Phototherapy is an efficient strategy to respond to oxidative stress and has been in the spotlight in various therapeutic fields through its biological effect, but the exact molecular mechanism has not yet been established. As a result of irradiating RAW264.7 cells with a 630 nm or 850 nm LED with an energy intensity of 0.01J/cm2, cell viability was increased depend on the irradiation time. After H2O2 was added, 630 nm or 850 nm LEDs were irradiated for 10 min or 40 min to increase cell viability by about 1.7- or 1.6-fold, respectively. In addition, 630nm or 850nm LED irradiation showed a significant ROS scavenging effect and significantly reduced TUNEL-positive cells by 45.7% and 37.8%, respectively, compared to cells treated only with H2O2. In the result of flow cytometry, the number of cells in the late apoptosis stage was about 2.3- and 1.8-fold lower than that of the cells treated with H2O2 only, but there was no significance. The Bax/Bcl-2 ratio of cells irradiated with 630 nm or 850 nm LED was significantly lower than that of cells treated with H2O2 only, and the expression of procaspase-3 and cleaved PARP was also significantly expressed in the direction of suppressing cell death. In conclusion, the ROS scavenging activity by 630 nm or 850 nm LED irradiation, leading the expression of cell death pathway proteins in the direction of inhibiting cell death.

Background Some patients with mild cognitive impairment (MCI) experience gait disturbances. However, there are few reports on the relationship between gait disturbance and cognitive function in patients with MCI. Therefore, we investigated the neural correlates of gait characteristics related to cognitive dysfunction. Methods Eighty patients diagnosed with MCI from three dementia centres in Gangwon-do, Korea were recruited for this study. We defined MCI as a Clinical Dementia Rating global score of 0.5 or higher, with a memory domain score of 0.5 or greater. The patients were classified as having either early or late MCI based on their Mini Mental Status Examination z-scores. Multiple logistic regression analysis was performed to examine the association between the gait characteristics and cognitive impairment. Analyses included variables such as age, sex, years of education, number of comorbidities, body mass index and height. Results Gait velocity, step count, step length, heel-to-heel base support, swing and stance phase duration, and support time were associated with cognitive function. A decrease in gray matter volume in the right pericalcarine area was associated with gait characteristics related to cognitive dysfunction. An increase in the curvature of gray matter in the right entorhinal, right lateral orbitofrontal, right cuneus, and right and left pars opercularis areas was also associated with gait characteristics related to cognitive dysfunction. Conclusion Since gait impairment is an important factor in determining activities of daily living in patients with mild cognitive impairment, the evaluation of gait and cognitive functions in patients with mild cognitive impairment is important.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Phosphatase and tensin homolog (PTEN) is a negative regulator of the phosphoinositide 3-kinases/protein kinase B (PI3K/AKT) signaling pathway. Notably, its active site harbors a cysteine residue that is susceptible to oxidation by hydrogen peroxide (H2O2). This oxidation inhibits the phosphatase function of PTEN, critically contributing to the activation of the PI3K/AKT pathway. Upon stimulation of cell surface receptors, the activity of NADPH oxidase 2 (NOX2) generates a transient amount of H2O2, serving as a mediator in this pathway by oxidizing PTEN. The mechanism underlying this oxidation, occurring despite the presence of highly efficient and abundant cellular oxidant-protecting and reducing systems, continues to pose a perplexing conundrum. Here, we demonstrate that the presence of bicarbonate (HCO3-) promoted the rate of H2O2-mediated PTEN oxidation, probably through the formation of peroxymonocarbonate (HCO4-), consequently potentiated the phosphorylation of AKT. In essence, our findings consolidate the crucial role of HCO3- in the redox regulation of PTEN by H2O2, lead to the presumption regarding HCO4- as a signaling molecule during cellular physiological processes.

Daniel Yergin’s “The New Map: Energy, Climate, and the Clash of Nations” is a remarkable and groundbreaking work that addresses the ever-changing global energy landscape and its profound geopolitical implications. In this modest book review, we aim to offer a fresh perspective by re-examining the core issues from the standpoint of political geography. The aim of this article is twofold: to enrich the existing literature on political geography and to provide valuable insights to students of geography to broaden their knowledge in this field.

This treatise offers a philosophical odyssey into the exigency of conservation within the broader context of an increasingly interconnected world, beset by the perils of globalization, climate change, and the looming specter of global warming. Employing the evocative metaphor of a jellyfish, it endeavors to shed light on the paramount role of humanity as the principal protagonist in the saga of environmental predicaments, thereby accentuating our profound moral responsibility to navigate the labyrinthine pathways toward viable solutions. While this discourse abstains from presenting empirical or case-specific inquiries, it unfurls an incisive analytical vantage point that enriches our cognitive grasp of the intricate interplay between human societies and the pristine realms of the natural order. By expounding upon poignant exemplars of environmental degradation and unveiling the resplendent tapestry of statistical observations, the profound ethical imperatives that undergird the imperative to confront predicaments such as climate change are thrust into the limelight of intellectual inquiry. Consequently, by delving deep into these philosophical bedrocks, this magnum opus augments our erudition concerning the multifaceted nexus that binds humankind to their surroundings, thus affording us a glimpse into the subtle tapestry of a complex relationship that must be diligently nurtured and preserved.

This article, inspired by Dr. Jürgen Essletzbichler’s chapter namely “Locating Location Models” in The SAGE Handbook of Economic Geography (2011), delves into the legacy and significance of location theory. By examining its integration of historical analysis and theoretical abstraction, the study highlights the crucial role played by historical and geographical contexts in shaping spatial patterns. It emphasizes the importance of complementing abstract models with historical analysis to gain a deeper understanding of real-world spatial phenomena. Acknowledging the delay in the development of location theory attributed to the dominance of the German historical school, the article recognizes its enduring value and resurgence in the realm of modern evolutionary economic geography. Ultimately, the abstract underscores the contributions of location theory to our comprehension of spatial dynamics and its potential for further advancements in the field of economic geography.

This article examines the application of Keynesian theory in economic geography, focusing on regional development and reducing inequalities. The objective is to highlight the relevance and benefits of applying Keynesian principles in addressing spatial economic challenges. The novelty lies in examining the intersection of Keynesian economics and geography, which offers insights into regional planning, infrastructure development, and cluster formation. The results show how policymakers and researchers can use Keynesian theory to promote balanced growth and improve living standards. The keywords for this article are Keynesian theory, economic geography, regional development, disparities, and policy interventions.

Uzbekistan, as an emerging national economy, aims to attract foreign direct investment (FDI) to foster the development of its free economic zones (FEZs). While recent policy reforms have enhanced the country's appeal to investors and facilitated the inflow of international capital, challenges persist in attracting investment. This study employs an economic geographical approach to analyze and propose solutions to these obstacles. By examining the spatial patterns of FEZs and FDI through a comprehensive geographical lens, this research utilizes document analysis as an alternative to empirical analysis, considering the broader context rather than focusing on a specific FEZ. The findings reveal that the insufficiency of an innovation-driven environment, logistical systems, energy resource-related issues, among others, negatively impact the inflow of FDI into FEZs. Moreover, the study underscores the significance of economic geography in understanding these factors. Finally, relevant insights and recommendations are provided from an economic geographical perspective.

This book review essay looks at Tim Marshall’s “Prisoners of Geography” and its in-depth examination of the interplay between geography and international politics. The aim is to highlight the book's key themes, including geopolitics, borders, trade routes, geopolitical conflict and colonial legacies. Through insightful analysis and engaging text, Marshall uncovers the central role that geography plays in shaping our world. The book’s continuing relevance is underlined by its links to significant global events and the author’s forward-looking questions. By recognising the practical factors that influence decision-making, rather than the purely ideological, the book offers a fresh perspective on current political and economic turmoil. The examination of the influence of geography and the call for increased international cooperation makes it a valuable resource for students of geography and anyone interested in political geography and globalisation.

The gradual decline of the Aral Sea’s water level over the past five decades poses a huge environmental problem in the heart of Central Asia. Uzbekistan, once blessed with abundant water resources, now struggles with water scarcity in certain regions. While global environmental issues contribute to some degree to this dilemma, irrigation mismanagement plays a central role. This study focuses on the widespread problem of irrigation mismanagement in Uzbekistan and specifically addresses the rural district of Oltinsoy in the southern province of Surkhandarya. The main objective of this research project is to propose effective measures that can alleviate the pressing problem of water scarcity in the region while emphasizing the urgent need for well-executed projects and careful maintenance to ensure long-term sustainability at the local level. It is important to note that this study does not include an examination of the impact of global warming on the decline of water resources in Uzbekistan.

This article explores the behavioral geography of the Hajj pilgrimage, focusing on the impact of the physical environment on pilgrims' behavior. Using qualitative research and analyzing religious literature and online publications, the study reveals significant findings. The spatial arrangement of the Grand Mosque, including the central courtyard and pillars, influences pilgrims' behavior during the Tawaf ritual. Environmental factors such as crowds and noise affect pilgrims' experiences, evoking anxiety while enhancing the ceremony's spiritual significance. Cultural and religious beliefs also shape pilgrims' behavior during the circumambulation. This study provides valuable insights into the multifaceted factors shaping pilgrims' behavior during the Hajj, including spatial organization, cultural influences, and social interactions. The findings can inform improvements in infrastructure, crowd management, and services to enhance the overall pilgrimage experience.

This study explores the geopolitical dynamics of water conflicts in Central Asia, focusing on Uzbekistan and its neighboring countries. Using a mixed methods approach within the framework of political geography, the research analyzes interactions among regional countries and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. It establishes research objectives, evaluates the water crisis, addresses challenges in water management, and examines contentious issues like hydropower, resource hegemony, and ethnic conflict. Also, the study uncovers historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance. The findings highlight the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes with recommendations to enhance regional cooperation, sustainable water management, and peacebuilding, drawing on soft power theory and advocating for collaborative approaches. This research provides valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges, contributing to informed decision-making, and promoting strategies for sustainable development in the region.

This study presents a meta-analysis of studies that investigate the effectiveness of chitosan administration on lifestyle-related disease in murine models. A total of 34 published studies were used to evaluate the effect of chitosan supplementation. The effect sizes for various items after chitosan administration were evaluated using the standardized mean difference. Using Cochran’s Q test, the heterogeneity of effect sizes was assessed, after which a meta-ANOVA and –regression test was conducted to explain the heterogeneity of effect sizes using the mixed-effect model. Publication bias was performed using Egger’s linear regression test. Among the items evaluated, blood triglyceride and HDL-cholesterol showed the highest Q statistics and I2 values, respectively. Other than blood HDL-cholesterol, total cholesterol, and triglyceride in feces, most items evaluated showed a negative effect size with high significance in the fixed- and random-effect model (p<0.0001). In the meta-ANOVA and -regression test, administering chitosan and resistant starch was revealed to be most effective in lowering body weight. In addition, chitosan supplementation proved to be an effective solution for TNF-α inhibition. In conclusion, chitosan has been shown to be somewhat useful in improving symptoms of lifestyle-related disease. Although there are some limitations in the results of this meta-analysis due to the limited number of animal experiments conducted, chitosan administration nevertheless shows promise in enhancing the quality of human life.

