolled steel and 3D additive steel. Experimental results show that 3D printing parts are approximately 13% to 14% lighter than the general rolled steel. The surface roughness performance of 3D printing steel is better than general rolled steel under the same material after milling or grinding processing. The hardness of the 3D printing steel is better than that of the gen-eral rolled steel. The research verifies that 3D additive manufacturing can use surface processing to optimize surface performance and achieve the functions of lightness and hardness.

Background: Inflammasomes recognize cytosolic danger signals, including pathogens, and subsequently induce the secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β. Studying inflammasomes in the red fox (Vulpes vulpes) is crucial from a wildlife veterinary and public health perspective, as it can be used to help control and prevent the transmission of zoonotic pathogens. The understanding of how diversity in inflammasomes across species affects pathogen carriage in the red fox is still limited. Methods: We investigated the activation and intracellular mechanisms of three inflammasomes (NLRP3, AIM2, and NLRC4) in fox peripheral blood mononuclear cells (PBMCs), using established triggers and inhibitors derived from humans and mice. Results: Fox PBMCs exhibited normal activation and induction of IL-1β secretion in response to representative inflammasome triggers (ATP and nigericin for NLRP3, dsDNA for AIM2, flagellin for NLRC4). However, in inhibitor studies, MCC950, a selective NLRP3 inhibitor, suppressed IL-1β secretion mediated by the fox AIM2 and NLRC4 inflammasomes. Conclusions: These findings suggest that NLRP3 may have a common role in dsDNA- and flagellin-mediated inflammasome activation in the red fox. In conclusion, this fox inflammasome biology can be applied to the control of zoonotic infections and the treatment of inflammasome-mediated diseases in the red fox.

Cisplatin-based chemotherapy has long been viewed as the first-line chemotherapy for advanced and metastatic urothelial carcinoma (UC). However, many patients with UC have been classified as “cisplatin-ineligible patient”, which requires alternative chemotherapy due to their poor responses. In fact, vast majority of those who initially responded to cisplatin-based chemotherapy eventually progressed. Understanding of UC tumor immunology provided an immunopathogenic bases for immune checkpoint inhibitors, targeting PD-1 and CTLA-4, to treat cisplatin ineligible metastatic UC and patients with platinum-refractory metastatic UC. In 2020, data from the trail further showed that PD-L1 inhibitors benefit prolonged survival and progression-free survival as maintenance therapy. Besides immune-targeting therapies, manipulation of tumor microenvironment via metabolic pathways alternation, such as inhibiting tumor glycolysis, lactate accumulation and exogenous glutamine uptake, has been investigated in the past few years. In this comprehensive review, we started by introducing traditional chemotherapy of UC, and summarized current evidences supporting the use of immune checkpoint inhibitors and highlighted ongoing clinical trials. Lastly, we reviewed the tumor metabolic characteristic and the anti-tumor treatments targeting metabolic pathways.

Hydrogels incorporated with hydrophobic motifs have received considerable attention to recapitulate the cellular microenvironments, specifically for the bio-mineralization of a 3D matrix. Introduction of hydrophobic motifs into a hydrogel often results in irregular arrangement of the motifs, and further phase separation of hydrophobic domains, but limited efforts have been made to resolve this challenge in the hydrophobically-modified hydrogel. Therefore, this study presents an advanced integrative strategy to incorporate hydrophobic domains regularly in a hydrogel by self-assembling of polymer cross-linkers, building blocks of a hydrogel. Self-assemblies between polymer cross-linkers were examined as micro-domains to incorporate hydrophobic motifs in a hydrogel. The self-assembled structures in a pre-gelled solution were confirmed with the fluorescence analysis and the hydrophobicity of a hydrogel could be tuned by incorporating the motifs in a controlled manner. Overall, the results of this study would greatly serve to tuning performance of a wide array of hydrophobically-modified hydrogels in drug delivery, cell therapies and tissue engineering.

The field of fluorescence sensing, leveraging various supramolecular self-assembled architectures constructed from macrocyclic pillar[n]arenes, has seen significant advancement in recent decades. This review comprehensively discusses, for the first time, the recent innovations in the synthesis and self-assembly of pillar[n]arene-based supramolecular architectures (PSAs) containing metal coordination sites, along with their practical applications and prospects in fluorescence sensing. Integrating hydrophobic and electron-rich cavities of pillar[n]arenes into these supramolecular structures endow the entire system with self-assembly behavior and stimulus responsiveness. Employing the host–guest interaction strategy coupled with complementary coordination forces, PSAs exhibiting both intelligent and controllable properties are successfully constructed. This provides a broad horizon for advancing fluorescence sensors capable of detecting environmental pollutants. This review aims to establish a solid foundation for the future development of fluorescence sensing applications utilizing PSAs. Additionally, current challenges and future perspectives in this field are discussed.

We evaluated hexadecyltrimethylammonium bromide (HTAB) for use in radio frequency (RF) applications in which liquid crystals (LCs) are used in layered structures that have various cell gap conditions. HTAB is a surfactant that can self-align vertically on the surface of indium tin oxide (ITO) substrates, and can induce homeotropic alignment of the LCs. For implementing RF devices with HTAB and LCs, we should consider limitations caused by the design conditions which are different from conventional liquid crystal displays such as cell gap. We quantified the concentration of HTAB ([HTAB]) that is necessary to form and maintain a sufficiently dense vertical alignment of 5CB (4-Cyano-4'-pentylbiphenyl). The required [HTAB] for full-homeotropic alignment was proportional to the cell gap until it was too large to support the transfer of the surface alignment to the LC, due to the weak anchoring nature of HTAB. We also showed the phase-change characteristic of the LC mixture depended on [HTAB] for the design of RF devices driven by light or heat. This work may help to guide the development of new approaches to designing efficient RF devices that use LCs.

Placenta-derived mesenchymal stem cells (PD-MSCs) have been highlighted as therapeutic sources in several degenerative diseases. Recently, microRNAs (miRNAs) were mediated one of the therapeutic mechanisms of PD-MSCs in regenerative medicine. To enhance the therapeutic effects of PD-MSCs, we established functionally enhanced PD-MSCs with phosphatase of regenerating liver-1 overexpression (PRL-1(+)). However, the profile and functions of miRNAs induced by PRL-1(+) PD-MSCs in a rat model with hepatic failure prepared by bile duct ligation (BDL) remained unclear. Hence, the objectives of the present study were to analyze the expression of miRNAs and investigate their therapeutic mechanisms for hepatic regeneration via PRL-1(+) in a rat model with BDL. We selected candidate miRNAs based on microarray analysis. Under hypoxic conditions, compared with invaded naïve PD-MSCs, invaded PRL-1(+) PD-MSCs showed improved integrin-dependent migration ability through RHO family-targeted miRNA expression (e.g., hsa-miR-30a-5p, 340-5p, and 146a-3p). Moreover, rno-miR-30a-5p and 340-5p regulated engraftment into injured rat liver by transplanted PRL-1(+) PD-MSCs through the integrin family. Additionally, an increase in PDGFRA by suppressing rno-miR-27a-3p improved vascular structure in rat liver tissues after PRL-1(+) PD-MSCs transplantation. Furthermore, decreased rno-miR-122-5p was significantly correlated with increased proliferation of hepatocytes in liver tissues by PRL-1(+) PD-MSCs by activating IL-6 signaling pathway through the repression of rno-miR-21-5p. Taken together, these findings improve the understanding of therapeutic mechanisms based on miRNA-mediated stem cell therapy in liver diseases.

In South Korea, demolition waste (DW) management has become increasingly significant owing to the rising number of old buildings. Effective DW management requires an efficient approach that accurately quantifies and predicts the generation of DW (DWG) of various types, which necessitates access to the required information or technology capable of achieving this. Hence, we developed an artificial intelligence-based model that predicts the generation of ten DW types, specifically from buildings in redevelopment areas. We used an artificial neural network algorithm with < 10 neurons in the hidden layer to derive individual input variables and optimal hyperparameters for each DW type. All DWG prediction models achieved an average validation and test prediction performance (R²) of 0.970 and 0.952, respectively, with their ratios of percent deviation ≥ 2.5, ver-ifying them as excellent models. Moreover, a Shapley additive explanations analysis revealed that DWG was most impacted by the floor area for all the DW types, with a positive correlation with DWG. Conversely, other factors showed either a positive or negative correlation with DWG de-pending on the DW type. The study findings will enable demolition companies and local gov-ernments in making informed decisions for efficient DW management and resource allocation by accurately predicting the generation of various types of DW.

(1) Background: The analysis of athletic performance has always aroused great interest from sport scientist. This study utilized machine learning methods to build predictive models using a comprehensive CrossFit (CF) dataset, aiming to reveal valuable insights into the factors influencing performance and emerging trends.; (2) Methods: The study used Random Forest (RF) and Multiple Linear Regression (MLR) models to predict performance in four key weightlifting exercises within CF: clean &amp; jerk, snatch, back squat, and deadlift. Performance was evaluated using R-squared (R2) values and Mean Squared Error (MSE). Feature importance analysis was conducted using RF, XGBoost, and AdaBoost models.; (3) Results: The RF model excelled in deadlift performance prediction (R2 = 0.80), while the MLR model demonstrated remarkable accuracy in clean &amp; jerk (R2 = 0.93). Across exercises, clean &amp; jerk consistently emerged as a crucial predictor. The feature importance analysis revealed intricate relationships among exercises, with gender significantly impacting deadlift performance.; (4) Conclusions: This research advances our understanding of performance prediction in CF through machine learning techniques. It provides actionable insights for practitioners, optimize performance, and demonstrates the potential for future advancements in data-driven sports analytics.

