Rice bran (RB) is a promising food ingredient that can improve biological function. In this study, we investigated the effects of RB, both unfermented (RB30) and fermented (RBF30) with five different microorganisms on the neurobehavioral activity in zebrafish larvae. Analytical methods such as UV spectrum and MS scan were performed. Interestingly, niacin content, which is known to improve brain functions such as cognition and emotion, was found to be higher in RBF30 than in RB30. Furthermore, niacin content was highly increased in the RBF30-exposed fish, compared to those in control fish. Therefore, we profiled behavioral patterns and various neurochemistry in zebrafish larvae following supplementation with RBF30 as well as performed calcium imaging on Tg (huC:GAL4-VP16);(UAS:GCaMP7a) zebrafish larvae to determine the correlation of neural activity. RBF30 revealed greater stimulation of locomotor activity without negatively affecting decision-making behavior in zebrafish larvae, as compared to RB30 or niacin. Its behavioral activation is mainly linked with the elevations of neural activity and several neurochemicals such as serotonergic and dopaminergic systems that are implicated in the control of anxiety and stress. Taken together, these results suggest that RBF30 could be a food material that improve the behavioral health by modulating neural activity and brain neurochemistry.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

This study investigated a novel radioimmunotherapy strategy for targeting tumor angiogenesis. We developed a radiopharmaceutical complex by labeling an anti-adenosine triphosphate syn-thase (ATPS) monoclonal antibody (mAb) with the radioisotope 177Lu using DOTA as a chelating agent. 177Lu-DOTA-ATPS mAb demonstrated high labeling efficiency (99.0%) and stability in se-rum. MKN-45 cancer cells exhibited the highest cellular uptake, which could be specifically blocked by unlabeled ATPS mAb. In mice, 177Lu-DOTA-ATPS mAb accumulated significantly in tumors, with a tumor uptake of 16.0 ± 1.5%ID/g on day 7. 177Lu-DOTA-ATPS mAb treatment sig-nificantly reduced the viability of MKN-45 cells in a dose-dependent manner. In a xenograft tumor model, this radioimmunotherapy strategy led to substantial tumor growth inhibition (82.8%). Furthermore, combining 177Lu-DOTA-ATPS mAb with sunitinib, an anti-angiogenic drug, en-hanced the therapeutic efficacy of sunitinib in the mouse model. Our study successfully developed 177Lu-DOTA-ATPS mAb, a radioimmunotherapy agent targeting tumor blood vessels. This ap-proach demonstrates significant promise for inhibiting tumor growth, both as a single therapy and in combination with other anti-cancer drugs.

The evolution in semiconducting devices has introduced flexible control on a system but it has also penetrated harmonics in the grid, which results in extra electrical stress and load. Limiting the presence of harmonics in the grid and low power factor maintained by consumers has become of utmost priority to the power system analyst. Hence, the need for Active Filter emerges. Here, a real-time simulation, in dSPACE- Targetlink, of shunt harmonics active filter is propounded. The possible basic control strategy used in the simulation is ”Instantaneous Power Theory”. Control logic of two features of Active Filter viz., Global Harmonics Elimination, and Reactive Power Compensation are produced in the paper. The results obtained in ”Software In Loop Mode” of dSPACE are discussed and verified in detail. The richness of the code generated by the dSPACE- Target link can be reasoned by observing the results which are well aligned with the industrial standards regarding the harmonics.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Bullying makes learning difficult for nursing students, and using real-life scenarios during training can improve the understanding of workplace bullying. Thus, to mitigate bullying experienced by nurses, this study developed and evaluated a cognitive rehearsal education program that constituted of training nursing students through role-play simulations. A mixed-method research design was used to evaluate 39 nursing students from two universities. A quasi-experimental research design was applied to assess symptoms, knowledge, and perceptions of bullying, and a focus group interview was conducted with six participants. Quantitative analyses revealed that the program improved participants’ knowledge and perceptions, but not their symptoms. The focus group interview revealed that the program improved participants’ coping skills and desire for education. This program could be effective in raising awareness of workplace bullying and increasing relevant coping skills. It can be further developed as part of an overall strategy to manage workplace bullying and its consequences in hospital settings.

This study provides a comprehensive analysis of global patent trends in battery recycling, focusing on secondary batteries and related technologies across Korea, China, and the United States. The data, collected from various patent databases, was quantitatively analyzed to identify technology trends and direct future development. The analysis reveals distinct emphases on technologies such as lithium-ion and waste battery recycling, highlighting notable differences in patent activities among key companies and countries. China's large number of patents in battery manufacturing processes contrasts with the USA's focus on electrochemical cell construction and storage systems, while Korea shows significant activity in waste battery technology. The study underscores the competitive landscape and innovation efforts in the battery recycling sector, providing insights into the technological focuses and priorities of each country. It also identifies key challenges, such as the need for consistent innovation and broader geographic coverage in Korea, enhancing patent influence and international presence in China, and ensuring high patent quality and fostering innovation in lagging sectors in the United States. Addressing these challenges through enhanced collaboration, increased R&D investments, and supportive policies is crucial for strengthening the global position and driving further innovation in the battery recycling sector.

Background: Angelica gigas Nakai, Korean dang-gui, has long been widely used in traditional treatment methods. There have been a number of studies of the health effects of A. gigas and related compounds, but studies addressing effects on blood triglycerides (TG) are lacking. To investigate the effects of A. gigas Nakai extract (AGNE) on TG in Korean subjects, we carried out a 12-week, randomized, double-blind, placebo-controlled clinical trial. Methods: Subjects who met the inclusion criterion (130 mg/dL ≤ fasting blood TG ≤ 200 mg/dL) were recruited for this study. One hundred subjects were assigned to the AGNE group (n=50) or the placebo group (n=50), who were given 1g/day of AGNE (as a gigas Nakai extract 200mg/d) in capsules, and the control group for 12 weeks. Outcomes were efficacy TG, lipid profiles, atherogenic index, and safety parameters were assessed initially for a baseline measurement and after 12 weeks. Results: After 12 weeks of supplementation, TG and very low-density lipoprotein cholesterol (VLDL-C) concentration and TG/HDL-C ratio in the AGNE group were significantly reduced compared to the placebo group (p <0.05). No significant changes in any safety parameter were observed. Conclusions: These results suggest that ingestion of AGNE may improve TG and be useful to manage or prevent hypertriglyceridemia.

(1) Background: Most hemodialysis patients may experience physiological and psychological stress. Exposure to nature has been previously reported to reduce the measures of psychological and physiological stress, and immune function. This study aimed to investigate psychological and physiological effects of integrated indirect forest therapy on chronic renal failure patients undergoing hemodialysis. (2) Methods: As a quasi-experiment, this study employed a nonequivalent control group, repeated measurements, and a non-synchronized design. A total of 54 participants were included: 26 and 28 in the experimental and control groups, respectively. During hemodialysis, five types of forest therapy stimuli (visual, auditory, olfactory, tactile, and motor) were applied 3 times per week for 4 weeks during 15-minute sessions. (3) Results: Positive but not negative emotion measures differed between the groups after the intervention. Fatigue and physiological stress levels were significantly reduced in the experimental group, whereas no significant difference was found between the groups on the measures of psychological stress. Activation of both the parasympathetic and sympathetic nervous systems was similar in both groups, as was the number of natural killer cells. (4) Conclusion: Integrated indirect forest therapy may help increase positive emotions and reduce fatigue and stress levels during hemodialysis in patients with chronic renal failure.

