In offshore drilling, accidents such as gas invasion, overflow, and kicks are inevitable, and they can escalate into blowouts and other catastrophic events that result in casualties and substantial economic losses. Therefore, maintaining drilling safety requires accurate monitoring of gas invasion and overflow. The majority of overflow monitoring methods currently utilized at drilling sites are threshold-based. However, monitoring parameters acquired during actual drilling operations frequently contain noise signals, making it difficult for threshold-based methods to strike a balance between improving accuracy and minimizing false positives. In this paper, Pattern Recognition-based Kick Detection (PRKD) is proposed as a novel method for diagnosing overflow in offshore drilling. This method utilizes the overflow evolution process by integrating multi-phase flow calculations, data filtering theory, pattern recognition theory, the Bayesian framework, and other theoretical models. The PRKD effectively detects and monitors gas intrusion and overflow based on single parameters by analyzing the shape and wave characteristics of the curves. The case analysis demonstrates that the proposed method for monitoring drilling overflow achieves high precision while maintaining a low false positive rate. By combining advanced computational techniques with pattern recognition algorithms, the PRKD improves the accuracy and reliability of kick detection, enabling proactive responses to potential risks, protecting the environment and human lives, and optimizing drilling operations.

Acute myeloid leukemia (AML) is a hematological malignancy that is the culmination of genetic and epigenetic alterations in the hematopoietic progenitor cells, leading to uncontrolled proliferation at the expense of normal hematopoiesis and bone marrow exhaustion. Although the outcomes for pediatric AML have improved in recent decades, at least one third of children still have relapses. Recent studies have notably highlighted the important role of dysregulated epi-genetic mechanisms in myeloid leukemogenesis. Epigenetic modifications are frequently reversible compared to genetic alterations, thus providing opportunities for targeted epigenetic therapy. In this review, we summarize the landscape of epigenetic alterations and the progress to date in epigenetic targeted therapy, and focus on the future role of epigenetic abnormalities in predicting relapse and the precision therapy in pediatric AML.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Human papillomavirus testing is increasingly central to screening programs for cervical cancer. Although HPV testing has excellent clinical sensitivity it suffers from modest clinical specificity. Cytology has taken an important role as a triage test, while more recently HPV16/18 genotyping has provided modest incremental benefits. Despite such progress issues remain to be addressed, some of which are how to: 1) improve access to the best methods, 2) decrease costs so more women can be screened, 3) simplify management algorithms, 4) Recognize the evolving diagnostic landscape created by widespread HPV vaccination. Part of the solution lies in improving the positive predictive value of the initial screen and reflex triage. An aspirational goal should be that most women attending colposcopy have true precancer; DNA methylation testing has a role to play here. Cervical cancers and CIN2/3 generally have high levels of methylation in target human and HPV genes. In contrast normal and healthy women with no intraepithelial lesions or malignancy usually have low methylation. Furthermore, there is an interesting and useful secular gradient of increasing cervical DNA methylation as women progress toward precancer and cancer. Recent results from clinical studies using commercially available routine qPCR-based DNA methylation tests have been encouraging, demonstrating the potential for higher sensitivity and specificity than current triage methods.

The accurate of model attitude angel plays an important role on the aerodynamic test results in the wind tunnel test. The original method applies the spherical coordinate system transformation to obtain attitude angel calculation. The model attitude angel is obtained by coordinate transformation and spherical surface mapping applying the nominal attitude angel (the balance attitude angel in the wind tunnel coordinate system) indicated by the mechanism. First, the coordinate transformation of this method is not only complex but also difficult to establish the transformed relationship between the space coordinate systems especially after many steps of coordinate transformation, moreover it cannot realize the iterative calculation of the interference relationship between attitude angels; Second, during the calculate process to solve the problem the arc is approximately used to replace the straight line, the angel for the tangent value, and the inverse trigonometric function is applied. Therefore, in the calculation of attitude angel, the process is complex and inaccurate, which can be solved approximately when calculating small attack angel. However, with the advancing development of modern aerodynamic unsteady research, the aircraft tends to develop high or super large attack angel and unsteady research field. According to engineering practice and vector theory, the concept of vector angel coordinate system is proposed for the first time, and the vector angel coordinate system of attitude angel is established. With the iterative correction calculation and avoiding the problem of approximate and inverse trigonometric function solution, the model attitude calculation process is carried out in detail, which validates that the calculation accuracy and accuracy of model attitude angels are improved. Based on engineering and theoretical methods, a vector angel coordinate system is established for the first time, which gives the transformation and angel definition relations between different flight attitude coordinate systems, that can accurately calculate the attitude angel of the corresponding coordinate system and determine its direction, especially in the channel coupling calculation, the calculation of the attitude angel between the coordinate systems is only related to the angel, and has nothing to do with the change order s of the coordinate system, which simplifies the calculation process.

Acute lymphoblastic leukemia is the most common malignancy in children and is characterized by numerous genetic and epigenetic abnormalities. Epigenetic mechanisms, which involve DNA methylations and histone modifications, result in the heritable silencing of genes without a change in their coding sequence. Emerging studies are increasing our understanding of the epigenetic role of leukemogenesis and have demonstrated the potential of DNA methylations and histone modifications as a biomarker for lineage and subtypes classification, predicting relapse, and disease progression in ALL. Epigenetic abnormalities are relatively reversible when treated with some small molecule-based agents compared to genetic alterations. In this review, we conclude the genetic and epigenetic characteristics in ALL and discuss the future role of DNA methylation and histone modifications in predicting relapse, finally focus on the individual and precision therapy targeting epigenetic alterations.

The field of fluorescence sensing, leveraging various supramolecular self-assembled architectures constructed from macrocyclic pillar[n]arenes, has seen significant advancement in recent decades. This review comprehensively discusses, for the first time, the recent innovations in the synthesis and self-assembly of pillar[n]arene-based supramolecular architectures (PSAs) containing metal coordination sites, along with their practical applications and prospects in fluorescence sensing. Integrating hydrophobic and electron-rich cavities of pillar[n]arenes into these supramolecular structures endow the entire system with self-assembly behavior and stimulus responsiveness. Employing the host–guest interaction strategy coupled with complementary coordination forces, PSAs exhibiting both intelligent and controllable properties are successfully constructed. This provides a broad horizon for advancing fluorescence sensors capable of detecting environmental pollutants. This review aims to establish a solid foundation for the future development of fluorescence sensing applications utilizing PSAs. Additionally, current challenges and future perspectives in this field are discussed.

As an emerging discipline, Design Morphology, with the advantage of "Form Study", has been integrated with many disciplines, and gradually formed its collaborative innovation paradigm. The inclusion of "Ecology" into Design Morphology is expected to promote the research of Design Morphology with the help of the systematic thinking and methods of ecology. The ecosystem of Design Morphology includes the natural ecosystem and the quasi-ecosystem closely related to human beings, and also put forward the concept of "Form Community" for the first time in the design field. In fact, this is exactly the research scope of Design Morphology. Advocating the ecological view of Design Morphology, can not only help to design researchers improve their values and world view, with new thinking and method to engage in "Form Study", but also contribute to the theoretical construction and thinking expansion of Design Morphology, and play a positive role in promoting interdisciplinary collaborative innovation led by Design Morphology. In addition, it can be used to evaluate the overall research and future development trend of Design Morphology, and provide the new research ideas and approaches for the development of design.

Bacterial indole-3-acetic acid (IAA), an effector molecule in microbial physiology, plays an important role in plant growth-promotion. Here, we comprehensively analyzed about 7282 prokaryotic genomes representing diverse bacterial phyla, combined with root-associated metagenomic data to unravel the distribution of tryptophan-dependent IAA synthesis pathways and to quantify the IAA synthesis-related genes in the plant root environments. We found that 82.2% of the analyzed bacterial genomes were potentially capable of synthesizing IAA from tryptophan (Trp) or intermediates. Interestingly, several phylogenetically diverse bacteria showed a preferential tendency to utilize different pathways and tryptamine and indole-3-pyruvate pathways are most prevalent in bacteria. About 45.3% of the studied genomes displayed multiple coexisting pathways, constituting complex IAA synthesis systems. Furthermore, root-associated metagenomic analyses revealed that rhizobacteria mainly synthesize IAA via IAM and tryptamine (TMP) pathways and might possess stronger IAA synthesis abilities than bacteria colonizing other environments. The obtained results refurbished our understanding of bacterial IAA synthesis pathways and provided a faster and less labor-intensive alternative to physiological screening based on genome collections. The better understanding of IAA synthesis among bacterial communities could maximize the utilization of bacterial IAA to augment the crop growth and physiological function.