Commiphora molmol myrrh resin extracts, which have different physical properties such as polarity and dielectric constant, were prepared by immersion in extraction solvents (hot water, DMSO, hexane, ethanol, and methanol). Methanolic myrrh resin extracts showed broad antibacterial activity against isolated airborne bacteria. Furanoeudesma-1,3-diene and curzerene, as the main terpenoids in the methanolic myrrh resin extract, were analyzed using GC-MS, and the methanolic myrrh resin extracts were found to have antiviral activity (81.2% viral RNA inhibition) against H1N1 influenza virus. Biochars (wood powder-and rice husk-derived) coated with myrrh resin extracts also showed antiviral activity (22.6% and 24.3% viral RNA inhibition), due to the adsorption of terpenoids onto biochar. Myrrh resin extract using methanol as the extraction solvent is a promising agent with antibacterial and antiviral efficacy, and it can be utilized as a novel material via adsorption onto biochar for air filtration processes, cosmetics, fertilizers, drug delivery, and corrosion inhibition.

As an implementation of inverse Radon transform, the Second-order Divided-difference Back Projection (SDBP) technique has been proposed in this paper, by which the accurate CT reconstruction can be theoretically realized. A computational model for CT reconstruction filter expressions has been derived on the basis of SDBP technique. The method reveals the correlation between the convolution kernel for data restoration and the filter expression. By substituting kernel functions into the computational model, the amplitude sequences of a variety of filters can be calculated. On the proposed filter construction method, the decomposition form of filters has been discovered, where a series of basic filters have been acquired. The properties of any filter depend on the decomposed basic filters. Basic filters can be used to compose filters in actual needs.

Natural products are an important source of antibacterial agents. Canthin-6-one alkaloids have displayed potential antibacterial activity based on our previous work. In order to improve the activity, twenty-two new 3-N-benzylated 10-methoxy canthin-6-ones were designed and synthesized through quaternization reaction. The in vitro antibacterial activity against three bacteria was evaluated by double dilution method. Four compounds (6f, 6i, 6p and 6t) displayed 2-fold superiority (minimum inhibitory concentration (MIC) = 3.91 µg/mL) against agricultural pathogenic bacteria R. solanacearum and P. syringae than agrochemical propineb. Moreover, the structure–activity relationships (SARs) were also carefully summarized in order to guide the development of antibacterial canthin-6-one agents.

A single fracture is the basic unit of fracture medium, and the roughness of fracture wall surface is an important factor influencing hydraulic characteristics of the flow in bedrock fracture. However, effects of the shape and density of roughness elements (various bulges/pits on rough fracture wall surfaces) on water flow in a single rough fracture have not been thoroughly discovered. Thus the water flow in single fracture with different shapes and densities of roughness elements was simulated by using Fluent software in this study. The results show that in wider fractures the flow rate mainly depends on fracture aperture, while in narrow and close fracture medium the surface roughness of fracture wall is the main factor of head loss of seepage; there is a negative power exponential relation between the hydraulic gradient index and the average fracture aperture, i.e. with the increase of fracture aperture, the relative roughness of fracture and the influence weight of hydraulic gradient both decrease; and in symmetrical-uncoupled fractures there is a super-cubic relation between the discharge per unit width and average aperture. Above results would help to deepen the understanding of rough fracture seepage.

Background: Atypical teratoid/rhabdoid tumor (AT/RT) is an uncommon and aggressive pediatric central nervous system neoplasm. However, a universal clinical consensus or reliable prognostic evaluation system for this malignancy is lacking. Our study aimed to develop a risk model based on comprehensive clinical data to assist in clinical decision-making. Methods: We conducted a retrospective study by examining data from the Surveillance, Epidemiology, and End Results (SEER) repository, spanning 2000 to 2019. The external validation cohort was sourced from the Children's Hospital Affiliated to Chongqing Medical University, China. To discern independent factors affecting overall survival (OS) and cancer-specific survival (CSS), we applied Least Absolute Shrinkage and Selection Operator (LASSO) and Random Forest (RF) regression analyses. Based on these factors, we structured nomogram survival predictions and initiated a dynamic online risk-evaluation system. To contrast survival outcomes among diverse treatments, we used propensity score matching (PSM) methodology. Molecular data with the most common mutations in AT/RT were extracted from the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Results: The annual incidence of AT/RT showed an increasing trend (APC, 2.86%; 95% CI:0.75-5.01). Our prognostic study included 316 SEER database participants and 27 external validation patients. The entire group had a median OS of 18 months (range 11.5 to 24 months) and median CSS of 21 months (range 11.7 to 29.2). Evaluations involving C-statistics, DCA, and ROC analysis underscored the distinctive capabilities of our prediction model. An analysis via PSM highlighted that individuals undergoing triple therapy (integrating surgery, radiotherapy, and chemotherapy) had discernibly enhanced OS and CSS. The most common mutations of AT/RT identified in the COSMIC database were SMARCB1, BRAF, SMARCA4, NF2, and NRAS. Conclusions: In this study, we devised a predictive model that effectively gauges the prognosis of AT/RT and briefly analyzed its genomic features, which might offer a valuable tool to address existing clinical challenges.

Acetic acid bacteria (AAB) are major contributors to the production of fermented vinegar, offering various cultural, culinary, and health benefits. Although the residual unpasteurized AAB after vinegar production are not pathogens, these are necessary the safety evaluations including antibiotic resistance for the use as starters. In this research, we investigated the antibiotics resistance profiles of 26 AAB strains, including various species of Komagataeibacter and Acetobacter, against ten different antibiotics using the E-test method. All strains exhibited resistance to aztreonam and clindamycin. Komagataeibacter species demonstrated a 50% resistance rate to ciprofloxacin, analogous to Acetobacter species, but showed twice the resistance rates to chloramphenicol and erythromycin. Genomic analysis of K. saccharivorans CV1 identified intrinsic resistance mechanisms, such as multidrug efflux pumps, thereby enhancing our understanding of antibiotic resistance in acetic acid-producing bacteria. These findings enhance understanding of antibiotic resistance in AAB for food safety and new antimicrobial strategies, suggesting the need for standardized testing methods and molecular genetic study.

RISC-V offers a modular technical approach combined with an open, royalty-free instruction set architecture (ISA). This openness allows various researches to incorporate RISC-V into both open and proprietary solutions or services. However, despite its advantages as a fundamental building block for many embedded systems, the escalating complexity and functional demands of real-time applications have made adhering to response time deadlines challenging. This has led to an increased demand for comprehensive development insights for real-time systems based on RISC-V. To improve development efficiency, we offer a detailed performance analysis of RISC-V in comparison to various ISAs. In this paper, we analyze the real-time performance of RISC-V through two real-time approaches based on processor architectures. For RTOS applications, we adopted FreeRTOS and evaluated its performance on HiFive1 Rev B (RISC-V) and STM3240G-EVAL (ARM M) to evaluate real-time performance. For Real-time Linux, we utilized Linux with the Preempt-RT patch and tested its performance on VisionFive 2 (RISC-V), MIO5272 (x86-64), and Raspberry Pi 4 B (ARM A). Through these experiments, we examined the real-time mechanism of each operating system. Additionally, in the Preempt-RT experiments, scheduling latencies were evaluated using cyclictest. Finally, in order to practically show the real-time capabilities of RISC-V, we implemented motion control of a six-axis collaborative robot, which was performed on the VisionFive 2 platform. This implementation provided a comparative result of RISC-V’s performance against the x86-64 architecture of MIO-5272. Ultimately, the results indicated that the real-time performance of RISC-V for real-time applications was slightly inferior to that of the x86-64 architecture. A noticeable achievement of this research was the first implementation of an EtherCAT Master on RISC-V designed for real-time applications featuring a multi-tasking structure. The research offers valuable insights into the real-time capabilities of RISC-V compared to established architectures like x86-64. While RISC-V might not surpass these architectures in real-time performance, its flexibility, modularity, and open nature make it a compelling choice for a wide range of real-time applications. The successful implementation of the EtherCAT Master on RISC-V further expands its potential in the domain of real-time embedded control systems.

A large number of studies have concluded that since housing pressure will affect the mobility of highly skilled young migrants (HSYM) in Chinese cities and regions, it is necessary to apply corresponding housing policies to adjust housing unaffordability for HYSM. This study uses a survey data conducted in China's Zhejiang Province of China, where specific policies have been implemented to attract talent and found that housing does crowds out the HSYM from a city, but the HSYM who have a master's degree or above or who work in government organizations or state-owned enterprises are more tolerant of housing unaffordability. The unmarried or those staying in the city for a long period are less tolerant of housing unaffordability. Meanwhile, there are the heterogeneous impacts of factors on the HSYM's tolerance for housing unaffordability across cities of different levels. Therefore, housing policies should highlight urban differences and intra-group differences.

