Gastric cancer is the 5th most common disease in the world and the 4th most common cause of death. It is diagnosed through esophagogastroduodenoscopy with biopsy, however there are limitations in finding lesions in the early stages. Recently, research has been actively conducted to use liquid biopsy to diagnose various cancers, including gastric cancer. Various substances derived from cancer are reflected in the blood. By analyzing these substances, it was expected that not only the presence or absence of cancer but also the type of cancer can be diagnosed. However, the amount of these substances is extremely small, and even these have various variables depending on the characteristics of the individual or the characteristics of the cancer. To overcome these, we collected methylated DNA fragments using MeDIP and compared them with normal plasma to characterize gastric cancer tissue or patient’s plasma. And we attempted to diagnose gastric cancer using the characteristics of cancer reflected in the blood through the cancer tissue and patient’s plasma. As a result, we confirmed that the consistency of common methylated fragments between tissue and plasma was approximately 41.2%, and found the possibility of diagnosing and characterizing cancer using the characteristics of the fragments through SFR and 5'end-motif analysis.

In recent years, the internet of things has been widely utilized in various fields, such as in smart factories or connected cars. As its domain of application has expanded, it has begun to be employed using multi-server architectures for a more efficient use of resources. However, because users wishing to receive IoT services connect to multi-servers over wireless networks, this can expose systems to various attacks and result in serious security risks. To protect systems (and users) from potential security vulnerabilities, a secure authentication technology is necessary. In this paper, we propose a smart card-based authentication protocol, which performs the authentication for each entity by allowing users to go through the authentication process using a smart card transmitted from an authentication server, and to login to a server connected to the IoT. Furthermore, the security of our proposed authentication protocol is verified by simulating a formal verification scenario using AVISPA, a security protocol-verification tool.

In this study, we analyzed the microbial community of traditional fermented foods in Jeju Island to identify the distribution of useful microorganisms and confirm their anti-inflammatory and anti-melanogenic effects to determine their potential use as cosmetic ingredients. Firstly, we examined the microbial communities of Omphalius rusticus Jeotgal (OR), Spratelloides gracilis Jeotgal (SG), Chromis notata Jeotgal (CN), Turbo cornutus Jeotgal (TC), Trichiurus lepturus intestine Jeotgal (TL), Branchiostegus japonicus Sweet Rice Punch (BJ), Salted Anchovy Sauce (SA), Jeju Soy Sauce (JSS), and Jeju Soybean Paste (JSP). We found that Latilactobacillus sakei (87.2%), Tetragenococcus halophilus (37.7%), T. halophilus (96.8%), Bacillus subtilis (23.4%), T. halophilus (71.3%), L. sakei (53.7%), Lentibacillus sp. (42.9%), Enterococcus durans (14.6%), and E. durans (32.8%) were the dominant species. Secondly, to study the nine Jeju fermented foods’ anti-inflammatory and anti-melanogenic effects, we employed RAW 264.7 and B16F10 cells, classic cell models for inflammation and melanogenesis studies. Ethyl acetate extracts of the nine Jeju fermented foods all inhibited nitric oxide (NO) and melanin production in a concentration-dependent manner. Thirdly, to test the applicability of the nine Jeju fermented foods to human skin, we used the MTT assay to assess their cytotoxic effects on human keratinocytes (HaCaT cells). Finally, the topical applicability of the nine Jeju fermented foods was tested through primary skin irritation, and it was found that they did not cause any adverse effects. Therefore, extracts from the nine Jeju fermented foods have potential applications as ingredients in anti-inflammatory and anti-melanogenic products and can be used in the cosmetic industry.

In order to reduce the large damage caused by train derailment, protective facilities of various shapes and conditions can be installed on railroad tracks. These protective facilities are referred to as derailment containment provisions (DCPs) and three different types are used worldwide. However, there are no clear standards for DCPs design such as installation location, size, and design load, and performance verification of DCPs installed in the actual railway field is not sufficiently performed. In this paper, the functionality of DCPs is analyzed through the full-scale derailment test. In order to propose a method for estimating the collision load acting on the DCP type I after derailment, the experimental results and simulation results are compared. The function of DCP type I according to the change of the vehicle's center of gravity is identified through comparative analysis of the post derailment behavior.