Sulforaphene (SFE), a major isothiocyanate in radish seeds, is a close chemical relative of sulforaphane (SFA) isolated from broccoli seeds and florets. The anti-proliferative mechanisms of SFA against cancer cells have been well investigated, but little is known about the potential anti-proliferative effects of SFE. In this study, we showed that SFE purified from radish seeds inhibited the growth of six cancer cell lines (A549, CHO, HeLa, Hepa1c1c7, HT-29, and LnCaP), with relative half maximal inhibitory concentration (IC50) values ranging from 1.37 to 3.31 g/mL. Among the six cancer cell lines evaluated, SFE showed the greatest growth inhibition against A549 lung cancer cells. In A549 cells, SFE induced apoptosis via changes in the levels of poly (adenosine diphosphate ribose) polymerase and caspase-3, -8, and -9. Our results indicate that SFE from radish seeds may have significant anti-proliferative potency against a broad range of human cancer cells via induction of apoptosis.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

The reaction mechanism of the carboxylation of K-2-naphthoxide was investigated by density functional theory calculations and spectroscopic studies. The reaction intermediates and products were confirmed by CO₂ adsorbed-FTIR and ¹H-NMR measurements. Four steps of the reaction pathway were identified: CO₂ activation, electrophilic substitution, CO₂-K complex rearrangement, and H-shift, producing 2-hydroxy-1-naphthoic acid (2,1-HNA), 2-hydroxy-3-naphthoic acid (2,3-HNA), and 2-hydroxy-6-naphthoic acid (2,6-HNA). The occurrence of CO₂-K complex rearrangement was also confirmed. These energy profiles of reaction pathways for the reaction intermediates were well consistent the experimental results on the carboxylation of K-2-naphthoxide.

While the container crane is an important part of daily port operations, it has received little attention compared with other infrastructures, such as buildings and bridges. Crane collapse due to earthquake affects the operation of the port, and indirectly impacts the economy. This study proposes fragility analyses for various damage levels of the container crane that allow the port owner and partners to better understand the seismic vulnerability presented by container cranes. A large quantity of nonlinear time history analyses was applied for a three-dimensional (3D) finite element model to quantify the vulnerability of the container crane in considering the uplift and derailment behavior. The uncertainty of demand and capacity of the crane structures were also considered through random variables, i.e. elastic modulus of members, ground motion profile, and intensity. The results analyzed in the case of a Korean container crane showed that the probability of exceeding the first uplift with or without derailment is shown before the crane reaches the structure’s limit states. This means that under low seismic excitation, the crane might be derailed without any structural damage. But when the crane reaches the minor damage state, it is always coupled with a certain probability of uplift with or without derailment. This study also proposes the fragility curves developed for different structural periods to enable port stakeholders to assess the risk of their container crane.

(1) Background: This study aimed to identify the recurrence and survival rates according to the mismatch repair (MMR), p53, and L1 cell adhesion molecule (L1CAM) states in patients with advanced and recurrent endometrial cancer receiving systemic chemotherapy.; (2) Methods: This single-center retrospective cohort study included chemotherapy-naïve patients (n=156) with advanced-stage (III/IV) or recurrent endometrial cancer who were administered chemotherapy as adjuvant therapy (n=112) or first-line palliative treatment (n=44) between January 2015 and June 2022. MMR and p53 states were assessed using PCR, and L1CAM was tested using immunohistochemistry in the no specific molecular profile (NSMP) group. The primary outcomes were progression-free survival (PFS) and overall survival (OS).; (3) Results: Of the 156 patients, 62 (39.7%), 53 (34.0%), and 41 (26.3%) had NSMP, abnormal p53 (p53abn), and an MMR deficiency (MMR-D), respectively. PFS and OS were longest in MMR-D, followed by NSMP, and were the least in p53abn tumors (PFS: p=0.0006, OS: p=0.0013). After NSMP was classified according to positive or negative L1CAM status, the L1CAM-negative group exhibited significantly lower survival rates than the L1CAM-positive group (PFS: p=0.0001, OS: p=0.0027); p53abn tumors were independent prognostic factors for poor PFS (p=0.039 on the multivariable analysis).; (4) Conclusions: In chemotherapy-naïve patients with advanced and recurrent endometrial cancer, the best prognosis after chemotherapy was obtained using MMR-D, followed by NSMP and p53abn tumors. The L1CAM status is a useful new marker for stratifying NSMP in advanced and recurrent patients.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

Background: Inflammasomes recognize cytosolic danger signals, including pathogens, and subsequently induce the secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β. Studying inflammasomes in the red fox (Vulpes vulpes) is crucial from a wildlife veterinary and public health perspective, as it can be used to help control and prevent the transmission of zoonotic pathogens. The understanding of how diversity in inflammasomes across species affects pathogen carriage in the red fox is still limited. Methods: We investigated the activation and intracellular mechanisms of three inflammasomes (NLRP3, AIM2, and NLRC4) in fox peripheral blood mononuclear cells (PBMCs), using established triggers and inhibitors derived from humans and mice. Results: Fox PBMCs exhibited normal activation and induction of IL-1β secretion in response to representative inflammasome triggers (ATP and nigericin for NLRP3, dsDNA for AIM2, flagellin for NLRC4). However, in inhibitor studies, MCC950, a selective NLRP3 inhibitor, suppressed IL-1β secretion mediated by the fox AIM2 and NLRC4 inflammasomes. Conclusions: These findings suggest that NLRP3 may have a common role in dsDNA- and flagellin-mediated inflammasome activation in the red fox. In conclusion, this fox inflammasome biology can be applied to the control of zoonotic infections and the treatment of inflammasome-mediated diseases in the red fox.

Capsizing accidents are regarded as marine accidents with a high rate of casualties per accident. Approximately 89% of all such accidents occur in small ships (vessels with gross tonnage less than 10 tons). Stability calculations are critical for assessing the risk of capsizing incidents and evaluating a ship's seaworthiness. Despite the high frequency of capsizing accidents involving small ships, they are generally exempt from adhering to stability regulations, thus remaining systemically exposed to the risk of capsizing. Moreover, the absence of essential design documents complicates direct ship stability calculations. This study utilizes hull form feature data—obtained from the general arrangement of small ships—as input for a deep learning model. The model is structured as a multilayer neural network and aims to infer hydrostatic curves, which is required data for stability calculations.

We report the development of an extrinsic self-healing coating system that shows no fluorescence from the intact coating, yellowish fluorescence in cracked regions, and greenish fluorescence in healed regions, thus allowing the separate monitoring of cracking and healing of coatings. This fluorescence monitoring self-healing system consisted of a top coating, an epoxy matrix resin containing mixed dye-loaded in single microcapsule. The dye-loaded microcapsules consisted of a poly(urea-formaldehyde) shell encapsulating a healing agent containing MAT-PDMS and styrene, a photo-initiator and a mixture of two dyes, one that fluoresces only in the solid state (DCM) and a second that fluoresces dramatically increased in the solid than solution state (4-TPAE). A mixture of the healing agent, photo-initiator and the two dyes was yellow due to fluorescence from DCM. On UV curing of this mixture, however, the color changed from yellow to green and the fluorescence intensity increased due to fluorescence from 4-TPAE in the solid state. When a self-healing coating embedded with microcapsules containing the DCM/4-TPAE dye mixture was scratched, the damaged region exhibited a yellowish color that changed to green after healing. Thus, the self-healing system reported here allows the separate monitoring of cracking and healing based on changes in fluorescence color.

In 2014, the outbreak of adenoviral pneumonia occurred in Korean military training center. However, there is limited data on characteristics of fever and its response to antipyretics therapy in immunocompetent adults with adenoviral positive community-acquired pneumonia (CAP). Medical records of patients who were admitted to Armed Forces Chuncheon Hospital for treatment of CAP between January 2014 and December 2016 were retrospectively analyzed. We evaluated demographics, clinico-laboratory findings and radiologic findings at admission were compared between adenovirus positive (Adv) group and adenovirus negative (non-Adv) group. Out of 251 military personnel with CAP during the study periods, 67 were classified into Adv group while 184 were Non-Adv group. Patients with Adv group had a longer duration of fever after admission and symptom onset. Adv group patients had a higher mean temperature at admission and more observed over 40 and 39 to 40℃. Adv group patients had more commonly observed no response to antipyretic treatment and adverse events after antipyretics use. Length of hospital stay had no significant difference between two groups and no patient died in both groups. In our study, Adv positive CAP in patients with immunocompetent military personnel had distinct characteristics of fever and response to antipyretic treatment.

Field cricket (Gryllus bimaculatus) is newly emerged as an edible insect in several countries. Anti-inflammatory effect of glycosaminoglycan derived this cricket was not fully investigated on chronic disease animal model such as diabetic mouse. For potential therapeutic agents, anti-diabetic activities of field cricket glycosaminoglycan (GbG) was evaluated in diabetic mice based on their abilities to reduce glucose, ALT, AST, LDL-cholesterol, and BUN levels, compared with dung beetle (Catharsius molossus) glycosaminoglycan (CaG) as a positive control glycosaminoglycan. Db mice were orally administered for one month according to their groups: Db Hetero (normal), Db Homo (type-2 diabetic), CaG (5 mg/kg), GbG (5 mg/kg), and metformin (10 mg/kg). Blood glucose level was decreased after 1^st week treatment with GbG. It also inhibited LDL-cholesterol and alkaline phosphatase levels. Regarding oxidative damage of diabetic state, levels of hepatocellular biomarkers levels and protein carbonyl content were reduced in db mice treated with GbG. Especially anti-oxidative activities of catalase, superoxide dismutase, and glutathione peroxidase were significantly increased in GbG treated group compared to those in the control. GbG was composed of heparin disaccharides and main N-glycan was identified as Hex₉GlcNAc₂ (m/z 1905.7) of with neutral mono-sugar mainly comprising of hexose, L (+) rhamnose by mass spectroscopy. These results from sero-biochemical, hepatocellular anti-oxidant assay in db mice data suggest cricket (G. bimaculatus) glycosaminoglycan might play a role in its anti-diabetic action.

Background: Oenothera biennis (evening primrose) produces bioactive substances with a diverse range of pharmacological functions. However, it is currently unknown whether extract prepared from the aerial parts of O. biennis (APOB) can protect the skin against oxidative stress. To investigate the protective effects of APOB against oxidative stress-induced damage in human skin keratinocytes (HaCaT) and elucidate the underlying mechanisms. Methods: We pretreated HaCaT cells with various concentrations of APOB or the antioxidant N-acetyl-L-cysteine before applying H2O2. We then compared the cell viability, intracellular reactive oxygen species (ROS) production, and DNA and mitochondrial damage between pretreated and untreated control cells using a range of assays, flow cytometry, and Western blot analysis and also examined the reducing power and DPPH free radical-scavenging activity of APOB. Results: APOB pretreatment significantly increased cell viability, effectively attenuated H2O2-induced comet tail formation, and inhibited H2O2-induced phosphorylation of the histone γH2AX, as well as the number of apoptotic bodies and Annexin V-positive cells. APOB was found to have a high reducing power and DPPH radical-scavenging activity and also exhibited scavenging activity against intracellular ROS accumulation and restored the loss of mitochondrial membrane potential caused by H2O2. APOB pretreatment almost totally reversed the enhanced cleavage of caspase-3, the degradation of poly (ADP-ribose)-polymerase (PARP), DNA fragmentation that usually occurs in the presence of H2O2 and increased the levels of heme oxygenase-1 (HO-1), a potent antioxidant enzyme that is associated with the induction of nuclear factor-erythroid 2-related factor 2 (Nrf2). Conclusions: APOB can protect HaCaT cells from H2O2-induced DNA damage and cell death by blocking cellular damage related to oxidative stress via a mechanism that affects ROS elimination and by activating the Nrf2/HO-1 signaling pathway.