Nonsteroidal anti-inflammatory drugs (NSAIDs), which block the activity of cyclooxygenase (COX) isoenzymes and inhibit the synthesis of prostaglandin, have been used for pain relief. We have developed a method to separate a mixture of three NSAIDs, such as aspirin, paracetamol, and naproxen, using reverse-phase high-performance liquid chromatography (RP-HPLC). An isocratic mobile phase consisting of acidic water and acetonitrile was selected to run at a low flow rate, such as 0.8 mL/min. The mixture of three NSAIDs was injected at a low volume into a C18 column that was 150 mm in length and characterized using a UV detector at 230 nm. We identified three peaks in the chromatogram indicating the three compounds. The elution time of the peaks was less than 10 minutes. To identify multiple peaks on the isocratic flow using a short column, further studies are required regarding the proposed method to generate microfluidic devices for nanoLC.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

Skin photoaging is caused by prolonged exposure to ultraviolet (UV) radiation from sunlight. UV-exposed skin appears rough, thick, dry, loose, and shows deep wrinkles, and thickening. Our previous research showed that a Phaseolus angularis seed extract (PASE) effectively inhibits photoaging through UVB protection in HaCaT cells. However, its efficacy has not been evaluated in clinical trials so far. In this single-centered, randomized, double-blind study, we investigated the anti-aging effect of PASE in eye wrinkle areas. To these 21 healthy adult women aged 30 to 65, a PASE cream was applied to the right eye wrinkle area and a placebo to the left eye wrinkle area twice a day (morning and evening) for 12 weeks. The change in thick, deep crease wrinkles around the eyes was confirmed by visual evaluation, skin measurements, and a questionnaire. As a result, the R1 (surface roughness), R2 (maximum roughness), R3 (average roughness), R4 (smoothness depth), and R5 (arithmetic mean roughness) values in the group using the PASE cream all decreased. Particularly, R1, R4, and R5 significantly decreased by 18.1%, 18.6%, and 25.0%. In addition, no participants reported side effects. Our study showed that PASE led to clinically significant levels of wrinkle improvement. In conclusion, as PASE is a natural food, safe, and with few side effects, it can be a good resource for natural anti-wrinkle cosmetics in the future.

The aim of this study was to study the effect of leisure identity, flow, satisfaction, and re-participate intention among outdoor leisure activity participants in South Korea. Due to the recent COVID-19 pandemic, there has been a tendency to more frequently participate in outdoor leisure activities as opposed to indoor leisure activities. Leisure activities bestow various benefits. Therefore, this study was used to analyze the relationships amongst leisure identity, flow, leisure satisfaction, and re-participate intention among various theories about leisure. The participants in this study were collected from amongst 369 people who were frequent participants in outdoor leisure activities. For the data analysis, the researchers used frequency, confirmatory analysis, reliability, correlation and structural equaling modeling. The findings were as follows: First, leisure identity had wielded an influence on leisure flow. Second, leisure identity had influence leisure satisfaction. did not have any significant influence on recreation specialization. Third, leisure identity had influence on re-participate intention. Fourth, leisure flow did not have any significant influence on leisure satisfaction. Fifth, leisure flow did not have any significant influence on leisure satisfaction. And finally, leisure satisfaction had an influence on re-participate intention. In the era of the COVID-19 pandemic, a new leisure identity has been formed, and it is believed to be a new study on leisure flow, leisure satisfaction, and re-participation intention. This study aims to provide basic data for constructing infrastructure to enable continued participation in outdoor sports in Korea.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

There is no doubt that seagrass beds constitute one of the most productive ecosystems in shallow coastal waters. Despite this, picoplankton in seagrass ecosystems has received relatively little attention. The purpose of this study was to compare picoplankton growth and mortality rates between seagrass and unvegetated habitats using chamber incubations. We tested two main hypotheses: (i) incubation with seagrass would result in higher bacterial growth rates due to increased DOM release from seagrass photosynthesis, and (ii) Synechococcus spp. would be lower in the presence of seagrass due to competition for inorganic nutrients. Our results showed bacterial growth rates of 2.31 and 2.44 d–1 without and with seagrass, respectively. In seagrass chambers, bacterial growth was higher than that in non-seagrass chambers, suggesting that organic carbon coming from the seagrass community may support bacterial production. Furthermore, we observed a negative Synechococcus spp. growth rate (-0.9 d–1) in the seagrass treatment, likely reflecting nutrient competition with the seagrass. Small-scale chambers proved to be a useful tool for studying the factors controlling spatial and temporal patterns of picoplankton across different habitats. Furthermore, future studies should examine picoplankton growth over a wider range of spatial scales in seagrass beds and adjacent unvegetated sediment.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

In mesoscale eddies, chemical properties and biological composition are different from those in surrounding water, due to their unique physical processes. It is unclear how physical-biological coupling occurs in warm-core eddies, particularly since no study has examined the relationship between bacteria and viruses. The purpose of the present study was to examine the influence of anticyclonic warm eddy on the relationship between bacterial and viral abundances as well as viral activity (viral production) in different depths. In the core of warm eddy, bacterial abundance (0.48 to 2.82 ×105 cells mL−1) fluctuated less than that of the outside eddy (1.12 to 7.03×105 cells mL−1). In particular, there was four-folds higher of viral-bacterial abundance ratio (VBR) estimated within the eddy below DCM than the outside eddy. We suggest that prevailing physical forces with downwelling at the center of the anticyclonic warm eddy, viruses can also be transmitted into the deep ocean directly through adsorption on particulate organic matter during sinking. Overall, our findings provide valuable insights into the interaction between bacterial and viral communities and their ecological mechanism within the warm eddy.

Glass has emerged as a highly versatile substrate for various sensor and MEMS packaging applications, including electromechanical, thermal, optical, biomedical, and RF devices, due to its exceptional properties such as high geometrical tolerances, outstanding heat and chemical resistance, excellent high-frequency electrical properties, and the ability to be hermetically sealed. In these applications, Through-Glass-Via (TGV) plays a vital role in manufacturing and packaging by creating electrical interconnections through glass substrates. This paper provides a comprehensive summary of the research progress in TGV fabrication along with their integrations, including through-via formation and metallization. The paper also reviews the significant qualification and reliability achievements obtained by the scientific community for TGV. Additionally, the paper summarizes the application of TGV technology in various sensors.

Background: Transit-time flow measurement (TTFM) is frequently used to evaluate intraoperative quality control during coronary artery bypass grafting (CABG). Although TTFM has the ability to assess graft failure intraoperatively, the perioperative factors affecting TTFM during CABG surgery remain poorly understood. Methods: Patients who underwent CABG surgery at a single institution between July 2016 and May 2018 were prospectively evaluated. Patients’ demographic characteristics, previous medical history, Euroscore, the results of preoperative blood tests, and intraoperative data were recorded. TTFM and blood viscosity were measured hemodynamically, and mean flow (mL/min) and pulsatility index (PI) were recorded. Arterial blood gas was analyzed immediately after anastomosis of the left internal mammary artery (LIMA) to the left descending artery (LAD) and before sternal closure. Factors associated with TTFM were assessed by multiple linear regression analysis. Results: Of the 62 patients who underwent CABG surgery during the study period, 57 were evaluated, including 49 who underwent off-pump and eight who underwent on-pump surgery. Blood viscosity was not significantly associated with TTFM (p > 0.05). However, TTFM was significantly associated with body mass index (BMI), systolic blood pressure, and cardiac index (p < 0.05 each). Conclusions: Blood viscosity was not significantly associated with intraoperative graft flow. Blood flow of graft vessels, however, was significantly associated with BMI, systolic blood pressure, and cardiac index.

Mumps is the second-most reported infectious disease in South Korea; however, due to the low pathogen confirmation rate in laboratory diagnoses, we proposed a method for reevaluating the high incidence rate via the laboratory verification of other viral diseases. In 2021, 63 cases of pharyngeal or cheek mucosal swabs of suspected mumps cases in Gwangju, South Korea, were assessed for causative pathogens using massive simultaneous pathogen testing (TaqManTM Array Cards). More than one respiratory virus was detected in 60 cases (95.2%), 44 (73.3%) of which were co-detected. Human rhinovirus was detected in 47 cases, followed by human herpesvirus (HHV)6 in 30; HHV4 (17), human bocavirus (17), HHV5 (10), and human parainfluenza virus 3 (6) were also detected. Our findings suggest the need for further investigations on the pathogenesis of diseases mimicking mumps, which are considered to aid with appropriate public health responses, treatment, and the prevention of infectious disease outbreaks.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power wasted for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power conversion efficiency (PCE) of 90.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding PCE of 74.6%. The result shows that the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.

Aluminum wire is a common material for wire bonding due to its resistance to oxidation and low price. It does not melt when becoming a free air ball (FAB) during the electronic flame-off (EFO) process with wettability, and is applied by wedge bonding. This study used 20μm Zn-Coated Al-0.5wt.%Si (ZAS) wires to improve the FAB shape after the EFO process, while maintaining stability of the mechanical properties, including the interface bonding strength and hardness. In order to test circuit stability after ball bonding, the current-tensile test was performed. During the experiment, it was found that 80nm ZAS with wire bonding has lower resistance and higher fusing current. For the bias tensile test, the thicker Zn film diffused into the Al-Si matrix easily, after which the strength was reduced. The ball-bond interfaces had no change in their condition before and after the bias. Accordingly, ZAS could be a promising candidate for ball bonding in the future.

There are two major proposed forms of dark energy: the cosmological constant and the quintessence scalar field. However, the former has the cosmological constant problem and the latter does not have observational evidence to support the theory. In this paper, we propose a dark energy paradigm to solve the cosmological constant problem and to predict lepton masses as evidence. The dark energy paradigm is a unified dark sector that is based on Planck's dimensional analysis, Lambda CDM, energy conservation, and force equilibrium. We find that dark energy can vary from the cosmological constant to the Planck scale. We find that the predicted values of lepton masses based on the dark energy paradigm agree with the observed values to 1% (or within error ranges).