Triticale is known for being an alternative energy source to usual cereals such as maize and wheat in poultry nutrition. Several studies suggested opposite results regarding its incorporation as a feed ingredient on laying hens’ production parameters. This article used a meta-analysis to assess the factors influencing the effects of triticale on layers’ performance. In July 2022, papers studying the effect of triticale on layers’ egg production (EP), egg weight (EW), egg yolk color (EYC), feed intake (FI), and feed conversion ratio (FCR) were identified on Google Scholar, PubMed, and Science Direct. According to the eligibility criteria of PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) guidelines, 6 articles were registered and segmented into 16 experiments for our meta-analysis. Overall, the trim and fill method revealed that triticale had similar impacts to conventional cereals on laying hens' performance. However, the meta-ANOVA and the meta-regression emphasized that triticale percentage, triticale strains and laying hens strains could significantly influence the effect of triticale on layers' performance. Indeed, the meta-Anova highlighted that the Hy-Line Brown strain and Joesong and Juanilo triticale strains in-duced the best laying hens’ performance. Moreover, the meta-regression emphasized a positive correlation between the triticale inclusion percentage and the EW in Juanilo triticale diets and a negative correlation between the triticale inclusion percentages and the EYC in the triticale and laying hens strains studied. Even though the funnel plot and the Egger linear test suggested sig-nificant publication bias, the present meta-analysis remains consistent research to understand how certain factors could influence the impact of triticale on layers' performance.

Kim(2015) introduced the degenerate Cauchy numbers of the second kind and gave some identities of them. In this paper, by using the modified polyexponential functions which are introduced by Kim-Kim(2019), we define the degenerate poly-Cauchy polynomials of the second kind and investigate some properties of them. Furthermore, we consider the degenerate unipoly-Cauchy polynomials of the second kind and discuss some properties of them.

The inclusion of exogenous phytase in broiler P and Ca deficient diets in response to heightened concerns over excessive P excretion into the environment over the years has remarkably been documented. However, responses among these studies have been inconsistent because of the several factors affecting P utilization. For this reason, a systematic review with meta-analysis of results from forty-one studies published from 2000 to February 2024 was evaluated to: 1) quantitatively summarize the size of phytase effect on growth performance, bone strength, and mineralization in broilers fed P and Ca deficient basal diets and 2) estimate and explore the heterogeneity of the effect sizes of outcomes using sub-group and meta-regression analyses. The quality of the included studies was assessed using the Cochrane Collaboration’s SYRCLE Risk of Bias checklists for animal studies. Additionally, applying the random-effects models, Hedges’ g effect size of supplementation with phytase was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (P_SMD ≤ 0.05, I² > 50%, n ≥ 10). The meta-analysis showed that supplemental phytase increases ADFI and BWG and reduces FCR at each time point of growth (< 0.0001). Additionally, phytase supplementation consistently increased tibia ash, P and Ca, and bone strength (< 0.0001) of broilers fed P and Ca deficient diets. Results of the subgroup and meta-regression analyses showed that age and strain of broiler, dietary P source, and duration of phytase exposure significantly influence the effect size of phytase on growth and bone parameters. In conclusion, phytase can attenuate the effect of reducing dietary available phosphorus and calcium and improve ADFI, BWG, and reduced FCR, especially when added to starter diets. It further enhances bone ash, bone mineralization, and bone-breaking strength of broilers, even though the effects of bone ash and strength can be maximized in the starter phase of growth. However, the effect sizes of phytase were related to the age and strain of the broiler, dietary P source, and duration of phytase exposure rather than the dosage.

Understanding the mechanism for heat tolerance is important for the hot pepper breeding program to develop heat-tolerant cultivars in changing climate. This study was conducted to investigate physiological and biochemical parameters related to heat tolerance and to determine leaf heat damage levels critical for selecting heat-tolerant genotypes. Seedlings of two commercial cultivars, heat-tolerant ‘NW Bigarim’ (NB) and susceptible ‘Chyung Yang’ (CY), were grown in 42 °C for ten days. Photosynthesis, electrolyte conductivity, proline content were measured among seedlings during heat treatment. Photosynthetic rate was significantly reduced in ‘CY’ but not in ‘NB’ seedlings in 42 °C. Stomatal conductivity and transpiration rate was significantly higher in ‘NB’ than ‘CY’. Proline content was also significantly higher in ‘NB’. After heat treatment, leaf heat damages were determined as 0, 25, 50 and 75% and plants with different leaf heat damages were moved to a glasshouse (30–32/22–24 °C in day/night). The growth and developmental parameters were investigated until 70 days. ‘NB’ was significantly affected by leaf heat damages only in fruit yield while ‘CY’ was in fruit set, number and yield. ‘NB’ showed fast recovery after heat stress compared to ‘CY’. These results suggest that constant photosynthetic rate via increased transpiration rate as well as high proline content in heat stress condition confer faster recovery from heat damage of heat-tolerant cultivars in seedlings stages.

With the continuous growth of electric and electronic appliances’ usage, the waste produced with obsolete material (e-waste) has an increasing environmental impact. Also, the production of such appliances bears to increased consumption of natural resources and produces a multitude of toxic and hazardous substances, which typically are not properly treated. One of the approaches that may be adopted to reduce such problems relies on the circularization of the current linear model, commonly adopted in the EEE value chain. This includes recovering eol products and reintroducing its parts, components, or raw materials into the value chain (e.g. semiconductors, circuit boards, raw metals, etc.), thus contributing to a more sustainable value chain. In this article, we present a state-of-art review that focuses on approaches and solutions for the EEE value chain traceability, and analyses the technologies that may be beneficial for promoting and implementing the CE model in this value chain.

The key to ensuring the sustainability of transportation operations on the roads is to manage traffic flows homogeneously. By homogenizing the behavior of various drivers, traffic operation can be optimized, and traffic safety can be improved. However, the advent of autonomous vehicles is expected to have a major impact on the homogeneity of sustainable transportation operations. In this study, a method of driving in harmony with surrounding vehicles was studied to minimize the impact of autonomous vehicles on current traffic operation. In particular, in this study, a methodology was developed to optimize the driving behavior of autonomous vehicles by analyzing the driving behavior of following vehicles using spectrum analysis. Specifically, a method for calculating three indicators that can analyze the driving behavior of a following vehicle, such as reaction time, stimulus adaptation index, and collision risk avoidance index, was proposed. These indices produced consistent and robust results for all traffic conditions. If these indicators are used, it is expected that sustainable traffic management will be possible even when autonomous vehicles and human drivers are mixed on the road.

