Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

The paper focuses on the admissibility problem of descriptor fractional-order systems (DFOSs). The alternate admissibility criteria are addressed for DFOSs with order in (0,2) which involve a non-strict linear matrix inequality (LMI) method and a strict LMI method, respectively. The forms of non-strict and strict LMIs are brand-new and distinguished with the existing literature, which fill the gaps of studies for admissibility. These approaches are available to the order in (0,2) without separating the order ranges into (0,1) and [1,2). In addition, a method involved least real decision variables in terms of strict LMIs is derived which is more convenient to process the practical solution. Three numerical examples are given to illustrate the validity of proposed results.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

Nickel-based Superalloy Inconel 718 is widely used in the aerospace industry for its excellent high-temperature strength and thermal stability. However, milling Inconel 718 presents challenges due to significantly increased cutting force and vibration, which is a typical difficult-to-machine material. This paper focuses on the milling process of Inconel 718, establishing a milling force model to analyze the force trends under various processing parameters. Finite element analysis is employed to study the stress and temperature fields during milling. Dynamic equations for milling Inconel 718 are developed, and stability lobe diagrams are generated based on modal experiments. Milling experiments on Inconel 718 validate the milling force model and finite element analysis results. The fmincon optimization algorithm is utilized to identify the optimal machining parameters for Inconel 718. Through this research, valuable insights into enhancing the efficiency and quality of Inconel 718 machining are provided. This study contributes to a deeper understanding of Inconel 718 milling behavior, offering crucial guidance for more efficient machining processes.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The composite post insulator composed of a large diameter mandrel and flange pressed by one-time integral pultrusion has high strength and good toughness, widely used in the existing flexible converter valve. For constructing the finite element model of the crimped post insulator, most of the flange surface and the mandrel surface are directly connected, making the simulation model's stiffness deviate from the actual model and the model distortion. Based on this, this study proposes a new finite element simplified model of crimped composite post insulator based on Multi-Point Constraints (MPC), which accurately simulates the crimping area of man-drel and flange in engineering practice. It verifies the model's reliability through static tests and characteristic vibration tests. The results show that the difference between the finite element simulation and test results is within 5 %. The finite element modeling method based on MPC local constraints is very reliable in applying crimped composite post insulators. Based on the proposed model, the influence of flange height and thickness on the mechanical properties of composite post-insulators is further explored. The results show that the influence of flange height on mechanical properties can be ignored when the height of the insulator stiff-ener ( non-press common area ) is constant. Within the allowable thickness range of the flange crimping process, the increase in flange thickness will significantly reduce the maximum bend-ing stress of the insulator and increase its safety margin. It provides a good design idea for the design of crimping composite insulators.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

A series of D–π–A diketopyrrolopyrrole (DPP)-based small molecules have been designed for organic light-emitting diodes (OLEDs) and organic solar cells (OSCs) applications. Appling the PBE0/6-31G(d,p) method, the ground state geometry and relevant electronic properties were investigated. The first excited singlet state geometry and the absorption and fluorescent spectra were simulated at the TD-PBE0/6-31G(d,p) level. The calculated results reveal that the photophysical properties are affected through the introduction of different end groups. Furthermore, the electronic transitions corresponding to absorption and emission exhibit intramolecular charge transfer feature. It was disclosed that the designed molecules act not only as luminescent for OLEDs, but also donor materials in OSCs. Moreover, they also can be used as potential electron transfer materials using for OLEDs and OSCs.

Metasurface holography offers significant advantages, including a broad field of view, minimal noise, and high imaging quality, making it valuable across various optical domains such as 3D displays, VR, and color displays. However, the conventional pure-structured metasurface holographic devices face a limitation: once fabricated, their functionality remains fixed, restricting practical applications. In recent developments, the landscape of metasurface holography has witnessed a notable shift from passive to active elements, spurred by the introduction of multiplexed and reconfigurable metasurfaces. This paper provides a comprehensive review of the latest advancements in multiplexing and reconfigurable metasurface holography, delving into fundamental characteristics, design strategies, and diverse applications. In conclusion, we offer a brief summary of this rapidly evolving research area, suggest potential future directions, and explore applications. Finally, we briefly summarize this rapidly growing area of research, propose future directions and potential applications.

To prepare an edible coating with a good preservative effect on sweet cherries, carboxymethyl chitosan (CMCS) and gelatin (GL) were selected as the film-forming matrix in this experiment, and CaCl2 and ascorbic acid (AA) were added as crosslinking agents and antioxidants, respectively. First, the film was prepared by the casting method, and the film formula with better mechanical and barrier performance was filtered out by one-factor and response surface optimization test, and the differences in the preservation effect of different film formulations (CMCS-GL, CaCl2- CMCS-GL, AA -CaCl2- CMCS-GL) on sweet cherries were compared. and then the different film formulations were compared. The difference in film formulation on the preservation effect of sweet cherries was investigated. The results showed that the optimal formulation for an edible film based on CMCS-GL with good performance was CMCS: GL (w:w)=2:1, with the additional amount of 1% glycerol, 2% CaCl2, 0.1% Tween-20, 2% AA, the tensile strength, elongation at break, oxygen permeability and water vapor permeability of the film obtained with this formula were: 16.28 MPa, 71.46%, 1.39×10-12 g- cm/(cm2-s-Pa), 5.10×10-11 cm3-cm/(m2-s-Pa), respectively. In the preservation of sweet cherries, all three film formulations effectively reduced the rotting rate and weight loss during storage while preserving the high hardness and skin color of the fruit. Among them, the formulation AA -CaCl2- CMCS-GL showed the best preservation effect and can be used as a new method for postharvest preservation of sweet cherries.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The prediction of drug--target interactions is always a key task in the field of drug redirection. However, traditional methods of predicting drug--target interactions are either mediocre or rely heavily on data stacking. In this work, we merged heterogeneous graph information and obtained effective node information and substructure information based on mutual information in graph embeddings. We then learned high quality representations for downstream tasks, and proposed an end--to--end auto--encoder model to complete the task of link prediction. Experimental results show that our method outperforms several state--of--art models. The model can achieve the area under the receiver operating characteristics (AUROC) curve of 0.959 and area under the precise recall curve (AUPR) of 0.848. We found that the mutual information between the substructure and graph--level representations contributes most to the mutual information index in a relatively sparse network. And the mutual information between the node--level and graph--level representations contributes most in a relatively dense network.

Objective: Identify factors associated with excessive day time sleepiness (EDS) in individuals with obstructive sleep apnea (OSA), and analyze the effects that obesity and gender have on excessive daytime sleepiness in such individuals. Methods: A total of 160 people were selected for this study. All the people have completed a clinical evaluation, and whose apnea-hypopnea index (AHI) > 10 events/hour of sleep on polysomnography were included in the study from the Department of otolaryngology. Results: The Mean age was 43.87±11.34 years, mean EDS score was 14.09± 4.91, and mean AHI was 43.88±20.66 events/hour of sleep. Male presented lower mean age, higher EDS scores, and more time in apnoea, whereas females presented with higher mean age, lower EDS scores, and less time in sleep apnea. The EDS score showed best correlation with duration of apnoea (r = 0.448; p < 0.01), peripheral oxygen saturation (SpO₂; r = -0.458; p < 0.01) and AHI (r = 0.484; p < 0.01). The mean body mass index (BMI) was 27.41±3.86 kg/m². Normal, Overweight, obese, and morbidly obese were observed in 20%, 61%, 18%, and 0.6% of cases, respectively. Severity of the disease best correlated with BMI (r = 0.421; p < 0.01). Conclusions: OSA is predominant in males (M/F 5:1), and obese population. Females diagnosed with OSA have higher mean age. However, EDS scores and time spent in sleep apnoea is lower in females. Higher BMI is associated with EDS, irrespective of gender.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

Exploring effective oxygen reduction reaction (ORR) electrocatalysts is crucial for progress in solid-state alkaline zinc-air batteries (ZAB). In this paper, silver-manganese dioxide-carbon nanotubes (SMC) ternary composites, which function as Electrocatalyst for air Electrodes, was produced via the pyrolysis of silver permanganate under microwave irradiation in one step. A scanning electron microscope (SEM), X-ray diffraction (XRD), and an energy dispersion spectrometer (EDS) have consistently determined that SMC consists of silver and alpha-manganese dioxide, which anchored on the surface of CNTs. Through polarization and chronoamperometery curves, the electrocatalytic activity of SMC for ORR was examined. The results reveal that SMC has higher catalytic activity than the chemically produced electrocatalyst for ORR in alkaline condition. Finally, a solid-state zinc-air cell with an electrocatalyst was constructed and tested. Constant current discharge curve of the zinc-air cell with SMC has a long discharge voltage plateau and a 60.03 mAh capacity at 30 mA · cm−2 . The mechanism of improvement in electrocatalytic activity was also discussed. In a summary, the strategy described in this study and the electrocatalyst produced can be regarded as an effective method for making a robust oxygen reduction catalyst toward solid-state zinc-air batteries.

Potato (Solanumtuberosum L.) is the world's largest non-cereal crop, occupying a position critical for global food security, the fourth largest crop food in China. Due to its location and weather conditions, Yunnan province is the fourth largest potato producer in China with twice yearly production system. However, compared to high number of consumers, potato yield is still low to satisfy the population need. In this study, we have analyzed impacts of three cultivation factors: (1) three cultivation models (T1, T2, and T3), (2) planting density (T1, T2, and T3), (3) soil covering (T1, T2, T3, T4) on plant growth, and yield production. The soil moisture content, temperature, roots growth, stems development, leaf area index, and number-weight of tubers per plant and per plot (g) have significantly increased with commercial yield average of 3tones/mu. This suggests that the combination of these three factors would be a great potato extension model in winter climate zones similar to Yunnan Province. This will contributes in satisfaction of the world population potato consumption need.