This research intended to report amine-functionalized multiwall carbon nanotubes (MWCNTs) prepared by a simple method for efficient and rapid removal of Reactive Yellow 2 (RY2) from water. EDS analysis showed that the N content increased from 0 to 2.42% and from 2.42 to 8.66% after modification by APTES and PEI, respectively. BET analysis displayed that the specific surface area, average pore size, and total pore volume were reduced from 405.22 to 176.16 m2/g, 39.67 to 6.30 nm, and 4.02 to 0.28 cm3/g, respectively. These results proved that the PEI/APTES-MWCNTs were successfully prepared. pH edge experiment indicated that pH 2 was optimal for RY2 removal. At pH 2 and 25 °C, the time required for adsorption equilibrium was 10, 15, and 180 min at initial concentrations of 50, 100, and 200 mg/L, respectively; and the maximum RY2 uptake calculated by the Langmuir model was 714.29 mg/g. Thermodynamic studies revealed that the adsorption process was spontaneous and endothermic. 0-0.1 mol/L of NaCl showed negligible effect on RY2 removal by PEI/APTES-MWCNTs. Five adsorption/desorption cycles confirmed the good reusability of PEI/APTES-MWCNTs in RY2 removal. Overall, the PEI/APTES-MWCNTs are a potential and efficient adsorbent for reactive dye wastewater treatment.

Background: Cancer stem cells (CSCs) exhibit self-renewal activity and give rise to other cell types in tumors. Due to the infinite proliferative potential of CSCs, drugs targeting these cells are necessary to completely inhibit cancer development. beta-lapachone (bL) has been widely used to treat cancer development, but its effect on cancer stem cells remain elusive. Thus, we investigated the effect of bL on mammosphere formation using breast cancer stem cell (BCSC) marker positive cells, MDA-MB-231. Methods: MDA-MB-231 Cells, which is negative for NQO1 expression, was constructed to stably express NQO1(NQO1 stable cells) to see the effect of bL. The effect of bL on cells were evaluated by wound healing and Transwell cell culture chambers, and ALDEFLUOR assay. Results: Here, we show that bL inhibited the proliferative ability of mammosphere derived from BCSC marker-positive cells, MDA-MB-231, in an NQO1-dependent manner. bL treatment efficiently downregulated expression level of BCSC markers CD44, ALDH1A1, and DLGAP5 that recently identified as a stem cell proliferation marker in both cultured cells and mammosphered cells. Moreover, bL efficiently downregulates cell proliferation and migration activities. Conclusions: These results strongly suggest that bL could be a therapeutic agent targeting breast cancer stem cells with proper NQO1 expression.

The quality of healthcare services is a very important indicator of social welfare in developed and emerging countries. Good quality levels are critical to ensuring patient safety, improving health outcomes, increasing patient satisfaction, optimizing resource utilization, and meeting regulatory requirements. The stable and sustainable operation of medical institutions urgently requires the establishment of a reliable and effective medical quality performance evaluation platform. However, the complexity of the evaluation process, involving numerous evaluators and the consideration of different subjective and objective criteria, poses significant challenges and essentially constitutes a group multi-criteria decision-making problem. This article uses the overall medical environment of the institution, medical service attitude, medical security, administrative service measures, etc. as measurement standards to deal with this challenge. It proposes a medical service quality measurement model suitable for both qualitative and quantitative analysis. In view of the heterogeneity of information, the two-tuple fuzzy language calculation method is introduced to enable evaluators to skillfully manage diverse information and effectively avoid potential information omission problems in the subjective evaluation integration process. The effectiveness and feasibility of the model were demonstrated by applying it to the operational framework of a medical institution in central Taiwan.

PEBAX-2533/metal salt/Al salt membranes were prepared for mixed olefin/paraffin separation. PEBAX-2533 with 80% ether group and 20% amide group was suggested as the polymer matrix for comparison of separation performance according to the functional group ratio in copolymer PEBAX. In addition, Al salts were used to stabilize metal ions for a long time as additives. High permeance was expected with the proportion of high ether groups since these functional groups provided relatively permeable regions. As a result, the PEBAX-2533 composite membrane showed a selectivity of 5 (propylene/propane) with 10 GPU. However, the permeance of membrane was not unexpectedly improved and the selectivity was reduced. The result was analyzed by SEM, FT-RAMAN and TGA, including FT-IR. The reduction in separation performance was determined by FT-IR. From these results, in order to stabilize the metal ions interacting with the polymer through Al(NO3)3, it was concluded that specific ratio of amide group was needed in PEBAX as polymer matrix.

The aim of this study was to examine oxidative stress and low level of alpha-1-antitrypsin (A1AT) in primary Sjögren's syndrome (pSS), and evaluate the associated autoreactivity against unmodified and their 4-hydroxy-2-nonenal (HNE)-modified peptides with pSS. Two differentially expressed proteins, alpha-1-acid glycoprotein 1 (A1AG1) and A1AT, exhibited 2-fold differences, and their HNE modifications were identified by depleted-albumin and immunoglobulin G (IgG) serum protein, in-solution digestion, in-gel digestion, and nano-LC-MS/MS from pSS patients and age-matched healthy controls (HCs). Furthermore, levels of proteins, confirmation of HNE modifications, HNE-protein adducts and autoreactivity against unmodified and their HNE-modified peptides were further validated. Levels of the HNE-protein adduct and A1AG1 were significantly higher in pSS patients than HCs, but levels of A1AT were significantly lower in pSS patients compared to HCs. Only the HNE modification of A1AT was confirmed. Further, concentrations of anti-A1AT^50-63 IgG and anti-A1AT^50-63 HNE IgA were significantly lower in pSS patients than HCs. Our study suggests that elevated HNE-protein adduct, oxidative stress, level [odds ratio (OR) 4.877, p = 0.003], lowered A1AT level (OR 3.910, p = 0.010) and a decreased level of anti-A1AT^50-63 IgG (OR 3.360, p = 0.010) showed an increased risk in pSS patients compared to HCs, respectively.

Effective oral care is important to maintain a high quality of life. Therefore, plaque control can prevent the development and recurrence of periodontitis. Brushing with a toothbrush and toothpaste is a common way to remove plaque; however, excessive brushing or brushing with abrasive toothpaste can cause wear and tear on the dental crown. Hence, we aimed to quantitatively compare the plaque-removal efficiency and tooth wear of toothbrushes using bioelectric effect (BE) with those of mechanical electric toothbrushes. To generate the BE signal, an electronic circuit was developed and embedded in a toothbrush. Further, typodonts were coated with cultured artificial plaques and placed in a brushing simulator. A toothpaste slurry was applied, and the typodonts were eluted with tap water after brushing. The plaques of the typodonts were captured, and the images were quantified. For the tooth wear experiment, polymethyl methacrylate disk resin blocks were brushed twice a day, and the thickness of the samples was measured. Subsequently, statistical differences between the experimental toothbrushes and typical toothbrushes were analyzed. The BE toothbrush had a higher plaque-removal efficiency and could minimize tooth wear. This study suggests that the application of BE may be a new solution for oral care.

Osteoporosis is an abnormal bone remodeling condition characterized by decreased bone density, which leads to high risks of broken bones. Previous studies have demonstrated that Lycii Radicis Cortex (LRC) extract inhibits bone loss in ovariectomized (OVX) mice by enhancing the osteoblast differentiation. A bioactive compound, Kukoamine B (KB), was identified from a fractionation of LRC extract as a candidate component responsible for an anti-osteoporotic effect. This study investigated the anti-osteoporotic effects of KB using in vitro and in vivo osteoporosis models. KB treatment significantly increased the osteoblastic differentiation and mineralized nodule formation of osteoblastic MC3T3-E1 cells, while it significantly decreased the osteoclast differentiation of primary-cultured monocytes derived from mouse bone marrow. The effects of KB on osteoblastic and osteoclastic differentiations under more physiological conditions were also examined. In the co-culture of MC3T3-E1 cells and monocytes, KB promoted osteoblast differentiation but did not affect osteoclast differentiation. For the in vivo experiments, KB significantly inhibited OVX-induced bone mineral density loss and restored the impaired bone structural properties in osteoporosis model mice. These results suggest that KB may be a potential therapeutic candidate for the treatment of osteoporosis.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

In recent decades, with the ever-growing scale of video data, near-duplicate videos continue to emerge. Data quality issue caused by near-duplicate videos is becoming more and more prominent, which has affected the application of normal videos. Although current studies on near-duplicate video detection can be helpful to uncover data quality issues for videos, they still lack a process of automatic merging for the video data represented by high-dimensional features, which are difficult to automatically clean the near-duplicate videos to improve data quality for video datasets. At present, there are few studies on near-duplicate video data cleaning. The existing studies have the sensitive problems of video data orderliness and clustering initial center under a condition that prior distribution is unknown, which seriously affect the accuracy of near-duplicate video data cleaning. To address the above issues, an automatic near-duplicate video data cleaning method based on a consistent feature hash ring is proposed in this paper. First, a residual network with convolutional block attention modules, a long short-term memory deep network, and an attention model are integrated to construct an RCLA deep network with the multi-headed attention mechanism to extract spatiotemporal features of video data. Then, a consistent feature hash ring is constructed, which can effectively alleviate the sensitivity of video data orderliness while providing a condition of near-duplicate video merging. To reduce the sensitivity of the initial cluster centers to results of near-duplicate video cleansing, an optimized feature distance-means clustering algorithm is constructed by utilizing a mountain peak function on a consistent feature hash ring, which can implement automatic cleaning of near-duplicate video data. Finally, experiments are conducted based on a commonly used dataset named CC_WEB_VIDEO and a coal mining video dataset. Compared with some existing works, simulation results demonstrate that the performance of the proposed method.