As lung cancer shows the highest mortality in cancer related death, serum biomarkers are demanded for the lung cancer diagnosis and its treatment. To discover lung cancer protein biomarkers, secreted proteins from primary cultured lung cancer and adjacent normal tissues from patients were subjected to LC/MS-MS proteomic analysis. Quescin sulfhydryl oxidase(QSOX1) was selected as a biomarker candidate from the proteins enriched in the secretion of lung cancer cells. QSOX1levels were higher in 82% (51 of 62 tissues) of lung cancer tissues compared to adjacent normal tissues. Importantly, QSOX1 serum levels were significantly higher in cancer patients (p<0.05, AUC=0.89), when measured by multiple reaction monitoring(MRM). Higher levels of QSOX1 are also uniquely detected in lung cancer tissues among several other solid cancers by immunohistochemistry. QSOX1 knock-downed Lewis lung cancer (LLC) cells was less viable from oxidative stress and had reduced migration and invasion. In addition, LLC mouse models with QSOX1 knock-down also proved that QSOX1 functions in promoting cancer metastasis. In conclusion, QSOX1 might be a lung cancer tissue-derived biomarker and involved in the promotion of lung cancers, and thus can be a therapeutic target for lung cancers.

Background: To date, FM using middle ear packing has rarely reported. In this study, we hypothesized that middle ear packing with dexamethasone soaked gelfoam and fibrin glue over the fat graft could promote the success rate of TMP closure regardless of perforation size. Methods: Between January 2005 and July 2020, a total of 209 patients who underwent fat myringoplasty due to chronic TMP at tertiary referral center were encountered and analyzed. The success rate and audiologic outcome was analyzed. Results: The mean successful TM closure rate was 88.0 %. The success rate by different age generation was not significant difference. The size of the perforation grade showed no significant difference. The perforation site by anterior or posterior was not significant. The preoperative mean threshold of AC, BC and ABG were 55.71, 12.98 and 42.73 dB respectively. The postoperative mean threshold of AC, BC and ABG were 23.67, 12.98 and 10.69 dB. The change of preoperative and postoperative hearing showed statistically significant. Conclusion: From our results, the simple trimming of the perforation edge and middle ear packing with external ear canal packing using fibrin glue induced the stable adhesion between the remnant TM and the fat graft.

To date, various chimeric lysins have been developed as efficacious antibiotics against multidrug-resistant bacteria, but direct comparisons of their antibacterial activities have been difficult due to the preparation of multiple recombinant chimeric lysins. Previously, we reported an E. coli cell-free expression method to screen better chimeric lysins against Staphylococcus aureus, but we still needed to increase the amounts of expressed proteins enough to be able to detect them non-isotopically for quantity comparisons. In this study, we improved the previous cell-free expression system by adding a previously reported artificial T7 terminator and reversing the different nucleotides between the T7 promoter and start codon to those of the T7 phage. The new method increased the expressed amount of chimeric lysins enough for us to detect them using Western blotting. Therefore, the qualitative comparison of activity between different chimeric lysins has become possible via the adjustment of the amount variables between samples without protein purification. We applied it to select more active chimeric lysins derived from our previously reported chimeric lysin (ALS2). Finally, we compared the antibacterial activities of our selected chimeric lysins with reported chimeric lysins (ClyC and ClyO) and lysostaphin, and determined the rank orders of antibacterial activities on different S. aureus strains in our experimental conditions.

Citrus peel has been used in Asian traditional medicine for the treatment of cough, asthma, and bronchial disorders. However, the anti-inflammatory effect of quercetogetin (QUE), a polymethoxylated flavone isolated from the peel of citrus unshui is poorly understood. We investigated the anti-inflammatory effect and the molecular mechanisms of QUE in lipopolysaccharide (LPS)-induced RAW264.7 cells. QUE inhibited the production of NO and prostaglandin E2 by suppressing the LPS-induced expression of inducible nitric oxide synthase and cyclooxygenase-2 at both the mRNA and protein levels. QUE suppressed the production of proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α. QUE also inhibited the translocation of the nuclear factor kappa B subunit, p65, into the nucleus by interrupting the phosphorylation of IκB-α in LPS-induced RAW 264.7 cells. Based on the finding that QUE significantly decreased p-ERK protein expression in LPS-induced RAW264.7 cells, we confirmed that suppression of the inflammatory process by QUE was mediated through the MAPK pathway. This is the first report on the strong anti-inflammatory effects of QUE, which is a compound that can potentially be used as a therapeutic agent for inflammatory diseases.

Arthrospira platensis is the widely available source of spirulina and contains distinctive natural pigments including carotenoids and C-phycocyanin (C-PC). In this study, the major carotenoid and C-PC contents were determined in seven commercially available spirulina powder products and laboratory-prepared A. platensis trichomes (AP-1) by an LC-DAD method and a UV-Visible spectrometry, respectively. The correlation of these two pigment content levels with Hunter color coordinates and antioxidant activity was also evaluated. The L* value failed to show a significant correlation with pigment content, but a positive correlation was observed between a* values and the contents of total carotenoid and C-PC. As b* values decreased, the total carotenoid and C-PC contents increased. AP-1 exhibited the highest content of total carotenoids, chlorophyll a and C-PC, and antioxidant activities among the samples. This observation could be related to degradation of these pigments during the mass production process. The carotenoid profiles suggested that the commercial spirulina powders originated from two different sources, A. platensis and A. maxima. Total carotenoid and C-PC content exhibited positive significant correlations with antioxidant activities measured by DPPH and ABTS assays. These results provide a strong scientific foundation for the establishment of standards for the commercial distribution of quality spirulina products.

(1)Background:The purpose of the study was conducted to investigate the recovery of heart rate according to the performance level and rest interval conditions during 65%1RM bench press exercise;(2)Methods:The subjects of this study were eight healthy male college studentsin their 20 (years) attending University C. 1RM was measured before theexperiment, and the exercise sequence of six rest intervals (30sec, 1, 2, 3, 4,5min) was randomly selected and cross-distribution experiment. The experimental measurement was conducted a total of six times according to the rest interval condition (six conditions) once every 3 days to minimize the learning effect. The data was verified with repeated measures Two-way ANOVA and Contrast's repeated method was applied for post-comparison;(3)Results: First, the amount of exercise and the number of repetitions statistically substantially dropped (p&lt;.001) as the number of sets rose, and a greater decline was shown when the rest periods got shorter. Second, the heart rate after exercise was increased significantly (p&lt;.01) as the set progressed in the long rest interval conditions (4, 5min), and the heart rate after rest was increased statistically significantly (p&lt;,05) as the set progressed in the short rest interval conditions (30sec, 1min). Third, the heart rate recovery rate (%) was able to perform more repetitions than in the short rest interval condition due to the relatively high physiological recovery of the neuromuscular and circulatory system under the long rest interval condition;(4)Conclusions: Therefore, according to the rest conditionduring the 65%1RM bench press exercise conducted in this study, the restinterval condition of 2~3min may be effective in improving muscular endurance,and the rest interval condition of 4~5min may be effective in improving muscular hypertrophy. As a result of this study, there was a significant difference in exercise performance (repetition) and physiological recovery depending on the rest interval condition according to the set progress during the same intensity resistance exercise. Through this, it is judged that it is possible to adjust the amount of exercise appropriate for the purpose of training by adjusting not only the intensity during resistance exercise but also the rest interval between sets.

The contact materials in high-voltage vacuum interrupter require properties such as high conductivity, high density, and high hardness to minimize arc heat damage. In this study, copper–molybdenum-chromium alloys contact materials are examined for a high voltage contact material. Ball milling process was carried out after analyzing the raw materials of copper, chromium, and molybdenum powders. A green compact was produced using a high press with the mixed powder. Afterwards, composite was produced by sintering method according to temperature and infiltration method according to Cu content in green compact. The composite of sintering method showed a density of 8.55 g/cm3 (relative density 93%) a hardness of 217 HV, and an electrical conductivity of 40.7 IACS% at 1200 °C. The composite of 10 wt.% Cu produced by the Cu infiltration method showed a density of 8.7 g/cm3 (relative density 94%), Hardness of 274HV and electrical conductivity of 39 IACS% at 1300 °C. The measurements of physical properties showed the new possibility of using the Cu–Cr–Mo alloy as a contact material for high-voltage vacuum interrupters.

As climate changes, our daily life has been much influenced by abnormal meteorological phenomena such as heavy rainfall, heat wave, heavy snowfall, and fine dust. Atmospheric air quality is worsening day by day and indoor air quality is also affected by interconnected daily activities throughout the inside and outside of buildings and houses. Nowadays, pollutants from various sources are emitted, transformed by sunlight, vapor, and ozone and transported into the city from country to country. Due to these reasons, there have been high demands to monitor the transportation of particulate matters and improve air quality. Monitoring of pollutants and identification of type and its concentration enables us to track and control its generation and consequently find out the solution. However, monitoring of pollutants, especially, particulate matter generation and its transportation is still not fully operated in atmospheric air due to its open nature and meteorological factors. Even though indoor air is relatively easy to monitor and control than outdoor in the aspect of specific volume and contaminant source, but it still needs to consider the meteorological parameters because indoor air is not fully separated from the outdoor air flow and contaminants transportation. In this study, optical approach using spectral sensor was attempted to reveal the feasibility of wavelength and chromaticity values of reflected light from specific particles. From the analysis of reflected light of various particulate matters according to different liquid additives, parameter studies were performed to investigate which experimental conditions can contribute to the enhanced selective sensing of particulate matters. Five different particulate matters such as household dust, soil, talc powder, gypsum powder and yellow pine tree pollen were utilized and observed to elucidate the relationship between property of particulate matter and detected light spectrum. Applicable approaches to assist current particle matter sensors and improve the selective sensing were suggested.

Phosphatase and tensin homolog (PTEN) is a tumor suppressor due to its ability to regulate cell survival, growth and proliferation by down-regulating PI3K/AKT signaling pathway. In addition, PTEN plays an essential role in other physiological events associated with cell growth demands, such as ischemia-reperfusion, nerve injury and immune response. Therefore, recently PTEN inhibition has emerged as a potential therapeutic intervention in these situations. Increasing evidence demonstrates that reactive oxygen species (ROS), especially hydrogen peroxide (H2O2), are produced and required for the signaling in many important cellular processes under such physiological conditions. ROS have been shown to oxidize PTEN at the cysteine residue of its active site, consequently inhibiting its function. Here we provide an overview of studies that highlight the role of oxidative inhibition of PTEN in physiological processes.

Voice search technology has gained popularity in recent years, transforming the way individuals interact with digital devices. This study aims to explore the sustainable use intention of voice search, focusing on the psychological factors that influence new technology adoption. Using the Technology Acceptance Model (TAM) and anthropomorphism theory, it provides insights for developers, marketers, and policymakers interested in voice search technology. Through an online survey targeting experienced voice search users in the U.S., the study examines the impact of TAM factors (perceived usefulness, ease of use, quality satisfaction) and anthropomorphism traits (narcissism, Machiavellianism) on sustainable use intention of voice search. Results from hierarchical regression analysis show that perceived usefulness, ease of use, and quality satisfaction positively affect sustainable intention of voice search. Additionally, narcissism and Machiavellianism predict sustainable intention of voice search. By merging TAM and anthropomorphism theory, this study enhances our understanding of voice search behavior and technology adoption.