A variable speed anti-tangling reel mechanism was designed to address the problems of tangling, hanging and rewinding of the tassel wheel and the high paddling loss in the current Chinese rape combine harvester cutting table. The kinematic equations of the reel mechanism were developed, and the analysis showed that the speed in the entry stage is low and the speed in the exit stage is high, and the attitude of the reel teeth change with the rape plant movement during the whole paddling process. A single-factor test and a multi-factor regression orthogonal combination test were carried out using the cutting table loss rate of rape harvesting as the evaluation index. The main and secondary factors affecting the cutting table loss of the variable speed reel were obtained as the reel speed, the machine travel speed and the ground angle of the frame. A mathematical model of regression of cutter loss and the main influencing factors was established, with the coefficient of determination R2 = 0.9918. The optimal combination of parameters for the variable speed reel was obtained with the lowest cutting table loss rate in rape harvesting as the optimization target: reel speed 25r/min, frame parallel to the ground and implement travel speed 0.7m/s. Field validation tests and comparative tests of cutting table loss of the two reels were carried out. The test results show that the regression mathematical model of the cutting table loss is more accurate, and the cutting table loss is reduced by 13.9% with the variable speed reel compared to the cam-action reel, and there are no problems with the paddle teeth hanging and tangling during the paddling process.

The aim of this study was to investigate the biochemical properties and gel-forming capacity of duck myofibrillar proteins under the effects of 2,2'-azobis (2-amidinopropane) dihydrochloride (AAPH)-mediated oxidation. Duck myofibrillar proteins were extracted and treated with different concentrations of AAPH solutions (0, 1, 3, 5, 10 mmol/L) and then analysed for carbonyl content, dynamic rheology, protein profiles and gel-forming properties (colour, water holding capacity, hardness, protein profile, microstructure). The results showed that with increasing AAPH concentration, the carbonyl content of protein showed an increasing trend (p &lt; 0.05); SDS-PAGE pattern results indicated that moderate oxidation (3 mmol/L AAPH) induced myosin aggregation via covalent bonds including disulfide, enhanced protein-protein, and thus improved protein-water interactions and gel strength of DMPs heat-induced gels. However, high oxidation (5 and 10 mmol/L AAPH) led to partial degradation of myosin heavy chain (MHC), as evidenced by lower storage modulus and irregular microstructure, which significantly reduced gelation ability. These results suggest that the internal relationship between alkanoperoxy radical-induced oxidation should be taken into account in the processing of duck meat, as mild protein oxidation is conducive to improving gel quality.

Code summarization plays a vital role in aiding developers with program comprehension by generating corresponding textual descriptions for code snippets. While recent approaches have concentrated on encoding the textual and structural characteristics of source code, they often neglect the global hierarchical features causing limited code representation. Addressing this gap, our paper introduces the Statement-grained Hierarchy enhanced Transformer model (SHT), a novel framework that integrates global hierarchy, syntax, and token sequences to automatically generate summaries for code snippets. SHT is distinctively designed with two encoders to learn both hierarchical and sequential features of code. One relational attention encoder processes the statement-grained hierarchical graph, producing hierarchical embeddings. Subsequently, another sequence encoder integrates these hierarchical structures with token sequences. The resulting enriched representation is then fed into a vanilla Transformer decoder, which effectively generates concise and informative summarizations. Our extensive experiments demonstrate that SHT significantly outperforms state-of-the-art approaches on two widely used Java benchmarks. This underscores the effectiveness of incorporating global hierarchical information in enhancing the quality of code summarizations.

Existing methods for 3D human pose estimation mainly divide the task into two stages. The first stage identifies the 2D coordinates of the human joints in the input image, namely the 2D human joint coordinates. The second stage uses the results from the first stage as input to recover the depth information of human joints from the 2D human joint coordinates to achieve 3D human pose estimation. However, the recognition accuracy of the two-stage method relies heavily on the results of the first stage and includes too many redundant processing steps, which reduces the inference efficiency of the network. To address these issues, we propose the EDD, a fully End-to-end 3D human pose estimation method based on transformer architecture with Dual Decoders. By learning multiple human poses, the model can directly infer all 3D human poses in the image using a pose decoder, and then further optimize the recognition result using a joint decoder based on the kinematic relations between joints. With the attention mechanism, this method can adaptively focus on the most relevant features to the target joint, effectively overcoming the feature misalignment problem in the human pose estimation task and greatly improving the model performance. Any complex post-processing step, such as non-maximum suppression, is eliminated, further improving the efficiency of the model. The results show that the method achieves an accuracy of 87.4% on the MuPoTS-3D dataset, significantly improving the accuracy of end-to-end 3D human pose estimation methods.

In this study, composite nanofiber films comprising polyvinyl alcohol, wheat gluten, and glucose (PWG) were fabricated using electrospinning, followed by cross-linking via the Maillard cross-linking. Various mass concentrations of ferulic acid (FA) were incorporated into the PWG films. The results indicate that the average diameter of the FA-PWG films decreased from 449 nm to 331 nm as the concentration of FA increased, until reaching a concentration of 12%, after which a significant increase in diameter was observed. Subsequent Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD) and differential scanning calorimetry (DSC) results suggested that FA was distributed in the sample films in an amorphous form through hydrogen and ester bonds. Additionally, release experiments and antimicrobial tests on FA-PWG sample films showed good con-trolled release of FA and excellent anti-Escherichia coli and Staphylococcus aureus activity of this film. These findings all indicate that the FA-PWG nanofiber film is a potential candidate for food active packaging.

Bacterial indole-3-acetic acid (IAA), an effector molecule in microbial physiology, plays an important role in plant growth-promotion. Here, we comprehensively analyzed about 7282 prokaryotic genomes representing diverse bacterial phyla, combined with root-associated metagenomic data to unravel the distribution of tryptophan-dependent IAA synthesis pathways and to quantify the IAA synthesis-related genes in the plant root environments. We found that 82.2% of the analyzed bacterial genomes were potentially capable of synthesizing IAA from tryptophan (Trp) or intermediates. Interestingly, several phylogenetically diverse bacteria showed a preferential tendency to utilize different pathways and tryptamine and indole-3-pyruvate pathways are most prevalent in bacteria. About 45.3% of the studied genomes displayed multiple coexisting pathways, constituting complex IAA synthesis systems. Furthermore, root-associated metagenomic analyses revealed that rhizobacteria mainly synthesize IAA via IAM and tryptamine (TMP) pathways and might possess stronger IAA synthesis abilities than bacteria colonizing other environments. The obtained results refurbished our understanding of bacterial IAA synthesis pathways and provided a faster and less labor-intensive alternative to physiological screening based on genome collections. The better understanding of IAA synthesis among bacterial communities could maximize the utilization of bacterial IAA to augment the crop growth and physiological function.

As an emerging discipline, Design Morphology, with the advantage of "Form Study", has been integrated with many disciplines, and gradually formed its collaborative innovation paradigm. The inclusion of "Ecology" into Design Morphology is expected to promote the research of Design Morphology with the help of the systematic thinking and methods of ecology. The ecosystem of Design Morphology includes the natural ecosystem and the quasi-ecosystem closely related to human beings, and also put forward the concept of "Form Community" for the first time in the design field. In fact, this is exactly the research scope of Design Morphology. Advocating the ecological view of Design Morphology, can not only help to design researchers improve their values and world view, with new thinking and method to engage in "Form Study", but also contribute to the theoretical construction and thinking expansion of Design Morphology, and play a positive role in promoting interdisciplinary collaborative innovation led by Design Morphology. In addition, it can be used to evaluate the overall research and future development trend of Design Morphology, and provide the new research ideas and approaches for the development of design.

The service conditions of underground coal mine equipment are poor, and it is difficult to accurately extract the fault characteristics of rolling bearings. In order to better improve the accuracy of fault identification of rolling bearings, a fault detection method based on multiscale permutation entropy and SOA-SVM is proposed. First, the whale optimization algorithm is used to select the modal analysis number K and the penalty factor α of the variational mode decomposition algorithm. Then, the vibration signal of rolling bearings is dissolved according to the optimized variational mode decomposition algorithm, and the multi-scale permutation entropy of the main intrinsic mode function is calculated. Finally, the feature values of the matrix are entered into the SVM algorithm optimized by the seagull optimization algorithm to obtain the classification result. The experimental results based on the published rolling bearing datasets of Western Reserve University show that the identification success rate of the proposed method can reach 98.75%. The fault detection of the rolling bearings can be completed accurately and efficiently.

Background: Disulfidptosis, a recently identified form of cell death triggered by excessive cysteine accumulation and subsequent disulfide stress, has emerged as a novel mechanism of cell death. Despite its significance, the role of disulfidptosis in the tumor microenvironment (TME) remains poorly understood. Methods: In this study, we employed single-cell RNA sequencing data from 100,987 cells of 11 osteosarcoma (OS) patients. Using the non-negative matrix factorization (NMF) algorithm, we performed dimensionality reduction analysis to identify distinct subtypes characterized by 14 disulfidptosis-related genes across major cell types within the TME. Subsequently, we assessed the prognosis and immunotherapy response associated with each disulfidptosis-related subtype, leveraging publicly available databases comprising osteosarcoma data and immunotherapy cohorts. Results: We identified distinct subtypes within tumor-associated fibroblasts, tumor-infiltrating lymphocytes, and macrophages, which we named and annotated based on their characteristic genes. Furthermore, we observed a close association between disulfidptosis-related genes and key biological features of immune cells within the TME, elucidating inferred pseudotime trajectories. Notably, integrating bulk-seq data of osteosarcoma patients, we observed significant differences in overall survival rates among the disulfidptosis-related subtypes. Particularly, the disulfidptosis-related subtype within tumor-associated fibroblasts exhibited superior discriminatory ability in predicting the response of patients undergoing immunotherapy, surpassing other cell subtypes. Our cell-cell communication analysis highlighted extensive and specific interactions between disulfidptosis-related subtypes and osteosarcoma cells. Furthermore, we confirmed the histological localization of the CAPZB+CAF subtype within osteosarcoma tissue and osteoclastoma using immunofluorescence (IF) techniques. Conclusions: Collectively, our study sheds light on the intercellular communication facilitated by disulfidptosis in the TME, underscoring its involvement in the biological functions and immunotherapy response of osteosarcoma.