Amid the swift progression of the global automobile industry, the aspiration for lightweight vehicle design has surfaced as a crucial approach to boost fuel efficiency and curtail environmental impact. The objective of this study revolves around achieving holistic optimization of vehicle structure via detailed scrutiny of vehicle process characteristics, amalgamated with a Back Propagation neural network (BPNN) optimized by a genetic algorithm (GA) and a topology optimization (TO) method.The process initiates with an examination of the vehicle's technical characteristics, succeeded by an optimization protocol that couples GA with BPNN. This exhaustive optimization procedure derives the best-fit values of design parameters and identifies the globally optimal lightweight design approach. Subsequently, a comprehensive structural optimization is actualized by modifying the topological distribution of the structure.A simulation experiment of the conceptual car body beam skeleton is conducted as a conclusive step, and the anti-collision capacity of the car body beam skeleton is assessed by measuring deformation intrusion. The findings reveal that in the vehicle topology optimization, a comparative analysis of pre and post-optimization results indicates an improved topological density across diverse sections. The topological density of the vehicle's frontal structure escalates from 0.75 to 0.8. Following optimization, the stiffness assessment records a marginal increase (within the range of 0.02–0.05), implying that the lightweight design does not compromise the general rigidity of the structure.The optimized body structure manifests superior crashworthiness in the crash test: the deformation intrusion diminishes by 27% in front-end collisions. In side impacts, the deformation and intrusion at critical points are reduced by 13.15% to 10% respectively. The comprehensive method proposed herein proves to be an efficient strategy to actualize the lightweight design of vehicles.

Controlling the concentration of free radicals in polymerization systems is advantageous for preparing cationic polyacrylamide (CPAM) with high molecular weight and acceptable dissolvability. In this study, a novel ultraviolet (UV)-initiated system characterized with adjustable light intensity and redox-azo complex initiator was used to synthesize a CPAM flocculant named NP. Comparatively, another CPAM flocculant named SP with stable UV light intensity and single initiator was prepared. The chemical structure, morphology, and thermal stability were analyzed through instrumental analysis. Proton nuclear magnetic resonance indicated that NP was successfully prepared, and a small fraction of cationic homopolymer was mixed in the product. Polymerization conditions were optimized, and polymerization mechanism was determined by investigating the effects of various parameters on intrinsic viscosity, conversion, and dissolvability. Results showed that the best performance was obtained at indexes of 0.45 wt‰ redox initiator concentration, 0.2 wt‰ azo initiator concentration, 40.0 wt% of cationic monomer, first- and second-stage light intensities of 8.5 and 13 mW/cm², respectively, and 3 wt% urea. Sludge conditioning performances of NP and SP were comparatively evaluated, and the mechanism was determined by investigating the sedimentation behavior and floc size distribution. High intrinsic viscosity, porous morphology structure, and the mixed cationic homopolymer of NP resulted in better sludge conditioning performance.

Major depressive disorder (MDD) is one of the most prevalent and disabling mental disorders worldwide. Among the symptoms of MDD, sleep disturbance such as insomnia is prominent and the first reason patients may seek professional help. However, the underlying pathophysiology of this comorbidity is still elusive. Recently, genome-wide association studies (GWAS) have begun to unveil the genetic background of several psychiatric disorders, including MDD and insomnia. Identifying the shared genomic risk loci between comorbid psychiatric disorders could be a valuable strategy to understand their comorbidity. This study seeks to identify the shared genes and biological pathways between MDD and insomnia based on their shared genetic variants. First, we performed a meta-analysis based on the GWAS summary statistics of MDD and insomnia obtained from Psychiatric Genomics Consortium and UK Biobank, respectively. Next, we associated shared genetic variants to genes using two gene mapping strategies: (a) positional mapping based on genomic proximity and (b) expression quantitative trait loci (eQTL) mapping based on gene expression linkage across multiple tissues. As a result, a total of 719 shared genes were identified. Over half (51%) of them are protein-coding genes. Functional enrichment analysis shows that the most enriched biological pathways are related to epigenetic modification, sensory perception, and immunologic signatures. We also identified druggable targets using a network approach. Together these results may provide insights into understanding the genetic predisposition and underlying biological pathways of comorbid MDD and insomnia symptoms.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

SARS-CoV-2, the newly identified human coronavirus causing severe pneumonia epidemic, was probably originated from Chinese horseshoe bats. However, direct transmission of the virus from bats to humans is unlikely due to lack of direct contact, implying the existence of unknown intermediate hosts. Angiotensin converting enzyme 2 (ACE2) is the receptor of SARS-CoV-2, but only ACE2s of certain species can be utilized by SARS-CoV-2. Here, we evaluated and ranked the receptor-utilizing capability of ACE2s from various species by phylogenetic clustering and sequence alignment with the currently known ACE2s utilized by SARS-CoV-2, predicting potential intermediate hosts of SARS-CoV-2.

This study reports the recovery of Pd(II) from acid solution by a polyethylenimine (PEI) crosslinked chitin (PEI-chitin) biosorbent. FE-SEM analysis demonstrated that there are many slot-like pores on PEI-chitin. N2 adsorption-desorption experiment revealed that the average pore size was 47.12 nm. Elemental analysis verified the successful crosslinking of PEI with raw chitin. The Langmuir model better explained the isotherm experimental data and the theoretical maximum Pd(II) uptake was 59.6 mg/g. The adsorption kinetic data was better described by pseudo-second-order model and the adsorption equilibrium was achieved within 30 min for all initial Pd(II) concentrations of 50-200 mg/L. In the fixed-bed column, the adsorption of Pd(II) on PEI-chitin showed slow breakthrough and fast saturation performance. The desorption experiments achieved a concentration factor of 8.4 ± 0.4. In addition, adsorption-desorption cycles in the fixed-bed column were performed up to 3 times, consequently confirming the good reusability of PEI-chitin for Pd(II) recovery. Therefore, the PEI-chitin can be used as a promising biosorbent for the recovery of Pd(II) in practical applications.

An elevated level of endoplasmic reticulum (ER) stress is considered an aggravating factor for inflammatory bowel disease (IBD). To develop an ER stress attenuator that is effective against colitis, 4-phenylbutyric acid (4-PBA), a chemical chaperone that alleviates ER stress, was conjugated with acidic amino acids to yield a 4-PBA-glutamic acid conjugate (PBA-GA) and a 4-PBA-aspartic acid conjugate (PBA-AA). The PBA derivatives were converted to 4-PBA in the cecal contents, where the conversion was greater with PBA-GA. After oral administration of PBA-GA (oral PBA-GA), millimolar levels of PBA were accumulated in the cecum, whereas 4-PBA was not detected in the blood, indicating the targeting of PBA-GA to the large intestine. At concentrations in the cecum achievable by oral PBA-GA, 4-PBA effectively attenuated ER stress in human colon epithelial cells. In 2,4-dinitrobenzenesulfonic acid-induced colitis in rats, oral PBA-GA alleviated the damage and inflammation in the colon. Moreover, oral PBA-GA substantially reduced the elevated levels of ER stress marker proteins in the inflamed colon. Moreover, PBA-GA was as effective as the currently used anti-IBD drug, sulfasalazine. In conclusion, PBA-GA is a colon-targeted prodrug of 4-PBA and is effective against rat colitis probably through the attenuation of ER stress in the inflamed colon.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

This review explores the field of retreatment strategies for the cases filled with calcium silicate-based root canal sealers. Since the introduction of calcium silicate-based materials in dentistry, calcium silicate-based root canal sealers have become popular among dentists because of their biocom- patibility, bioactivity, and sealing ability. Therefore, effective retreatment strategies are indispensable. This article aims to identify the challenges associated with the removal of calcium silicate-based sealers itself and gutta-percha with the sealers during retreatment, evaluate current techniques and materials, and provide future directions for research in this field. Regarding the strategies of removal of root canal sealers, calcium silicate-based sealers are still relatively new materials for clinicians compared with the traditional sealers such as epoxy- or eugenol-based sealers. First, no clinically established solvents have been reported. Second, calcium silicate-based sealers are currently utilized by clinicians in either cold sealer-based technique or warm vertical condensation technique. Third, the setting process of calcium silicate-based sealers generates byproducts primarily calcium hydroxide and secondarily hydroxyapatite, which could interact with dentine. Lastly, there is a lack of clinical studies evaluating the efficacy of retreatment protocols for teeth filled with calcium silicate-based sealers. Therefore, it is important to investigate chemo-mechanical properties of calcium silicate- based sealers itself and their reactions to solvents and/or mechanical instruments, and identify the interfacial properties of calcium silicate-based sealers in respect to dentine and gutta-percha. In addition, researchers in clinical field need to actively gather and report data on retreatments of teeth filled with calcium silicate-based sealers.

Arthroscopic capsular release (ACR) is used for persistent shoulder stiffness after an index surgery. No cases of post-ACR humeral head osteonecrosis have been reported to date. A 56-year-old male patient underwent open reduction and internal fixation using a hook plate for acromioclavicular joint dislocation. Despite hardware removal, the patient presented with unresolved shoulder pain and range-of-motion (ROM) limitation. He had a history of hypertension, chronic hepatitis B infection, and alcohol consumption. Preoperative ROM was forward flexion 90°and internal rotation sacral level. Preoperative functional status was visual analog scale (VAS) score 4, American Shoulder and Elbow Surgeons (ASES) score 51, and Constant–Murley (CMS) score 48, and normal radiography and magnetic resonance imaging. Standard ACR was performed with 360° release of the joint capsule via electrocautery ablation. Six-months post-ACR, ROM (forward flexion: 135°, abduction: 135°, external rotation: 70°, internal rotation: T10 vertebra) and functional outcomes (VAS 2; ASES79; CMS 75) were significantly improved, without interval change in radiographic assessment. However, 21 months later, he had recurrent shoulder pain and decreased ROM. Radiography revealed humeral head osteonecrosis. Patients with intrinsic or extrinsic risk factors related to humeral head circulation disturbance should be monitored for humeral head osteonecrosis post-ACR.