This study investigates the synergistic impact of fermenting kale juice with Limosilactobacillus strains on its antioxidant and anti-inflammatory properties. Kale's rich nutrient profile, especially its flavonoids, offers potential health benefits. Probiotic lactic acid bacteria are employed in kale fermentation to enhance nutrient bioavailability and generate bioactive compounds. Kale juices fermented with L. reuteri EFEL6901 or L. fermentum EFEL6800 exhibited superior microbial growth. Free sugars and amino acids were converted to alcohols and organic acids, affecting the organoleptic and health-related properties of product. In addition, fermentation increased quercetin and kaempferol content, indicating improved availability. Furthermore, the fermented juice exhibited notable antioxidant activity and suppressed NO production, revealing anti-inflammatory potential. Gene expression analysis confirmed reduced pro-inflammatory markers and elevated anti-inflammatory cytokines. This research highlights the promising potential of fermented kale juice, enriched with Limosilactobacillus strains, as a functional food with combined antioxidant and anti-inflammatory benefits.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Lectins, characterized by their carbohydrate-binding ability, have an extensive practical application. However, their industrial use is limited by low yields, and few active recombinant lectins have been reported. In this study, the algal lectin BPL-3 (Bryopsis plumosa lectin 3) was successfully produced using a bacterial expression system, BL21(DE3), with an artificial repeated structure (dimeric construct). Recombinant dimeric BPL3 (rD2BPL3) was confirmed by LC-MS/MS spectrometry. Expression efficiency was greater for the construct with the repeat structure (rD2BPL3) than the monomeric form (rD1BPL3). Optimal conditions for expression were 1 mM IPTG at 20 °C. Recombinant lectin was purified under denaturing conditions and refolded by the flash dilution method. Recombinant BPL3 was solubilized in 1× PBS containing 2 M urea. rD2BPL3 showed strong hemagglutination activity using human erythrocytes, similar to that of native BPL3. rD2BPL3 had a similar sugar specificity to that of the native protein, i.e., to N-acetyl-glucosamine (GlcNAc) and N-acetyl-galactosamine (GalNAc). Glycan array results showed that recombinant BPL3 and native BPL3 exhibited different binding properties. Both showed weak binding activity to α-Man-Sp. Native BPL3 showed strong binding specificity to the alpha conformation of amino sugars, and rD2BPL3 had binding activity to the beta conformation. The process developed in this study was suitable for the quality-controlled production of high amounts of soluble recombinant lectins.

The purpose of this paper is to find the time optimal control to a target set for semilinear stochastic functional differential equations involving time delays or memories under general conditions on a target set and nonlinear terms even though the equations contain unbounded principal operators. Our research approach is construct a fundamental solution for corresponding linear systems and establish variations of constant formula of solutions for given stochastic equations. The existence result of time optimal controls for one point target set governed by the given semilinear stochastic equation is also established.

The runtime environment is an important concern for self-adaptive systems (SASs). Although researchers have proposed many approaches for developing SASs that address the issue of uncertain runtime environments, the understanding of these environments varies depending on the objectives, perspectives, and assumptions of the research. Thus, the current understanding of the environment in SAS development is ambiguous and abstract. To make this understanding more concrete, we describe the landscape in this area through a systematic literature review (SLR). We examined 128 primary studies and 14 unique environment models. We investigated concepts of the environment depicted in the primary studies and the proposed environment models based on their ability to aid in understanding. This illustrates the characteristics of the SAS environment, the associated emerging environmental uncertainties, and what is expressed in the existing environment models. This paper makes explicit the implicit understanding about the environment made by the SAS research community and organizes and visualizes them.