Cloud robotics is becoming an alternative to support advanced services of robots with low computing power as network technology advances. Recently, fog robotics has gained attention since the approach has merit relieving latency and security issues over the conventional cloud robotics. In this paper, a Function-as-a-Service based Fog Robotic (FaaS-FR) for cognitive robots is proposed. The model distributes the cognitive functions according to the computational power, latency and security with a public robot cloud and fog robot server. During the experiment with a Raspberry Pi as an edge, the proposed FaaS-FR model shows efficient and practical performance in the proper distribution of the computational work of the cognitive system.

This study was conducted to investigate the prevalence of Coxiella burnetii infection according to cattle breeds and growth types. A total of 491 cattle [cattle breed: 216 dairy cattle and 275 beef cattle; according to growth type: indoor housing (n = 294) and grazing (n = 197)] were tested for the presence of C. burnetii DNA and antibodies against C. burnetii using a commercial enzyme-linked immunosorbent assay (ELISA). Overall, 10.8% and 8.8% of the cattle were positive by PCR and for C. burnetii antibodies, respectively. The prevalence of C. burnetii was significantly higher in beef cattle than in dairy cattle using PCR (13.6% vs 7.4%; P = 0.032) and ELISA (14.6% vs 1.4%; P = 0.000), respectively. The overall infection rate of C. burnetii was significantly high in grazing cattle (PCR: 24.9%, ELSIA: 21.3%; P = 0.000) compared with housing cattle (PCR: 1.4%, ELISA: 0.3%). The results indicate that beef cattle have a significantly higher risk of contracting C. burnetii infection compared with dairy cattle (21.5% vs. 7.9%, χ2 = 5.82, P = 0.000, odds ratio = 3.197, 95% CI: 1.80-5.67). In addition, the infection of C. burnetii was significantly associated with grazing (P = 0.000). Moreover, a risk of contracting C. burnetii infection in grazing cattle was increased by 32.57-fold (95% CI: 12.84-82.60, P = 0.000) compared with indoor housed cattle. The phylogenetic analysis based on the IS111 gene revealed that our isolates were grouped together with humans, ticks, goats, and cattle isolates found in several countries. C. burnetii isolates circulating in the Republic of Korea exhibit genetic variations. Consequently, our results suggest that cattle are potential reservoirs for C. burnetii infection and most importantly, grazing acts as a high risk factor for the occurrence and transmission of this infection.

Frontotemporal dementia (FTD) is the second most common form of presenile dementia; however, its diagnosis has been poorly investigated. Previous attempts to diagnose FTD using quantitative electroencephalography (qEEG) have yielded inconsistent results in both spectral and functional connectivity analyses. This study aimed to introduce an accurate qEEG marker that could be used to diagnose FTD and other neurological abnormalities. We used open-access electroencephalography data from OpenNeuro to investigate the power ratio between the frontal and temporal lobes in the resting state of 23 patients with FTD and 29 healthy controls. Spectral data were extracted using a Fast Fourier Transform in the delta (1–4 Hz), theta (4–8 Hz), alpha (8–13 Hz), beta (13–32 Hz), and gamma (32–45 Hz) bands. We found that the spectral power ratio between the frontal and temporal lobes is a promising qEEG marker of FTD. Frontal/temporal (F/T) theta/alpha, alpha/theta, al-pha/gamma, and gamma/alpha showed a consistently high discrimination score for the diagnosis of FTD for different parameters and referencing methods. The study findings can serve as reference for future research focused on diagnosing FTD and other neurological anomalies.

The phenolics concentrations of rapeseed are important because they are antinutritional com-pound or directly positive related to antioxidant actives. In this study, single nucleotide poly-morphisms (SNPs) identified from genotyping-by-sequencing (GBS), and genome-wide associa-tion study of phenolic contents were investigated in 95 rapeseed mutant lines derived from gamma rays and their original cultivar. A total of 3,196,318 SNPs were detected, identifying a set of 70,208 union SNPs used to perform association studies. Six phenolics and glucosinolate (pro-goitrin) were identified, sinapine was the major phenolic compound (91.2–99.2%) in all geno-types. The association study was conducted for six phenolic compounds, progoitrin, total sinap-ine content (TSC), total phenolic content (TPC) and seed yield. The association study identified 241 SNPs that were significantly associated with six phenolic compounds, progoitrin, TSC and TPC. Based on the detected SNP markers, BnaA06g31740D, a gene associated progoitrin, BnaC-nng39930D, a gene associated trans-sinapine 1, BnaA07g31720D, a gene associated trans-sinapine 2, BnaC03g31950D and BnaA06g09180D, a gene associated TSC, and BnaAnng27700D, a gene associ-ated TPC, were selected as candidate genes. The SNP makers associated major phenolic com-pounds identified and could be used as targets for breeding programs aimed at improving anti-oxidant contents and reducing antinutritional components.

Background: The world-wide rate of obesity is increasing continuously, representing a serious medical threat since it is associated with a variety of diseases including type 2 diabetes, cardiovascular disease, and numerous cancers. Sophora japonica is used as a traditional herb for medicinal purposes in eastern Asia. However, the anti-obesity effects of S. japonica fruit have not been explored. Objective: The aim of this study is to investigate the inhibition of adipocyte differentiation and adipogenesis by an ethanol extract of S. japonica fruit (EESF) in 3T3-L1 pre-adipocytes. Methods: MTT assay, Oil Red O staining, and Triglyceride contents were used to investigate lipid accumulation in 3T3-L1 cells to clarify adipocyte differentiation. The expression levels of various molecular signals associated with adipogenesis and lipogenesis were examined by western blot analysis. Results: Our results demonstrate that EESF suppressed the terminal differentiation of 3T3-L1 pre-adipocytes in a dose-dependent manner, as confirmed by a decrease in lipid droplet number and lipid content through Oil Red O staining. EESF significantly reduced the accumulation of cellular triglyceride, which was associated with a significant inhibition of the levels of pro-adipogenic transcription factors, downregulated the expression levels of adipocyte-specific proteins. Furthermore, EESF treatment effectively increased the phosphorylation of AMPK and ACC. Conclusions: These results together indicate that EESF has significant effects on the inhibition of adipogenesis and acts by stimulating the AMPK signaling pathway. Further studies will be needed to identify the active compounds in S. japonica.

In this study, we aimed to identify blood lymphocytes as a prognostic factor for survival in patients with locally advanced stage III non-small cell lung cancer (NSCLC) treated with concurrent chemoradiotherapy (CCRT). We conducted a secondary analysis of 196 patients enrolled in the Korean Radiation Oncology Group 0903 phase III clinical trial to evaluate the prognostic significance of circulating blood lymphocyte levels. The median total lymphocyte count (TLC) reduction ratio during CCRT was 0.74 (range: 0.29 – 0.97). In multivariate analysis, patient age (p = 0.014) and gross tumor volume (GTV, p = 0.031) were significant factors associated with overall survival, while TLC reduction (p = 0.018) and pretreatment neutrophil-to-lymphocyte ratio (NLR; p = 0.010) were associated with progression-free survival (PFS). In multivariate logistic regression analysis, pretreatment NLR, GTV, and heart V20 were significantly associated with TLC reduction. TLC reduction during CCRT is a significant prognostic factor for PFS, and heart V20 is significantly associated with TLC reduction. Thus, constraining the volume of the radiation dose to the whole heart must be prioritized to reduce TLC.

An efficient design method is proposed for a compact common-mode rejection (CMR) filter utilizing dumbbell-shaped defected ground (DS-DG) structures and gap-coupled stub (GCS) resonators. A CMR filter for differential lines helps to improve the signal integrity of high-speed digital signals on printed circuit boards. The proposed CMR filter design is based on the equivalent circuit models, while the previous designs depended heavily on the DS-DG structure optimization using the EM simulations. The proposed CMR filter effectively reject the common-mode components with minimally affecting the differential signals. To prove the simplified design approach, a 5th-order Chebyshev band-stop filter has been designed with three DS-DG structures and two GCS resonators. From the simulated and measured results, it is found that the proposed CMR filter provides ~90% fractional frequency bandwidth with more than 20 dB of common-mode rejection ratio and less than 0.6 dB of insertion loss of the differential signal.

Zirconia has recently become one of the most popular dental materials in prosthodontics being used in crowns, bridges, and to implants. However, weak bonding strength of dental adhesives and resins to zirconia surface has been a grand challenge in dentistry, thus finding a better adhesion to zirconia is urgently required. Marine sessile organisms such as mussels use a unique priming strategy to produce a strong bonding to wet mineral surfaces; one of the distinctive chemical features in the mussel’s adhesive primer proteins is high catechol contents among others. In this study, we pursued a bioinspired adhesion strategy, using a synthetic catechol primer applied to dental zirconia surfaces to study the effect of catecholic priming to shear bonding strength. Catechol priming provided a statistically significant enhancement (P < 0.05) in shear bonding strength compared to the bonding strength without priming, and relatively stronger bonding than commercially available zirconia priming techniques. This new bioinspired dental priming approach can be an excellent addition to the practitioner’s toolkit to improve dental bonding to zirconia.

This study was to investigate and assess salivary biomarkers as a means of diagnosing periodontitis. A total of 121 subjects were included: 28 periodontally healthy subjects, 24 with stage I, 24 with stage II, 23 with stage III, and 22 with stage IV periodontitis. Salivary proteins including active matrix metalloproteinase-8 (MMP-8), pro-MMP-8, total MMP-8, C-reactive protein, secretory immunoglobulin A and planktonic bacteria including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum, Prevotella intermedia, Porphyromonas nigrescens, Parvimonas micra, Campylobacter rectus, Eubacterium nodatum, Eikenella corrodens, Streptococcus mitis, Streptococcus mutans, Staphylococcus aureus, Enterococcus faecalis, and Actinomyces viscosus were measured from salivary samples. The performance of the diagnostic models was assessed by receiver operating characteristics (ROC) and area under the ROC curve (AUC) analysis. The diagnostic models were constructed based on the subjects’ proteins and/or microbial profiles, resulting in two potential diagnosis models, which achieved better diagnostic powers with an AUC value &gt; 0.750 for the diagnosis of stage II, III, and IV periodontitis (Model PC-I; AUC: 0.796, sensitivity: 0.754, specificity: 0.712) and for the diagnosis of stage III and IV periodontitis (Model PC-II; AUC: 0.796, sensitivity: 0.756, specificity: 0.868). This study can contribute to screening for periodontitis based on salivary biomarkers.

The way in which a perforated structure is formed has attracted much interest in the porous membrane research community. This novel structure gives materials an excellent antifouling property as well as a low operating pressure and other benefits. Unfortunately, the current membrane fabrication methods usually involve multi-step processes and the use of organic solvents or additives. Our study is the first to offer a way to prepare perforated membrane by using a physical foaming technique with CO₂ as the blowing agent. We selected thermoplastic polyurethane (TPU) as the base material because it is a biocompatible elastomer with excellent tensility, high abrasion resistance, and good elastic resilience. Various processing parameters, which included the saturation pressure, the foaming temperature, and the membrane thickness, were applied to adjust the TPU membrane’s perforated morphology. We proposed a possible formation mechanism of the perforated membrane. The as-prepared TPU membrane had good mechanical properties with a tensile strength of about 5 MPa and an elongation at break above 100%. Such mechanical properties make this novel membrane usable as a self-standing filter device. In addition, its straight-through channel structure can separate particles and meet different separation requirements.