The need for cross-modal retrieval (CMR) among users is growing because of the swift advancements in computer vision and natural language processing. Promoting home operating systems is greatly aided by the openKylin home operating system. It is focused on enhancing the functionality of the operating system with safe and dependable operating technologies. Practical implications abound for integrating computer vision research into home operating systems. A multimodal retrieval approach based on openKylin is presented to improve the usability of text search graphs, audio, and video. The overview of pertinent domestic and international research is the main topic of this article. This technological advancement. It then offers details on the design, implementation procedure, and final implementation outcomes for demonstration. The works of natural operations show that this strategy has excellent accuracy and performance.

As the core of intelligent manufacturing, CPS has serious security issues, especially for the communication security of its terminal M2M. In this paper, blockchain technology is introduced to address such a security problem of communications between different types of machines in CPS. According to the principles of blockchain technology, we design a blockchain for secure M2M communications. As a communication system of M2M consists of public network areas, equipment areas and private areas, we design a sophisticated blockchain structure between the public area and private area. For validating our design, we take cotton spinning production as a case study to demonstrate our solution to M2M communication problems under the CPS framework.

The basic idea is to expand the completed zeta function $\xi(s)$ in MacLaurin series (infinite polynomial), which can be further expressed as infinite product (Hadamard product) by conjugate complex roots. Finally, the functional equation $\xi(s)=\xi(1-s)$ leads to $(s-\alpha_i)^2 = (1-s-\alpha_i)^2, i \in \mathbb{N}$ with solution $\alpha_i= \frac{1}{2}, i \in \mathbb{N}$, where $\alpha_i$ are the real parts of the zeros of $\xi(s)$, i.e., $s_i =\alpha_i\pm j\beta_i, i\in \mathbb{N}$. Therefore, a proof of the Riemann Hypothesis is achieved.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

In this study, we design a new refractive index sensor based on a metal–insulator–metal waveguide coupled with a notched ring and vertical rectangular resonators. We use the finite element method to study the propagation characteristics of the sensor. According to the calculation results, the transmission spectrum exhibits a typical Fano resonance shape. The phenomenon of Fano resonance is caused by the coupling between the wide spectrum and narrow spectrum. In the design, the wide spectrum signal is generated by the vertical rectangular resonator, while the narrow spectrum signal is generated by the notched ring resonator. In addition, we varied the structural parameters of the resonators and filled the structure with media of different refractive indices to study the sensing properties. The maximum achieved sensitivity of the sensor reached 1071.4 nm/RIU. The results reveal potential applications of the coupled system in the field of sensors.

In wideband radar systems, the performance of motion parameters estimation can significantly affect the performance of object detection and the quality of inverse synthetic aperture radar (ISAR) imaging. Although the traditional motion parameters estimation methods can reduce the range migration (RM) and Doppler frequency migration (DFM) effects in ISAR imaging, the computational complexity is high. In this paper, we propose a new fast non-searching motion parameters estimation method based on cross-correlation of adjacent echoes (CCAE) for wideband LFM signals. A cross-correlation operation is carried out for two adjacent echo signals, then the motion parameters can be calculated by estimating the frequency of the correlation result. The proposed CCAE method can be applied directly to the stretching system, which is commonly adopted in wideband radar systems. Simulational results demonstrate that the new method can achieve better estimation performances, with much lower computational cost, compared with existing methods. The experimental results on real radar data sets are also evaluated to verify the effectiveness and superiority of the proposed method compared to the state-of-the-art existing methods.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

SMARCA4-deficient non-small cell lung cancer (NSCLC) is a more recently recognized subset of NSCLC. We describe the 18F-fluorodeoxyglucose (FDG) PET/CT findings in a rare case of SMARCA4-deficient NSCLC and response to therapy. A 45-year-old male patient with a history of heavy smoking (10 years) underwent an 18F-fluorodeoxyglucose (FDG) PET/CT dynamic (chest) + static (whole-body) scan for diagnosis and pre-treatment staging. 18F-FDG PET/CT showed an FDG-avid mass in the upper lobe of the left lung (SUVmax of 22.4) and FDG-avid lymph nodes (LN) in the left pulmonary hilar region (SUVmax of 5.7). In addition, there are multiple metastases throughout the body, including distant LNs, adrenal glands, bone, and brain. Pathological findings confirmed SMARCA-4 deficient NSCLC. After 4 cycles of chemotherapy and immune checkpoint inhibitors（ICI）, the patient underwent again an 18F-FDG PET/CT scan (including dynamic scan) for efficacy evaluation. We report cases that deepen the understanding of the 18F-FDG PET/CT presentation of SMARCA4-deficient NSCLC as well as dynamic imaging features and parametric characteristics.

Adopting banana peel as raw material, the adsorption properties of banana peel hydrothermal carbon modified with KOH solution for lead ions in aqueous solution were studied. The surface structure and functional groups of the modified hydrothermal carbon were analyzed by XRD and SEM. The results showed that the banana peel hydrothermal carbon prepared from 0.5 mol/L KOH solution had large pores, and its adsorption capacity reached 42.92 mg/g at a pH value of 6; When the concentration of KOH solution is 0.5 mol/L, the solid liquid ratio is 2 g/L, the adsorption capacity reaches 21.39 mg/g, and the adsorption rate reaches 82.74%; When the concentration of lead solution increased to 100 mg/L, the adsorption capacity of modified hydrothermal carbon for lead ions decreased to 78.26%; The equilibrium adsorption time of lead ion in solution on phosphoric acid modified hydrothermal carbon from banana peel was 250 minutes, and the adsorption process met the quasi second order kinetic model and Freundlich isotherm equation, with an equilibrium adsorption rate of 88.62%. The adsorption of lead ions in solution by KOH modified hydrothermal carbon is mainly chemical physical adsorption.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Simultaneous Localization and Mapping (SLAM), as one of the core technologies in intelligent robotics, has gained substantial attention in recent years. Addressing the limitations of SLAM systems in dynamic environments, this research proposes a system specifically designed for plant factory transportation environments, named GY-SLAM. GY-SLAM incorporates a lightweight target detection network GY based on YOLOv5, which utilizes GhostNet as the backbone network. This integration is further enhanced with CoordConv coordinate convolution, CARAFE up-sampling operators, and SE attention mechanism, leading to simultaneous improvements in detection accuracy and model complexity reduction. While improving [email protected] by 0.514%, the model simultaneously reduces the number of parameters by 43.976%, computational cost by 46.488%, and model size by 41.752%. Additionally, the system constructs pure static octree maps and grid maps. Tests conducted on the TUM dataset and a proprietary dataset demonstrate that GY-SLAM significantly outperforms ORB-SLAM3 in dynamic scenarios in terms of system local-ization accuracy and robustness. It shows a remarkable 92.58% improvement in RMSE for Absolute Trajectory Error (ATE). Compared to YOLOv5s, the GY model brings a 41.5944% improvement in detection speed and a 17.7975% increase in SLAM operation speed to the system, indicating strong competitiveness and real-time capabilities. These results validate the effectiveness of GY-SLAM in dynamic environments and provide substantial support for the automation of logistics tasks by robots in specific contexts.

The hydrodynamic behavior of the air-acetic acid system in a bubble column is studied using a differential pressure transmitter, double probe optical fiber probe, and the electrical resistance tomography (ERT) technique. The superficial gas velocity ranges from 0.016 to 0.094 m/s under ambient temperature and pressure. The influences of viscosity and surface tension on gas holdup, bubble rising velocity, and bubble chord distribution in the column are discussed with different mass fractions of an acetic acid solution. The results show that as the mass fraction of acetic acid increases, the surface tension of the liquid phase decreases, and the viscosity first increases and then decreases. This causes the gas holdup in the column to first increase and then decrease, and reaches the maximum value at an acetic acid mass fraction of 55% to 60%. The rising velocity of the bubbles in the column is high in the central region and has a low-value distribution near the wall. The bubble chord length distribution is concentrated, and the distribution of the bubble chord length in the column becomes narrow with any decrease in surface tension. Studying the hydrodynamic behavior of a bubble column with the air-acid system is of great significance considering the absence of data on air-organic acid systems.

In scenarios such as natural disasters and military strike, it is common for unmanned aerial vehicles (UAVs) to form groups to execute reconnaissance and surveillance. To ensure the effectiveness of UAV communications, repeated resource acquisition issues and transmission mechanism design need to be addressed urgently. In this paper, we build an information interaction scenario in a Flying Ad-hoc network (FANET). The data transmission problem with the goal of throughput maximization is modeled as a coalition game framework. Then, a novel mechanism of coalition selection and data transmission based on group-buying is investigated. Since large-scale UAVs will generate high transmission overhead due to the overlapping resource requirements, we propose a resource allocation optimization method based on distributed data content. Comparing existing works, a data transmission and coalition formation mechanism is designed. Then the system model is classified into graph game and coalition formation game. Through the design of the utility function, we prove that both games have stable solutions. We also prove the convergence of the proposed approach with coalition order and Pareto order. Binary log-linear learning based coalition selection algorithm (BLL-CSA) is proposed to explore the stable coalition partition of system model. Simulation results show that the proposed data transmission and coalition formation mechanism can achieve higher data throughput than the other contrast algorithms.