This purpose was to compare the ability of body shape index (ABSI) and body roundness index (BRI) with waist circumference (WC), body mass index (BMI), waist-to-hip ratio (WHR), waist-to-height ratio (WHtR) and body adiposity index (BAI) to predict metabolic risk. The cross-sectional study was conducted in 17,360 Chinese subjects (were aged 18-95 years old) who escaped cardiovascular disease (CVD) or diabetes. Biochemical and anthropometric variables were measured by trained staff. Receiver operating characteristic curve (ROC) and optimal cutoff values of obesity indices were recruited to compare the predictive ability for metabolic risk factors. The mean age of subjects was 53.7(13.1) years, 41.6 % were males. Within young group (<60 years), the areas under the curve (AUC) demonstrated that WC, BMI, WHR, WHtR and BRI were able to similarly predict high metabolic risk in males (0.74 vs. 0.74 vs. 0.73 vs. 0.73 vs. 0.73) and in females (0.73 vs. 0.73 vs. 0.71 vs. 0.73 vs. 0.73), while the approximate predictive ability were only acquired in males (0.73 vs. 0.73 vs. 0.70 vs. 0.73 vs. 0.73) within elder group (≥60 years). The optimal cut-off values of BRI for high metabolic risk were calculated in males (<60 y: 3.49 vs. ≥60 y: 3.46) and females (<60 y: 3.47 vs. ≥60 y: 3.60). Meanwhile, BRI displayed a strong prediction to elevated BP and elevated TG in males (AUC = 0.64; AUC = 0.70) and to elevated BP, elevated TG and elevated SUA in females (AUC = 0.67; AUC = 0.69; AUC =0.70). BRI was able to similarly predict high metabolic risk compared to WC, BMI, WHR, WHtR and BAI, while ABSI was not. Moreover, BRI revealed specific predictive ability for elevated BP, elevated TG and elevated SUA.

As a typical visual positioning system, monocular ranging is widely used in various fields. However, when the distance increases, there is a greater error. YOLOv8 network has the advantages of fast recognition speed and high accuracy. This paper proposes a method by combining YOLOv8 network recognition with a monocular ranging method to achieve target localization and grasping for the NAO robots. By establishing a visual distance error compensation model and applying it to correct the estimation results of the monocular distance measurement model, the accuracy of the NAO robot's long-distance monocular visual positioning is improved. Additionally, a grasping control strategy based on pose interpolation is proposed. Throughout, the proposed method's advantage in measurement accuracy was confirmed via experiments, and the grasping strategy has been implemented to accurately grasp the target object.

Controlling the concentration of free radicals in polymerization systems is advantageous for preparing cationic polyacrylamide (CPAM) with high molecular weight and acceptable dissolvability. In this study, a novel ultraviolet (UV)-initiated system characterized with adjustable light intensity and redox-azo complex initiator was used to synthesize a CPAM flocculant named NP. Comparatively, another CPAM flocculant named SP with stable UV light intensity and single initiator was prepared. The chemical structure, morphology, and thermal stability were analyzed through instrumental analysis. Proton nuclear magnetic resonance indicated that NP was successfully prepared, and a small fraction of cationic homopolymer was mixed in the product. Polymerization conditions were optimized, and polymerization mechanism was determined by investigating the effects of various parameters on intrinsic viscosity, conversion, and dissolvability. Results showed that the best performance was obtained at indexes of 0.45 wt‰ redox initiator concentration, 0.2 wt‰ azo initiator concentration, 40.0 wt% of cationic monomer, first- and second-stage light intensities of 8.5 and 13 mW/cm², respectively, and 3 wt% urea. Sludge conditioning performances of NP and SP were comparatively evaluated, and the mechanism was determined by investigating the sedimentation behavior and floc size distribution. High intrinsic viscosity, porous morphology structure, and the mixed cationic homopolymer of NP resulted in better sludge conditioning performance.

This paper aims to quantify the influence of hydrogen embrittlement on Wierzbicki and Xue (W-X) model parameters. This model has 4 parameters which have been obtained by tensile tests on smooth specimens, tensile notch specimens, single notch tensile specimens (SENT) and pure shear specimens. Hydrogen embrittlement has been obtained by electrolytic method. Application of the (W-X) model has been done to get the local resistance used to predict failure by the Volumetric Method (VM). An example is given for the case of an embedded pipe submitted to service pressure and lateral seismic displacement. The effect of this displacement is then assimilated to the shearing of the straight section of the pipe. The pipe shows a corrosion defect considered a semi-elliptical crack. The influence of hydrogen embrittlement on local strain resistance and safety factors is discussed.

Rheumatoid arthritis (RA) is a complex disease triggered by the interaction between genetics and environment, especially through the shared epitope (SE) and cell surface calreticulin (CSC) theory. However, the available evidence shows that genetic diversity and environmental exposure cannot explain all the clinical characteristics and heterogeneity of RA. In contrast, recent studies demonstrate that epigenetics play important roles in the pathogenesis of RA, especially DNA methylation and histone modification. DNA methylation and histone methylation are involved in innate and adaptive immune cell differentiation, and migration, proliferation, apoptosis, and mesenchymal characteristics of fibroblast-like synoviocytes (FLS). Epigenetic-mediated regulation of immune-related genes and inflammation pathways explains the dynamic expression network of RA. In this review, we summarized the comprehensive evidence to show that methylation of DNA and histones is significantly involved in the pathogenesis of RA and could be applied as a promising biomarker in the disease progression and drug response prediction. We also explained the advantages and challenges of the current epigenetics research in RA. In summary, epigenetic modules provide a possible interface, through which genetic and environmental risk factors connect to contribute to the susceptibility and pathogenesis of RA. Additionally, epigenetic regulators provide promising drug targets to develop novel therapeutic drugs for RA. Finally, DNA methylation and histone modifications could be important features for providing a better RA subtype identification, to accelerate personalized treatment and precision medicine.

Developing and utilising of underground space is an vital direction for urban growth. Underground commercial streets, as a significant component of underground space accommodating extensive human social activities, and consequently necessitate the creation of human-scale spaces. In the evolution of urban design development towards greater refinement, applying architectural theories and excessively subjective designs has resulted in a deficiency of human-centered design and a disordered spatial environment. This study merges environmental psychology and architectural theory to determine the appropriate length of spatial scale. Two experiments focusing on spatial perception evaluation were conducted using a virtual experimental platform that featured varying dimensions of spatial scale combinations. These quantified combinations were correlated with perception evaluation, and regression analysis was employed to identify appropriate scale ranges, which were superimposed on the range of length selection. Finally, the optimal length and scale combination for underground commercial street spaces were established, providing a reference for the human-centered design of these environments.

Glass has emerged as a highly versatile substrate for various sensor and MEMS packaging applications, including electromechanical, thermal, optical, biomedical, and RF devices, due to its exceptional properties such as high geometrical tolerances, outstanding heat and chemical resistance, excellent high-frequency electrical properties, and the ability to be hermetically sealed. In these applications, Through-Glass-Via (TGV) plays a vital role in manufacturing and packaging by creating electrical interconnections through glass substrates. This paper provides a comprehensive summary of the research progress in TGV fabrication along with their integrations, including through-via formation and metallization. The paper also reviews the significant qualification and reliability achievements obtained by the scientific community for TGV. Additionally, the paper summarizes the application of TGV technology in various sensors.

Understanding the infiltration and solidification processes of liquid 5083Al alloy into Al2O3 three-dimensional reticulated porous ceramic (Al2O3(3D) RPC) is essential for optimizing the microstructure and properties of Al2O3(3D)/5083Al interpenetrating phase composites (IPCs) prepared by low-pressure infiltration process (LPIP). This study employs ProCAST software to simulate the infiltration and solidification processes of liquid 5083Al with pouring velocities (PV) of 0.4 m/s infiltrating into Al2O3(3D) RPC preforms with varying porosities at different pouring temperatures (PT) to prepare Al2O3(3D)/5083Al IPCs using LPIP. The results demonstrate that pore diameter of Al2O3(3D) RPC preforms and PT of liquid 5083Al significantly influence the of the infiltration. Solidification process analysis reveals that the Al2O3(3D) RPC preform with smaller pore diameters allows the lower pouring velocity of 5083Al to solidify faster compared to the preform with larger pore diameters. Al2O3(3D)/5083Al IPCs were prepared successfully from Al2O3(3D) RPC porosity of 15 PPI with liquid 5083Al at PV 0.4 m/s and PT 800 °C using LPIP, resulting in nearly fully dense composites, where both Al2O3(3D) RPCs and 5083Al interpenetrate throughout the microstructure. The infiltration and solidification defects were reduced under air pressure of 0.3 MPa (corresponding to PV of 0.4 m/s) during LPIP. Finite volume method simulations are in good agreement with experimental data, validating the suitability of the simplified model for Al2O3(3D) RPCs in the infiltration simulation.