With the increasing prominence of renewable energy sources providing flexibility to the power grid, there is a growing recognition of the need to expand virtual Energy Storage Systems (ESS) to replace traditional ESS, which faces challenges in terms of supply and scalability. Grid-connected microgrids can supply power stably and are being built, so they can be used as virtual ESS to provide flexibility to the power system. This study proposes an approach to determine the optimal Power Conversion System (PCS) and battery capacity for a Virtual Energy Storage System(VEES) based on a grid-connected microgrid incorporating Photovoltaic (PV) and ESS. In this paper, it is assumed that microgrids can provide flexibility to the grid by participating in the energy trading market, there are corresponding profits and penalties for order. Numerical examples are performed to demonstrate the effectiveness of the proposed method.

The purpose of this study was to develop a reflective evaluation tool that can enhance the teaching competency of pre-service physical education teachers. A Delphi survey was conducted to modify the questions based on the evaluation tool for the teaching competency of physical education teachers, and each evaluation standard based on teaching competency was developed. The evaluation tool consisted of 46 questions for class preparation (the creation of the learning environment), the introduction (routine activities, learning goals, and task presentation), development (class strategy, observation and interaction, and the maintenance of the learning environment), and conclusion (routine activities, summary, and closure). It was designed to increase the accuracy of evaluation by developing evaluation criteria for each question. An evaluation tool including quantitative and qualitative methods for use in pre-service physical education teacher education was developed. The significance of this study was the development of an effective evaluation tool that can evaluate the core teaching behaviors in the field of physical education. This evaluation tool should be used as a learning tool that includes planning, operation, evaluation, and seeking improvement measures through reflective activities. If pre-service teacher education institutions apply this evaluation tool in their teacher training programs, it would be a great chance to learn how to develop and sustain teaching abilities and effectiveness.

The aim of this study was to study the effect of leisure identity, flow, satisfaction, and re-participate intention among outdoor leisure activity participants in South Korea. Due to the recent COVID-19 pandemic, there has been a tendency to more frequently participate in outdoor leisure activities as opposed to indoor leisure activities. Leisure activities bestow various benefits. Therefore, this study was used to analyze the relationships amongst leisure identity, flow, leisure satisfaction, and re-participate intention among various theories about leisure. The participants in this study were collected from amongst 369 people who were frequent participants in outdoor leisure activities. For the data analysis, the researchers used frequency, confirmatory analysis, reliability, correlation and structural equaling modeling. The findings were as follows: First, leisure identity had wielded an influence on leisure flow. Second, leisure identity had influence leisure satisfaction. did not have any significant influence on recreation specialization. Third, leisure identity had influence on re-participate intention. Fourth, leisure flow did not have any significant influence on leisure satisfaction. Fifth, leisure flow did not have any significant influence on leisure satisfaction. And finally, leisure satisfaction had an influence on re-participate intention. In the era of the COVID-19 pandemic, a new leisure identity has been formed, and it is believed to be a new study on leisure flow, leisure satisfaction, and re-participation intention. This study aims to provide basic data for constructing infrastructure to enable continued participation in outdoor sports in Korea.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation &lt; 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

Rapeseed (Brassica napus L.) is one of the most oil crop, and its commercial value is contingent upon its agronomic characteristics and oil quality. In this study, 73,226 single nucleotide polymorphisms (SNPs) across 95 rapeseed mutant lines derived from gamma rays and their original cultivar (‘Tamra’) obtained from genotyping-by-sequencing (GBS) was investigated gene ontology (GO) analysis and genome-wide association study (GWAS). GWAS was conducted on agronomic (plant height, ear length, thousand seed weight and seed yield) and oil (fatty acid and crude fat) traits. GO analysis showed that many genes displaying SNPs were involved in cellular processes, intracellular anatomical structures and organic cyclic compound binding. A total of 149 significant SNPs were associated with the agronomic traits (76 SNPs) and oil traits (73 SNPs). Bna.A05p02350D (SFGH) and Bna.C02p22490D (MDN1) were selected as novel candid genes for thousand seed weight. In addition, Bna.C03p14350D (EXO70) and Bna.A09p05630D (PI4Kα1) were selected as novel candidate genes for the erucic acid and crude fat content, respectively. These findings could facilitate the identification of optimal genotypes for breeding new cultivars, and association studies represent an economically efficient tool for mutant screening and the selection of elite rapeseed-breeding lines.

If an algebra of type $A$ contains a subalgebra which is also an algebra of type $B$, then it is a Smarandache $B$-type $A$-algebra provided the subalgebra of type $B$ contains at least two elements. This generalizes the notion of Smarandache group, where the group of order $\geq 2$ is a subsemigroup of a semigroup. In this paper we investigate a number of such pairings and we deduce a number of conclusions as a consequence.

In this paper, we observe that if X is a set and (Bin(X), □) is the semigroup of binary systems on X, then its center ZBin(X) consists of the locally-zero-semigroups and that these can be modeled as (simple) graphs and conversely. Using this device we show that we may obtain many results of interest concerning groupoids by reinterpreting graph theoretical properties and at the same time results on graphs G may be obtained by considering them as elements of centers of the semigroups of binary systems (Bin(X), □) where X = V(G), the vertex set of G.

Cabbage (B. oleracea var. capitata) contains three FLC homolog genes (BoFLC1, BoFLC2, and BoFLC3) and one pseudogene (BoFLC5) that responds to low temperatures necessary for flowering. We isolated three BoFLC-encoding genes from early-, mid-, and late-flowering cabbage plants. Leaf samples were collected for RNA extraction and expression analysis. Gene structure analysis and phylogenetic comparison were performed for intra- or interspecific relationships of the BoFLC homologs. Gene expression related to flowering regulators (BoGI, BoCOOLAIR, and BoVIN3) was analyzed. While BoFLC genes commonly have seven exons and six introns of 3,361–4.384 bp, variations in insertion or deletion were evident between the early- and late-flowering genotypes. Repressed expression of BoFLC 1, 2, and 3 genes under chilling temperatures appeared to occur from 8 weeks after vernalization. Higher expression levels of GI, COOLAIR, and VIN3 were initiated 7 weeks after chilling (WAT) treatment in the early flowering genotype. The vernalization trigger repressed the expression of BoFLC homologs. This study provides molecular insights into BoFLC homologs between early- and late-flowering cabbage genotypes, in which structural variations in BoFLC1 appeared to be important as a binding motif to flowering regulating factors such as BoGI, BoCOOLAIR, and BoVIN3 for which motif analysis is further implemented.

Emotion plays a powerful role in humans’ interaction with robots. In order to express more human-friendly emotions, robots need the capability of contextual appraisal that expresses the emotional relevance of various targets in the spatiotemporal situation. In this paper, an emotional appraisal methodology is proposed in this study to cope with such contexts. Specifically, the Ortony, Clore, and Collins model is abstracted and simplified to approximate an emotional appraisal model in the form of a sentence-based cognitive system. The contextual emotion appraisal is modeled by formulating the emotional relationships among multiple targets and the emotional transition with events and time passing. To verify the proposed robotic system’s feasibility, simulations were conducted for scenarios where it emotional interacts with humans manipulating liked or disliked objects on a table. This experiment demonstrated that the robot's emotion can variously change over time like human by using a proposed formula for emotional valence, which is moderated by emotion appraisal of occurring events.

Neuroinflammatory responses are implicated in the pathogenesis of neurodegenerative diseases. In neurodegenerative diseases, neuroinflammatory reactions to neuronal injury are modulated by microglial cells, which are vital innate immune cells in the central nervous system. Activated microglial cells release proinflammatory cytokines, mediators, and neurotoxic factors that induce fatal neuronal injury. The present study investigated the anti-neuroinflammatory effects of cudratricusxanthone L (1), which was isolated from Cudrania tricuspidata. This compound reduced the levels of lipopolysaccharide-stimulated inflammatory mediators and cytokines, including nitric oxide, prostaglandin E2, interleukin (IL)-1β, tumor necrosis factor-α, IL-6, and IL-12. These effects suggested that cudratricusxanthone L (1) suppressed the nuclear factor-kappa B (NF-κB) signaling pathway. Specifically, cudratricusxanthone L (1) also attenuated the phosphorylation of Jun kinase and inhibited p38 mitogen-activated protein kinase (MAPK) signaling in BV2 and rat primary microglial cells. These results indicated that cudratricusxanthone L (1) effectively repressed neuroinflammatory processes in BV2 and rat primary microglial cells by inhibiting NF-κB and the MAPK signaling pathway.

Water management can improve the quality of valuable ecosystem services but can be costly to implement and the management costs are covered by national taxes collected by water users. Based on 30 valuation studies of water quality improvement from the Environmental Valuation Information System (EVIS) database provided by Korea Environment Institute (KEI), a meta-regression analysis was employed to measure the benefits that major river basins provided to the society. We compare these benefits to the costs, namely River Management Funds (RMFs) which are financial resources to support a variety of projects for managing and improving upstream water quality. Based on benefit-cost comparison, this study evaluates the efficiency of water resource management in South Korea. This study also provides policy options that are helpful to maintain the sustainability of water resource by improving the planning and performance of water management in the long run.

In this study, a new empirical equation was established to predict the sedimentation volume resulting from the construction of a multipurpose weir or low-head dam. The study employed a one-dimensional numerical model (STAFF) to investigate the key parameters affecting sedimentation volume. Short-term predictions were conducted through laboratory experiments with movable bed, and the results indicated that dimensionless unit stream power and the Shields parameter exhibited the most significant correlation with dimensionless deposition volume. Using a multiple regression approach, an empirical equation was formulated and validated for predicting sedimentation in the upstream reservoir of the weir.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

A sintered wick was formed in a heat pipe through the process of sintering a mixture of copper powder with particle sizes of 100㎛ and 200㎛, mixed with a pore-forming agent. On application to the heat pipes. The thermal resistance of heat pipes containing a sintered wick was calculated for different tilting angles (0°, 45°, and 90°) according to the type of powder, thickness of the sintered wick, and the filling ratio of the working fluid. The heat transfer efficiencies were evaluated through temperature tests. The capillary force, which is closely related to heat transfer efficiency, is determined by the effective pore radius resulting from the sintering of the copper powder. Furthermore, it was observed that the heat transfer performance of the heat pipe was at its best when the working fluid filling ratio was 30%. Additionally, the width of the wick was found to have a direct correlation with the heat transfer performance.

The incidence of radiculopathy due to lumbar spinal stenosis has been on the increase in the aging population. However, patients aged 80 years hesitate to undergo conventional open surgery under general anesthesia because of the risk of postoperative morbidity and adverse events. Therefore, less invasive surgical alternatives are required for the elderly or medically handicapped patients. Transforaminal endoscopic lumbar lateral recess decompression (TELLRD) may be helpful for those patients. This study aimed to demonstrate the efficacy of TELLRD for treating radiculopathy in octogenarian patients. A total of 21 consecutive octogenarian patients with lumbar foraminal stenosis underwent TELLRD between January 2017 and January 2021. The inclusion criterion was unilateral radiculopathy, which stemmed from lumbar lateral recess stenosis. The pain source was verified using imaging studies and selective nerve blocks. Full-scale lateral canal decompression was performed using a percutaneous transforaminal endoscopic approach under local anesthesia. We found the pain scores and functional status improved significantly during the 24-month follow-up period. The clinical improvement rate was 95.24% (20 of 21 patients) with no systemic complication. In conclusion, endoscopic lateral recess decompression via the transforaminal approach is practical for octogenarian patients while reducing the medical risks of aggressive open surgery.