The development of computational acoustics allows simulation of sound generation and propagation in complex environment. In particular, meshfree methods are widely used to solve acoustics problems through arbitrarily distributed field points and approximation smoothness flexibility. As a Lagrangian meshfree method, smoothed particle hydrodynamics (SPH) method reduce the difficulty in solving problems with deformable boundaries, complex topologies, or multiphase medium. The traditional SPH method has been applied in acoustic simulation. This study presents the corrective smoothed particle method (CSPM), which is a combination of SPH kernel estimate and Taylor series expansion. The CSPM is introduced as a Lagrangian approach to improve accuracy in solving acoustic wave equations in the time domain. Moreover, a boundary treatment technique based on the hybrid meshfree and finite difference time domain (FDTD) method is proposed to represent different acoustic boundaries with particles. To model sound propagation in pipes with different boundaries, soft, rigid, and absorbing boundary conditions are built with this technique. Numerical results show that the CSPM algorithm is consistent and demonstrates convergence with exact solutions. Main computational parameters are discussed, and different boundary conditions are validated to be effective for benchmark problems in computational acoustics.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

The collaboration of multimodal transport documents is the foundation for conducting multimodal transport operations. Blockchain technology can effectively address trust issues and information sharing difficulties in current multimodal transport document collaboration. However, in current blockchain-based electronic document research, the bottleneck problem lies in the collaboration of multiparty in multimodal transport under the "one-bill coverage system". We design a blockchain platform architecture for multimodal transport, reshaping collaboration processes for different modes of transport based on the blockchain platform. It proposes a collaboration model for multimodal transport under the "one-bill coverage system" and performs model solving and case analysis. The obtained collaboration strategies are embedded into the platform's application layer. Finally, using Solidity language, it writes smart contracts related to multimodal transport under the "one-bill coverage system " and deploys and executes them on the Remix platform.

A single fracture is the basic unit of fracture medium, and the roughness of fracture wall surface is an important factor influencing hydraulic characteristics of the flow in bedrock fracture. However, effects of the shape and density of roughness elements (various bulges/pits on rough fracture wall surfaces) on water flow in a single rough fracture have not been thoroughly discovered. Thus the water flow in single fracture with different shapes and densities of roughness elements was simulated by using Fluent software in this study. The results show that in wider fractures the flow rate mainly depends on fracture aperture, while in narrow and close fracture medium the surface roughness of fracture wall is the main factor of head loss of seepage; there is a negative power exponential relation between the hydraulic gradient index and the average fracture aperture, i.e. with the increase of fracture aperture, the relative roughness of fracture and the influence weight of hydraulic gradient both decrease; and in symmetrical-uncoupled fractures there is a super-cubic relation between the discharge per unit width and average aperture. Above results would help to deepen the understanding of rough fracture seepage.

The rock joint fissure slope in cold regions is prone to deformation and failure problems such as relaxation, tension and collapse under freeze-thaw (F-T) cycles. Based on the ideology of clean production and promoting the structural integrity of geotechnical projects in cold areas, this study designed and prepared aeolian-sand (AS) to replace part of river sand as a filling mortar material by taking advantage of the low cost and easy availability of AS. Investigations were carried out to determine the impact of varying proportions of AS in mortar on the microstructure and shear properties of the mortar-rock interface under F-T cycles. Therefore, F-T cycle testing, nuclear magnetic resonance (NMR) testing and shear testing were carried out on grout with different proportions of AS. The results show that the right proportion of AS replacement could enhance the shear deformation resistance and F-T resistance of the mortar-rock interface, and 30% proportion is the optimal proportion. By increasing of F-T cycles, the three types of specimens showed different degrees of particle spalling, shedding and cracking. The slurry-rock interface layer in the A (0%) group exhibited the most severe F-T deterioration, while the B (15%) group showed a lesser degree, and the C (30%) group performed the best. T2 spectrum curve and total spectrum area change law from the microscopic point of view to verify the 30% AS proportion mortar-rock interface F-T resistance is the strongest, followed by 15% AS proportion mortar, the weakest is ordinary mortar. The degradation of the mortar-rock bond is primarily due to the conversion of solid to liquid phases and the movement of internal water caused by fluctuating temperatures. The extent of F-T deterioration in the slurry-rock interface layer is greatly affected by the varying proportions of AS. The shear strength and shear stiffness of specific proportion of AS decreased with the increase of F-T cycles. For same F-T cycles, the shear strength and shear stiffness of group C (30%) were the highest, followed by group B (15%) and group A (0%). The grout material not only reinforces the F-T joint fissure slope, but also reduces the cost of grout reinforcement and promotes the clean production of geotechnical structures.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Accurate prediction of the degree of airport delays under the influence of convective weather is crucial for collaborative traffic management implementation and improving the efficiency of airport operations. However, existing studies usually only consider numerical-type quantitative features of weather-affected traffic in their models, and lack the introduction of spatial information to comprehensively portray the traffic operation scenarios under the influence of weather. In order to overcome this problem, this paper firstly designs a new image representation of weather-affected air traffic, and constructs a multi-channel traffic and weather scene image (MTWSI) by populating the airspace two-dimensional grid with traffic and meteorological information to represent the overall traffic operation situation in the terminal area under the influence of convective weather; then, a deep convolutional neural network-based airport delay prediction model ( ADLCNN), which takes MTWSI images as input and uses a specific CNN model to extract the deep features that affect traffic operation in it to input into the subsequent classification algorithm to predict the flight delay level; finally, a series of comparative experiments are carried out on the operational data of Guangzhou Baiyun Airport, and the experimental validation shows that, compared with the traditional machine learning methods, the proposed CNN-based airport delay prediction The experimental validation shows that the proposed CNN-based airport delay prediction model has satisfactory prediction performance compared with the traditional machine learning methods, which also proves that the proposed MTWSI method can more comprehensively respond to the real traffic conditions.

Crop breeding is an important global strategy to meet sustainable food demand. CRISPR-Cas is a most promising gene-editing technology for rapid and precise generation of novel germplasm, and leads to revolutionary crop breeding innovation. In this review, we summarize recent advance of CRISPR/Cas technology in gene function analyses and generation of new germplasms with increased yield, improved product quality, and enhanced resistance to biotic and abiotic stress. We highlight their applications and breakthroughs in agriculture including crop de novo domestication, decoupling the gene pleiotropy tradeoff, crop hybrid seed conventional production, hybrid rice asexual reproduction, and double haploid breeding. Moreover, the challenges and development of CRISPR/Cas technology in crops are also discussed.

Gravel packing completion method for horizontal wells has the advantages of maintaining high oil production for a long time, maintaining wellbore stability and preventing sand production, so it has become the preferred completion method for horizontal wells. At present, this technology still faces the problems of high sand bed height and poor gravel migration. In order to improve the efficiency of gravel packing in horizontal wells, pulsed gravel packing technology for horizontal wells is proposed for the first time. Based on the mechanism of hydraulic pulse, the Eularian model, RNG K-ε model and CFD model are used to simulate the solid-liquid two-phase flow. By optimizing the parameters such as frequency and amplitude of pulse waveform, the optimal pulse waveform of pulsed gravel packing in horizontal wells is determined. The effects of parameters such as sand-carrying fluid displacement, sand-carrying fluid viscosity, sand-carrying ratio, gravel particle size and string eccentricity on pulsed gravel packing in horizontal wells are studied, and the distribution law of gravel migration velocity and volume fraction in horizontal wells is obtained. According to the results, it can be seen that with the increase of displacement and viscosity of carrier fluid, the volume fraction of fixed bed and moving bed decreases gradually, while that of suspension bed increases gradually. With the increase of sand-carrying ratio, gravel particle size and string eccentricity, the volume fraction of fixed bed and moving bed increases gradually, while that of suspended bed decreases gradually. Comparing the effects of conventional gravel packing and pulsed gravel packing in horizontal wells, it can be concluded that the efficiency of pulsed gravel packing in horizontal wells is higher. The volume fraction of fixed bed and moving bed decreased by 30% and 40% respectively, while the volume fraction of suspended bed increased by 20%. The migration velocity of moving bed and suspended bed increased by 40% and 25% respectively. And the migration ability of gravel improved obviously.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Using banana peel as raw material, the adsorption properties of hydrothermal carbon pre-10 pared from banana peel modified with different concentrations of phosphoric acid solution for lead 11 ions in aqueous solution were studied. The surface structure and functional groups of the modified 12 hydrothermal carbon were analyzed by XRD and SEM. The results show that the surface of the 13 modified banana peel hydrothermal carbon prepared at 240℃ and 2mol/L phosphoric acid solution 14 has large pores. The adsorption capacity is larger when pH value is 6.When the concentration of 15 phosphoric acid solution was 2mol/L, the solid-liquid ratio was 2g/L, the adsorption capacity was 16 40.64mg/g, and the removal rate was 82.74%.When the initial concentration of lead solution in-17 creased to 100mg/L, the adsorption capacity of modified hydrothermal carbon for lead ion increased 18 to 76.81mg/g, and the removal rate decreased to 76.81%.The equilibrium adsorption time of banana 19 peel phosphoric acid modified hydrothermal carbon for lead ions in solution is 300min. The adsorp-20 tion process satisfies the pseudo-second-order kinetic model and Langmuir isotherm equation. The 21 reaction temperature is 313K, and the equilibrium adsorption capacity can reach 101.19mg/g. The 22 adsorption of Pb ions in aqueous solution by phosphoric acid modified hydrothermal carbon is 23 dominated by single layer chemisorption. The artificial neural network has a fitting correlation of 24 0.99, and the adsorption process includes physical adsorption, electrostatic attraction, ion exchange, 25 and surface complexation.