In industrial settings, gears play a crucial role by assisting various machinery functions such as speed control, torque manipulation, and altering motion direction.The malfunction or failure of these gear components can have serious repercussions, resulting in production halts and financial losses. As a result, there is an increasing requirement to monitor the state of these components in order to avoid such issues from occurring. To address this need, research efforts have focused on early defect detection in gears in order to reduce the impact of possible failures. This study focused on analyzing vibration and thermal datasets from two extruder machine gearboxes using an autoencoder Long Short-Term Memory (LSTM) model. The major goal is to implement an outlier detection approach to detect and classify defects. The results of this study highlighted the extraordinary performance of the Autoencoder LSTM model, which achieved an impressive accuracy rate of 94.42% in recognizing malfunctioning gearboxes within the extruder machine system. Furthermore, the study used a thorough global metrics evaluation methodology to further test the model’s dependability and efficacy, consequently substantiating the proposed approach’s validity.

As broiler farming facilities have become larger and more concentrated in response to external environmental changes, there is a possibility of increased concentrations of fine dust and aerosols inside these facilities due to enclosure. In particular, workers are exposed to high concentrations of organic particulate matter and harmful gases while performing their tasks, and as they age, they become more vulnerable to respiratory diseases. It is essential to directly monitor the concen-trations to which workers are exposed, along with the spatial distribution of aerosols inside broiler house. In this study, we analyzed the regional aerosol concentrations using passive samplers in commercial tunnel-ventilated broiler farms. Simultaneously, we employed active samplers at the height of the workers' breathing zones to monitor real-time aerosol concentrations by particle size along their work routes. Spatial aerosol concentrations generally increased from the inlet to the exhaust in the breathing zone. The average aerosol concentrations were TSP -1,042 µg/m³, PM-10 718 µg/m³, and PM-2.5 137 µg/m³. To analyze the workers' exposure environments, we categorized the tasks in the barn into Static work period (SWP) and Moving work period (MWP) based on video analysis. The results showed that during MWP, fine dust concentrations exceeded the standards by up to 214%. Particularly, during MWP, the concentrations were 1.74 times higher for TSP, 1.40 times higher for PM-10, and 1.22 times higher for PM-2.5 compared to SWP. It was observed that during the movement of workers, physical generation of particles around 10 µm, such as feces, feed, and bedding, occurred due to the movement of chicken, which influenced the aerosol concentration.

Many farms utilize closed-type livestock systems to enhance productivity and facilitate effective environmental management. However, the confined nature of these closed spaces poses an increased risk of exposure to harmful gases and organic dust for both workers and livestock. Additionally, the introduction of outside air through ventilation systems can lead to temperature fluctuations within the breeding environment, resulting in potential productivity issues. This research paper employs computational fluid dynamics (CFD) to develop ventilation operation management plans that address both the working environment and the breeding environment simultaneously. The proposed plans are designed to be easily implemented in practical farm settings. The findings of this study, based on simulation analysis, indicate that while ventilation is effective in reducing harmful gases and improving the working environment, its efficiency decreases after the initial 3 minutes of operation. Furthermore, uncontrolled ventilation can cause sudden temperature changes, which may adversely affect the well-being of the livestock. However, when upgraded ventilation structures are implemented, significant improvements in the working environment (an average of 27.3% improvement) can be achieved while maintaining temperature stability for the livestock. These results highlight the importance of referring to the provided ventilation operation management table before commencing work, as it enables workers to improve the working environment while minimizing the potential impact of ventilation on the breeding environment.

Recently, the demand for electric vehicle is increasing worldwide due to eco-friendly policies and stricter emission regulations. As a traction motor for electric vehicle, interior permanent magnet synchronous motors are mainly used. For the design of the interior permanent magnet synchronous motor, the magnetic equivalent circuit method, which is a method of lumped constant circuit, and the finite element method, which is a method of distributed constant circuit, mainly are used. Magnetic equivalent circuit method is useful for simple design through fast and intuitive parameters, but it cannot derive the distribution of magnetic field. The finite element method can derive an accurate magnetic field distribution, but it takes a long time to analyze and it is difficult to analyze intuitive design parameters. In this paper, magnetic equivalent circuit method and Carter coefficient are mixed for rotor structure design. This design method will be called the hybrid magnetic equivalent circuit method. Intuitive design parameters are derived through this hybrid magnetic equivalent circuit method. We will derive the Air gap flux density distribution according to rotor shape, no-load induced voltage, and cogging torque, and compare and verify it with the finite element method.

In previous researches, Job Crafting questionnaire to develop is consists of 3 factors which are Task Crafting, Cognitive Crafting, and Relationship Crafting with 12 to 17 items. The purpose of study is to develop JCQ for leisure sports instructor of Korean. 274 valid samples are used for analysis. Data collecting is purposeful sampling. At result, for Korean Sports Instructor Job Crafting Scale is constructed 3 factors with 12 items is constructed by 3 step procedure. KSIJCQ is confirmed on convergent discriminant validity evidence. In conclusion, KSIJCQ is a valid scale of the measuring and distributes Job Crafting of generalization in sports.

The degradation of Proton-exchange membrane fuel cell (PEMFC) gasket materials is crucial in electric vehicles as it can cause hazardous hydrogen fuel leaks, which are usually due to high temperatures, pressures, and hydrogen fuel exposure. Degradation of gasket materials in PEMFC presents a critical concern for electric vehicle safety due to potential hydrogen fuel leaks. This study utilizes finite element analysis (FEA) to assess the suitability of gasket materials for PEMFC applications, focusing on aging and tensile conditions. The dual degradation framework, incorporating contact pressure and von Mises stress, is employed to evaluate Liquid Silicon Rubber (LSR) and Ethylene Propylene Diene Monomer (EPDM) materials. Under aging techniques, the Yeoh model exhibits the least Mean Absolute Percentage Error (MAPE) and computational cost of 0.27 seconds, while the Ogden model records the highest computational cost of 0.89 seconds. In evaluating MAE, Root Mean Square Error (RMSE), and R-squared metrics, LSR and EPDM materials demonstrate respective averages of 0.25%, 0.275%, 0.945%, and 0.815%, 0.685%, 0.77%. Tensile testing (Uniaxial) reveals RMSE and MAE values of 0.30%, 0.40%, and 0.50%, 0.40%, respectively. FEA proves instrumental in identifying suitable gasket materials for PEMFC applications. LSR emerges as the superior choice, demonstrating enhanced FEA modelling performance under aging and tensile conditions. These findings contribute valuable insights to the design and development of improved gasket materials, bolstering the safety and reliability of electric vehicles.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Objective: To use the ancient and modern medical record cloud platform (V2.3.5) to organize and explore the medication patterns of the "Three Causes, Extremity, and One Disease Syndrome Formula" by Chen Wuxuan, and to summarize its therapeutic ideas. Method: Collect and organize the "San Yin Si Tian Fang" in the "San Yin Ji Yi Zheng Fang Lun", and use the modern medical record cloud platform (V2.3.5) to conduct medication frequency statistical analysis, cluster analysis, and complex network analysis. As a result, a total of 16 Chinese herbal medicines were collected in the "Three Causes, Extreme and One Disease Syndrome Formula", involving 75 traditional Chinese medicines. Statistical analysis showed that roasted licorice was the most commonly used, followed by Pinellia ternata, papaya, ginger, and Poria cocos; Medications mainly include warm drugs, sweet and pungent flavors, as well as drugs that promote lung and spleen meridians. Cluster analysis can divide the above-mentioned traditional Chinese medicine into two groups, with specific grouping as follows. Group 1: ginger, white peony, aconite, papaya, and achyranthes bidentata; Group 2: roasted licorice, poria cocos, dried ginger, pinellia ternata, and green peel. Conclusion: The characteristics of the 16 prescriptions are biased towards Xin Gan Wen, emphasizing the regulation of the spleen and stomach, which may be related to the common use of prescription by doctors in the Song Dynasty and the tendency towards warm and dry medication.

This paper addresses a method to transmit streaming data via rolling shutter camera-based optical camera communications (OCC). Since the amount of data that can be contained within one frame is limited, and the continuity of received data cannot be guaranteed due to OCC environmental variations, we introduce the concept of dividing the streaming data into several fragmented sets that are transmitted sequentially. We propose a superframe to contain sequential packets of fragmented data and corresponding indexes, so that sequential packets for streaming data can be continuously collected. When redundant frame transmission is considered, any packet lost due to OCC environmental conditions can be recovered. Experimental results show that the proposed method can be successfully used to transmit streaming data, with the number of redundant frames required to acquire all data packets based on image resolution. In addition, we describe how to identify missing packets from a network point of view to reduce the number of redundant frames needed to acquire all the data. This paper presents baseline results of communication performance when sending streaming data via a rolling shutter-based OCC.

Agriculture is an industry that heavily relies on the environment. The increasing frequency of ex-treme disasters attributable to climate change has adversely affected agricultural land and dis-rupted the stability of the supply of agricultural products. Therefore, we implemented a research program focused on current strategies for adapting to agricultural meteorological disasters. The primary goal was to actively promote disaster prevention information and techniques through information platforms and applications and to provide refined forecasting and an early warning system to enhance preparedness for and recovery from agricultural disasters. This initiative can transform passive mitigation into dynamic action by disseminating crucial information to farmers. We integrated meteorological data and crop characteristics to develop disaster prevention strate-gies for the predisaster, during-disaster, and postdisaster stages to empower farmers to implement autonomous disaster prevention, ensuring their profitability and minimizing the impact of disas-ters. This paper presents an agricultural disaster prevention system involving cross-disciplinary collaboration to establish an early warning system for crop disasters. However, the effectiveness of the early warning system relies on the availability of complete meteorological and crop infor-mation, necessitating high-density agricultural meteorological stations, refined weather forecast services, historical crop damage data, and ongoing research and development on disaster preven-tion technology. In the system, a diversified social media interface is used to provide local farmers with weather forecast information. When impending disasters are identified, the platform acti-vates disaster prevention measures to reduce agricultural losses. This article paper introduces Taiwan’s agricultural disaster prevention system as a complete disaster prevention strategy.