Despite the impressive performance of deep neural networks on many different vision tasks, they have been known to be vulnerable to intentionally added noise to input images. To combat these adversarial examples (AEs), improving the adversarial robustness of models has emerged as an important research topic, and research has been conducted in various directions including adversarial training, image denoising, and adversarial purification. Among them, this paper focuses on adversarial purification, which is a kind of pre-processing that removes noise before AEs enter a classification model. The advantage of adversarial purification is that it can improve robustness without affecting the model’s nature, while another defense techniques like adversarial training suffer from a decrease in model accuracy. Our proposed purification framework utilizes a Convolutional Autoencoder as a base model to capture the features of images and their spatial structure. We further aim to improve the adversarial robustness of our purification model by distilling the knowledge from teacher models. To this end, we train two Convolutional Autoencoders (teachers), one with adversarial training and the other with normal training. Then, through ensemble knowledge distillation, we transfer the ability of denoising and restoring of original images to the student model (purification model). Our extensive experiments confirm that our student model achieves high purification performance(i.e., how accurately a pre-trained classification model classifies purified images). The ablation study confirms the positive effect of our idea of ensemble knowledge distillation from two teachers on performance.

Dual energy X-ray absorptiometry (DEXA) measuring tool is a reliable and accurate technology to measure bone density and bone mineral composition. This research examined the composition and bone density (bone mineral composition and bone mineral density) of the whole body and representative body parts using DEXA. The participants were 240 healthy adult men and women who were divided into three groups based on age. The total bone mineral density (BMD) of women amounted to an average of 1.14 g/㎠ in Group A, 1.14 g/㎠ in Group B, and 0.98 g/㎠ in Group C. For men, the average BMD was 1.25 g/㎠ in Group A, 1.20 g/㎠ in Group B, and 1.17 g/㎠ in Group C. As a result, the reduction of age-specific BMD was shown to have a correlation with aging and body mass index(BMI), and it is determined that exercising on a regular basis can prevent reduction in BMD by maintaining appropriate muscle mass.

Increasingly, firms are expected to implement ESG (Environment, Social, and Governance) mandates to appeal to the global market. However, this requires overcoming practical challenges and capitalizing on emerging opportunities. This paper conducts an in-depth analysis of the ESG practices of leading Korean global firms. The study selects five firms for case studies representing industries such as electronics, automotive, steelmaking, and chemicals. It examines ESG reports, performance indicators, and corporate disclosures of these firms. The analysis reveals the adoption of industry-specific ESG strategies, highlighting how these firms tailor their approaches to address unique industry challenges while aligning with global sustainability trends. Key findings include a strong emphasis on innovative solutions to ESG challenges, the integration of ESG into core business operations, and a balanced approach to economic, social, and environmental responsibilities. This study contributes to a broader understanding of how ESG practices are implemented in various industrial contexts, particularly in the dynamic and evolving landscape of Korean global businesses. It offers valuable insights and benchmarks for global companies, underlining the importance of contextualized and industry-specific ESG strategies in achieving sustainable and ethical business practices

This study aims to suggest a basis for the selection of technologies for developing high-performance buildings to reduce energy consumptions and greenhouse gas emissions. Energy-saving technologies comprising of 15 cases were categorized into passive, active, and renewable energy systems. EnergyPlus v8.8 was used to analyze the contribution of each technology in reducing the primary energy consumptions and CO₂ emissions in the Korean climate. The primary energy consumptions of the base model were 464.1 and 485.1 kWh/m²a in the Incheon and Jeju, respectively, and the CO₂ emissions were 83.4 and 87.4 kgCO₂/m²a, respectively. Each technology (cases 1–15) provided different energy-saving contributions in the Korean climate depending on their characteristics. The heating, cooling, and other energy-saving contributions of each technology indicate that their saving rates can be used when selecting suitable technologies during the cooling and heating seasons. Case 15 (active chilled beam with dedicated outdoor air system + ground source heat pump) showed the highest energy saving rate. In case 15, the Incheon and Jeju models were reduced by 189.4 (59.2%) and 206.2 kWh/m²a (57.4%) compared to the base case, respectively, and the CO₂ emissions were reduced by up to 32.7 (60.8%) and 35.6 kgCO₂/m²a (59.3%), respectively.

The purpose of this study is to identify the different effects exerted by planting density and nitrogen fertilization on high-salinity Reclaimed Paddy Fields(RPF) and General Paddy Fields(GPF), and to find the amount of fertilization and the planting density suitable for the growth of forage rice in each paddy field. In both experimental locations, there was no significant change in the soil due to N treatment, but in the case of RPF, electrical conductivity(EC) decreased significantly from more than 5dS/m to up to 2.87dS/m during the yellow ripe stage due to the influence of floods and concentrated precipitation on the fields. In all soils, as both the amount of N treatment and the planting density increased, there was a proportional relationship in which the number of tillers and the dry weight also increased, with the occurrence of lodging also being increased. The dry weight, as expected, was 1.5 times higher at a planting distance of 10 cm, rather than 16 cm. In addition, in both locations N treatment led to an increase in the dry weight, but when N treatment reached 400kg/ha (2.0), the dry weight decreased instead. Moreover, although there was no clear difference in feed value according to N treatment, in RPF, neutral detergent fiber(NDF) was higher than 60%, RFV was less than 98, and TDN was also low, confirming that the quality of rice was higher in GPF.

In this paper, the design process of BLDC adopting the dual rotor method that can reduce the overall size of the motor while generating the same torque as the conventional Permanent Magnet BLDC is analyzed. A simple size is selected by obtaining the torque per rotor volume (TRV), and a method of matching the counter electromotive force by selecting the pole arc of the magnet through a magnetic equivalent circuit is analyzed. Since the efficiency is low because the 120-degree commutation method is selected, the middle stator is optimized through detailed design through the experimental design method. Afterwards, it has the advantage of being able to shift without stopping due to the characteristic of a dual rotor. For this, an analysis of the driving characteristics for each mode is performed.

Anesthetics reduce cardiac functions and lower blood pressure (BP), potentially causing excessive BP reduction in dehydrated patients or those with heart conditions, such as coronary artery disease (CAD). Considering the increased prevalence of cardiovascular disease with age, anesthesiologists must be cautious about BP reduction during general anesthesia in older adults. In the present case, an undiagnosed CAD patient in a hypovolemic state experienced a significant systolic blood pressure drop to the 50s during propofol and sevoflurane anesthesia. Despite the use of vasopressors, excessive hypotension persisted, leading to anesthesia suspension. Subsequent cardiac examinations, including computed tomography heart angio and calcium score, and coronary angiogram, revealed a near total occlusion of the left main coronary artery and the formation of collateral circulation. After 5 days of hydration and anticoagulation medications and confirmation of normovolemic state, general anesthesia was attempted again and successfully induced; a normal BP was maintained throughout the surgery. Thus, it is important to conduct a thorough cardiac evaluation and maintain normovolemia for general anesthesia in older adults.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

The purpose of this study is to develop and evaluate a self-microemulsifying drug delivery system (SMEDDS) to improve the oral absorption of poorly water-soluble Olaparib. Through the solubility test of Olaparib in various oils, surfactants and co-surfactants, pharmaceutical excipients for use in SMEDDS manufacturing were selected. Self-emulsifying regions were identified by mixing the selected materials at various ratios, and a pseudoternary phase diagram was constructed by synthesizing these results. Various physicochemical properties of microemulsion incorporating Olaparib were confirmed by investigating the particle morphology, particle size, zeta potential, drug content and stability. In addition, the improved dissolution and oral absorption of Olaparib were also confirmed through a dissolution test and a pharmacokinetic study. An optimal microemulsion was generated in the formulation of Capmul MCM EP/NF 10%, Labrasol 80% and PEG 400 10%. Fabricated nano-sized microemulsions were well-dispersed in aqueous solutions, and it was also confirmed that it was maintained well without any problems of either physical or chemical stability. The 5 min initial dissolution of Olaparib in fabricated formulations was improved by 10.6 times (pH1.2), 14.8 times (pH6.8) and 14.8 times (distilled water) compared to the values of Olaparib powder. The dissolution at 120min was 45.4±4.0%(pH1.2), 53.5±1.1% (pH6.8) and 58.1±1.00% (distilled water) in Olaparib powder but has been significantly improved by 1.7 times (74.8±1.9%), 1.6 times (84.2±0.3%) and 1.5 times (81.2±0.7%) in SMEDDS. Associated with the high dissolutions of Olaparib in fabricated microemulsions, the pharmacokinetic parameters were also greatly improved. The Cmax and AUCinf of Olaparib in the prepared microemulsion were increased 4.2- and 3.2-fold, respectively, compared to powder. Taken together with the results mentioned above, the microemulsion system could be an effective tool as an oral delivery formulation for Olaparib. Additionally, our results demonstrate that the SMEDDS systems comprising Capmul MCM, Labrasol and PEG 400 could be a useful option for improvement of several other poorly water-soluble drugs with physico-chemical properties similar to Olaparib.

Hepatitis B virus (HBV) is known to cause severe liver diseases such as acute or chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. Chronic hepatitis B (CHB) infection is a major health problem with nearly 300 million individuals infected worldwide. Currently, nucleos(t)ide analogs (NAs) and interferon alpha are clinically approved treatments for HBV infection. NAs are potent antiviral agents that bind to HBV polymerase and block viral reverse transcription and replication. Besifovir dipivoxil maleate (BSV) is a newly developed NA against HBV in the form of acyclic nucleotide phosphonate that is available for oral administration similar to adefovir and tenofovir. Until now, resistance to BSV treatment has not been reported. In this study, we found a CHB patient who showed viral breakthrough after long-term treatment with BSV. The isolated HBV DNA from patient’s serum were cloned into the replication-competent HBV 1.2mer and the sequence of reverse transcriptase (RT) domain of HBV polymerase were analyzed. We also examined the drug susceptibility of generated clones in vitro. Several mutations were identified in HBV RT domain. A particular mutant harboring ten RT mutations showed resistance to BSV treatment in vitro. The ten mutations include rtV23I (I), rtH55R (R), rtY124H (H), rtD134E (E), rtN139K (K), rtL180M (M), rtM204V (V), rtQ267L (L), rtL269I (I) and rtL336M (M). To further identify the responsible mutations for BSV resistance, we performed in vitro drug susceptibility assay on several artificial clones. As a result, our study revealed that rtL180M (M) and rtM204V (V) mutations, already known as lamivudine-resistant mutations, confer resistance to BSV in the CHB patient.

To determine the mode of action of the effects of phytoalexins in soybeans, we analyzed enzyme inhibition kinetics using Michaelis–Menten plots and the Lineweaver–Burk plots. The results showed that glyceollin showed competitive inhibition, genistein showed noncompetitive, daidzein was uncompetitive, and luteolin showed a mixed mode of action. The Ki values were determined using a Dixon plot as: glyceollin, 18.99; genistein, 15.42; luteolin, 16.81; and daidzein, 9.99 μM, respectively. Furthermore, potential synergistic effects between glyceollin and the three designated polyphenols were investigated. A combination of glyceollin and luteolin (the ratio of 3:7 of glyceollin and luteolin) had synergistic effects on α-glucosidase inhibition according to combination index (CI)-isobologram equation. Collectively, these results showed that a combination of glyceollin and luteolin has the potential to inhibit α-glucosidase activity via a synergistic mode of action.