Rheumatoid arthritis (RA) is a complex disease triggered by the interaction between genetics and environment, especially through the shared epitope (SE) and cell surface calreticulin (CSC) theory. However, the available evidence shows that genetic diversity and environmental exposure cannot explain all the clinical characteristics and heterogeneity of RA. In contrast, recent studies demonstrate that epigenetics play important roles in the pathogenesis of RA, especially DNA methylation and histone modification. DNA methylation and histone methylation are involved in innate and adaptive immune cell differentiation, and migration, proliferation, apoptosis, and mesenchymal characteristics of fibroblast-like synoviocytes (FLS). Epigenetic-mediated regulation of immune-related genes and inflammation pathways explains the dynamic expression network of RA. In this review, we summarized the comprehensive evidence to show that methylation of DNA and histones is significantly involved in the pathogenesis of RA and could be applied as a promising biomarker in the disease progression and drug response prediction. We also explained the advantages and challenges of the current epigenetics research in RA. In summary, epigenetic modules provide a possible interface, through which genetic and environmental risk factors connect to contribute to the susceptibility and pathogenesis of RA. Additionally, epigenetic regulators provide promising drug targets to develop novel therapeutic drugs for RA. Finally, DNA methylation and histone modifications could be important features for providing a better RA subtype identification, to accelerate personalized treatment and precision medicine.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The transition region is a very thin but most peculiar layer in the solar atmosphere, located between the solar chromosphere and the corona. It is a key region for understanding the coronal heating, the solar eruptions triggering, and the origin of solar winds. Here, the gradients of all physical parameters are very high, including plasma density, ionization degree, temperature, and magnetic fields, etc. Therefore, the transition region should be highly dynamic, such as fast energy releasing and transporting, plasma heating, and even particle accelerating. They include two physical aspects: thermal and non-thermal processes. The thermal processes can be observed from the ultraviolet (UV) and extreme ultraviolet (EUV) emission by multi-wavelength images. The non-thermal processes, however, should be related to radio emissions especially at millimeter wavelengths, and the frequency range should span from several GHz to beyond 300 GHz, and the emission mechanism should be highly related to the magnetic fields and variations. The ultra-wide broadband spectral observations at millimeter wavelengths with high spectral resolutions may provide rich dynamic information about the transition region, such as non-thermal energy release and transmission, the flows of plasma and energetic particles, the magnetic fields and their variations, the generation and transportation of various waves, and the formation and evolution of the source regions of solar eruptions. Here, we discussed the spectral characteristics of millimeter-wave emission from the transition region and proposed a new conception of ultra-wide broadband millimeter-wave spectrometers to observe them.

An experiment was conducted to investigate the role of single nucleotide polymorphisms of the gene RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T with carcass and meat quality traits of Chinese Simmental-cross steers. METHOD: We performed sequencing and restriction enzyme digestion to detect genotypes of RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T. Then, we analyzed the association of novel single nucleotide polymorphisms in intron regions of the RNF128 gene and in the 3′UTR region of RNF34 and meat quality traits of Chinese Simmental-cross steers. RESULTS: Statistical analyses revealed that SNP of RNF128 (I1-2380C>T) was significantly associated with dressed weight, forepaw weight, carcass depth, carcass brisket depth, hind legs length (P<0.05), etc. And RNF34 (3′UTR-588 G>A) were significantly associated with testis weight, kidney weight, tare weight (P<0.05), etc. CONCLUSION: Our findings suggest that polymorphisms in RNF34 and RNF128 might be important genetic factors that influence carcass and meat quality in beef cattle. Thus, they might be useful markers for meat quality traits in future marker-assisted selection programs in beef cattle breeding and production.

In order to correct attenuated millimeter-wavelength (Ka-band) radar data and address the problem of instability, an attenuation correction methodology (attenuation correction with variation trend constraint; VTC) was developed. Using synchronous observation conditions and multi-band radars, the VTC method adopts the variation trends of reflectivity in X-band radar data captured with wavelet transform as a constraint to adjust reflectivity factors of millimeter-wavelength radar. The correction was evaluated by comparing reflectivities obtained by millimeter-wavelength cloud radar and X-band weather radar. Experiments showed that attenuation was a major contributory factor in the different reflectivities of the two radars when relatively intense echoes exist, and the attenuation correction developed in this study significantly improved data quality for millimeter-wavelength radar. Reflectivity differences between the two radars were reduced and reflectivity correlations were enhanced. Errors caused by attenuation were eliminated, while variation details in the reflectivity factors were retained. The VTC method is superior to the bin-by-bin method in terms of correction amplitude and can be used for attenuation correction of shorter wavelength radar assisted by longer wavelength radar data.

In (Semigroup Forum 77: 325-338, 2008) Mahmoudi M. and Renshaw J. solved a study that covers of cyclic $S$-acts over monoids. This article is an attempt to initiate the covers of finitely generated $S$-acts. We give a necessary and sufficient condition for a monoid to have the properties that $n$-generated $S$-acts have strongly flat covers, Condition $(P)$ covers and projective covers. The main conclusions extend some known results. We show also that Condition $(P)$ covers of finitely generated $S$-acts are not unique, unlike the situation for strongly flat covers. Additionally, we demonstrate that the property of Enochs' $\mathcal{X}$-precover of $S$-act $A$, where $\mathcal{X}$ denotes a class of $S$-acts that are closed under isomorphisms.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

The pathogenicity of grapevine geminivirus A (GGVA), a recently identified DNA virus, to grapevine plants remains largely unclear. Here, we report a new GGVA isolate (named GGVAQN) obtained from grapevine ‘Queen Nina’ plants with severe disease symptoms; the infectious clone of GGVAQN (pXT-GGVAQN) was also constructed. Infection assays indicated that Nicotiana benthamiana plants inoculated with GGVAQN display upward leaf curling and chlorotic mottling symptoms. Direct injection of Agrobacterium tumefaciens cells carrying pXT-GGVAQN into roots of in vitro-grown ‘Red Globe’ grape plantlets by syringe led to systemic infection with GGVAQN, and the plants exhibited chlorotic mottling symptoms on their upper leaves, and downward curling, interveinal yellowing, and leaf-margin necrosis symptoms on their lower leaves. Our results provide insights into the pathogenicity of GGVA, and a simple and efficient inoculation method to deliver infectious viral clones to woody perennial plants.

With the increasing concern of environment, the energy-efficiency scheduling of manufacturing industry is becoming urgent and popular. In turning processes, both spindle speed and processing time can affect the final energy consumption and thus the spindle speed and scheduling scheme need to be optimized simultaneously. Since the turning workshop can be regarded as the flexible flow shop, this paper formulates a mixed integer linear programming model for energy-efficient scheduling of flexible flow shop. Accordingly, a new decoding method is developed by considering of the optimization of spindle speed and scheduling scheme simultaneously, and an estimation of distribution algorithm adopting the new decoding method is proposed to solve large-size problems. The parameters of this algorithm are determined by statistical technique with a simplified practical case. In order to validate the proposed method, a case from practical factories is studied, in which the makespan can be shortened by 25.22%, and the consumed energy can be saved by 5.48%. These results demonstrate the effectiveness of the proposed mathematical model and algorithm.

This paper aims to address the exponential stability and stabilization problems for a class of delayed nonlinear Markov jump systems under randomly occurring Denial-of-Service (DoS) attack and packet loss. Firstly, the stochastic characteristics of DoS attack and packet loss are depicted by the attack success rate and packet loss rate. Secondly, a Period Observation Window (POW) method and a hybrid-input strategy are proposed to compensate for the impact of DoS attack and packet loss on the system. Thirdly, A Dynamic Event-triggered Mechanism (DETM) is introduced to save more network resources and ensure the security and reliability of systems. Then, by constructing a general common Lyapunov functional and combining with the DETM and other inequality analysis techniques, the less conservative stability and stabilization criteria for the underlying systems are derived. In the end, the effectiveness of our result is verified through a numerical example.

Enterovirus 71 (EV71) infection hand-foot-mouth disease (HFMD), meningoencephalitis, neonatal sepsis, and even fatal encephalitis in children, thereby representing a serious public health hazard. It is important to determine the mechanisms underlying the regulation of EV71 infection. In this study, we initially reveal that the interleukin enhancer binding factor 2 (ILF2) down-regulates EV71 50% tissue culture infective dose (TCID50), attenuates EV71 plaque formation unit (PFU), thereby repressing EV71 infection. Moreover, we reveal a distinct mechanism by which EV71 antagonizes ILF2-mediated antiviral effects. Chip data analyses show that ILF2 mRNA is reduced upon EV71 infection. Cellular studies indicate that EV71 infection represses ILF2 mRNA expression and protein production in human leukemic monocytes (THP-1) differentiated macrophages and in human rhabdomyosarcoma (RD) cells. Additionally, EV71 non-structural protein 2B interacts with ILF2 in human embryonic kidney (HEK293T) cells. Interestingly, in the presence of EV71 2B, ILF2 is translocated from the nucleus to the cytoplasm and co-localizes with 2B in the cytoplasm. Therefore, we reveal a distinct mechanism by which EV71 antagonizes ILF2-mediated antiviral effects by inhibiting ILF2 expression and promoting ILF2 translocation from the nucleus to cytoplasm through its 2B protein.

Although Eulerian approaches are standard in computational acoustics, they are less effective for certain classes of problems like bubble acoustics and combustion noise. A different approach for solving acoustic problems is to compute with individual particles following particle motion. In this paper, a Lagrangian approach to model sound propagation in moving fluid is presented and implemented numerically, using three meshfree methods to solve the Lagrangian acoustic perturbation equations (LAPE) in the time domain. The LAPE split the fluid dynamic equations into a set of hydrodynamic equations for the motion of fluid particles and perturbation equations for the acoustic quantities corresponding to each fluid particle. Then, three meshfree methods, the smoothed particle hydrodynamics (SPH) method, the corrective smoothed particle (CSP) method, and the generalized finite difference (GFD) method, are introduced to solve the LAPE and the linearized LAPE (LLAPE). The SPH and CSP methods are widely used meshfree methods, while the GFD method based on the Taylor series expansion can be easily extended to higher orders. Applications to modeling sound propagation in steady or unsteady fluids in motion are outlined, treating a number of different cases in one and two space dimensions. A comparison of the LAPE and the LLAPE using the three meshfree methods is also presented. The Lagrangian approach shows good agreement with exact solutions. The comparison indicates that the CSP and GFD method exhibit convergence in cases with different background flow. The GFD method is more accurate, while the CSP method can handle higher Courant numbers.