MicroRNAs (miRNAs) play crucial roles in the regulation of the transcriptome and development of diseases including cancer and autoimmune diseases, such as rheumatoid arthritis (RA). Currently, a comprehensive map, illustrating how miRNAs regulate transcripts, pathways, immune system differentiation, and their interaction with terminal cells, such as T cells, fibroblast-like synoviocytes (FLS), osteoblasts, and osteoclasts, is still missing. In this review, we provide a thorough summary of the roles of miRNAs in the susceptibility to pathogenesis, diagnosis, therapeutic intervention, and prognosis of RA. Numerous miRNAs are abnormally expressed in cells involved in RA, and regulate target genes and pathways including the NF-κB, Fas-FasL, JAK-STAT, IRE1-RIDD, and mTOR pathways. By regulating gene expression, miRNAs affect T cell differentiation to diverse cell types, including Th17 and T-reg cells, and thus constitute promising gene therapy targets to modulate the immune system in RA. We summarize the diagnostic and prognostic potential of blood-circulating and cell-free miRNAs, highlighting the novel opportunities to combine these with rheumatoid factor (RF) and anti-cyclic citrullinated peptide (anti-CCP) to provide accurate diagnosis and prognosis, especially for seronegative patients. Furthermore, we outline how functional genetic variants of miR-499 and miR-146a partly explain the unmet susceptibility to RA. Additionally, we review the evidence implicating miRNAs as promising biomarkers of efficiency, response, and resistance to disease-modifying anti-rheumatic drugs (DMRDs) and immunotherapy. Finally, we discuss the autotherapeutic effect of miRNA intervention as a step toward the development of miRNA-based anti-RA drugs. Collectively, the current evidence supports miRNAs as interesting targets to better understand the pathogenetic mechanisms of RA and design more efficient therapeutic interventions.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

Rheumatoid arthritis (RA) is a chronic, systemic, abnormal inflammatory immune response. It is characterized by the involvement of the synovium and multiple organs and the destruction of joints and articular cartilage. Over the past 30 years, several promising novel compounds and antibodies have been developed for the treatment of RA. The introduction of new drugs and precision medicine for all forms of RA raises several issues related to access to novel treatments by patients, optimal regimen selection, cost-effectiveness, prognosis monitoring and outcome surveillance, particularly with regarding to the development of low drug response rates, drug resistance and adverse side effects. Tremendous attention has been given to the identification of optimized drug combinations for the treatment of RA, particularly in early high-risk vulnerable and early individuals. Addressing these issues requires novel therapeutic approaches with new mechanisms and the establishment of accurate guidelines for drug selection, drug recombination, and non-chemical therapeutic efforts. In this study, we reviewed the most exciting recently established or ongoing novel drugs and methods according to the clinical trial database maintained by the United States National Library of Medicine and discussed the trends in RA drug development and challenges in the treatment, providing a reference significant for the accurate treatment of RA and the research direction in the future.

This paper investigates the cooperative anti-jamming distributed channel selection problem in UAV communication networks. Considering the existence of malicious jamming and co-channel interference, a location-aware cooperative anti-jamming scheme is designed for the purpose of maximizing the users' utilities. Users in the UAV group cooperate with each other via location information sharing. When the received interference energy is lower than mutual interference threshold, users conduct channel selection strategies independently. Otherwise, users take joint actions with a cooperative anti-jamming pattern under the impact of mutual interference. Aimed at the independent anti-jamming channel selection problem under no mutual interference, a Markov Decision Process framework is introduced, whereas for the cooperative anti-jamming channel selection case under the influence of co-channel mutual interference, a Markov game framework is employed. Furthermore, motivated by reinforcement learning with a ``Cooperation-Decision-Feedback-Adjustment" idea, we design a location-aware cooperative anti-jamming distributed channel selection algorithm (LCADCSA) to obtain the optimal anti-jamming channel strategies for the users with a distributed way. In addition, the channel switching cost and cooperation cost, which have great impact on the users' utilities, are introduced. Finally, simulation results show that the proposed algorithm converges to a stable solution with which the UAV group can avoid the malicious jamming as well as co-channel interference effectively.

Two interesting compounds such as quaternary ammonium lignin(QAL) and 2-ethylhexyl phosphoric acid mono-2-ethylhexyl ester (P507) were synthesized as ionic liquids(QP-ILs) for the extraction of metal ions. The extraction behavior of Co(II) and Ni(II) from chloride solution was compared between QP-ILs and P507. The results showed that the extraction rates of Co(II) and Ni(II) in the two solutions varied with the extraction conditions, but QP-ILs has stronger extractability for cobalt than P507, while Ni is on the contrary. Under the same conditions, the Co/Ni separation performance(βCo/Ni) in QP-ILs is superior to that in p507. At pH4.0, 55℃, concentration of 20%, extraction time of 10 minutes, the βCo/Ni of QP-ILs reached to 2703, while that of P507 was only 164. In conclusion, QP-ILs was more efficient than P507 for separating Co from mixed solutions.

Simultaneous Localization and Mapping (SLAM), as one of the core technologies in intelligent robotics, has gained substantial attention in recent years. Addressing the limitations of SLAM systems in dynamic environments, this research proposes a system specifically designed for plant factory transportation environments, named GY-SLAM. GY-SLAM incorporates a lightweight target detection network GY based on YOLOv5, which utilizes GhostNet as the backbone network. This integration is further enhanced with CoordConv coordinate convolution, CARAFE up-sampling operators, and SE attention mechanism, leading to simultaneous improvements in detection accuracy and model complexity reduction. While improving [email protected] by 0.514%, the model simultaneously reduces the number of parameters by 43.976%, computational cost by 46.488%, and model size by 41.752%. Additionally, the system constructs pure static octree maps and grid maps. Tests conducted on the TUM dataset and a proprietary dataset demonstrate that GY-SLAM significantly outperforms ORB-SLAM3 in dynamic scenarios in terms of system local-ization accuracy and robustness. It shows a remarkable 92.58% improvement in RMSE for Absolute Trajectory Error (ATE). Compared to YOLOv5s, the GY model brings a 41.5944% improvement in detection speed and a 17.7975% increase in SLAM operation speed to the system, indicating strong competitiveness and real-time capabilities. These results validate the effectiveness of GY-SLAM in dynamic environments and provide substantial support for the automation of logistics tasks by robots in specific contexts.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

The formation of atroposelective biaryl compounds in plants and fungi is well understood; however, the polyketide aglycone synthesis and dimerization in bacteria remain unclear. Thus, the biosynthetic gene cluster (BGC) responsible for antibacterial setomimycin production from Streptomyces nojiriensis JCM3382 was examined in comparison with the BGCs of spectomycin, julichromes, lincolnenins, and huanglongmycin. Setomimycin BGC includes post-PKS assembly/cycling enzymes StmD (C-9 ketoreductase), StmE (aromatase), and StmF (thioesterase) as key components. The heterodimeric TcmI-like cyclases StmH and StmK are proposed to aid in forming the setomimycin monomer. In addition, StmI (P-450) is predicted to catalyze biaryl coupling of two monomeric setomimycin units, with StmM (ferredoxin) specific to setomimycin BGC. The roles of StmL and StmN, part of the nuclear transport factor 2 (NTF-2)-like protein family and unique to setomimycin BGCs, could particularly interest biochemists and combinatorial biologists. α-Glucosidase, a key enzyme in type 2 diabetes, hydrolyzes carbohydrates into glucose, thereby elevating blood glucose levels. This study aimed to assess the α-glucosidase inhibitory activity of EtOAc extracts of JCM 3382 and setomimycin. The JCM 3382 EtOAc extract and setomimycin exhibited greater potency than the standard inhibitor, acarbose, with IC50 values of 285.14 ± 2.04 μg/mL and 231.26 ± 0.41 μM, respectively. Kinetic analysis revealed that setomimycin acts as a competitive inhibitor of α-glucosidase. Molecular docking demonstrated two hydrogen bonds with maltase-glucoamylase chain A residues Thr205 and Lys480 (binding energy = −6.8 kcal·mol⁻¹), two π-π interactions with Trp406 and Phe450, and one π-cation interaction with Asp542. Residue-energy analysis highlighted Trp406 and Phe450 as key in setomimycin's binding to maltase-glucoamylase. These findings suggest that setomimycin is a promising candidate for further enzymological research and potential antidiabetic therapy.