Emulsifiers like egg yolk (EY) are necessary for the formation of mayonnaise, which is an oil-in-water type colloid. This study aimed to assess the potential of defatted soybean powder treated with supercritical carbon dioxide (DSF-SC) in enhancing the quality of plant-based may-onnaise as plant-based alternatives gain popularity. This study involved producing DSF-SC and comparing its quality attributes to those of mayonnaise made with varying amounts of control soy flour (CSF), DSF-SC, and EY. It was found that mayonnaise made with DSF-SC, with increased emulsifier quantity, showed better emulsion stability, viscosity, and smaller, more uniform particle size compared with CSF mayonnaise. Additionally, DSF-SC mayonnaise was overall rated higher in sensory evaluation. The addition of approximately 2% DSF-SC positively influenced the emul-sion and sensory properties of the vegan mayonnaise, making DSF-SC a promising plant-based alternative emulsifier for replacing animal ingredients.

Methotrexate (MTX) is commonly used in intrathecal chemotherapy for patients with acute lymphocytic leukemia (ALL) to prevent central nervous system (CNS) involvement. However, the use of MTX-based chemotherapy can lead to rare yet severe complications, such as MTX-induced myelopathy. Here we report the case of MTX-induced myelopathy initially misdiagnosed as Guillain-Barre syndrome, leading to a delay in diagnosis and treatment. We present a case of a 39-year-old male with a history of B-cell acute lymphoblastic leukemia (B-ALL) who experienced bilateral foot paresthesia and progressive lower extremity weakness after intrathecal methotrexate (MTX) treatment. Initially suspected as Guillain-Barre syndrome (GBS) due to similar clinical features and nerve conduction studies. The patient received intravenous immunoglobulin (IVIG) treatment, but his condition worsened. A subsequent spine MRI revealed MTX-induced myelopathy. This case highlights the diagnostic challenge posed by the similarity in clinical presentation between MTX-induced myelopathy and GBS. Differentiating between these conditions is critical for appropriate management. Prompt recognition and treatment with folate metabolism compounds may mitigate neurological sequelae.

This work focuses on forced combustion with regards to the relationship between vent mixer models and several injection locations in unheated supersonic flow. A plasma jet torch was used to ignite the hydrogen–air mixture in a laboratory-scaled combustor duct. The flow field of the combustion was visualized with pressure and gas-sampling measurements. The vent mixers indicate good dispersion characteristics of the mixture for both parallel and normal 1 injections. However, forced combustion is dominantly governed by the injection rate toward the plasma jet (hot source) because the combustible region is restricted under the cold main flow. For this reason, the parallel injection, which provides the hydrogen–air mixture directly toward the plasma jet, shows good combustion performance. The normal 1 injection interacted with the vent mixers and shows slightly good combustion performance. Lastly, the normal 2 injection is little affected by the vent mixers and has poor combustion performance.

Cancer stem cells (CSCs) are a tumor cell subpopulation that drives tumor progression and metastasis, leading to poor overall survival of patients. In colorectal cancer (CRC), hyper-activation of Wnt/β-catenin signaling by mutation of both Adenomatous polyposis coli (APC) and K-Ras increases the size of the CSC population. We previously showed that the CPD0857 inactivates Wnt/β-catenin signaling by promoting ubiquitin-dependent proteasomal degradation of β-catenin and Ras proteins, thereby decreasing proliferation and increasing apoptosis of CRC lines. CPD0857 also decreased growth and invasiveness of CRC cells harboring mutant K-Ras resistant to EGFR mAb therapy. Here, we show that CPD0857 treatment decreases proliferation and increases neuronal differentiation of neural progenitor cells (NPCs). CDP0857 effectively reduced expression of CSC markers and suppressed self-renewal capacity. CPD0857 treatment also inhibited proliferation and expression of CSC markers in D-K-Ras MT cells carrying K-Ras, APC and PI3K mutations, indicating inhibition of PI3K/AKT signaling. Moreover, CPD0857-treated xenograft mice showed regression of tumor growth and decreased numbers of CSCs in tumors. We conclude that CPD0857 could serve as the basis of a drug development strategy targeting CSCs activated through Wnt/β-catenin-Ras MAPK-PI3K/AKT signaling in CRCs.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

The Textile and Clothing (T\&C) value chain is one of the most polluting in the world and one that produces the most waste. It is, therefore, important to encourage the Circular Economy (CE) model in this sector, to reduce pollution and mitigate the effects of waste production, and consequently increase environmental sustainability. For that, the involvement of the final consumer is essential. And, the final consumer's use of an Eco-gamified application for registering and promoting Consumer-to-Consumer (C2C) and Consumer-to-Business (C2B) activities, which extends the life time of textile products, is of utmost importance. In this article, we survey gamification frameworks for analyzing system design level techniques that enable engaging the final consumer in the CE process. Then, we select and use one of such frameworks, Gameful Design Heuristics (GDH), for defining the gamification structure needed to implement on a Business-to-Consumer-to-Consumer (B2C2C) context of a circular economy. As result, we present a B2C2C circular business process model for the T\&C value chain, and propose the design model of a gamified platform for the final consumers, which allows them to register the C2B and C2C activities, from the circular value chain's business process, and benefit from a game-like experience. All model features have been mapped to GDH framework heuristics, validating that it is possible to support a set of defined heuristics of applied gamification for promoting CE in the T\&C value chain.

Since the COVID-19 pandemic, urban forest mountains have become important restorative environmental spaces, and demand-customized management based on users’ experiences is needed. We collected 21,557 data points from blogs from January 2020 to December 2021. For data analysis, keyword frequency, term frequency-inverse document frequency, and sentiment analyses were conducted using TEXTOM 4.0, and a semantic linkage network was established and analyzed using Gephi 0.92. In the analyses, the restorative environment components of “being away” “fascination,” “extent,” and “compatibility” were derived from users’ experiences. Fascination, which stems from natural objects such as rocks, valleys, and trails, was derived the most frequently, and being away and compatibility, representing leisure activities such as climbing and walking, formed the largest cluster in cluster analysis. Sentiment analysis revealed a high positive word rate of 91.6%, with favorable feelings accounting for 87.5%, whereas the proportions of joy and interest (12.5%) were relatively low. This study showed that leisure activities related to nature objects had a positive impact. However, joy and interest, which correspond to vitality, were relatively lacking in the restorative experience. To improve restorative experience quality, diversification of leisure activities should be promoted and customized management plans corresponding to restorative environment components developed.