Understanding the infiltration and solidification processes of liquid 5083Al alloy into Al2O3 three-dimensional reticulated porous ceramic (Al2O3(3D) RPC) is essential for optimizing the microstructure and properties of Al2O3(3D)/5083Al interpenetrating phase composites (IPCs) prepared by low-pressure infiltration process (LPIP). This study employs ProCAST software to simulate the infiltration and solidification processes of liquid 5083Al with pouring velocities (PV) of 0.4 m/s infiltrating into Al2O3(3D) RPC preforms with varying porosities at different pouring temperatures (PT) to prepare Al2O3(3D)/5083Al IPCs using LPIP. The results demonstrate that pore diameter of Al2O3(3D) RPC preforms and PT of liquid 5083Al significantly influence the of the infiltration. Solidification process analysis reveals that the Al2O3(3D) RPC preform with smaller pore diameters allows the lower pouring velocity of 5083Al to solidify faster compared to the preform with larger pore diameters. Al2O3(3D)/5083Al IPCs were prepared successfully from Al2O3(3D) RPC porosity of 15 PPI with liquid 5083Al at PV 0.4 m/s and PT 800 °C using LPIP, resulting in nearly fully dense composites, where both Al2O3(3D) RPCs and 5083Al interpenetrate throughout the microstructure. The infiltration and solidification defects were reduced under air pressure of 0.3 MPa (corresponding to PV of 0.4 m/s) during LPIP. Finite volume method simulations are in good agreement with experimental data, validating the suitability of the simplified model for Al2O3(3D) RPCs in the infiltration simulation.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

A typical solid-state quantum sensor can be developed based on negatively charged nitrogen-vacancy (NV-) centers in diamond. The electron spin state of NV- can be controlled and read at room temperature. Through optical detection magnetic resonance (ODMR) technology, temperature measurement inside living cells can be achieved at the nanoscale. The key to ODMR technology is to apply microwave resonance to manipulate the electron spin state of NV-. Therefore, the microwave field characteristics formed near the NV- have a crucial impact on the sensitivity of ODMR measurement. This article mainly focuses on the temperature situation in cellular applications, and simulates the influence of structural parameters of double open loop resonant (DOLR) microwave antennas and broadband large-area (BLA) microwave antennas on the microwave field’s resonance frequency, quality factor Q, magnetic field strength, uniformity, etc. The parameters are optimized to have sufficient bandwidth, high signal-to-noise ratio, low power loss, and high magnetic field strength in the temperature range of 36 ℃ to 42.5 ℃. Finally, the ODMR spectra are used for effect comparison, and the signal-to-noise ratio and Q values of the ODMR spectra are compared when using different antennas. We have provided an optimization method for the design of microwave antennas and it is concluded that the DOLR microwave antenna is more suitable for living cell temperature measurement in our study.

The low-temperature environment significantly inhibits the growth and metabolism of denitrifying bacteria, leading to an excessive concentration of ammonia nitrogen and total nitrogen in sewage treatment plants during the cold season. In this study, an efficient denitrifying strain of heterotrophic nitrification–aerobic denitrification(HN-AD) bacteria named HS2 was isolated and screened from industrial sewage of a chemical factory in Inner Mongolia at 8°C. The strain was confirmed to be Achromobacter spiritinus, a colorless rod-shaped bacterium. When cultured with sodium succinate as the carbon source, a carbon-to-nitrogen ratio of 20-30, a shaking rate of 150-180 r/min, and the initial pH of 6-10, the Strain HS2 exhibited excellent nitrogen removal at 8°C. Through the results of whole-genome sequencing, gene amplification, and gas product detection, the Strain HS2 was determined to possess key enzyme genes in both nitrification and denitrification pathways, suggesting a HN-AD pathway of NH4+-N→NH2OH→NO2--N→NO→N2O→N2. At 8°C, the Strain HS2 could completely remove ammonia nitrogen from industrial sewage with an initial concentration of 127.23 mg/L. Microbial species diversity analysis of the final sewage confirmed Achromobacter sp. as the dominant genus, this indicated that the low-temperature denitrifying strain HS2 plays an important role in nitrogen removal of actual low-temperature sewage.

Effects of oxygen content on microstructure and creep property of FGH96 superalloy were investigated. When oxygen content increased from 135ppm to 341ppm, prior particle boundary (PPB) rose from degree 2 to degree 3, and the size of γ′ phase on PPB enlarged from 1.07μm to 1.27μm, and MC carbide size grew from 77.4nm to 104.0nm. Meanwhile, the steady creep rate accelerated form 4.34×10-3 h-1 to 1.87×10-2 h-1, and the creep rupture life shortened from 176h to 94h, and the creep rupture mode transferred from intergranular and transgranular mixed fracture to along PPB fracture. During creep, the micro-twins formation and gliding will be restrained by ∑3 boundaries. FGH96 superalloy with higher oxygen content contains less ∑3 boundaries and its micro-twins cross slipped instead of single direction slip in lower oxygen content superalloy. Consequently, specimen with higher oxygen content creeped faster and raptured earlier.

Poor interlaminar fracture toughness has been a major issue in glass fiber-reinforced epoxy resin (GF/EP) laminate composites. In this paper, soft carboxy-terminated liquid nitrile (CTBN) rubber particles and rigid nano-SiO2 are used to toughen the epoxy resin (EP) matrix to improve the interlayer properties of GF/EP laminate composites. The effects of adding two toughening agents on the mechanical and interlayer properties of GF/EP laminates were studied. The results showed that adding the two kinds of particles improved the mechanical properties of the epoxy matrix. When the additional amount of flexible CTBN rubber particles was 8wt%, and the rigid nano SiO2 was 0.5wt%, the fracture toughness of the matrix resin was increased by 215.8%, and the tensile strength was only decreased by 2.3% compared with the pure epoxy resin. On this basis, the effects of two kinds of particles on the interlayer properties of GF/EP composites were studied. Compared with the unmodified GF/EP laminates, the interlayer shear strength and mode Ⅰ interlayer fracture toughness is significantly improved by toughening agent, and the energy release rate GIC of interlayer shear strength and interlayer fracture toughness is increased by 109.2%, and 86.8%, respectively.

Expansion tube is ideal energy absorber which dissipates kinetic energy through plastic deformation and friction. There is an urgent need to understand the influence of key parameter, e.g. semi angle, tube material, and friction coefficient, on the mechanical response and energy absorption characteristics of expansion tube. In the present work, the material properties of the tubes were tested under quasi-static loading condition, and the numerical simulations were carried out by using commercial software ABAQUS. Based on the validated finite element simulation, all the semi angle, tube material, and friction have significant effects on the energy absorption capacity of expansion tube. The expansion tube with high tensile stress of parent material have high energy absorption capacity, while the specific energy absorption is linear with the tensile stress/density of tube material. This work would give a guidance to the structural design and parent materials selection for expansion tubes.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

We experimentally study the supercontinuum (SC) induced by femtosecond filament in different liquid media, and determine the relative measurement value of filamentation threshold Pth for these media by using a Mach-Zehnder interferometer (MZI). It is found that the value of Pth is higher than the critical power for self-focusing Pcr, which can be attributed to the strong dispersion effect. Changing the focal length of the focusing lens affect the measured results of the filamentation threshold: In the case of shorter focal length, linear focusing (i.e., geometrical focusing) regime dominates, and the measured values of Pth for different media are almost the same; as the focal length becomes larger, self-focusing starts to play a role, making the values of Pth for different media different from each other. This work provides an effective approach to study the femtosecond filamentation process in liquid media, and helpful to further understand the physical process of supercontinuum induced by femtosecond filament in liquid media.

Recently, the phase-sensitive OTDR (Φ-OTDR) based vibration sensor system has gained the focus of many researchers and some efforts have been undertaken to push further the limitations imposed on the performance of the Φ-OTDR sensor system. Then, progress in the different areas of its performance evaluation factors such as: improvement of the signal-to-noise ratio (SNR), spatial resolution (SR) in the sub-meter range, enlargement of the sensing range, frequency response bandwidth over the conventional limit and phase signal demodulation for quantitative measurement have been realized. This paper presents an overview of the recent progress in the Φ-OTDR based vibration sensing system in the different areas mentioned above.

Abstract: The chemical mechanical polishing (CMP) has been widely used for surface modification of critical materials and components and provided global planarization of topography with a low post-planarization slope high quality and efficiency. The colloidal silica slurries play an important role in the finishing processes of optical components. Monodisperse mesoporous silica nanospheres were synthesized with different surfactant by Stöber method. Their architectural features and texture parameters were characterized by XRD, FTIR, N2 adsorption–desorption isotherms, SEM, XPS, and TGA techniques. The spherical SiO2 products presented with the controllable 50-150 nm particle size and distribution. The AFM micrographs reveal that flat and smooth surfaces without distinct scratches residual particles are achieved by using the as-obtained composite particles as abrasives[The particle size of SiO2 slurry plays a critical role in the chemical-mechanical polishing process.