This study aimed to compare the prognosis and characteristics of patients with advanced hepatocellular carcinoma treated with first-line atezolizumab plus bevacizumab (AB) combination therapy and hepatic artery infusion chemotherapy (HAIC). We retrospectively assessed 179 and 72 patients treated with HAIC and AB combination therapy, respectively, between January 2018 and January 2023. The progression-free survival of patients treated with HAIC was significantly superior than that of patients treated with AB (P&lt;0.05), but there was no significant difference in overall survival and objective response rate (ORR) between the two groups (P=0.1056 and P=0.137, respectively). After propensity score matching (PSM), our data revealed that there was no significant difference in PFS between patients who received AB combination therapy and HAIC therapy (P=0.8888). However, patients who received AB combination therapy had significantly better overall survival than those who received HAIC therapy (P=0.0133). In addition, after PSM, significant differences in ORR and disease control rate were not observed. In conclusion, our propensity score study reveals that patients treated with AB therapy have a significantly longer OS than those treated with HAIC.

Bioactive plant compounds, also known as phytochemicals, are essential for plant resistance, growth, and development. These chemicals often possess therapeutic properties that have been used in traditional medicine for centuries as herbal remedies for a variety of diseases. As a member of the Lamiaceae family, Rydingia (Syn: Otostegia) is found in Asia and northeastern Africa. R. michauxii, is a unique shrub that grows in the Southern region of Iran, Fars province. Rydingia species have been used as traditional herbal medicine in Iran for many years. It seems that R. michauxii offers great potential for in-depth research on its diverse biological properties, especially its antioxidant and lipid-lowering effects. Nevertheless, no clinical investigation has been carried out on the phytochemical characteristics of this plant to date. Therefore, this study aims to contribute to the scientific knowledge on the pharmacological properties of R. michauxii and its phytochemical compounds and encourage researchers to evaluate its biological properties in animal models. In this study, all available scientific literature was compiled and all phytochemical and pharmacological properties of the R. michauxii plant were investigated, including antibacterial, antifungal, antiviral, antioxidant, antimalarial, cytotoxic, and lipid-lowering effects, which may prove useful in developing novel formulations with greater therapeutic benefits in clinical applications.

With the rapid development of communication technology, connected vehicles (CV) have the potential, through the sharing of data, to enhance vehicle safety and reduce vehicle energy consumption and emissions. Numerous research efforts have been conducted to quantify the impacts of CV applications, assuming instant and accurate communication among vehicles, devices, pedestrians, infrastructure, the network, the cloud, and the grid, collectively known as V2X (vehicle-to-everything). The use of cellular vehicle-to-everything (C-V2X), to share data is emerging as an efficient means to achieve this objective. C-V2X releases 14 and 15 utilize the 4G LTE technology and release 16 utilizes the new 5G new radio (NR) technology. C-V2X can function without network infrastructure coverage and has a better communication range, improved latency, and greater data rates compared to older technologies. Such highly efficient interchange of information among all participating parts in a CV environment will not only provide timely data to enhance the capacity of the transportation system but can also be used to develop applications that enhance vehicle safety and minimize negative environmental impacts. However, before the full benefits of CV can be achieved, there is a need to thoroughly investigate the effectiveness, strengths, and weaknesses of different CV applications, the communication protocols, the varied results with different CV market penetration rates (MPRs), the interaction of CVs and human driven vehicles, the integration of multiple applications, and the errors and latencies associated with data communication. This paper reviews existing literature on the environmental, mobility and safety impacts of CV applications, identifies the gaps in our current research of CVs and recommends future research directions. The results of this paper will help shape the future research direction for CV applications to realize their full potential benefits.

Migraine is a neurovascular disorder that affects approximately 12% of the global population. While its exact causes are still being studied, researchers believe that nociceptors in the trigeminal ganglia play a key role in the pain signals of migraine. These nociceptors innervate the intracranial meninges and convey pain signals from the meninges to the thalamus. Targeting these nociceptors is considered promising due to their accessibility and distinct molecular profile, which includes the expression of several transient receptor potential (TRP) channels. These channels have been linked to various pain conditions, including migraine. This review discusses the role and mechanisms of nociceptors in migraine, the challenges of current antimigraine drugs, and the evidence for well-studied and emerging TRP channels, particularly TRPC4, as novel targets for migraine prevention and treatment.

Research has been actively conducted on the materials used to commercialize finished products that use hydrogen energy. Hydrogen embrittlement that occurs when hydrogen atoms penetrate metals is the largest problem that must be addressed first regarding safety. Because liquefied hydrogen has an 800 times higher density than hydrogen gas, hydrogen has been stored and transported through liquefaction at -253℃ using helium gas as a refrigerant. However, even if extreme temperatures below zero are maintained, natural vaporization loss that reduces liquefied hydrogen by 3 to 5% of the tank storage capacity per day occurs. In addition, when liquefied hydrogen is converted into high-pressure hydrogen gas for use, it is difficult to completely prevent the loss of the gas, even if sealing technology is applied to prevent gas leaks in transport and storage tanks. Therefore, methods to minimize the loss of hydrogen, establishment of assessment criteria for the embrittlement caused by a small amount of hydrogen gas, and related research are essential. We researched the hydrogen embrittlement resistance of SUS316L rods according to the tensile speed by conducting water electrolysis testing at room temperature, at which hydrogen gas is used to present hydrogen embrittlement assessment criteria for primary ring-shaped forged products.

The steering performance according to the steering angle control was tested by using the active steering bogie developed to reduce excessive wheels and rail wear and noise generated when the railway vehicle run in a curved section. As a result of the test of increasing the steering angle in accordance with the target steering angle in the 300m radius of curvature, the bogie is gradually aligned in the radial steering position, and when the control is carried out to 100% of the target steering angle, the bogie angles of the front and rear bogies appeared almost the same. As the steering angle increased, wheel lateral force and derailment coefficient also decreased. Therefore, the validity of the radial steering position control method applied in this paper was confirmed experimentally. This test results will be used for future research on active steering bogie commercialization.

Cartels cause tremendous damage to the market economy and disadvantage consumers by causing higher prices and lower quality; moreover, they are difficult to detect. We need to prevent them by scientific analysis, which includes the determination of an indicator to explain antitrust enforcement. Particularly, the probability of cartel penalization is a useful indicator for the evaluation of the competition enforcement. This study is to estimate the probability of cartel penalization by using a Bayesian approach. In the empirical study, the probability of cartel penalization is estimated by Bayesian approach from cartel data of Department of Justice in United States from 1970 to 2009. The probability of cartel penalization is seen to be sensitive to change of competition law and the results shows the usefulness of higher interpretation than other research. The result of the policy simulation shows how effective the leniency program is. From this estimation, antitrust enforcement is evaluated, and thereby, can be improved.

Because the application of antibiotic growth promoters (AGP) causes accelerated adverse effects on the animal diet, the scientific community has taken progressive steps to enhance sustainable animal productivity without using AGP in animal nutrition. Organic acids (OAs) are non-antibiotic feed additives and a promising feeding strategy in the swine and broiler industry. Mechanistically, OAs improve productivity through multiple and diverse pathways: (a) reduction of pathogenic bacteria in the gastrointestinal tract (GIT) by reducing the gut pH; (b) boosting the digestibility of nutrients by facilitating digestive enzyme secretion and increasing feed retention time in the gut system; (c) having a positive impact and preventing meat quality deterioration without leaving any chemical residues. Recent studies have reported the effectiveness of using encapsulated OAs and synergistic mechanisms of OAs combinations in swine and broiler productivity. On the other hand, the synergistic mechanisms of OAs and the optimal combination of OAs in the animal diet are not completely understood, and further intensive scientific explorations are needed. Moreover, the ultimate production parameters are not similar owing to the type of OAs, concentration level, growth phase, health status of animals, hygienic standards, and environmental factors. Thus, those factors need to be considered before implementing OAs in feeding practices. In conclusion, the current review evaluated the basics of OAs, mode of action, novel strategies to enhance utilization, influence on growth performances, nutrient digestibility, quality traits, and meat preservation of swine and broilers and their potential concerns regarding utilization.

This paper proposes a real-time local positioning system (RT-LPs) utilizing a mobile platform equipped with three anchor nodes placed in a right-angle triangle formation for a real-time locating system (RTLS). After deriving an analytic formula to calculate the target position utilizing the measured distances among anchor nodes and the target node, we find that four parameters have an effect on the position error of the target node. The spacing between anchors is a design parameter that must be large enough to the reduce position error. However, the distance from the anchor node to the target node is an operation parameter that must be small enough to reduce the position error. Additionally, the measured ranges among the anchors and the target node have probabilistic distributions with a mean and variance, which are dominant parameters that have effects on the position error. A comparison study was conducted to determine the effects of the parameters of the target position in both a simulation and an experiment, showing rates of approximately 4% ~ 10%. These findings indicate that our simulation can work properly with the proposed method after assuming that the distance error is a Gaussian model.

Clay ball is a pavement surface defect which refers to a clump in which clay or dirt is mixed with hot asphalt mixture. Clay ball is typically caused by a combination of aggregate contamination of clay or soil, high aggregate moisture, and low production temperature at the asphalt plant. It usually appears a few weeks or months after paving under traffic load, after being liquefied and knocked from the pavement surface. Clay balls can be the source of potholing, raveling, and other issues such as moisture infiltration and reduced ride quality. This paper presents an investigation of the clay balls on US-31 one winter after construction in Hamilton County, Indiana. In order to understand the pavement condition, their severity was measured using both visual observation and infrared image collection system. In addition, a clay ball distribution pattern, its density, and cores condition were evaluated. A precipitation effect on clay ball formation was investigated for finding a cause of the clay balls. The investigation found that infrared image collection system was appropriate in detecting the clay balls. The clay balls were elliptic in shape with 1 inch to 4 inches in diameter, and the maximum clay ball depth is almost penetrating the entire surface course. It was also found that the asphalt paving on the raining days or right after raining could increase the potential of clay balls. Monitoring of aggregate moisture during construction on or after raining days should be able to reduce the risk of clay balls.

The Advanced Meteorological Image (AMI) onboard GEOKOMPSAT 2A (GK-2A) enables the retrieval of dust aerosol optical depth (DAOD) from geostationary satellites using infrared (IR) channels. IR observations allow the retrieval of DAOD and the dust layer altitude (24 hour) over surface properties, particularly over deserts. In this study, dust events in northeast Asia from 2020 to 2021 were investigated using five GK-2A thermal IR bands (8.7, 10.5, 11.4, 12.3, and 13.3 μm). For the dust cloud, the observed brightness temperature differences (BTDs) of 10.5 and 12.3 μm were found to be always negative, while the BTD of 8.7 and 10.5 μm varies relying on the dust intensity. Making the best use of optical properties, a physical approach for DAOD lookup tables (LUTs) was developed using IR channels to retrieve the DAOD. This study simulated the characteristics of thermal radiation transfer using the forward model and dust aerosols can explain by BTD (10.5, 12.3 μm), which is an intrinsic characteristic of dust aerosol. The DAOD and property of dust can be gained from the brightness temperature (BT) of 10.5 μm and the BTD of 10.5, 12.3 μm. Additionally, the cumulative distribution function (CDF) was employed to strengthen the continuity of 24-hour DAOD, which was applied to the algorithm by calculating the conversion value coefficient for the DAOD error correction of the IR with daytime visible aerosol optical depth (VAOD) as the true value. The results show that DAOD product can be successfully used during both daytime and nighttime to continuously monitor the flow of yellow dust from the GK-2A satellite in northeast Asia. In particular, the validation result of IR DAOD was similar to that of the active satellite product (CALIPSO/CALIOP), which showed a tendency similar to that for IR DAOD at night.