Kim-Kim ([9]) studied some properties of the degenerate gamma and degenerate Laplace transformation and obtained their properties. In this paper, we define modified degenerate gamma and modified degenerate Laplace Transformation and investigate some properties and formulas related to them.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

The improvement of the methane combustion activity was observed in cyclic temperature-programmed and isothermal reactions over Pd/ZrO2 catalysts by simple reduction/re-oxidation treatment. The catalytic activity increased during the initial stages of isothermal reaction, and the light-off temperature was lowered as the number of cycles increased in the cyclic temperature-programmed reaction. To reveal the origin of activation, variations in the reduction properties after the activation period were carefully investigated through CH4 temperature-programmed reduction (TPR) measurements. From the CH4-TPR results, it was confirmed that the reduction temperature decreased significantly after activation. The observation of the CH4-TPR peak at relatively low temperatures is directly proportional to the catalytic activity of CH4 combustion. It was therefore concluded that repeated reduction/re-oxidation occurred in the reactant stream, and this phenomenon allowed the combustion reaction to proceed more easily at lower temperatures.

The circadian clock is a 24-hour cycle within the body that regulates various factors, including sleep, body temperature, and hormone secretion. It allows the body to adjust to the light and dark cycle. Disruptions to the circadian rhythm are important risk factors for many diseases, including neurodegenerative illnesses. The central clock is controlled by the clock genes in the suprachiasmatic nucleus (SCN) of the brain, and one of the main functions of the circadian clock is to regulate lipid metabolism. There has been a lack of investigation on the circadian regulation of lipid metabolism-related apolipoprotein genes in the brain; thus, this study sought to summarize the rhythmic expression of clock genes and lipid metabolism-related apolipoprotein genes within the SCN of Mus musculus. Out of the 20 apolipoprotein genes that were studied by the published database, all 9 genes were highly expressed in the SCN. Most of the 6 genes showed rhythmic expression in the brain of mice, suggesting that the master clock might regulate them. The results, therefore, reveal a potential target for preventing and treating circadian disorders. We summarized most studies of lipid-related apolipoprotein genes within limited locations of the SCN and brain to further understand how disordered cerebral lipid metabolism causes multiple brain diseases and disorders. We reviewed recent studies, determined the unexplored questions, and identified a potential direction for further research.

This study uses explainable artificial intelligence to analyze major predictors of poor self-rated health, dementia and their comorbidity, which include various aspects of social support. Data came from the Korean Longitudinal Study of Ageing (2016-2018), with 5527 participants aged 56 or more. The dependent variables were: (1) poor self-rated health (SRH) with 5 categories (very good, good, middle, poor, very poor); (2) dementia (no, yes); and (3) their comorbidity with 4 categories (SRH very good, good or middle, dementia no; SRH very good, good or middle, dementia yes; SRH poor or very poor, dementia no; SRH poor or very poor, dementia yes). The 49 demographic, socioeconomic and health-related predictors were included. The accuracy and area under the receiver operating characteristic curve (AUC) were compared for logistic regression and the random forest. Logistic regression and the random forest registered similar AUCs with the range of 0.80-0.87. Based on random forest variable importance, 18 out of top-20 predictors were identical for SRH, dementia and their comorbidity: previous SRH, life satisfaction - health, age, body mass index, income, chronic diseases, life satisfaction - economic, life satisfaction - overall, grandchildren alive, friendship meeting, brothers/sisters alive, class identity, children alive, social activity - friendship, education, children in weekly contact, religion and drinker. However, some variations were found among the three dependent variables, i.e., previous SRH for comorbidity (1st) and SRH (1st) compared to dementia (11th), grandchildren alive for SRH (6th) and dementia (4th) compared to comorbidity (9th), chronic diseases for comorbidity (6th) compared to SRH (10th) and dementia (10th). In terms of Shapley Additive Explanation (SHAP) values, the probability of dementia is expected to decrease by 5.57% in case a predictor grandchildren alive is included to the model. This study highlights the importance of social support for the prediction of poor self-rated health, dementia and their comorbidity. Specifically, the promotion of family support and friendship activity for elders would be vital for the prevention and management of their self-rated health and dementia.

Despite the impressive performance of deep neural networks on many different vision tasks, they have been known to be vulnerable to intentionally added noise to input images. To combat these adversarial examples (AEs), improving the adversarial robustness of models has emerged as an important research topic, and research has been conducted in various directions including adversarial training, image denoising, and adversarial purification. Among them, this paper focuses on adversarial purification, which is a kind of pre-processing that removes noise before AEs enter a classification model. The advantage of adversarial purification is that it can improve robustness without affecting the model’s nature, while another defense techniques like adversarial training suffer from a decrease in model accuracy. Our proposed purification framework utilizes a Convolutional Autoencoder as a base model to capture the features of images and their spatial structure. We further aim to improve the adversarial robustness of our purification model by distilling the knowledge from teacher models. To this end, we train two Convolutional Autoencoders (teachers), one with adversarial training and the other with normal training. Then, through ensemble knowledge distillation, we transfer the ability of denoising and restoring of original images to the student model (purification model). Our extensive experiments confirm that our student model achieves high purification performance(i.e., how accurately a pre-trained classification model classifies purified images). The ablation study confirms the positive effect of our idea of ensemble knowledge distillation from two teachers on performance.

Heat shock protein 27 (HSP27), induced by heat shock, environmental, and pathophysiological stressors, is a multi-dimensional protein that acts as a protein chaperone and an antioxidant. HSP27 plays a major role in the inhibition of apoptosis and actin cytoskeletal remodeling. HSP27 is upregulated in many cancers and is associated with poor prognosis, as well as treatment resistance whereby cells are protected from therapeutic agents that normally induce apoptosis. This review highlights the most recent findings and role of HSP27 in cancer, as well as strategies for using HSP27 inhibitors for therapeutic purposes.

In accordance with regulations set forth by the Ministry of Land, Infrastructure, and Transport in Korea regarding the "Flame Retardant Performance of Building Finishing Materials and Fire Spread Prevention Structure," it is mandated that semi-noncombustible materials have a total heat emission less than 8 MJ/m². Consequently, our study aimed to determine the ideal quantity of flame-retardant treatment required to meet the fire safety standards for Korean larch and Japanese cedar, commonly used exterior materials in Korean construction. To this end, we investigated using a cone calorimeter to observe changes in the THR (Total Heat Released) based on the AFI (Amount of Flame-retardant Impregnation) in Korean larch and Japanese cedar. Our findings indicated that the AFI needed to satisfy the prescribed flame-retardant standard of 8 MJ/m² was THR 299 MJ/m² for Korean larch and THR 526 MJ/m² for Japanese cedar. As a result, we established optimal impregnation levels of flame retardant for both species.

The hematopoietic system plays a crucial role in immune defense response and normal development, and is regulated by various factors from other tissues. The dysregulation of hematopoiesis is associated with melanotic mass formation; however, the molecular mechanisms underlying this process are poorly understood. Here, we observed that the overexpression of miR-274 in the fat body resulted in the formation of melanotic masses. Moreover, abnormal activation of the JNK and JAK/STAT signaling pathways was linked to these consequences. In addition to this defect, miR-274 overexpression in the larval fat body decreased the total tissue mass, leading to a reduction in body weight. miR-274-5p was found to directly suppress the expression of found-in-neurons (fne), which encodes an RNA-binding protein. Similar to the effects of miR-274 overexpression, fne depletion led to melanotic mass formation and growth reduction. Collectively, miR-274 plays a regulatory role in the fne-JNK signaling axis in melanotic mass formation and growth control.