MicroRNAs (miRNAs) play crucial roles in the regulation of the transcriptome and development of diseases including cancer and autoimmune diseases, such as rheumatoid arthritis (RA). Currently, a comprehensive map, illustrating how miRNAs regulate transcripts, pathways, immune system differentiation, and their interaction with terminal cells, such as T cells, fibroblast-like synoviocytes (FLS), osteoblasts, and osteoclasts, is still missing. In this review, we provide a thorough summary of the roles of miRNAs in the susceptibility to pathogenesis, diagnosis, therapeutic intervention, and prognosis of RA. Numerous miRNAs are abnormally expressed in cells involved in RA, and regulate target genes and pathways including the NF-κB, Fas-FasL, JAK-STAT, IRE1-RIDD, and mTOR pathways. By regulating gene expression, miRNAs affect T cell differentiation to diverse cell types, including Th17 and T-reg cells, and thus constitute promising gene therapy targets to modulate the immune system in RA. We summarize the diagnostic and prognostic potential of blood-circulating and cell-free miRNAs, highlighting the novel opportunities to combine these with rheumatoid factor (RF) and anti-cyclic citrullinated peptide (anti-CCP) to provide accurate diagnosis and prognosis, especially for seronegative patients. Furthermore, we outline how functional genetic variants of miR-499 and miR-146a partly explain the unmet susceptibility to RA. Additionally, we review the evidence implicating miRNAs as promising biomarkers of efficiency, response, and resistance to disease-modifying anti-rheumatic drugs (DMRDs) and immunotherapy. Finally, we discuss the autotherapeutic effect of miRNA intervention as a step toward the development of miRNA-based anti-RA drugs. Collectively, the current evidence supports miRNAs as interesting targets to better understand the pathogenetic mechanisms of RA and design more efficient therapeutic interventions.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Ischemic stroke is one of the most disabling diseases and a leading cause of death globally. Despite advances in medical care, the global burden of stroke continues to grow, as no effective treatments to limit or reverse ischemic injury to the brain are available. However, recent preclinical findings have revealed the potential role of transient receptor potential cation 6 (TRPC6) channels as endogenous protectors of neuronal tissue. Activating TRPC6 in various cerebral ischemia models has been found to prevent neuronal death, whereas blocking TRPC6 enhances sensitivity to ischemia. Evidence has shown that Ca2+ influx through TRPC6 activates cAMP response element-binding protein (CREB), an important transcription factor linked to neuronal survival. Additionally, TRPC6 activation may counter excitotoxic damage resulting from glutamate release by attenuating the activity of NMDA receptors of neurons by posttranslational means. Unresolved though, are the roles of TRPC6 channels in non-neuronal cells such as astrocytes and endothelial cells. Moreover, TRPC6 channels may have detrimental effects on the blood-brain barrier, although their exact role in neurovascular coupling requires further investigation. This review discusses evidence-based cell-specific aspects of TRPC6 in the brain to assess the potential targets for ischemic stroke management.

This study was first time designed to investigate the effect of oxidation on protein digestion and transport properties in boiled sea cucumber body wall (BSCBW) via simulated digestion combine with everted-rat-gut-sac models. Boiling heat treatments led to protein oxidation in SCBW, manifested by increases in free radical intensity, thiobarbituric acid reactive substances, carbonyl groups, disulfide bonds, dityrosine bonds, advanced glycation end products, protein hydrophobicity and aggregation, declines in free sulfhydryl group, and secondary structure transition from α-helix to β-sheet. Boiling for 2 h caused the anti-digestion collagen unfolding, provided the action site for protease, and improved the protein digestion and transport levels. On the contrary, excessive oxidative modification of 4 h-BSCBW resulted in decreased protein digestion and transport levels. From the perspective of texture, digestion and transport properties, boiling for 2 h can obtain sea cucumber products with better edible and digestible properties, which is considered to be a better processing condition.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

The exceptional performance advantages of the fiber optic gyroscope (FOG) position it as a dominant player in middle and high-end inertial navigation systems. To prevent the loss of sensor precision caused by algorithm design and simplify the complex modeling strategy in traditional methods. We gradually demonstrate the significant role of Convolutional Neural Network (CNN) in the navigation system based on FOG, and utilize the particle swarm optimization algorithm (PSO) to expedite the convergence of the network. The experimental results demonstrate that the initial alignment method based on deep learning is more accurate than the traditional method. The attitude angle error is reduced by 81.25%, 92.54% and 36.53% respectively. The research provides support for the future application of deep learning in optical navigation systems.

Semisolid casting can provide excellent castings, but the nature of the pore-forming mechanisms has not been properly clarified. In the current communication, it was suggested that hydrogen precipitated during slurry making might have a decisive role in the formation of both gas and shrinkage porosity. Intensive stirring at the end of the slurry making process may act as a degassing step. Without the intense stirring, structures of primary slurry particles form around the hydrogen pores, strongly affecting pore formation and feeding during the intensification stage.

Outdoor lighting is becoming increasingly widespread, and residents are suffering from serious light pollution as a result. Residents’ awareness of their rights to protection has gradually increased. However, due to the sometimes-inaccessible nature of residential vertical light incidence intensity data and the high cost of obtaining specific measurements, there is no appropriate hierarchic compensation for residents suffering from different degrees of light pollution. It is therefore important to measure light pollution levels and their damage at the neighborhood scale to provide residents with basic materials for proper protection and to create more politically suitable solutions. This article presents a light pollution assessment method that is easy to perform, is low-cost, and has a short data-processing cycle. This method can be used to monitor residential zone light pollution in other cities. We chose three open areas to test the spatial variation pattern of light intensity. The results are in accordance with spatial interpolation patterns and can be fit, with high precision, using the IDW method. This approach can also be used in 3 dimensions to quantitatively evaluate the distribution of light intensity distribution. We use a mixed-use zone in Beijing known as The Place as our case study area. The vertical illumination at the windows of residential buildings ranges from 2 lux to 23 lux; the illumination in some areas is far higher than the value recommended by CIE. Such severe light pollution can seriously interfere with people's daily lives and has a serious influence on their rest and health. The results of this survey will serve as an important database to assess whether the planning of night-time lighting is scientific and whether it provides residents with a basis for the protection of their rights.

This study investigates the impact of specimen size on the mechanical properties of wood, specifically focusing on compression strength, elastic modulus, and Poisson's ratio. Compression tests were conducted using three different specimen sizes (20mm×20mm×30mm, 40mm×40mm×60mm, 60mm×90mm×90mm) in the longitudinal, radial, and tangential directions. Mechanical parameters, failure mechanisms, load-displacement curves, and stress-strain relationships were systematically analyzed for each size. The study also evaluated the influence of specimen size on the accuracy of finite element numerical simulations by utilizing the obtained mechanical parameters. The results reveal a significant correlation between compressive strength and specimen size, indicating a decrease in compressive strength with increasing specimen size. Conversely, elastic modulus and Poisson's ratio exhibit less sensitivity to variations in specimen size. Notably, parameters derived from small-sized specimens (20mm×20mm×30mm) exhibited substantial errors, while those obtained from medium-sized (40mm×40mm×60mm) and large-sized specimens (60mm×90mm×90mm) demonstrated greater reliability, providing precise results in finite element numerical simulations.

In the contemporary world of science, continuous observation of specific fixed regions is required, awaiting the emergence of targets or phenomena within those areas to locate and identify them. Astronomy requires continuous monitoring of stars, swiftly pinpointing occurrences, such as flares, and acquiring their spectral data to aid identification. In military contexts, continuous observation of specific areas is essential for promptly locating enemy movements and obtaining target spectral data for deciphering enemy disguises. Additionally, continuous observation of experimental samples in biochemistry is mandatory to pinpoint localized changes and acquire spectral data from those areas. Hence, this paper develops a novel imaging spectrometer solution to monitor localized regions continuously. Specifically, this paper first elaborates on the developed instrument’s characteristics and optical structure, followed by optical design software simulations. The instrument has an F-number of 5, a focal length of 100mm, and a field of view covering the wavelength range from 400nm to 600nm. The optical path diagram indicates that the system’s dispersion and imaging images can be separated, meeting the system’s requirements. Besides, the Modulation Transfer Function (MTF) graph confirms that the image quality meets the requirements. Furthermore, a region-monitoring type imaging spectrometer was constructed to assess the instrument’s capability for spectral observation of fixed regions. The instrument can detect a fixed area, with the target placed within the detection area. Spectral data were successfully obtained by conducting image processing on the acquired images. The correlation coefficient between this data and reference data was as high as 0.9226, indicating the instrument’s successful measurement of the target’s spectrum. Thus, the developed instrument demonstrated that it can image the observed areas and acquire spectral data from targets within those regions.

An efficient stereoselective three-component reaction for the synthesis of spiro[4H-chromene-3,3’-oxindole] derivatives was realized through an organocatalyzed cascade Knoevenagel/Michael/cyclization reaction using a quinidine-derived squaramide as the catalyst. Under the optimized conditions, the reactions of isatins, malononitrile, and sesamol yield the desired spirooxindoles in good yields (75–87%) and moderate to high ee values (up to 90% ee). Two pairs of selected enantiomers were subjected to evaluate their antiproliferative activities on three types of human cancer cell lines using the MTT assay. The results indicated that stereoselectivity and electrical effect showed significant impact on activity. Enanotiomer R-3f exhibited optimal cytotoxic activity against U2OS cell line, which was close to the inhibitory activity of positive control, Adriamycin.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

To investigate the effects of plant polysaccharides combined with boric acid on digestive function, immune function, and harmful gas and heavy metal contents in faeces of finishing pigs, for this study, 90 healthy three-way cross-bred pigs were selected and randomly divided into five groups: Con) A control, fed basic feed; BA) fed basic feed supplemented with 40 mg/kg of boric acid; BA+APS) fed basic feed supplemented with 40 mg/kg of boric acid and 400 mg/kg of Astragalus polysaccharides; BA+GLP) fed basic feed supplemented with 40 mg/kg of boric acid with 200 mg/kg of Ganoderma lucidum polysaccharides; and BA+EPS) fed basic feed supplemented with 40 mg/kg of boric acid and 500 mg/kg of Echinacea polysaccharides. Compared with the Con, the average daily gain (ADG) and trypsin activity were higher in BA, along with there being increased glutathione peroxidase (p < 0.05); furthermore, lower malondialdehyde content and harmful substance emissions from manure were observed (p < 0.05). Compared with BA, increases in ADG, gain-to-feed ratio (G/F), trypsin, and maltase activities were observed in BA+EPS (p < 0.05), as well as a lower NH3 emissions (p < 0.05). Compared with BA, BA+APS exhibited higher ADG, average daily feed intake (ADFI), G/F, trypsin, and maltase activities (p < 0.05), while H2S emissions were lower (p < 0.05). And Taken together, our findings reveal that supplementation with boric acid and plant polysaccharides in the diet of finishing pigs synergistically improved their growth performance, trypsin and maltase activities, and immune function, while also discovered the intestinal digestive enzymes, serum inflammatory factors, oxidative stress responseand emissions of harmful gases and heavy metals from feces and urine were tightly related, further reducing the impact of fecal pollution generated by modern animal husbandry on the environment.