Global warming may increase the potential evapotranspiration (Etp), thereby affecting the amount of clean water resources available in a region. In this study, the systematic biases in temperature outputs of 24 global climate models (GCMs) under 3 emission scenarios are corrected by using 8 bias correction methods. The trend of Etp in Yangzi River Delta in the 21st century is projected by using 4 Etp calculation formulas. The uncertainty of the projections is estimated and decomposed by using multi-way analysis of variance. The influence of uncertainty on the projected change signal is quantified by using the signal-to-noise ratio. The results show that, relative to the reference period (1971~2000), the annual mean daily Etp in Yangzi River Delta will increase by 0.14~0.17mm/d during the period 2021~2050 and by 0.21~0.41mm/d during the period 2061~2090, respectively. During 2021~2050, the uncertainty of Etp increase projections is dominantly contributed by the main effects of GCM (63%) and Etp calculation formula (24%). During 2061~2090, it is mainly contributed by the main effect of GCM (36%), followed by the main effects of emission scenario (34%) and Etp calculation formula (18%). The increase projections of Etp are generally reliable and robust during the two projection periods.

With the integrated development of the Internet, wireless sensor technology, cloud computing, and mobile Internet, there has been a lot of attention given to research about and applications of the Internet of Things. A Wireless Sensor Network (WSN) is one of the important information technologies in the Internet of Things; it integrates multi-technology to detect and gather information in a network environment by mutual cooperation, using a variety of methods to process and analyze data, implement awareness, and perform tests. This paper mainly researches the localization algorithm of sensor nodes in a wireless sensor network. Firstly, a multi-granularity region partition is proposed to divide the location region. In the range-based method, the RSSI (Received Signal Strength indicator, RSSI) is used to estimate distance. The optimal RSSI value is computed by the Gaussian fitting method. Furthermore, a Voronoi diagram is characterized by the use of dividing region. Rach anchor node is regarded as the center of each region; the whole position region is divided into several regions and the sub-region of neighboring nodes is combined into triangles while the unknown node is locked in the ultimate area. Secondly, the multi-granularity regional division and Lagrange multiplier method are used to calculate the final coordinates. Because nodes are influenced by many factors in the practical application, two kinds of positioning methods are designed: the unknown node is in the positioning unit or not. When the unknown node is on the side of the positioning unit, we use the method of vector similarity. Moreover, we use the centroid algorithm to calculate the ultimate coordinates of unknown node. When the unknown node is not on the side of the positioning unit, we establish a Lagrange equation containing the constraint condition to calculate the first coordinates. Furthermore, we use the Taylor expansion formula to correct the coordinates of the unknown node. In addition, this localization method has been validated by establishing the real environment.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Plants do need a fixed proportion of carbon (C), nitrogen (N) and phosphorus (P) elements to maintain normal metabolic activities. The P fertilizers are widely used to supplement nutrients in subtropical plantations. Stoichiometric homeostasis reflects the strategy of plants to cope with various environments (including P fertilizer supply rate). It is thus of great significance to understand C:N:P stoichiometry in the plant-litter-soil system under P addition and stoichiometric homeostasis of plant tissues for fertilization management of slash pine (Pinus elliottii Engelm) plantations. We measured the C, N and P contents in root, branch, needle, litter and soil in slash pine plantations fertilized with four treatments - P1 (25 kg P ha−1 yr−1), P2 (50 kg P ha−1 yr−1), P3 (100 kg P ha−1 yr−1), and a control (CK) in subtropical China and calculated stoichiometric homeostasis of plant tissues. Results showed that P addition increased the capacity of needle to obtain C, N and P elements and altered the C:N:P stoichiometry of plant tissues, as well promoted the accumulation of C and P elements in soil, but had no significant effect on soil stoichiometry. The nutrient contents of needle and branch were higher than those of root and litter, indicating that slash pine was more inclined to allocate nutrient to the aboveground tissues. The stoichiometric homeostasis of C, N and P among plant tissues was ranked as follows: root > branch > needle, and homeostasis of nutrient elements in the needle was C > N > P. This indicated that the C, N and P stoichiometric homeostasis was various among plant tissues and elements types under P addition. These findings suggest P addition would alleviate the P limitation of slash pine growth in subtropical regions. In the future, long-term observation experiments should be conducted and the trade-off between P addition rates and economic and ecological benefits should be considered.

This paper aims to address the exponential stability and stabilization problems for a class of delayed nonlinear Markov jump systems under randomly occurring Denial-of-Service (DoS) attack and packet loss. Firstly, the stochastic characteristics of DoS attack and packet loss are depicted by the attack success rate and packet loss rate. Secondly, a Period Observation Window (POW) method and a hybrid-input strategy are proposed to compensate for the impact of DoS attack and packet loss on the system. Thirdly, A Dynamic Event-triggered Mechanism (DETM) is introduced to save more network resources and ensure the security and reliability of systems. Then, by constructing a general common Lyapunov functional and combining with the DETM and other inequality analysis techniques, the less conservative stability and stabilization criteria for the underlying systems are derived. In the end, the effectiveness of our result is verified through a numerical example.

Viruses can induce the fusion of infected and neighboring cells, leading to the formation of syncytia. Cell-cell fusion is mediated by viral fusion proteins on the plasma membrane of infected cells that interact with cellular receptors on neighboring cells. Viruses use this mechanism to spread rapidly to adjacent cells or escape host immunity. For some viruses, syncytium formation is a hallmark of infection and a known pathogenicity factor. For others, the role of syncytium formation in viral dissemination and pathogenicity remains poorly understood. Human cytomegalovirus (HCMV) is an important cause of morbidity and mortality in transplant patients and the leading cause of congenital infections. Clinical HCMV isolates have broad cell tropism but differ in their ability to induce cell-cell fusions, and little is known about the molecular determinants. We developed a system to analyze HCMV glycoprotein B (gB) variants in a defined genetic background. HCMV strains TB40/E and TR were used as vectors to compare the fusogenicity of six gB variants from congenitally infected fetuses with those from three laboratory strains. Five of them conferred the ability to induce fusion of MRC-5 human embryonic lung fibroblasts to one or both backbone strains, as determined by a split GFP-luciferase reporter system. The same gB variants were not sufficient to induce syncytia in infected ARPE-19 epithelial cells, suggesting that additional factors are involved. The system described here allows a systematic comparison of the fusogenicity of viral envelope glycoproteins and may help to clarify whether fusion-promoting variants are associated with increased pathogenicity.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

Inflammasomes are multiprotein complexes that activate inflammatory responses by inducing pyroptosis and secretion of pro-inflammatory cytokines. Along with many previous studies on inflammatory responses and diseases induced by canonical inflammasomes, an increasing number of studies have demonstrated that non-canonical inflammasomes, such as mouse caspase-11 and human caspase-4 inflammasomes, are emerging key players in inflammatory responses and various diseases. Flavonoids are natural bioactive compounds found in plants, fruits, vegetables, and teas and have pharmacological properties in a wide range of human diseases. Many studies have successfully demonstrated that flavonoids play an anti-inflammatory role and ameliorate many inflammatory diseases by inhibiting canonical inflammasomes. Others have demonstrated the anti-inflammatory roles of flavonoids in inflammatory responses and various diseases, with a new mechanism by which flavonoids inhibit non-canonical inflammasomes. This review discusses recent studies that have investigated the anti-inflammatory roles and pharmacological properties of flavonoids in inflammatory responses and diseases induced by non-canonical inflammasomes and further provides insight into developing flavonoid-based therapeutics as potential nutraceuticals against human inflammatory diseases.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The increased deployment of IoT devices in specific areas results in an interference among them and the quality of communications can be severely degraded. To deal with this interference issue, the IEEE 802.11ax standard has been established in hyper-densely wireless networking systems. The 802.11ax adopts a new candidate technology that is called multiple network allocation vector in order to mitigate the interference problem. In this paper, we point out potential problem in multiple network allocation vector which can cause delays to the communication among IoT devices in hyper-dense wireless networks. Furthermore, this paper introduces an adaptive beam alignment algorithm for interference issue resolution. In addition, we analyze potential delays of communications among IoT devices under interference conditions. Lastly, we simulate our proposed algorithm in densely deployed environment and show that the interference issue can be mitigated and the IEEE 802.11ax-based IoT devices can utilize the air interface more fairly compared to conventional IEEE 802.11 distributed coordination function.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

To enhance the overall reliability of the power system, engineers have redirected their focus toward health monitoring and early detection of faults in transformers. Among these faults, transformer core defects demand particular attention. While fault simulation using software has traditionally been the preferred approach, these methods suffer from data inaccuracies in real-world conditions. Consequently, conducting actual experimental setups with induced faults is imperative to investigate core issues. This study uses Hilbert Transform (HT) as a signal processing technique to extract crucial data characteristics, thereby enhancing the performance of the classifier model. The research involves analyzing electric current signals from a single-phase 1kVA transformer. A comparative assessment of our proposed model was conducted using raw data and Fast Fourier Transform (FFT), evaluating accuracy, precision, recall, F1-score, and computational time. The results demonstrate a significant improvement in all metrics for the classifier models, particularly the k-nearest neighbor (KNN) algorithm, which exhibited values of 83.89%, 84.39%, 83.89%, 83.79%, and 0.0156 seconds, respectively. Future work aims to extend this analysis under different loading conditions.