MicroRNAs (miRNAs) play a pivotal role in important biological processes by regulating posttranscriptional gene expression and exhibit differential expression patterns during development, immune responses, and stress challenges. The diamondback moth causes significant economic damage to crops worldwide. Despite substantial advancements in understanding the molecular biology of this pest, our knowledge regarding the role of miRNAs in regulating key immunity-related genes remains limited. In this study, we leveraged whole transcriptome resequencing data from P. xylostella infected with Metarhizium anisopliae to identify specific miRNAs targeting the prophenoloxidase-activating protease1 (PAP1) gene through bioinformatic analysis. Seven miRNAs (pxy-miR-375-5p, pxy-miR-4448-3p, pxy-miR-279a-3p, pxy-miR-3286-3p, pxy-miR-965-5p, pxy-miR-8799-3p and pxy-miR-14b-5p) were identified and validated. Luciferase reporter assays confirmed that pxy-miR-279a-3p binds to the open reading frame (ORF) and pxy-miR-965-5p to the 3’ untranslated region (3’ UTR) of PAP1. Our experiments demonstrated that injecting a pxy-miR-965-5p mimic significantly reduced PAP1 expression in P. xylostella larvae, suppressing PO activity and increasing larval mortality rate. Conversely, the injection of inhibitors obtained opposite results. Furthermore, we identified four LncRNAs (MSTRG.32910.1, MSTRG.7100.1, MSTRG.6802.1, and MSTRG.22113.1) that potentially interact with pxy-miR-965-5p. Interference assays using antisense oligonucleotides (ASO) revealed that silencing MSTRG.7100.1 and MSTRG.22113.1 increased the expression of pxy-miR-965-5p. These findings shed light on the potential role of pxy-miR-965-5p in the immune response of P. xylostella to M. anisopliae infection and provide a theoretical basis for biological control strategies targeting the immune system of this pest.

Acanthamoeba keratitis (AK) is a blinding corneal infection caused by the protozoan Acanthamoeba. The long-term course of AK suggests the host immunity could not kill Acanthamoeba rapidly. The immune status is still unclear in the late stage of AK. The comparative transcriptome analysis was made based on the bulk RNA sequencing of cornea tissues from AK patients and donors. Differentially expressed genes and enriched signaling pathways were calculated. CIBERSORT algorithm was used for Immune infiltration analysis of cornea tissue between AK and normal controls. A total of 2668 differentially expressed genes, including 1477 upregulated genes and 1191 downregulated genes, were detected. Gene Ontology analysis revealed that the pathways were significantly enriched in leukocyte migration, regulation of T cell activation, the external side of plasma membrane, collagen-containing extracellular matrix, immune receptor activity and cytokine binding. KEGG pathway analysis showed that the pathways were significantly enriched in the cytokine-cytokine receptor interaction, hematopoietic cell lineage and Staphylococcus aureus infection pathway. The immune infiltration profiles varied little between AK and normal controls. Compared with normal tissue, cornea tissue of AK contained a higher proportion of M0 macrophages and CD8 T cells, while resting memory CD4 T cells contributed to a relatively lower portion (P &lt; 0.05). Finally, the expression levels of cell markers and SLAMF7/STAT6 pathway were confirmed by histopathology examinations, RT-qPCR and western blot.

Abstract: (1) Background: Cancer immune escape is associated with the metabolic reprogramming of TME, and combining metabolic targets with immunotherapy has great potential to improve clinical outcomes. Among all metabolic processes, lipid metabolism, especially fatty acid (FA) metabolism, has a huge role in cancer cell survival, migration, and proliferation, but its mechanism and role in the tumor immune microenvironment remain to be investigated. (2) Methods: We comprehensively analyzed 309 fatty acid-related genes, screened 121 different genes, and used one-way COX regression to select 15 genes with prognostic impact. Systematically evaluated the correlation between FMGs modification patterns and Tumor Microenvironment Infiltration, prognosis, and Immunotherapy. The FMGs-Score was constructed to quantify the FMGs modification patterns using principal component analysis. (3) Results: Three clusters based on FMGs-related genes were demonstrated in breast cancer, with three patterns of distinct immune cell infiltration and biological behavior. An FMGsScore signature was constructed to reveal that patients with a low FMGsScore had higher immune checkpoint expression, higher immune checkpoint inhibitor (ICI) scores, increased immune microenvironment infiltration, better survival advantage, and were more sensitive to immunotherapy than those with a high FMGsScore. Finally, the expression and function of the signature key gene NDUFAB1 were examined by in vitro experiments. (4) Conclusions: This study significantly demonstrates the non-negligible role of FMGs in the immune microenvironment of breast cancer, and that FMGsScores can be used to guide the prediction of immunotherapy in breast cancer patients. In in vitro experiments, knockdown of the NDUFAB1 gene resulted in reduced proliferation and migration of MCF-7 cell lines.

In this paper, the sol−gel method was used to synthesize powders of LaMnO3 (LMO), La0.85Ca0.15MnO3 (LCM), and La0.85Sr0.15MnO3 (LSM). We investigated the impact of substituting Ca and Sr at the A−site on the perovskite crystal structure and electrochemical capabilities of LMO. LCM retained its orthogonal structure in comparison to the parent LMO components, whereas LSM transitioned to a rhombic structure. At 0.5 A/g, the specific capacitance of LCM and LSM electrodes is 185.5 F/g and 248 F/g, respectively.The specific capacitance of LCM was more three times than that of the LMO electrode. Among the three samples (LMO, 22.25 m2 g−1; LSM, 31.56 m2 g−1), the LCM sample exhibited the highest specific surface area of 38.79 m2 g−1. The charge transfer resistances of the LMO, LCM, and LSM are 0.48 Ω, 0.36 Ω, and 0.38 Ω, correspondingly. The LCM electrode exhibits the greatest capacitance performance due to its more refined morphology, increased concentration of oxygen vacancy, and more complete utilization of the perovskite bulk structure. The above results demonstrate that Ca or Sr substitution of A−site compounds has great potential for supercapacitor applications.

Tuning fork gyroscopes (TFGs) are promising for potential high-precision applications. This work proposes and experimentally demonstrates a novel high-Q dual mass tuning fork microelectro-mechanical system (MEMS) gyroscope utilizing three-dimensional (3D) packaging techniques. Except for two symmetrically-decoupled proof masses (PM) with synchronization structures, a symmetrically-decoupled lever structure is designed to force the antiparallel, antiphase drive-mode motion and basically eliminate the low-frequency spurious modes. The thermoelastic damping (TED) and anchor loss are greatly reduced by the linearly-coupled, momentum- and torque-balanced antiphase sense mode. Besides, a novel 3D packaging technique is used to realize high Q-factors. A composite substrate encapsulation cap, fabricated by through-silicon-via (TSV) and glass-in-silicon (GIS) reflow processes, is anodically bonded to the sensing structures at wafer scales. A self-developed control circuit is adopted to realize loop control and characterize gyro-scope performances. It is shown that a high-reliability electrical connection together with a high-air-impermeability package can be fulfilled with this 3D packaging technique. Furthermore, the Q-factors of the drive and sense modes reach up to 51947 and 49249, respectively. This TFG realizes a wide measurement range of ±1800° /s and a high resolution of 0.1° /s with a scale-factor nonlinearity 720 ppm after automatic mode-matching. Besides, the long-term zero-rate output (ZRO) drift can be effectively suppressed by temperature compensation, inducing a small angle random walk (ARW) of 0.923°/√h and a low bias instability (BI) of 9.270°/h.