Triticale is known for being an alternative energy source to usual cereals such as maize and wheat in poultry nutrition. Several studies suggested opposite results regarding its incorporation as a feed ingredient on laying hens’ production parameters. This article used a meta-analysis to assess the factors influencing the effects of triticale on layers’ performance. In July 2022, papers studying the effect of triticale on layers’ egg production (EP), egg weight (EW), egg yolk color (EYC), feed intake (FI), and feed conversion ratio (FCR) were identified on Google Scholar, PubMed, and Science Direct. According to the eligibility criteria of PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) guidelines, 6 articles were registered and segmented into 16 experiments for our meta-analysis. Overall, the trim and fill method revealed that triticale had similar impacts to conventional cereals on laying hens' performance. However, the meta-ANOVA and the meta-regression emphasized that triticale percentage, triticale strains and laying hens strains could significantly influence the effect of triticale on layers' performance. Indeed, the meta-Anova highlighted that the Hy-Line Brown strain and Joesong and Juanilo triticale strains in-duced the best laying hens’ performance. Moreover, the meta-regression emphasized a positive correlation between the triticale inclusion percentage and the EW in Juanilo triticale diets and a negative correlation between the triticale inclusion percentages and the EYC in the triticale and laying hens strains studied. Even though the funnel plot and the Egger linear test suggested sig-nificant publication bias, the present meta-analysis remains consistent research to understand how certain factors could influence the impact of triticale on layers' performance.

The levels of informatization, automation, and intelligence are continuously improving; however, the risks due to the increased design and operational complexity of ship systems are increasing. Large-scale ship accidents occur for various reasons. Existing accident analysis methods that examine marine accidents from the perspective of causal one-to-one correspondence have limitations in systematically analyzing complex marine risks when identifying their causes for the prevention of similar accidents. This study focuses on a systematic causality analysis of the factors related to human errors in marine accidents that may occur during the arrival and departure of mega container ships. In particular, a representative case of the Milano Bridge crane contact accident at Busan New Port is considered. To explore the complex organizational–technical, human–technical, and organizational–human relationships relevant to this case, human factors (seafarer, pilot, etc) that are closely related to the linked causes were analyzed using the functional resonance analysis method. This study aims to reduce human error and prevent marine accidents including pilotage.

As one of GEO-constellation for environmental monitoring in the next decade, Geostationary Environment Monitoring Spectrometer (GEMS) is designed to observe the Asia Pacific region to provide the information on the atmospheric chemicals, aerosol and cloud properties. For the continuous monitoring of the sensor performance after its launch in early 2020, here we suggest deep convective clouds (DCCs) as a possible target for the vicarious calibration of GEMS, the first UV/VIS hyperspectral sensor onboard a geostationary satellite. Tropospheric Monitoring Instrument (TROPOMI) and Ozone Monitoring Instrument (OMI) are used as a proxy of GEMS, and a conventional DCC detection approach applying the thermal threshold test is used for the DCC detection based on the collocations with Advance Himawari-8 Imager (AHI) onboard Himawari-8 geostationary satellite. DCCs are frequently detected over the GEMS observation area on average over 200 pixels in a single observation scene. Considering the spatial resolution of GEMS, 3.5 km×7 km which is similar to TROPOMI, and its temporal resolution (8 times a day), availability of DCCs for vicarious calibration of GEMS is expected to be sufficient. Inspection of the DCC reflectivity spectra estimated from the OMI and TROPOMI data also shows a promising result. Even though, their observation geometry and sensor characteristics are quite a different, the estimated DCC spectra agree quite a well within a known uncertainty range with comparable spectral features. When the DCC detection is further improved by applying both visible and infrared tests, the variability of DCC reflectivity from the TROPOMI data is reduced by half, from 10% to 5%. This is mainly due to the efficient screening of cold thin cirrus with the visible test and of bright warm clouds with the infrared test. The precise DCC detection is also expected to contribute to the accurate characterization of the cloud reflectivity, which will be further investigated.

In this paper, we investigate the effects of certain variants of the commutative laws on properties of several families of algebras which are in general not commutative, such as groups, linear algebras, or actually quite anti-commutative, such as $BCK$-algebras and $d$-algebras among others. From results obtained it becomes clear that by considering these variants in the presence of yet other axioms it is to be expected that a quite rich and varied set of results may be obtained both in the general and the particular setting of which what has been accomplished in this paper is a substantial sample.

Sustainability is directly linked to firms’ survival in competitive markets. To survive, firms need extra capital, and seasoned equity offerings (SEOs) are one sustainability strategy. Additional resources from SEOs leads to changes in firms’ operational structure, which brings future sustainability. This study investigates whether there is sustainability in firms’ operational structure and the effects of sustainable development on operational performance and market reaction. We measure the operational structure change of firms as three proxies: 1) the rate of increase in the number of operating segments, 2) the Berry–Herfindahl index using the ratio of sales of each operating segment out of total sales, and 3) the size of net investment in plant and equipment. Our results show that operational structure change has a statistically significant and positive correlation with long-term operating performance. In addition, there is no significant stock price response at first, but the operating performance in the next term is perceived as a favorable factor after 3 years. The results show that there are different responses in the stock market toward operational structure change. The empirical results confirm that firms with SEO have sustainable development in operational structure and that markets recognize firms’ sustainability strategy arising from SEOs.

Objectives: The aim of the present study was to evaluate the association between psoriasis and osteoporosis using two different studies. Methods: Data from the Korean National Health Insurance Service-Health Screening Cohort of participants who were ≥ 40 years old were collected from 2002 to 2013. Psoriasis and osteoporosis were included using ICD-10 codes. In study I (a follow-up study), a total of 25,306 psoriasis participants were matched to 101,224 controls with respect to age group, sex, income group, and region of residence, and the occurrence of osteoporosis was analyzed. Crude (simple) and adjusted hazard ratios (HRs) were analyzed using a stratified Cox proportional hazard model. In study II (a nested case–control study), a total of 79,212 osteoporosis patients were matched to 79,212 controls, and a previous history of psoriasis was analyzed. Crude and adjusted odds ratios (ORs) were analyzed using a conditional logistic regression analysis. Subgroup analyses were conducted according to age group and sex. Results: The adjusted HR of osteoporosis was 1.11 (95% confidence interval [CI] = 1.07-1.15, P < 0.001) in study I. In the subgroup analysis according to age and sex, the results were consistent except for the ≥ 60-year-old women. The adjusted OR of psoriasis was 1.22 (95% CI = 1.16-1.28, P < 0.001) in study II. All subgroups demonstrated high adjusted ORs of osteoporosis for psoriasis. Conclusions: Psoriasis increased the risk of osteoporosis in the population of participants aged ≥ 40 years in Korea.

Background and Objectives: Angioembolization has emerged as an effective therapeutic approach for pelvic hemorrhages; however, its exact effect size remains uncertain. Therefore, we conducted this systematic review and meta-analysis to investigate the effect size of embolization-related pelvic complications after nonselective angioembolization compared to that after selective angioembolization in patients with pelvic injury accompanying hemorrhage. Materials and Methods Relevant articles were collected by searching the PubMed, EMBASE, and Cochrane databases until June 24, 2023. Meta-analyses were conducted using odds ratios (ORs) for binary outcomes. Quality assessment was conducted using the risk of bias tool in non-randomized studies of interventions. Results: Five studies examining 357 patients were included in the meta-analysis. Embolization-related pelvic complications did not significantly differ between patients with nonselective and selective angioembolization (OR 1.581, 95% confidence interval [CI] 0.592 to 4.225, I2 = 0%). However, in-hospital mortality was more likely to be higher in the nonselective group (OR 2.232, 95% CI 1.014 to 4.913, I2 = 0%) than in the selective group. In the quality assessment, two studies were found to have a moderate risk of bias, whereas two studies exhibited a serious risk of bias. Conclusions: Despite the favorable outcomes observed with nonselective angioembolization concerning embolization-related pelvic complications, determining the exact effect sizes was limited owing to the significant risk of bias and heterogeneity. Nonetheless, the low incidence of ischemic pelvic complications appears to be a promising result.

This study compared condylar volume, length, and articular eminence (AE) characteristics in normal individuals and those with unilateral and bilateral juvenile idiopathic osteoarthritis (JOA). The 116 patients were divided into four groups: control (n=16), affected condyle of unilateral JOA (Aff-Uni) (n=36), non-affected condyle of JOA (NonAff-uni) (n=36), and bilateral JOA (Bi-JOA) (n=28). Volume and length differences in the condyle and AE were analyzed using ANOVA and Bonferroni post hoc tests. The results showed that Bi-JOA had significantly different condylar volume, especially in the condylar head (p&lt;0.01), specifically the middle, anterior, and medial parts (p&lt;0.05). Condylar length also differed among the groups, with differences observed between the control group and the other three groups, as well as between the bilateral group and the other three groups (p&lt;0.01). AE total volume differed between the control group and Aff-Uni. In the detailed comparison, Aff-Uni and NonAff-Uni were smaller than the control group in the posterior, lateral, and medial sections (p&lt;0.05). In conclusion, depending on the involvement of unilateral or bilateral JOA, there were differences in condylar volume and AE compared to the normal control group. Therefore, prognosis should be evaluated by distinguishing between patients with unilateral and bilateral JOA.

This study aimed to evaluate the level of skill in observing teaching competency in pre-service physical education (PE) teachers and provide basic data to cultivate teaching competency. A total of 21 third-year pre-service PE teachers were selected as participants. The study derived descriptive statistics to analyze the participants’ observation skills regarding teaching competency in different class stages using evaluation results of class demonstrations by pre-service teachers. Mann–Whitney U test was conducted to verify the statistical significance of the evaluation between in-service and pre-service teachers. Compared with in-service teachers, pre-service teachers reported high agreement with intuitive teaching behaviors. However, pre-service teachers indicated low agreement with skills that required complex teaching behaviors depending on various situations. Based on theories by Schon (1983), pre-service teachers showed high “knowledge for practice” and low “knowledge in practice.” Thus, pre-service education must balance practical knowledge and theory rather than focus on theory-based education. This study provided directions for pre-service teacher education to enhance the competency of pre-service teachers for leading and analyzing classes.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Hepatitis B virus (HBV) infection is a major factor in development of various liver diseases such as hepatocellular carcinoma (HCC). Among HBV encoded proteins, HBV X protein (HBx) is known to play key role in development of HCC. Hepatocyte nuclear factor 4α (HNF4α) is a nuclear transcription factor which is critical for hepatocyte differentiation. However, the expression level as well as its regulatory mechanism in HBV infection have yet to be clarified. Here, we observed the suppression of HNF4α in cells which stably express HBV whole genome or HBx protein alone, while transient transfection of HBV replicon or HBx plasmid had no effect on the HNF4α level. Importantly, in the stable HBV- or HBx-expressing hepatocytes, the downregulated level of HNF4α was restored by inhibiting ERK signaling pathway. Our data showed that HNF4α was suppressed during long-term HBV infection in cultured HepG2-NTCP cells as well as in mouse model following hydrodynamic injection of pAAV-HBV or in mice intravenously infected with rAAV-HBV. Importantly, HNF4α downregulation increased cell proliferation which contributed to the formation and development of tumor in xenograft nude mice. The data presented here provided several proofs for the effect of HBV infection in manipulating HNF4α regulatory pathway in HCC development.