Background and Objectives: This study aimed to evaluate the effects of subtalar joint axis-based balance exercises on the anterior talofibular ligament (ATFL) thickness, ankle strength, and ankle stability after an arthroscopic modified Broström operation (AMBO) for chronic ankle instability (CAI). Materials and Methods: The study included 47 patients diagnosed with CAI who underwent AMBO and were randomly divided into three groups: control (n=11), general balance exercise (n=17), and subtalar joint axis balance exercise (n=19), regardless of the affected area. Participants in the exercise rehabilitation group performed exercises for 60 min twice a week for 6 weeks, starting 6 weeks after AMBO. ATFL thickness, ankle strength, and ankle dynamic stability were measured using musculoskeletal ultrasonography, Biodex, and Y-balance test, respectively, before and after treatment. Results: Compared with the remaining groups, the subtalar joint axis balance exercise group had reduced ATFL thickness (p = 0.000), improved ankle strength for eversion (p = 0.000) and inversion (p = 0.000), and enhanced ankle stability (p = 0.000). Conclusions: The study results suggests that subtalar joint axis-based balance exercises may contribute to the early recovery of the ankle joint after AMBO.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Standardized protocols were specifically designed and developed for clinical information collection and obtaining trio genomic information from infants affected with congenital anomalies (CA) and their parents, as well as securing human biological resources. Two large areas of these protocols include clinical and genomic information collection on CA which were difficult to diagnose using pre-existing screening methods. The following are three essential items for the clinical information collection protocol: establishment of a consent system for collecting and utilizing research resources, establishment of criteria for target patient selection, and collection of clinical and epidemiological information. A total of 138 cases consisting of 45 families of infants with CA and their parent trios have provided human-derived resources and genomic information. Whole genome sequencing data have been generated for all participants, and standardized protocols for resource collection and manufacturing have been developed. Phenotype information according to the Human Phenotype Ontology term and major test findings were recorded. It is important to keep updating and recording clinical symptoms and genetic diagnosis that are newly added or changed over time. The unique significance of this study is to develop a protocol that enables long-term tracking by adding growth and development tests that reflect important characteristics of newborns. By using these clinical and genetic information collection protocols for CA, it will be possible to establish an essential platform for early genetic diagnosis and diagnostic research, and further present new genetic diagnostic guidelines in the near future.

Aluminum (Al), making up a third of the Earth's crust, is a widespread toxic contaminant, particularly in acidic soils. It impacts crops at multiple levels, from the cellular to the whole plant. This review delves into aluminum's reactivity, including its cellular transport, involvement in oxidative redox reactions, development of specific metabolites, and the influence of genes on the production of membrane channels and transporters, as well as its role in triggering apoptosis leading to senescence. It discusses the involvement of channel proteins in calcium influx, vacuolar proton pumping, the suppression of mitochondrial respiration, and the initiation of programmed cell death. At the cellular nucleus level, the effects of Al on gene regulation through alterations in nucleic acid modifications, such as methylation and histone acetylation, are examined. The review in addition outlines the pathways of Al induced metabolic disruption specifically citric acid metabolism, regulation of proton excretion, induction of specific transcription factors, modulation of Al-responsive proteins, changes of citrate and nucleotide glucose transporters and overall metal detoxification pathways in tolerant genotypes. It also considers the expression of phenolic oxidases in response to oxidative stress, their regulatory feedback on mitochondrial cytochrome proteins, and their consequences on root development. Ultimately, the review focuses on the selective metabolic pathways that facilitate Al exclusion and tolerance, emphasizing compartmentalization, antioxidative defense mechanisms, and the control of programmed cell death to manage metal toxicity.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Short stature has been associated with increased various disease and all-cause death, but no reliable data exist the association between height and end-stage renal disease (ESRD) in diabetic patients. We investigated the relationship between short stature, development of ESRD, and mortality in type 2 diabetes. This study analyzed clinical data using the National Health Insurance Database in Korea. Height was stratified by five groups according to age and sex. Risk of ESRD and all-cause mortality was analyzed with Cox proportional hazards models. During a 6.9-year follow-up period, 220,457 subjects (8.4%) died and 28,704 subjects (1.1%) started dialysis. Short stature significantly increased the incidence of ESRD and all-cause mortality in the overall cohort analysis. In multivariable analysis, hazard ratios (HR) for development of ESRD comparing the highest versus lowest quartiles of adult height were 0.86 (95% confidence interval (CI), 0.83–0.89). All-cause mortality also decreased with highest height compared to patients with lowest height after fully adjusting for confounding variables (HR 0.79, 95% CI, 0.78–0.81). Adult height had an inverse relationship with newly diagnosed ESRD and all-cause in both males and females. Short stature is strongly associated with an increased risk of ESRD and all-cause mortality in type 2 diabetes.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Dry mouth, hyposalivation, or xerostomia is a significant problem in diabetic patients; however, there was no way to relieve these symptoms. This study was aimed to evaluate the effects of Ixeris dentata (IXD) in combination with lactobacillus extract on the salivation rate in diabetes-induced dry mouth, and its mechanism was also investigated. In the streptozotocin-induced diabetes model, dry mouth condition was established as a model. Both control and diabetic rats were treated with a sublingual spray of either water or IXD and subsequently treated with or without a spray of lactobacillus extract. In diabetes condition, the salivary flow rate, amylase activity, and aquaporin-5 and Na+/H+ exchanger (NHE-1) expressions were markedly decreased, whereas they were more significantly recovered in the sequential treatment of IXD-lactobacillus extract than each single treatment. Furthermore, oxidative stress and its related ER stress response were especially regulated in the IXD/lactobacillus extract condition, where the following anti-oxidative enzymes; GSH:GSSG ratio, superoxide dismutase (SOD), and glutathione peroxidase (GPx) were involved. This study suggests that the combination of IXD and lactobacillus would be a potential alternative medicine against diabetes-induced hyposalivation and xerostomia.

Berberis koreana Palibin is an endemic plant native to Korea. In this study, we aimed to study seed germination in this species using a water imbibition experiment, gibberellic acid (GA3) treat-ment (0, 10, 100, or 1000 mg·L−1), cold stratification (0, 2, 4, 8, or 12 weeks at 4 °C), a move-along experiment, and phenology studies. In the water imbibition experiment, the weight of the seeds increased by more than 120% in 24 h. Analysis of the internal and external morphological char-acteristics of the seed revealed that the embryo was already fully grown from the fruit and did not grow thereafter. The final germination percentages for cold stratification at 0, 2, 4, 8, and 12 weeks at 4 °C were 12, 32, 59, 59, and 71%, respectively. In the move-along experiment and phe-nology studies, a longer low-temperature treatment period resulted in a higher germination percentage. However, the GA3 treatment had little effect on seed germination. Our results indi-cate that B. koreana exhibits intermediate physiological seed dormancy.