With the development of designing and manufacturing level for micro-electromechanical system (MEMS) gyroscopes, the control circuit system becomes a key point to determine their internal performances. Nevertheless, phase delay of electron components may result in some serious hazards. This paper describes a real-time circuit phase delay correction system for MEMS vibratory gyroscopes. A detailed theoretical analysis is provided to clarify the influences of circuit phase delay on the in-phase and quadrature (IQ) coupling characteristics and zero rate output (ZRO) utilizing force-to-rebalance (FTR) closed-loop detection and quadrature correction system. By deducing the relationship between amplitude-frequency, phase-frequency of MEMS gyroscope and the phase relationship of the whole control loop, a real-time correction system is proposed to automatically adjust the phase reference value of phase-locked loop (PLL) and thus compensate for the real-time circuit phase delay. The experimental results show that the correction system can accurately measure and compensate the circuit phase delay in real time. Furthermore, the unwanted IQ coupling can be eliminated and the ZRO is decreased by 755% to 0.095°/s. This correction system realizes a small angle random walk of 0.978°/√h, and a low bias instability of 9.458°/h together with a scale factor nonlinearity of 255 ppm at room temperature. Besides, the thermal drift of ZRO is reduced to 0.0034°/s/°C at a temperature range from -20°C to 70°C.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

In today's highly digitized and globalized financial environment, the need to protect payment systems from risk is more urgent than ever. Artificial intelligence (AI) technology is rapidly becoming a key tool in this space, with machine learning algorithms, big data analytics, and real-time monitoring enabling AI to effectively detect and prevent fraudulent activity, optimize risk management processes, and deliver intelligent services. AI not only improves the security and efficiency of payment systems, but also significantly improves customer satisfaction and loyalty. With the continuous development of AI technology and financial payment technology, the financial payment industry will usher in more innovations and changes in the future, further optimizing the payment process, improving payment efficiency, and ensuring payment security.

This study investigates the spatial and temporal dynamics of Paomo restaurants in Xi'an's central urban area from 2012 to 2023, leveraging Point of Interest (POI) data through a series of sophisticated analytical techniques. Methods including nearest neighbor distance, kernel density estimation, and band set statistical analysis were employed to thoroughly examine the evolutionary patterns and key drivers influencing the spatial distribution of these eateries. Our results highlight a notable trend of expansion from the central city to the periphery, characterized by significant spatial agglomeration. Initially concentrated in the city center, the distribution of Paomo restaurants has progressively shifted towards multiple distinct cores, reflecting the dual influence of urban policy initiatives and the dynamics of market competition. Furthermore, the research identifies several pivotal factors shaping this spatial distribution, particularly transportation access, residential quality of life, and the availability of commercial services. These findings demonstrate the profound effects of urban spatial reconfiguration and socioeconomic development on the specialized catering industry. The insights gleaned from this analysis offer valuable guidance for urban planners and policymakers, providing strategic recommendations for the spatial planning of specialty catering services to optimize urban layouts and foster sustainable economic progress.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Amid escalating urbanization, devising rational commercial space layouts is a critical challenge. Leveraging machine learning, this study uses a Back-propagation (BP) neural network to optimize commercial spaces in Weinan City's central urban area. The results indicate an increased number of commercial facilities with a trend of multi-centered agglomeration and outward expansion. Based on these findings, we propose a strategic framework for rational commercial space development emphasizing aggregation centers, development axes, and spatial guidelines. This strategy provides valuable insights for urban planners in small and medium-sized cities in the Yellow River Basin and metropolitan areas, ultimately showcasing the power of machine learning in enhancing urban planning.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Adipose tissue composition contributes greatly to the quality and nutritional value of meat. Transcriptomic and lipidomic techniques were used to investigate the molecular mechanism of fat deposition difference among Ningxiang, Berkshire and F1 pigs. Transcriptomic analysis identified 680, 592 and 380 differentially expressed genes (DEGs) by comparing the groups of Ningxiang pigs vs Berkshire pigs, Berkshire pigs vs F1 pigs, Ningxiang pigs vs F1 pigs. Lipidomic analysis screened 423, 252, and 50 significantly changed lipids (SCLs) by comparing the groups of Ningxiang pigs vs Berkshire pigs, Berkshire pigs vs F1 pigs, Ningxiang pigs vs F1 pigs. Lycine, serine and threonine metabolism pathway, fatty acid biosynthesis and metabolism related pathways were siginificant enriched in the groups of Berkshire pigs vs Ningxiang pigs and Berkshire pigs vs F1 pigs. The DEGs (PHGDH, LOC110256000) and the SCLs (Phosphatidylserines) may have a great impact on lycine, serine and threonine metabolism pathway. Moreover, the DEGs (FASN, ACACA, CBR4, SCD, ELOV6, HACD, CYP3A46, CYP2B22, GPX1, GPX3) and the SCLs (palmitoleic acid, linoleic acid, arachidonic acid, icosadienoic acid) play important role in fatty acid biosynthesis and metabolism. Thus, the fat deposition difference among Ningxiang, Berkshire and F1 pigs may be caused by the difference of the expression pattern of key genes in multiple enrichment KEGG pathways. The research presented multiple lipids that were potentially available biological indicator and screened key genes that were potentially gene targets for molecular design breeding. The research also explored the molecular mechanisms of fat deposition difference among Ningxiang, Berkshire and F1 pigs and provides insight into the selection of backfat thickness and fat composition of adipose tissue for future breeding strategies.

The escalation of mining activities in the karst regions of Guizhou Province has heightened the occurrence of water-inrush incidents in deep coal mines. This study focused on water-inrush phenomena within the Xinhua mining area of Jinsha County, Guizhou Province, aiming to investigate the sources of these incidents. The findings indicated that the overlying limestone of the Changxing Formation in the coal seam served as a vulnerable aquifer under certain conditions, leading to water inrushes. The analysis of the spatiotemporal distribution patterns of water-inrush incidents at the working face indicated that previous mining operations damaged the shallow Changxing Formation limestone, resulting in the accumulation of goaf water and the formation of numerous mining-induced fractures. These fractures served as rapid conduits for water inrushes from both atmospheric precipitation and underground sources at the deep working face. The examination of surface water and mine water quality demonstrated that both exhibited similar characteristics, predominantly featuring bicarbonate, sulfate, and sodium compositions. Investigation into the relationship between mine water inflow and atmospheric precipitation established that atmospheric precipitation influenced the mine water supply cycle, with a replenishment period of ~10 months during the operational phase of the Jinyuan Coal Mine and about one month post-closure. The fractures induced by mining activities within the Changxing Formation limestone facilitated water flow, with atmospheric precipitation serving as the primary water source for the mine. This study offered a valuable scientific foundation for addressing water-related damage resulting from atmospheric precipitation in mines susceptible to water inrushes under analogous hydrogeological conditions.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Purpose: To elucidate the mechanism of CXCR4/EAAT1/GS pathway in CXCL12 regulating invasion and migration in malignant pleural mesothelioma (MPM). Methods: Immunohistochemistry for CXCL12, CXCR4, EAAT1 and GS stainings and correlation analysis between them were conducted in MPM and normal tissues. Western blot and real-time PCR were performed to examine the CXCR4, EAAT1 and GS expression in H2052 cells. Wound healing and transwell assay were applied to determine the cell migration and invasion. MTT was utilized to assess cell viability. Results: CXCL12, CXCR4, EAAT1 and GS were highly expressed in MPM tissues and correlated with each other. CXCL12 upregulated both in protein and mRNA levels of CXCR4, EAAT1 and GS in H2052 cells. The EAAT1 and GS expression upregulated or not by CXCL12 were decreased by CXCR4 and EAAT1 knockdown. CXCR4 antagonist AMD3100 and EAAT1 antagonist TFB-TBOA also resulted in the same effects as CXCR4 and EAAT1 knockdown, respectively. CXCL12 promoted cell invasion and migration and increased the Matrix metalloproteinase 9 (MMP9) mRNA level. CXCR4 and EAAT1 knockdown suppressed all these functions. Furthermore, CXCL12 promoted H2052 cells growth in nude mice, both AMD3100 and TFB-TBOA inhibited this promotion. Conclusions: CXCL12 regulated the invasion and migration through CXCR4/EAAT1/GS pathway in H2052 cells.

This study used Dutch potatoes at the end of dormancy as the material to explore the impact of menthol (0.2 and 0.5 g/kg based on potato mass) treatment on sprouting inhibition and potato quality. The findings revealed that a menthol concentration of 0.5 g/kg effectively inhibited potato tuber sprouting and significantly reduced glucoside alkaloids production. After a storage period of 15 days, the sprouting percentage and glucoside alkaloids content of potatoes treated with 0.5 g/kg menthol were observed to be significantly lower at 4.17% and 68.63 mg/kg, respectively, compared to the control group which exhibited values of 100% and 282.01 mg/kg, respectively (P < 0.05). Throughout the storage period, 0.5 g/kg of menthol promoted respiration, reduced malondialdehyde production in potatoes, inhibited polyphenol oxidase activity, and slowed down tissue browning. Additionally, it mitigated the decline in starch and soluble protein content, inhibiting the accumulation of reducing sugars.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Civic participation is of great significance to urban management decision-making. In order to facilitate citizens to participate in city management decision-making, this paper proposes a large-scale group decision-making (LSGDM) method based on multi-granular probabilistic linguistic preference relations (MG-PLPRs). First, each decision maker selects a language terms set from the multi-granularity language terms set to represent individual preference relations and the MG-PLPRs are obtained by statistical calculation to represent sub-group’s preferences information. Then, an optimization model based on the expected consistency of PLPR and consensus measure of groups is established to achieving consensus reaching processes, which can ensure satisfactory individual consistency and group consensus. Finally, the validity and applicability of the proposed method is verified by a case of a city "shared garden" site selection with the participation of citizens.