Switched-mode power supplies (SMPS) often utilize electrolytic capacitors due to their substantial energy density and economical pricing. However, their ability to function at low temperatures is essential for dependable operation in several sectors, including telecommunications, automotive, and aerospace. This study includes an experimental evaluation of how well standard SMPS electrolytic capacitors operate at low temperatures. This paper investigates the suitability of standard electrolytic capacitors used in switched-mode power supplies (SMPS) for low-temperature applications. The experimental evaluation exposed the capacitors to temperatures ranging from - 5 ∘C to - 40 ∘C, assessing capacitance (Cp), impedance (Z), dissipation factor (DF), and equivalent series resistance (ESR) at each temperature. The capacitor’s time-domain electrical signals were analyzed using the Pearson correlation coefficient to extract discriminative features. These features were input into an Artificial Neural Network (ANN) for training and testing. Results indicated a significant impact of low temperatures on capacitor performance. Capacitance decreased with lower temperatures, while ESR and leakage current increased, affecting stability and efficiency. Impedance proved to be a valuable diagnostic tool for identifying potential capacitor failure, showing a 98.44% accuracy drop at - 5 degrees and 88.75% at the peak temperature, indicating proximity to the manufacturer’s specified limit. The study suggests further research and development to improve electrolytic capacitors’ performance in SMPS systems under cold conditions to enhance efficiency and reliability.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Health issues of children with intellectual disabilities (ID) have gained significant attention as a key focus of China health goals. This study aimed to compare the differences in displacement skills and problem behaviors among children with varying degrees and types of ID, while also exploring their relationship. The study included 90 participants who were children with ID and had completed TGMD-2 displacement skills and Strengths and Difficulties Questionnaire (SDQ) assessments. Covariance, partial correlation, and multiple linear regression analyses were conducted to examine the differences and correlations between these factors. The findings revealed that higher severity of intellectual disability was associated with lower scores in locomotor skills and increased manifestation of problem behaviors. Notably, there were significant variations in locomotor skills and problem behaviors among children with different types of intellectual disabilities. There is a positive correlation between locomotor skills and problem behaviors in children with intellectual disabilities, where locomotor skills can predict the occurrence of problem behaviors. In Conclusion, the research confirms that the development of locomotor skills can have a positive impact on the accompanying problem behaviors of children with developmental disabilities.

In autonomous driving systems, high-speed and real-time image processing, along with object recognition, are crucial technologies. This paper builds upon the research achievements in in-dustrial item sorting systems and proposes an object recognition and sorting system for auton-omous driving. In industrial sorting lines, goods sorting robots often need to work at high speeds to efficiently sort large volumes of items. This poses a challenge to the robot's real-time vision and sorting capabilities, making it both practical and economically viable to implement a real-time and low-cost sorting system in a real-world industrial sorting line. Existing sorting systems have limitations such as high cost, high computing resource consumption, and high power consump-tion. These issues lead to the fact that existing sorting systems are typically used only in large industrial plants. In this paper, we design a high-speed, low-cost, low-resource-consumption FPGA (Field-Programmable Gate Array) based item sorting system that achieves similar perfor-mance to current mainstream sorting systems at a lower cost and consumption than existing sorting systems. The recognition part employs a morphological recognition method, which segments the image using a frame difference algorithm and then extracts the color and shape features of the items. To handle sorting, a six-degree-of-freedom robotic arm is introduced in the sorting segment. The improved cubic B-spline interpolation algorithm is employed to plan the motion trajectory and consequently control the robotic arm to execute the corresponding actions. Through a series of experiments, this system achieves an average recognition delay of 25.26ms, ensures smooth operation of the gripping motion trajectory, minimizes resource consumption, and reduces implementation costs.

In this nano era, nanomaterials and nanostructures are popular in developing novel functional materials. However, the combinations of nanoproducts with materials at micro and macro scale can open new routes for conceiving novel materials with an improved or even new functional performances. In this study, a brand-new hybrid, containing both nanofibers and particles having a microsize, was fabricated using a sequential electrohydrodynamic atomization (EHDA) process. Firstly, the microparticles loaded with drug (berberine hydrochloride, BH) molecules in the cellulose acetate (CA) were fabricated using a solution electrospraying process. Later, these microparticles were suspended into a co-dissolved solution containned BH and a hydrophilic polymer (polypyrrolidone, PVP), and were co-electrospun into the nanofiber/microparticle hybrids. The EHDA processes were clearly recorded, and the resultant products showed a typical hybrid topography, with microparticles distributed all over the nanofibers, which was demonstrated by SEM assessments. FTIR and XRD demonstrated that the components within the hybrids were presented in an amorphous state and have fine compatibility with each other. In vitro dissolution tests verified that the hybrids were able to provide the designed dula-step drug release profiles, a combination of the fast release step of BH from the hydrophilic PVP nanofibers through an erosion mechanism and the sustained release step of BH from the insoluble CA microparticles via a typical Fickian diffusion mechanism. The present protocols pave a new way for developing trans-scale functional materials.

Titanium (Ti) and Ti-based alloys are commonly used in dental implants, and surface modifications of dental implants are important for achieving osseointegration (i.e., direct connection between the implant surface and bone). This study investigated the effect of an eco-friendly etching solution—a hydrogen peroxide–sodium bicarbonate mixture—on the surface properties and contact angles of and osteoblast adhesion and proliferation on Ti surfaces. Disk-shaped Ti specimens were prepared using different surface treatments (machining, sandblasting, and sandblasting/acid-etching), and they were immersed in the etching solution and then ultrasonically cleaned. Surface characterization was performed using scanning electron microscopy, digital microscopy, contact angle analysis, and X-ray photoelectron spectroscopy. MG-63 osteoblasts were cultured on the specimens, and their adhesion to the specimen surface and their proliferation were examined using staining and the MTT assay, respectively. Additional etching with the etching solution caused the formation of nano/micro hierarchical structures, increased the surface roughness, and enhanced the hydrophilicity. Osteoblast adhesion and proliferation were found to improve on the modified surfaces. The eco-friendly etching method has the potential to enhance the biological properties of Ti implant surfaces and to thereby improve the dental implant performance.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

This paper proposes a novel phase-resolved partial discharge (PRPD) sensor embedded in MV-class bushing for high-accuracy insulation analysis. The design, fabrication, and evaluation of a PRPD sensor embedded in MV-class bushing aimed to detect partial discharge (PD) pulses that are phase-synchronized with the applied primary HV signals. A prototype PRPD sensor was composed of a flexible printed circuit board (PCB) with dual-sensing electrodes, utilizing a capacitive voltage divider (CVD) principle for voltage measurement and D-dot principle for PD detection, and a signal transducer with passive elements. A PD simulator was prepared to emulate typical PD defects, i.e., a metal protrusion. The voltage measurement precision of the prototype PRPD sensor was satisfied with the accuracy class of 0.2 specified in IEC 61869-11, as the maximum corrected voltage error ratios and corrected phase errors in 80%, 100%, and 120% of the rated voltage (13.2 kV) were less than 0.2% and 10 minutes, respectively. In addition, the prototype PRPD sensor had good linearity and high sensitivity for PD detection compared with a conventional electrical detection method. According to performance evaluation tests, the prototype PRPD sensor embedded in the MV-class bushing can measure PRPD patterns phase-synchronized with the primary voltage without any additional synchronization equipment or system. Therefore, the prototype PRPD sensor holds potential as a substitute for conventional commercial PD sensors. Consequently, this advancement could lead to the enhancement of power system monitoring and maintenance, contributing to the digitalization and minimization of power apparatus.

Chemical investigation of the Chinese soft coral Lobophytum sp. has resulted in the isolation of six new compounds, namely lobosteroids A–F (1–6), along with four known compounds. Their structures were determined by extensive spectroscopic analysis and comparison with the spectral data reported in the literature. Among them, the absolute configuration of 1 was determined by X-ray diffraction analysis. These steroids characterized by either the presence of an α,β-αꞌ,βꞌ-unsaturated carbonyl or an α,β-unsaturated carbonyl moiety in ring A, or the existence of a 5α,8α-epidioxy system in ring B, as well as diverse oxidation sites of side chains. The prelimi-nary antibacterial bioassay showed all compounds exhibited significant antibacterial activities against the fish pathogenic bacteria Streptococcus parauberis FP KSP28 and Phoyobacterium damselae FP2244 with all inhibition rates more than 90% at the concentration of 150 µM. And at the same concentration, compounds 2, 6–10 also displayed potent inhibitory effects against vancomy-cin-resistant Enterococcus faecium bacteria G7 with all inhibition rates more than 90%.

Surface-enhanced Raman spectroscopy (SERS) is commonly used for super-selective analysis through nanostructured silver layers in the environment, food quality, biomedicine, and materials science. To fabricate a high-sensitivity but more accessible device of SERS, dc magnetron sputtering technology was used to realize high sensitivity, low cost, stable deposition rate, and rapid mass production. This study investigated various thicknesses of a silver film ranging from 3.0 to 12.1 nm by field-emission-scanning-electron microscope, X-ray diffraction, and X-ray photoelectron spectroscopy. In the rhodamine 6G (R6G) testing irradiated by a He-Ne laser beam, the analytical enhancement factor (AEF) of 9.35x108, the limit of detection (LOD) of 10-8 M, and the relative standard deviation (RSD) of 1.61% were better than other SERS substrates fabricated by the same dc sputtering process because the results show that the 6 nm thickness silver layer has the highest sensitivity, stability, and lifetime. The paraquat and acetylcholine analytes were further investigated and high sensitivity was also achievable. The proposed SERS samples were evaluated and stored in a low humidity environment for up to forty weeks, and no spectrum attenuation could be detected. Soon, the proposed technology to fabricate high sensitivity, repeatability, and robust SERS substrate will be an optimized process technology in multiple applications.