Astroviruses (AstVs) have been detected in a wide range of animal species, including mammals and birds. Recently, a novel AstVs associated with neurological symptoms has been detected in the brain of some mammals. Raccoon dog AstV has been reported recently in China. However, there have been no reports in South Korea. Therefore, the present study aimed to detect and genetically characterize AstVs in intestine and brain tissues of 133 wild raccoon dogs collected in Korea between 2017 and 2019. Seven wild raccoon dogs were positive for AstV, four of which were also detected in brain tissue. Analysis of the capsid protein amino acid sequences of raccoon dog AstVs detected in Korea revealed a high similarity to canine AstVs, suggesting possible interspecies transmission between raccoon dogs and dogs. Phylogenetic and capsid protein amino acid sequence analysis of raccoon dog AstVs detected in brain 17-148B strain belonged to the HMO clade and exhibited conserved sequences found in neurotropic AstVs (NT-AstVs), indicating their potential as NT-AstVs. However, the pathogenicity and transmission routes of the raccoon dog AstV detected in Korea have not yet been elucidated, so further research and continued surveillance for AstV in wild raccoon dogs are needed.

In this paper, we introduce two discrete degenerate random variables, namely the degenerate binomial and degenerate Poisson random variables. We deduce the expectations of the degenerate binomial random variables. We compute the generating function of the moments of the degenerate Poisson random variables, which leads us to define the new type degenerate Bell polynomials, and hence obtain explicit expressions for the moments of those random variables in terms of such polynomials. We also get the variances of the degenerate Poisson random variables. Finally, we illustrate two examples of the degenerate Poisson random variables.

Low night temperature (LNT) can be a practical and economical target in tomato breeding programs in terms of energy saving in greenhouses. This study was conducted to investigate the physiological responses to LNT using four tomato accessions of cherry and large fruit types with LNT tolerance and sensitivity grown in two greenhouses with night temperature set-points of 10 and 15°C for heating. LNT significantly reduced plant height regardless of fruit types and LNT tolerance. The number of flowers were significantly reduced in 10°C in cherry but not in large fruit types. Fruit set in 10°C was significantly lower in LNT sensitive accessions than tolerant ones regardless of fruit types, which was due to abnormal flower morphology in 10°C. Proline accumulation patterns between 10 and 15°C significantly differed between fruit types as well as between LNT tolerant and sensitive accessions. Chlorophyll content in 10 °C was significantly higher at later growth stages in LNT tolerant accessions than sensitive ones in both fruit types. No clear difference in photosynthetic parameters was observed between fruit types or tolerance and sensitive accessions except for photosynthetic rate, which was significantly lower in tolerant than sensitive accessions during early growing period. These results suggest that different tomato fruit types may have different mechanisms for LNT tolerance.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

This paper presents a finite element analysis of the bi-directional orthogonal model, which incorporates individual crack strain separation and tracking. The objective of the research is to expand the current shear friction model to manage bi-directional cracking at any angle, allowing for a more universal model that can be applied to intricate structures and non-proportional loading cases. The proposed model was initially developed as a total strain-based model, with the assumption that crack strains are equivalent to total strains, but was subsequently recalculated to improve accuracy by separating crack strains from total strains. Furthermore, a separate crack strain formulation was created to account for strains in the concrete's uncracked portions and locked-in crack strains. The article then discusses the testing of various convergence methods and loading programs to achieve high convergence. Comparative analyses of the generalized shear friction model with other models for crack orientation and loading cases similar to those of a reinforced concrete membrane are also presented. The MATLAB program successfully applied the bi-directional cracking model for one finite element under a uniform cyclical strain state, using a secant stiffness formulation.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Background: Pathologic complete response (pCR) of breast cancer after neoadjuvant chemotherapy (NAC) is highly related to molecular subtypes. Patients who achieved tumor pCR after NAC have a better prognosis. However, despite of better prognosis, pCR patients have a potential for recurrence. There is little evidence of risk factors of recurrence in patients with pCR. We aim to analyze factors associated with tumor recurrence in patients who achieved pCR. Methods: This study retrospectively reviewed the data of patients diagnosed with breast cancer who achieved pCR after receiving NAC between January 2009 and December 2018 in Samsung Medical Center. pCR was defined as no residual invasive cancer in the breast and axillary nodes even if there is residual ductal carcinoma in situ (ypT0 or ypTis with ypN0). Breast cancers are classified into 4 subtypes based on hormone receptors (HR) and human epithelial growth factor receptor 2 (HER2) status. Patients who had bilateral breast cancer, inflammatory breast cancer, distant metastasis, unknown subtype, and histologically unique case were excluded from the study. Results: In total 483 patients were included in this study except for patients who corresponded to the exclusion criteria. The median follow-up duration was 59.0 months (range, 0.5-153.3 months). Breast cancer recurred in 4.1% of patients (20 of 483). There was a significant difference in clinical T (p = .004) and clinical N (p = .034) stage in the Kaplan-Meier curve for disease-free survival. Molecular subtypes (p = .573), Ki67 (p = 1.000), and breast surgery type (p = .574) were not associated with tumor recurrence in patients who achieved pCR after NAC. In the clinical T stage and clinical N stage, there was a significant difference between recurrence and no-recurrence groups (clinical T stage; p = .045, clinical N stage; p = .002). Univariable Cox regression revealed statistical significance in the clinical T stage (p = .049) and clinical N stage (p = .010), while multivariable Cox regression demonstrated non-significance in the clinical T stage (p = .320) and clinical N stage (p = .073). Conclusion: Results in this study showed that clinical T, clinical N stage, and molecular subtypes were not statistically significant predictors of recurrence in patients who achieved pCR after NAC. It is hypothesized that a multicenter-based study would lead to the identification of factors as predictors of recurrence after achieving pCR.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Sarcopenia becomes more common with age, being most prevalent among elderly individuals. According to the EWGSOP, muscle mass is one of the criteria for the evaluation of sarcopenia. The main methods for evaluating muscle mass are CT, MRI, and DXA, but these methods are difficult to apply in the field due to equipment costs, radioactivity, and lack of portability. BIVA and PhA are alternative approaches for assessing somatic cell mass and volume and do not require predictive equations. These variables are clinically relevant parameters that indicate cell health, especially cell membrane integrity and cell function. This study in sarcopenic and nonsarcopenic elderly volunteers aimed to determine the BIVA distribution pattern among individual sarcopenia patients; to evaluate the relationship between PhA and muscle strength, muscle quality, and physical function; and to find any correlates of PhA. The sample comprised 134 free-living elderly individuals of both sexes aged 69–91 years. Anthropometric parameters, grip strength, DXA findings, BIA results, and physical performance (the 6-meter walk test) were measured. Impedance vector distributions were evaluated in sarcopenia patients and healthy elderly individuals using BIVA. According to the AWGS criteria, sarcopenia was diagnosed according to DXA findings, grip strength and physical performance test results. Group differences were evaluated using the t test, Mann‒Whitney U test, and Hotelling's T2 test. Correlation analysis was performed to identify variables significantly associated with PhA. Linear regression analysis was performed to determine whether PhA was associated with muscle strength, muscle quality and physical function. BIVA detected a significant difference between the sarcopenia and non-sarcopenia groups (both sexes) due to higher R/H values and lower phase angles in a few individuals, whereas Xc/Ht values did not differ between the two groups. The sarcopenia group had a significantly lower PhA than the non-sarcopenia group among both males (p&lt;0.01) and females (p&lt;0.05). PhA was significantly correlated with age, ASM, HGS, and muscle quality in both sexes and significantly correlated with ASM/Ht2 and physical performance in males. PhA was a significant indicator of muscle strength in both males (β = 2.6; p&lt;0.01) and females (β = 3.4; p&lt;0.01), a significant indicator of muscle quality in both males (β = 0.07; p&lt;0.05) and females (β = 0.17; p&lt;0.01), and a significant indicator of physical performance in males (β = 0.3; p&lt;0.01). BIVA can detect changes in muscle mass in individuals with sarcopenia and is a practical method for the assessment of sarcopenia in the field. PhA is a good indicator of muscle strength, muscle quality and physical performance (in males). These methods can help diagnose sarcopenia in elderly individuals with reduced mobility.