This paper proposed an optimal tracking control scheme through adaptive dynamic programming(ADP) for a class of partially unknown discrete-time nonlinear systems based on radial basis function neural network(RBF-NN). In order to acquire the unknown system dynamics, we use two RBF-NNs, the one is used to construct the identifier, and the another is used to directly approximate the steady-state control input, where a novel adaptive law is proposed to update neural network weights. While the optimal feedback control and the cost function are derived via feedforward neural networks approximating, it is proposed to regulate the tracking error, the critic network and the actor network are then trained online to obtain the solution of the associated Hamilton–Jacobi–Bellman (HJB) equation being built under the ADP framework. Simulations verify the effectiveness of the optimal tracking control technique using the neural networks.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Carbon dots are carbon based nanoparticles, which have the characteristics of simple preparation process, photoluminescence, biocompatibility, adjustable surface function, water solubility, and low toxicity. They are widely used in biological applications such as imaging, biosensing, photocatalysis, and molecular transfer. It has also aroused great interest among researchers in agriculture and has made significant progress in improving crop growth and production. This review presents the physiological functions of carbon dots for crop growth and development, photosynthesis, water and nutrient absorption, and abiotic stress resistance and their applications in improving ecological environment and agriculture as biosensors, and the future application prospects and research directions of carbon dots in agriculture were prospected.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

Real-time object detection remains a pivotal topic in the realm of computer vision. Balancing the accuracy and speed of object detectors poses a formidable challenge for both academic researchers and industry practitioners. While recent transformer-based models have showncase the prowess of the attention mechanism, delivering remarkable performance improvements over CNNs, their computational demands can hinder their effectiveness in real-time detection tasks. In this paper, we elect to use YOLOX as our robust starting point and introduce a series of effective enhancements, culminating in a new high-performance detector named YOLOAX. To further exploit the power of the attention mechanism, we devise multi-dimensional attention-based modules that activate CNNs, emphasizing the most pertinent regions and bolstering the capacity to learn the most informative image representations from feature maps. Moreover, we introduce a novel leading label assignment strategy called STA, along with a groundbreaking loss function named GEIOU Loss, to further refine our detector's performance. We provide extensive ablation studies on the COCO and PASCAL VOC 2012 detection datasets to validate our proposed methods. Remarkably, our YOLOAX is trained solely on the MS-COCO dataset from scratch, without leveraging any prior knowledge, which achieves an impressive 54.2% AP on the COCO 2017 test set while maintaining a real-time speed of 72.3 fps, surpassing YOLOX by a significant margin of 3.0% AP. Our source code and pre-trained models are openly accessible at https://github.com/KejianXu/yoloax.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Cotton is one of the most important economic crops in the world, whereas insect attacks is a prime cause of its losses on yield and quality. Despite it is important, little is known about the mechanism of cotton response to insect. In this study, we simulated insect feeding by applying insect oral secretions (OS) to wounds, and combined transcriptome and metabolome analysis to comprehensively investigate how OS from two major pest species (Helicoverpa armigera and Spodoptera litura) affect cotton defense responses. Obvious differences were observed that 12,668 and 13,379 genes differently expressed respectively in cotton after being treated with different OS when compared with wounding along. Upon the addition of OS, JA-signaling pathway were rapidly and strongly induced, however SA-biosynthesis related gens were significantly down-regulated. By constructing the co-expression gene network, we identified a hub gene which encoding a leucine-rich repeat receptor kinase may play important role in recognition and signal transduction at early stage. We also found that OS from different insect species altered abundance of flavonoid related compound with different patterns. Interestingly, Gossypol which is a well-known anti-insect compound was kept a relative low content after OS application relative to wounding which implied the existence of the suppression effects of OS to cotton defense response. This study illustrated the transcriptional and metabolic changes of cotton in responding to OS from two chewing insect species, identified potential key gene during the interaction process and finds the evidence for OS’s inhibition effects on cotton defense response.

The rapid growth of the sharing economy has propelled shared mobility to the forefront of attention. The continuous advancement of autonomous driving technology also brings new opportunities and challenges to the shared mobility market. This study comprehensively analyzes the market potential concerning autonomous vehicles (AVs) to provide shared mobility services, utilizing SWOT analysis, PESTLE analysis, and Porter’s Five Forces. The findings reveal that AVs can provide improved shared mobility services by increasing transportation safety, reducing emissions, reducing costs, enhancing traffic efficiency, and increasing customer satisfaction and the profitability of shared mobility services. However, challenges such as technological and policy uncertainties, safety concerns, high initial costs, inadequate public communication infrastructure, and the absence of standardized regulations can hinder the widespread adoption of AVs. The benefits are also restricted with a low market penetration rate of AVs. To promote AVs in the shared mobility market, this study also provides implications for AV stakeholders tailored to the evolving shared mobility market dynamics.

High dimensional statistical analysis for the yield of large-scale circuits is quite difficult due to expensive simulations, especially for the memory circuits with high sigma requirement (e.g., SRAM). In this paper, we developed an efficient sparse additive model to substitute simulations. To fit high sigma region accurately, the modeling center is moved to near failure boundary searched by scaling the shape of sampling function. To solve the model efficiently, the process variables are grouped by standard cells so that the model can be solved by our developed blockwise greedy algorithm. The experiments on the 28nm memory circuits validate that our method achieves high accuracy and efficiency compared with other state-of-art works.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

We study a two-echelon supply chain made up of a supplier and a manufacturer, both of which can reduce their component/product carbon emissions. With the vertical technology spillovers, we explore the optimal decisions of centralized and decentralized supply chains with price dependent demand and propose coordination strategy for the decentralized supply chain. Considering the cost contraction effectiveness of the technology spillovers, the centralized and decentralized game theoretic models of a two-echelon supply chain are developed to investigate optimal decisions of pricing and carbon emissions reduction. Through a systematic comparison and numerical analysis, we show that the profits of both players and the entire supply chain improve with the effect of technology spillovers increasing. Carbon emissions reduction will be taken by various protective measures so that the supplier and the manufacturer who do not innovate can hardly share the results of innovating via the “free-riding” methods when the technology spillover is relatively small. We also propose a revenue-cost sharing contract through bargaining to enhance the performance of the decentralized supply chain.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The use of chimeric antigen receptor (CAR) in natural killer (NK) cells for cancer therapy is gaining momentum, marking a significant shift in cancer treatment. This review aims to explore the potential of CAR-NK cell therapy in cancer immunotherapy, providing a fresh perspective. It discusses the innovative approaches in CAR-NK cell design and engineering, particularly targeting refractory or recurrent cancers. By comparing CAR-NK cells with traditional therapies, the review highlights their unique ability to tackle tumor heterogeneity and immune system suppression. Additionally, it explains how novel cytokines and receptors can enhance CAR-NK cell efficacy, specificity, and functionality. The review underscores the advantages of CAR-NK cells, including reduced toxicity, lower cost, and broader accessibility compared to CAR-T cells, along with their potential in treating both blood cancers and solid tumors.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

As a precious natural resource, forests are being destroyed. In previous studies, there is a lack of interactive assessment of its distribution that comprehensively considers multiple external disturbances. This paper takes the Barcelona Metropolitan Region as an example. Based on remote sensing, it analyzes the development process of the forest from 2006 to 2018 through multiple landscape indicators, and OLS models were established to analyze variables that have direct and indirect effects on forest distribution. In addition, the ecological structure of the forest was analyzed based on NDVI. It was found that the forest area is the largest but has been decreasing, becoming more complex in distribution structure. Much of the forest was converted to agricultural land and grassland. The green quality of forests was increasing, and the broad-leaved forest, the second largest area, contributes the most. NDVI is the most important positively correlated variable, and daytime surface temperature is an important inverse factor related to NDVI. In addition, NDBI is also a negative condition that inhibits forest development. In conclusion: The BMR forest area is decreasing and becoming more fragmented. NDVI and daytime LST are the two most significant factors. Climate warming may lead to worse forest development.