The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

We fabricated the nano-aperture plasmonic platforms for single molecule detection and other various applications such as infrared thermal emission device. The nano-apertures including the nanopores on the pyramid, and the nano-slits on the Au flat membrane were fabricated using a Ga ion focused ion beam drilling technique, followed by high energy electron beam irradiations dependent upon the electron beam current density. The nanopores with a few nanometer size and the nanoslit array with order of ~ 100 nm width were fabricated. Optical characteristics for the various nanoslits were examined dependent upon the slit opening width and sample thickness. The broad emission spectra from the (7x 7) slit array are obtained from spp-mediated emission in the visible and infrared region. A sharp strong infrared emission peak is also obtained due to Au nanoparticle. The fabricated Au platform can be utilized as single molecule sensor and infrared thermal emission device.

Febuxostat (FBX), a selective xanthine oxidase inhibitor, belongs to BCS class II showing low solubility and high permeability with a moderate F value (&lt; 49%). Recently, FBX/L-pyroglutamic acid cocrystal (FBX-PG) was developed with improving 4-fold increase of the FBX solubility. Nevertheless, in vivo pharmacokinetic property of FBX-PG has not been evaluated yet. Therefore, the pharmacokinetic feasibility of FBX in FBX and FBX-PG-treated rats and mice was compared in this study. The results showed that the F values of FBX were 210% and 159% in FBX-PG rats and mice, respectively. The 2.10-fold greater AUC of FBX was due to the increased absorption (i.e., 2.60-fold higher Cmax,1 at 15 min) and entero-hepatic circulation of FBX (i.e., 1.68-fold higher Cmax,2 at 600 min) in FBX-PG rats compared to the FBX rats. The 1.59-fold greater AUC of FBX was due to a 1.65-fold higher Cmax,1 at 5 min, and 1.15-fold higher Cmax,2 at 720 min of FBX in FBX-PG mice than those in FBX mice. FBX was highly distributed in the liver, stomach, small intestine, and lungs in both groups of mice, and the FBX distributions to the liver and lungs were increased in FBX-PG mice compared to FBX mice. The results suggest the FBX-PG has a suitable pharmacokinetic profile of FBX for improving its oral F value.

A millimeter-wave (mmWave) gallium nitride (GaN) high-power amplifier (PA) monolithic microwave-integrated circuit (MMIC) was implemented, considering a source via effect. In this paper, we introduce guidelines for designing GaN high PA MMICs, from device sizing to meeting high-power specifications, power matching considering source via effects, schematic design of three-stage amplifier structures, and electromagnetic (EM) simulation. Based on the results of load pull simulation and small-signal maximum stable gain (MSG) simulation, the GaN high electron-mobility transistor (HEMT) size was selected to be 8×70 μm. However, since the source via model provided by the foundry was significantly different from the EM results, it was necessary to readjust the power matching considering this. Additionally, when selecting the source via size, the larger the size, the easier the matching, but since the layout of the peripheral bias circuit is not possible, a compromise was required considering the actual layout. To prevent in-band oscillation, an RC parallel circuit was added to the input matching circuit, and low-frequency oscillation was solved by adding a gate resistor on the PCB module. The proposed PA was fabricated with a commercial 0.1 μm GaN HEMT MMIC process. It exhibited 38.56 to 39.71 dBm output power (Pout), 14.2 to 16.7 dB linear gain, and 14.1% to 18.2% power-added efficiency (PAE) between 34 and 36 GHz. The fabricated GaN power amplifier MMIC shows competitive Pout in the Ka upper band above 33 GHz

Hispidulin is a natural bioactive flavonoid that has been studied for its potential therapeutic properties, including its anti-inflammatory, antioxidant, and neuroprotective effects. The aim of this study was to explore whether hispidulin could inhibit endothelial inflammation triggered by Porphyromonas gingivalis (P. gingivalis) lipopolysaccharide (LPS). The adhesion of monocytes to vascular endothelium was evaluated by in vitro and ex vivo monocyte adhesion assays. We analyze the migration of monocytes across the endothelial layer using transmigration assay. The result showed that treatment with hispidulin decreased P. gingivalis LPS-induced the adhesion of monocytes to endothelial cells and their migration by suppressing P. gingivalis LPS-triggered expression of intercellular adhesion molecule-1 (ICAM-1) through downregulating nuclear factor-қB (NF-қB). In addition, hispidulin inhibited P. gingivalis LPS-induced mitogen-activated protein kinases (MAPKs) and AKT in endothelial cells. Altogether, the results indicate that hispidulin suppresses vascular inflammation induced by P. gingivalis LPS. Mechanistically, it prevents the adhesion of monocytes to the vascular endothelium and migration and inhibits NF-қB, MAPKs, and AKT signaling in endothelial cells.