Sunflower is one of the oil crops and its planting areas was listed behind Soybean, peanut and rapeseeds in China. It will encounter different kind of diseases during planting, thus limited the seeds yield. Fusarium species are the major threat to different crops nowadays, it is very important to identify the species caused diseases on different hosts, so that the potential control measures may be explored. In Inner mongolia, Sunflower Disk Rot (SDR) was found in different sunflower planting field, the average infection ratio around 8.50%, typically in some verieties, its infection ratio reach to 11.67%. The diseased receptacle were collected from different locations and Koch’s postulate was conducted. The results showed that Fusarium verticillioides was the main causal agent caused SDR. Fungicide toxicity tests shown that Fludioxonil and Flutolanil were screened out from six fungicides for controlling F. verticillioides, with EC50 values of 0.05 µg/mL (R = 0.9825) and 0.96 µg/mL (R = 0.9964) , respectively. This is the first report of SDR caused by F. verticillioides, and it will alert sunflower reseachers to include SDR in the disease list, so as to control sunflower diseases with integrated management strategy successfully.

Disposal and treatment of excess sludge is a huge problem in waste water treatment plants. Discharge plasma oxidation is an effective approach for sludge dewatering and digestion. In this study, the excess sludge disintegration by non-thermal discharge plasma coupled with thiosulfate (TSA) was investigated. The soluble chemical oxygen demand (SCOD) increased to 404.93 mg L-1 after 20 min of single discharge plasma treatment, and it further increased to 549.08 mg L-1 after adding 15 mmol L-1 of TSA; the water content of filter cake also further decreased in the presence of TSA. There existed an appropriate TSA dosage. In the discharge plasma coupled with TSA system, reactive oxygen species (·OH and ·O2-) were produced and played important roles in sludge disintegration. The addition of TSA promoted the production of ·OH. These reactive oxygen species destroyed the floc structures and promoted the transformation of organic substances, leading to reduction in average size of sludge flocs. The ratio of soluble extracellular polymer substances (S-EPS) was enhanced, while the ratio of tightly bound fraction was reduced after treatment. Thus, discharge plasma coupled with TSA promoted the lysis of microbial cells and released intracellular organic matter and bound water, finally improving sludge dewaterability.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

ITRF input data which are integrated by GNSS, SLR, VLBI, DORIS combination centers are considered to be relatively high-quality and accurate solutions. However, when utilizing these inputs, one still needs to identify outliers, rescale inaccurate covariance matrix and evaluate the precision of the observed datum information. To achieve the above-mentioned objectives, we propose a terrestrial reference frame (TRF) stacking approach to establish the single technical reference frameworks for the ITRF2014 and ITRF2020 datasets of all four technologies. As a result, roughly 0.5% or less of the SLR observations are identified as outliers, while the ratio of DORIS, GNSS, and VLBI observations are below 1%, around 2%, and ranging from 1% to 1.2%, respectively. The post-rescaling covariance scale factors are 25.07, 27.25, 18.84, 6.98 for GNSS, SLR, VLBI, and DORIS in ITRF2014 datasets, and 8.95, 14.9, 16.8, 7.78 in ITRF2020 datasets, respectively. It is shown that the consistency between the SLR scale and ITRF has improved, increasing from around -5mm in ITRF2014 datasets to approximately -1mm in ITRF2020 datasets. The scale velocity derived from fitting the VLBI scale parameter series with all epochs in ITRF2020 datasets differs by approximately 0.21mm/year from the velocity obtained by fitting the data up to 2013.75 because of the scale drift of VLBI at around 2013. The decreasing standard deviations of the Polar motion parameter (XPO, YPO) offsets between Stacking TRFs and 14C04 (20C04) indicating an improvement in the precision of polar motion observations for all of the four techniques. From the perspective of the Weighted Root Mean Square in station coordinates, the measurement precision of GNSS, SLR, and DORIS techniques has improved, while VLBI shows no significant change.

Rapid and accurate detection of road cracks is of great significance for road health monitoring, but currently this work is mainly completed through manual site surveys. Low-altitude UAV remote sensing can obtain images with centimeter or even subcentimeter ground resolution, which provides a new efficient and economical approach for rapid crack detection. Nevertheless, crack detection networks face challenges such as edge blurring and misidentification due to the heterogeneity of road cracks and the complexity of the background. To address these issues, we propose a real-time edge reconstruction crack detection network (ERNet) which adopts multi-level information aggregation to reconstruct crack edges and improve the accuracy of segmentation between the target and background. To capture global dependencies across spatial and channel levels, we propose an efficient bilateral decomposed convolutional attention module (BDAM) that combines depth separable convolution and dilated convolution to capture global dependencies across spatial and channel levels. To enhance the accuracy of crack detection, we use a coordinate-based fusion module that integrates spatial, semantic, and edge reconstruction information. In addition, we propose an automatic measurement of crack information for extracting the crack trunk and its corresponding length and width. Experimental results demonstrate that our network achieves the best balance between accuracy and inference speed.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Domain generalization has led to remarkable achievements in Hyperspectral Image (HSI) classification. Inspired by contrastive language-image pre-training (CLIP), the language-aware domain generalization method has been explored to learn cross-domain-invariant representation. However, existing methods face some challenges: 1) The weak capacity to extract long-range contextual information and inter-class correlation. 2) Due to the inadequacies of the large-scale pre-training for HSI data, the spatial-spectral features of HSI and linguistic features can not be straightforwardly alignment. To address the above problems, a novel network has been proposed with a CLIP framework, which consists of an image encoder, based on an encoder-only transformer to obtain the global contextual information and inter-class correlation, a frozen text encoder, and a cross-attention mechanism, named Linguistic-Interact-with-Visual Engager (LIVE), enhances the interaction between two modalities. Extensive experiments demonstrating superior performance over state-of-the-art methods in HSI Domain Generalization with a CLIP framework.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

This paper investigates the cooperative anti-jamming distributed channel selection problem in UAV communication networks. Considering the existence of malicious jamming and co-channel interference, a location-aware cooperative anti-jamming scheme is designed for the purpose of maximizing the users' utilities. Users in the UAV group cooperate with each other via location information sharing. When the received interference energy is lower than mutual interference threshold, users conduct channel selection strategies independently. Otherwise, users take joint actions with a cooperative anti-jamming pattern under the impact of mutual interference. Aimed at the independent anti-jamming channel selection problem under no mutual interference, a Markov Decision Process framework is introduced, whereas for the cooperative anti-jamming channel selection case under the influence of co-channel mutual interference, a Markov game framework is employed. Furthermore, motivated by reinforcement learning with a ``Cooperation-Decision-Feedback-Adjustment" idea, we design a location-aware cooperative anti-jamming distributed channel selection algorithm (LCADCSA) to obtain the optimal anti-jamming channel strategies for the users with a distributed way. In addition, the channel switching cost and cooperation cost, which have great impact on the users' utilities, are introduced. Finally, simulation results show that the proposed algorithm converges to a stable solution with which the UAV group can avoid the malicious jamming as well as co-channel interference effectively.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Lactobacillus plantarum has been observed to play a crucial role in shaping the sensory properties of chili sauce. However, the specific taste-active metabolites responsible for the desirable flavor profile of chili sauce remain inadequately characterized. This study employed a combination of metabolomics and web-based computational tools analysis to investigate the dynamic changes in taste-active metabolites during chili sauce fermentation. Initially, metabolites were rapidly annotated using a feature-based molecular network, leading to the tentative annotation of 206 metabolites, of which a significant proportion had not been previously reported. Subsequently, the VirtualTaste tool identified dihydrosphingosine, lactic acid, isoleucine, phytosphingosine, and gluconic acid as potential taste markers for quality control. Finally, pathway enrichment analysis revealed that these components were primarily associated with amino acid tRNA, phenylalanine, tyrosine, and tryptophan biosynthesis, as well as sphingolipid metabolism. This study provides valuable insights into the mechanisms underlying the formation of the distinctive flavor of chili sauce.

Multimodal remote sensing data classification can enhance the model’s ability to distinguish land features through multimodal data fusion. In this context, how to help models understand the relationship between multimodal data and target tasks is the focus of researchers. Inspired by human feedback learning mechanisms, causal reasoning mechanisms, and knowledge induction mechanisms, this paper integrates causal learning, reinforcement learning, and meta learning into a unified remote sensing data classification framework and proposed the causal meta-reinforcement learning (CMRL). First, based on feedback learning mechanisms, we have overcome the limitations of traditional implicit optimization of fusion features and customized a reinforcement learning environment for multimodal remote sensing data classification tasks. Through feedback interactive learning between agents and the environment, we help them understand the complex relationships between multimodal data and labels, thereby achieving full mining of multimodal complementary information. Second, based on the causal inference mechanism we designed causal distribution prediction action, classification reward, and causal intervention reward, capturing pure causal factors in multimodal data and cutting off false statistical associations between non-causal factors and class labels. Finally, based on the knowledge induction mechanism, we designed a bi-layer optimization mechanism based on meta-learning. By constructing a meta training task and meta validation task simulation model in the generalization scenario of unseen data, we helped the model induce cross-task shared knowledge, thereby improving its generalization ability for unseen multimodal data. The experimental results on multiple sets of multimodal datasets show that the proposed method achieved state-of-the-art performance in multimodal remote sensing data classification tasks.