The development of computational acoustics allows simulation of sound generation and propagation in complex environment. In particular, meshfree methods are widely used to solve acoustics problems through arbitrarily distributed field points and approximation smoothness flexibility. As a Lagrangian meshfree method, smoothed particle hydrodynamics (SPH) method reduce the difficulty in solving problems with deformable boundaries, complex topologies, or multiphase medium. The traditional SPH method has been applied in acoustic simulation. This study presents the corrective smoothed particle method (CSPM), which is a combination of SPH kernel estimate and Taylor series expansion. The CSPM is introduced as a Lagrangian approach to improve accuracy in solving acoustic wave equations in the time domain. Moreover, a boundary treatment technique based on the hybrid meshfree and finite difference time domain (FDTD) method is proposed to represent different acoustic boundaries with particles. To model sound propagation in pipes with different boundaries, soft, rigid, and absorbing boundary conditions are built with this technique. Numerical results show that the CSPM algorithm is consistent and demonstrates convergence with exact solutions. Main computational parameters are discussed, and different boundary conditions are validated to be effective for benchmark problems in computational acoustics.

Few-shot object detection (FSOD) aims to address the challenge of requiring a substantial amount of annotations for training in conventional object detection, which is very labor-intensive. However, existing few-shot methods achieve high precision with the sacrifice of time-consuming for exhaustive fine-tuning, or take poor performance in novel-class adaptation. We presume the major reason is that the valuable correlation feature among different categories is insufficiently exploited, hindering the generalization of knowledge from base to novel categories for object detection. In this paper, we propose Few-Shot object detection via Correlation-RPN and Transformer Encoder-Decoder (CRTED), a novel training network to learn object-relevant features of inter-class correlation and intra-class compactness while suppressing object-agnostic features in the background with limited annotated samples. And we also introduce a 4-way tuple-contrast training strategy to positively activate the training progress of our object detector. Experiments over two few-shot benchmarks (Pascal VOC, MS-COCO) demonstrate that, our proposed CRTED without further fine-tuning can achieve comparable performance with current state-of-the-art fine-tuned works. The codes and pre-trained models will be released.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

With the continuous advancement of digital transformation, digital payments are playing an increasingly important role in the financial industry. This study aims to utilize machine learning models to predict and analyze digital payment behavior. Initially, the background and significance of digital payments in the financial sector are introduced. Subsequently, the current status and trends of traditional digital payment distribution are reviewed, alongside related work on digital payment behavior prediction. Methodologically, principles and applications of machine learning models such as logistic regression, decision trees, and random forests are elaborated, along with experimental design and data preprocessing methods. The experimental results and discussion section illustrates the performance of each model in digital payment prediction and explores their impact on credit decisions. This exploration equips financial institutions with more effective user behavior analysis and risk management tools, thereby fostering future development and application of digital payment technologies.

The eddy current loss should be optimized to be as less as possible for the stability of permanent magnet in high speed permanent magnet synchronous motor (HSPMSM) rotor and ensure the high efficiency and low temperature of the motor. This paper analyzes the eddy current distribution in rotor, with consideration of the conflict of the thickness of sleeve and diameter of the rotor, calculating the eddy current loss (ECL) and the thermal distribution via Separation of variables method for solving Maxwell's equations with analytical hieratical model of ECL constructed. The optimization result of ECL of the HSPMSM whose power and rated speed is 30kw 48000r/min can be got by multi-objective optimization method, combined weighting coefficient method and traversal algorithm based on chaotic local search particle swarm optimization (CLSPSO), utilizing ECL analytical model and other analytical constraints. Related experiment and measurement has been implemented with new approach of loss separation.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

The belief in online news has become a hot topic. Previous studies have shown the role of emotion in susceptibility to believing fake news. However, Few studies have explored the effect of empathy on belief in online news. This study investigated the relationships between trait empathy, state empathy, the belief in online news, and the potential moderating effect of the news type. One hundred and forty undergraduates evaluated 50 online news pieces (25 real, 25 fake) regarding their believability, state empathy, valence, arousal, and familiarity. Trait empathy data were collected using the Chinese version of the Interpersonal Reactivity Index. State empathy was positively correlated with affective empathy in trait empathy and believability, and affective empathy was positively correlated with believability. The influence of affective empathy on news belief was partially mediated by state empathy, regulated by the news type (fake, real). We discussed the influence of empathy on the belief in online news and its internal processes. This study explains some unique insights for researchers, practitioners, social media users, and social media platform providers.

'Huangguan' pear has significant social and economic value, and phosphorus, as one of the three main mineral elements of plants, has an irreplaceable effect on the normal growth of 'Huangguan' pear trees. The objective of this study was to predict the content of phosphorus in the pulp and peel of ‘Huangguan’ pears nondestructively and conveniently by using near-infrared spectroscopy (900–1700 nm) technology. First, twelve algorithms are used to preprocess the original spectral data, and the partial least squares regression algorithm and the gradient boosting regression tree algorithm are used to build a full-band prediction model based on the original spectral data and the processed spectral data. The characteristic wavelengths were extracted using genetic algorithms, followed by establishing a characteristic wavelength prediction model. The prediction accuracy of the models was evaluated according to the coefficient of determination R² and the relative analysis error RPD. The study found that the best prediction model for predicting phosphorus content in the pulp of 'Huangguan' pear was MSC-GA-PLSR, which had R²=0.843 and RPD=1.857 in the modelling set and R²=0.989 and RPD=7.041 in the prediction set. The best prediction model for predicting phosphorus content in the peel of ‘Huangguan’ pear was SG+SNV+FD-GA-PLSR, which had R²=0.991 and RPD=7.470 in the modelling set and R²=0.974 and RPD=4.414 in the prediction set, and the effect was good and met expectations. The results demonstrated that near-infrared spectroscopy could successfully achieve nondestructive detection of phosphorus content in the pulp and peel of 'Huangguan' pears.

Effective prediction of wastewater treatment is beneficial for precise control of wastewater treatment processes. The nonlinearity of pollutant indicators such as COD and TP makes the model difficult to fit and has low prediction accuracy. The classical deep learning methods have been shown to perform nonlinear modeling. However, there are enormous numerical differences between multi-dimensional data in the prediction problem of wastewater treatment, such as COD above 3000 mg/L and TP around 30 mg/L. It will make current normalization methods challenging to handle effectively, leading to the training failing to converge and the gradient disappears or exploding. This paper proposes a multi-factor prediction model based on deep learning. The model consists of a combined normalization layer and a codec. The combined normalization layer combines the advantages of three normalization calculation methods: z-score, Interval, and Max, which can realize the adaptive processing of multi-factor data, fully retain the characteristics of the data, and finally cooperate with the codec to learn the data characteristics and output the prediction results. Experiments show that the proposed model can overcome data differences and complex nonlinearity in predicting industrial wastewater pollutant indicators and achieve better prediction accuracy than classical models.

Mycophenolate mofetil was reported to have broad in vitro activity against different viruses and had been tried in combination with IFN-β in treating MERS infection. We tested the pharmacological activity of mycophenolate mofetil using SARS-CoV-2 infected Vero cells. The half-maximal effective concentration (EC₅₀) of mycophenolate mofetil against SARS-CoV-2 was 0.47 μM while that of remdesivir was 0.77 μM. Molecular docking results of mycophenolate mofetil to potential target proteins of COVID-19 suggested that mycophenolate mofetil might inhibit SARS-CoV-2 mainly by interacting with DHODH and IMPDH2. Furthermore, mycophenolate mofetil as an immunosuppressant may be a good therapeutic option for the management of hyperinflammation in patients with severe COVID-19. Based on its high potency against SARS-CoV-2 in Vero E6 cells, its good pharmacokinetics and clinical safety profile, mycophenolate mofetil deserves further exploration as potential treatment for COVID-19.

Marine mortar was the goal material and its multi-scale physical-chemical-mechanical characteristics were the principal interest in this study. The on-line multi-scale damage detection experiments art was designed to quantify the characteristics mathematically and graphically. The normal cylinder specimen with 70-day age was produced and investigated by dynamically global MSHCT scan and local detection of EDS, SEM and XRD. The experiments results indicated that the marine mortar offered the appreciable strength at the early age at least, although some saline minerals were generated during the preparation. The micro-interfacial behavior and the parental foci controlled the damage development of the marine mortar the performance of which was still the adjustable one by the composition optimization.