Background and objectives: TSC1 is a crucial component of the mTOR pathway, impacting cell growth, proliferation, and autophagy, while TSC2 is a tumor suppressor gene that regulates cell growth and is associated with the mTOR signaling pathway. In the present study, we analyzed TSC1 and TSC2 mRNA expression levels in rectal cancer, and evaluated the clinicopathological and prognostic characteristics of TSC1 and TSC2. Materials and Methods: TSC1 and TSC2 mRNA expression was examined in various cancer types. We further evaluated survival to determine the prognostic significance of TSC1 and TSC2 mRNA in CRC using The Cancer Genome Atlas (TCGA) data. Results: The study focused on rectal cancer, as it exhibited the most promising results. The patients were split into two subgroups, each comprising 50% of the total, based on the TSC gene expression levels. This division was made to assess the clinical characteristics associated with the expression of TSC1 and TSC2 genes. In the study, lower TSC1 expression was linked to venous invasion in rectal cancer patients, and there was also a related trend with lymphatic invasion, although it didn't reach statistical significance. Lower TSC2 expression was observed in younger patients and had some associations with sex and M stage, but these correlations were not statistically significant. When it came to survival analysis, TSC1 expression did not significantly impact overall survival, while higher TSC2 expression was associated with a poorer prognosis in rectal cancer. To enhance our comprehension, additional research, especially in larger case studies, is needed to explore the molecular mechanisms and clinical characteristics of TSC genes in colorectal cancer.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Tobacco smoke is an environmental mixture including polycyclic aromatic hydrocarbons and may interfere in endocrine system as an EDC in aging. Thus, we performed a molecular epidemiological approach with in-depth biological monitoring of combustible cigarette smoking among adolescents and adults in South Korea (N=620) with exposure biomarkers, i.e., exhaled CO, urinary cotinine, t,t-muconic acid (TTMA), malondialdehyde (MDA), and obtained information of their lifestyle and tobacco addiction status. We also diagnosed the genetic polymorphisms on the 96 SNPs for tobacco-metabolism, -addiction, and expression differences and compared mtDNA abnormalities in buccal and blood cells. As results, there were positive associations among the above tobacco exposure biomarkers. Man or youth smokers showed high frequency in some of mtDNA alteration, such as ‘SNPs for inconsistent bases between buccal and blood cells’. Among the SNPs, the polymorphisms on SULT1A1, DRD2, and ADH1B were related to multi-exposure biomarkers. Interestingly, youth showed similar levels of urinary TTMA and MDA to adults, although their pack-year was approx. 1/6 volume of that of adults. We also observed the negative association between urinary MDA levels and the growth rate in the adolescents (p<0.05). In conclusion, the present biological monitoring provides high susceptible population, i.e., adolescents rather than adults, and reliable genetic factors affecting tobacco exposure. The inferred environment-gene-gene interaction suggests tobacco smoking accelerats aging in adolescents as an EDC.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

High temperature (HT) significantly affects the crop physiological traits and reduces the 12 productivity in plants. To increase yields as well as survival of crops under HT, developing heat13 tolerant plants is one of the main targets in crop breeding programs. The present study attempted 14 to investigate the linkage of the heat tolerance between the seedling and the reproductive growth 15 stages of tomato cultivars ’Dafnis‘ and ’Minichal’. This research was undertaken to evaluate heat 16 tolerance under two experimental designs such as screening at seedling stage and screening from 17 reproductive traits in greenhouses. Survival rate and physiological responses in seedlings of 18 tomatoes with 4-5 true leaf were estimated under HT (40 °C, RH 70%, day/night, respectively) and 19 under two control and HT greenhouse conditions (day time 28 °C and 40 °C, respectively). Heat 20 stress significantly affected physiological-chemical (photosynthesis, electrolyte conductivity, 21 proline) and vegetative parameters (plant height, shoot fresh weight, root fresh weight) in all 22 tomatoes seedlings. The finding revealed that regardless of tomato cultivars the photosynthesis, 23 chlorophyll, total proline and electrical conductivity parameters were varied in seedlings during the 24 heat stress period. The heat tolerance rate of tomatoes in the seedling stage might not be associated 25 always with reproductive parameters. HT reduced the fruit parameters likeas fruit weight (31.9%), 26 fruit length (14.1%), fruit diameter (19.1%) and fruit hardness (9.1%) in compared to NT under HT 27 in heat susceptible tomato cultivar ‘Dafnis’, while in heat tolerant cultivar ‘Minichal’ fruit length 28 (7.1%) and fruit diameter (12.1%) was decreased by the affect of HT but on the contrary fruit weight 29 (3.6%) and fruit hardness (8.3%) were increased. In conclusion, screening and selection for tomatoes 30 should be evaluated at the vegetative and reproductive stages with consideration of reproductive 31 parameters.

During the Covid-19 pandemic in Taiwan, analytical tools of PEST (political, economic, social-cultural, and technological), SWOT (strength, weakness, opportunity, threat), nine building blocks of a business model canvas, and knowledge management were combined to develop a theoretical framework, and used to assess business, smart and sustainable management of two case companies: Tung Sheng Company Limited and its subsidiary, Strong Basic Enterprise Limited. A heuristic inquiry research design was adopted. In addition to secondary data from the two case companies, major top managers were interviewed to reveal constructive questions about the existing business models and to re-interpret strategy. The results showed that case companies own capabilities of R &amp; D (research and development) as a foundation to further apply new smart ICT (information and communication technology) and execute green manufacturing. Additionally, strong key partnerships are used to diversify business investment for leveraging on limited resources given current insufficient qualified employees. Resilient practices adopted new and green technology to help mitigate the negative impacts of the Covid-19 pandemic. This study provides a useful framework and practical information about how to examine business models, smart and sustainable management processes of the two case companies and to make adjustments in strategies for the future.