Although several carbon sequestration methods have been proposed according to theories from various disciplines, it is not known which method is the best. This study evaluated and summarized the advantage and disadvantages of several major carbon sequestration methods, including carbon capture and sequestration, ocean alkalinization, algal cultivation, and wood burial, based on the first principles, namely, sequestration scale and time, elemental stoichiometry, and energy use efficiency. This study suggested that, at present, wood burial may be a leading candidate for carbon sequestration because it can be implemented immediately on a large scale, is cost-effective and efficient, has a long sequestration time, has low technical requirements, and has a relatively low impact on agriculture. This study also discussed the implementation of wood burial from the perspective of nutrient requirements. To achieve carbon neutrality by 2050, the present study proposed a 25-year project starting in 2025 with an average sequestration rate of 3 Pg C per year, which includes burying 1.5 Pg of dead wood carbon and the creation of 9.7 × 10⁶ ha woodland.

This paper aims at tackling with the task of fusion feature from images and its corresponding point clouds for 3D object detection in autonomous driving scenarios basing on AVOD, an Aggregate View Object Detection network. The proposed fusion algorithms fuse features targeted from Bird’s Eye View (BEV) LIDAR point clouds and its corresponding RGB images. Differs in existing fusion methods, which are simply the adoptions of concatenation module, element-wise sum module or element-wise mean module, our proposed fusion algorithms enhance the interaction between BEV feature maps and its corresponding images feature maps by designing a novel structure, where single level feature maps and another utilizes multilevel feature maps. Experiments show that our proposed fusion algorithm produces better results on 3D mAP and AHS with less speed loss comparing to existing fusion method used on the KITTI 3D object detection benchmark.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

: This study focuses on optimizing chlorophyll extraction techniques and strategically placing leaf disks to enhance chlorophyll concentration in sesame (Sesamum indicum L.) leaves. Thirty sesame genotypes, categorized into light green (LG), middle green (MG), and deep green (DG) pigment groups based on leaf coloration, were selected from a larger pool of field-grown accessions. The investigation involved determining optimal SPAD value index measurements, quantifying pigment concentrations, exploring extraction solvents, and selecting suitable leaf disk positions. Significant variations in chlorophyll content were observed across genotypes, greenness categories, and leaf disk positions. The categorization of genotypes into DG, MG, and LG groups revealed a correlation between leaf appearance and chlorophyll content. The study highlighted a consistent relationship between carotenoids and chlorophyll, indicating their role in adaptation to warm environments. Examination of leaf disk positions revealed a significant chlorophyll gradient along the leaf blade, emphasizing the need for standardized protocols. Chlorophyll extraction experiments identified DMSO and 96% ethanol, particularly the later incubated for 10 minutes at 85°C, as effective choices. This recommendation considers factors like cost-effectiveness, time efficiency, safety, and environmental regulations, ensuring consistent and simplified extraction processes. For higher chlorophyll extraction, focusing on leaf tips and the 75% position along the sesame leaf blade is suggested, consistently yielding higher chlorophyll content. Our findings therefore, underscores insightful knowledge on chlorophyll gradients and encouraging for standardized protocols, that enabling researchers to refine experimental designs for precise and comparable chlorophyll measurements. Recommended solvent choices ensure reliable outcomes in plant physiology, ecology, and environmental studies.

The massive use of electronic equipment has raised concerns about electromagnetic (EM) pollution, leading to increased attention to EM shielding in both civil and military applications. EM absorption materials play a crucial role in reducing the energy of microwaves projected onto their surface. In this work, we propose a novel OTA (over-the-air) antenna test method to evaluate and analyze the functionality of EM absorption materials. This method offers a new and practical way to assess the effectiveness of these materials. Measured results indicate that the presence of the EM absorption material led to a decrease in antenna gain of approximately 2-3 dB, a reduction in efficiency of more than 10-15%, and a smaller radiation pattern during the actual testing process. These findings highlight the impact of EM absorption materials on antenna performance. Compared to the traditional S-parameter testing method, the gain comparison testing method exhibits the advantages of higher accuracy and simpler operation in the lower frequency experiment.

In order to study the effects of irradiation on the physicochemical properties and digestion behavior of chickpea protein, chickpea protein concentrate (CPC) was treated with electron beam irradiation (EBI) at doses of 5, 10, 15 and 20 kGy, respectively. After irradiation, protein solubility first increased at 10 kGy and 15 kGy, and then decreased at higher dose of 20 kGy. This was supported by SDS-PAGE where the intensity of major protein bands first increased and then decreased. Increased does of EBI generally led to greater oxidative modification of proteins in CPC, indicated by reduced sulfhydryls and increased carbonyls. In addition, protein structure was modified by EBI shown by Fourier transform infrared spectroscopy analysis where α-helix generally decreased and β-sheet increased. Although the protein digestibility was not significantly affected by EBI, the peptidomic analysis of the digests revealed significant difference among CPC irradiated with varying doses. A total of 337 peptides were identified from CPC irradiated with 0 kGy, 10 kGy and 20 kGy, respectively, with 18 overlapping peptides and 60, 29 and 40 peptides specific to the groups of 0, 10 and 20 kGy respectively. Theoretical calculation showed that the distribution of peptide length, hydrophobicity, net charge, and C-terminal residues were affected by irradiation. The 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging activity showed a marginal decrease with increasing dose of irradiation. In conclusion, EBI led to oxidative modification and structural changes of the chickpea protein, which subsequently affected the physicochemical properties of peptides obtained from in-vitro digestion of CPC despite of similar digestibility.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

This paper presents a piezoresistive pressure sensor with a shield layer for improved stability. Compared with the conventional piezoresistive pressure sensors, p-type piezoresistors are covered by an n-type shield layer, which is formed by ion implantation. The proposed pressure sensors have been successfully fabricated by bulk micromachining techniques. The impact of electrical field on piezoresistors is studied by simulation. The temperature drift of the pressure sensor has been investigated by both simulation and experimental measurement. Characteristics of developed pressure sensors are tested from -40 C to 125 C. A sensitivity of 0.022 mV/V/KPa and a maximum non-linearity of 0.085% FS are measured for the fabricated sensor in a pressure range of 1 MPa. The temperature coefficients of resistance of shielded piezoresistors are found to be smaller than those of un-shielded ones. It is demonstrated that the shield layer is able to reduce the drift caused by electrical field and ambient temperature variation.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

In this paper, the distributed formation tracking control problem of quadrotor unmanned aerial vehicles (UAVs) is considered. Adaptive backstepping technology is used to design flight control schemes for quadrotor UAVs. For the position subsystem, a distributed robust formation tracking control scheme is developed to achieve formation flight of quadrotor UAVs and track the desired flight trajectory. For the attitude subsystem, an adaptive disturbance rejection control scheme is proposed to achieve attitude stabilization during UAV flight under uncertain disturbances. Compared with the existing results, the novelty of this paper is that the proposed formation control scheme does not require the use of the quadrotor model parameters. Finally, a quadrotor UAV swarm system is used to verify the effectiveness of the proposed control scheme.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

The rapid development of the Industrial Internet of Things (IIoT) has brought enormous opportunities to the industrial environment but has also posed significant challenges to network security, especially the physical layer security challenges,which is crucial for the reliable transmission of messages interconnected devices and sensors. Focus on the enhancing the physical layer security in the IIoT communication, this paper proposed a mechanism of Spatial Secrecy Outage Probability (SSOP) to ensure the secure transmission of data. The SSOP algorithm assumes that the location of legitimate device is known, while eavesdropper on the random distribution of device locations, forming the SSOP model related to device locations from the perspective of insecure regions (ISR) and secure regions (SR), and deduce the closed-form expression for its upper bound. Subsequently under the constraint of SSOP conditions, establish an optimization model with the objective of system throughput maximization based on Spatial Secrecy Outage Probability(SRM-SSOP). By optimizing the transmission rate of legitimate channels or controlling the transmission power, the maximization of system throughput can be achieved, thus reducing the consumption of communication resources. Through sophisticated modeling and simulation in the MATLAB, we verified the accuracy of the definition and derived upper bound of SSOP. The experimental results also show that SSOP algorithm gradually converges to a specific value as the number of antenna elements increases. In addition, we observed that when the receiver device is aligned with the normal direction of the transmit antenna array, the SSOP reaches a minimum value. These performance are crucial for understanding and optimizing the security performance of IIoT communication systems.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.