The population parameters of the ecologically important mud shrimp Upogebia major were analyzed from 2012 to 2015 in tidal flats in Seonjaedo and Jugyo on the West coast of Korea. The shrimp density averaged 265/m2 in Seonjaedo and 118/m2 in Jugyo. The sex ratio varied monthly, often male-biased, but by size, males were significantly dominant, with a carapace length (CL) over 30 mm. Although the shrimp settled almost annually, only a single size-group was observed from 2012 to 2014. The recruitment in Jugyo in 2014 was notably successful, resulting in two cohorts persisting until 2015. Many shrimp were parasitized at varying local rates: 6.0% in Seonjaedo and 37.1% in Jugyo. The growth curves revealed that the shrimp grew annually after settlement, reaching CLs of 11.90, 18.24, and 23.02 mm in Seonjaedo and 13.73, 20.86, and 25.82 mm in Jugyo. Annual mortality was 77.2% in Seonjaedo and 67.4% in Jugyo. The estimated lifespan (tmax) was 10 years in Seonjaedo and 8 years in Jugyo, whereas the 2010 cohort in Jugyo largely disappeared in 5 years. Ovigerous females appeared from November to June and benthic juveniles between June and September. The shrimp’s growth was slower relative to other East Asian populations, likely due to colder sea water temperatures and altered food conditions from a higher shrimp density.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

(1) Background: This study aimed to evaluate whether the implementation of a modified blood sampling protocol, which focused on need-based laboratory testing and minimized venous sampling by replacing it with point-of-care testing (POCT) via capillary puncture, successfully reduced iatrogenic blood loss, incidence of anemia, and frequency of blood transfusion in extremely low birth weight infants (ELBWIs) without negatively affecting neonatal outcomes. (2) Methods: A retrospective analysis was conducted on 313 ELBWIs of gestational age (GA) between 23 and 28 weeks, born between 2013 and 2019. The infants were divided into two groups: before (period I) and after (period II) the implementation of the modified blood sampling protocol in January 2016. Propensity score matching was conducted to minimize selection bias. Clinical data, including the frequency and amount of blood sampling, frequency and volume of blood transfusion, and clinical characteristics, such as gestational age, birth weight, and neonatal outcome data, were collected and compared between the two groups. (3) Results: No significant differences in the GA or birth weight between the two periods were observed. The total sampling volume during a month after birth (16.7 ± 4.1 mL vs. 15.6 ± 4.4 mL, P=0.03) and total sampling volume during hospital days (51.4 ± 29.7 mL vs. 44.3 ± 27.5 mL, P=0.04) in period II were significantly lower than that in period I. There were no differences in the mortality or morbidity between the two periods. Although the transfusion frequency and amount did not have significant differences between the periods, we observed a positive correlation between the transfusion frequency and sampling volume (coefficient: 0.09, 95% CI: 0.08–0.11). (4) Conclusions: The modified blood sampling protocol effectively reduced the iatrogenic blood loss without negatively affecting the neonatal outcomes.

The effect of CO2 pre-treatments on tomato quality prior to cold storage was investigated using physiochemical and transcriptome changes. Three hours CO2 treated fruits were firmer than untreated fruits and had a good appearance even after being transferred from 4°C storage to 20°C for 8 d. CO2 pretreatment with cold storage showed a synergistic effect on delayed ripening through reduced respiration; these tomatoes exhibited a lower lycopene content than untreated fruit under cold storage. Tomatoes treated with 30% CO2 had fewer pits than untreated fruits subjected to chilling temperatures, even after being transferred to 20°C for 8 d. Functional enrichment analyses from transcriptome and metabolome commonly showed that CO2-responsive genes or metabolites were involved in the sucrose and starch and biosynthesis of secondary metabolisms. The most frequently detected domain, ethylene-responsive factor domain and reduced glycolysis provide insights into the mechanism that CO2 regulates tomato quality.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Recently, astroviruses (AstVs) have been associated with neurological symptoms in pigs, cattle, sheep, minks, muskoxes, alpacas, and humans. To investigate genotypes of porcine astrovirus (PAstV) and neuroinvasive (Ni) PAstV in South Korea, five domestic pigs with neurological symptoms from three farms were tested using reverse transcriptase PCR, histopathology, and in situ hybridization (ISH). All five genotypes of PAstV were detected in brain tissues and coinfection of PAstV with multiple genotypes was observed. To the best of our knowledge, this is the first study to report pig infection by Ni-PAstV with multiple genotypes in South Korea.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

The purpose of this study is to compare and analyze the kinematic characteristics of the upper limb segments during the archery shooting of Paralympic Wheelchair Class archers (ARW2 - second wheelchair class – paraplegia or comparable disability) and Paralympic Standing Class archers (ARST - standing archery class – loss of 25 points in the upper limbs or lower limbs), where archers are classified according to their disability grade among elite disabled archers. The participants of this study were selected as seven elite athletes with disabilities, 4 ARW2, and 3 ARST. The analysis variables were 1) the time required for each phase, 2) the angle of inclination of the body center, 3) the change of trajectory of body center, and 4) the change of movement locus of bow center by phase when performing six shots in total. The ARW2 group showed a longer time than the ARST group, and the angle of the body did not show a significant difference between the two groups. Although there was no significant difference in the mean score between the two groups, it was judged that kinematic performance according to each group was, in that there was a measurable variation in kinematic variables.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Background and Objectives: Chemokines have various biological functions and potential roles in the development or progression of neuroinflammatory diseases. However, the specific pathogenic roles of chemokines in age-related macular degeneration (AMD), the leading cause of blindness in older individuals, remain elusive. Chemokines interact with their receptors expressed in the endothelium and on leukocytes. The sulfation of tyrosine residues in chemokine receptors increases the strength of ligand–receptor interaction and modulates signaling. Therefore, in the present study, we aimed to construct a human recombinant sulfated CXCR3 peptide trap (hCXCR3-S2) and mouse recombinant sulfated CXCR3 peptide trap (mCXCR3-S2) to demonstrate in vivo effects in preventing choroidal neovascularization and chemotaxis. Materials and Methods: First, the effect of hCXCR3-S was validated in vitro. Interestingly, hCXCR3-S2 inhibited the migration and invasion of two human cancer cell lines. Subsequently, the in vivo efficacy of mCXCR3-S2 was investigated using a mouse model of neovascular AMD. Results: Intravitreal injection of mCXCR3-S2 attenuated choroidal neovascularization and macrophage recruitment in neovascular lesions. These in vitro and in vivo effects were significantly stronger with CXCR3-S2 than with wild-type CXCR3 peptides. Conclusion: These findings demonstrate that the sulfated form of the CXCR3 peptide trap is a valuable tool that could be supplemented with antivascular endothelial growth factors in AMD treatment.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.