Alzheimer’s disease (AD) is a chronic neurodegenerative disease, and typical pathologic findings include abnormally hyperphosphorylated tau aggregation and neurofibrillary tangles. Insulin resistance and hyperglycemia have been assessed as risk factors for AD development. As the maintenance of optimal blood glucose levels is an important indicator of diabetes mellitus (DM) treatment, diet control is essential. AMPK is a crucial sensor of cellular bioenergetics for controlling anabolic and catabolic metabolism. Diet restriction to achieve euglycemia can increase AMPK activity in the liver and heart. Since AMPK is a direct regulator of tau phosphorylation, we hypothesized that strict diet control to achieve euglycemia affects tau protein phosphorylation through increased AMPK activity in the hippocampus of DM rats. To confirm this hypothesis, we generated insulin-deficient DM rats by subtotal pancreatectomy. Animals were categorized into the restriction (R) group, control (C) group and ad libitum (AL) group according to the diet. We found that tau phosphorylation was significantly increased in the R group compared with the C or AL group. AMPK activity in the R group significantly increased compared to that of the C group or AL group, as expected. Furthermore, the R group showed more critical tau pathology in the hippocampus than the other groups. These results suggest that diet control to achieve euglycemia in insulin-deficient DM conditions is harmful because of the increased possibility of AD development through increased tau phosphorylation by AMPK activation in the hippocampus. We propose that not only hyperglycemia but also euglycemia, which is beneficial in DM patients, must be considered a potential risk factor for AD development, especially when euglycemia is achieved by diet control during insulin deficiency.

Suppressing the charge recombination at the interface of photoanode/electrolyte is the crucial way to enhance the photovoltaic performance of quantum dot sensitized solar cells (QDSSCs). In this scenario, ZnS/SiO2 blocking layer was deposited on TiO2/CuInS2 QDs to inhibit the charge recombination at photoanode/electrolyte interface. As a result, the TiO2/CuInS2/ZnS/SiO2 based QDSSCs delivers a power conversion efficiency (η) value of 4.63%, which is significantly higher than the 2.15% and 3.23% observed for QDSSCs with a TiO2/CuInS2 device and TiO2/CuInS2/ZnS, respectively. Electrochemical impedance spectroscopy and open circuit voltage decay analyses indicate that ZnS/SiO2 passivation layer on TiO2/CuInS2 suppress the charge recombination at the photoanode/electrolyte interface and prolongs the electron lifetime.

To determine the mode of action of the effects of phytoalexins in soybeans, we analyzed enzyme inhibition kinetics using Michaelis–Menten plots and the Lineweaver–Burk plots. The results showed that glyceollin showed competitive inhibition, genistein showed noncompetitive, daidzein was uncompetitive, and luteolin showed a mixed mode of action. The Ki values were determined using a Dixon plot as: glyceollin, 18.99; genistein, 15.42; luteolin, 16.81; and daidzein, 9.99 μM, respectively. Furthermore, potential synergistic effects between glyceollin and the three designated polyphenols were investigated. A combination of glyceollin and luteolin (the ratio of 3:7 of glyceollin and luteolin) had synergistic effects on α-glucosidase inhibition according to combination index (CI)-isobologram equation. Collectively, these results showed that a combination of glyceollin and luteolin has the potential to inhibit α-glucosidase activity via a synergistic mode of action.

Diabetes mellitus is associated with cardiovascular, ophthalmic, and renal comorbidities. Among these, diabetic cardiomyopathy (DCM) causes the most severe symptoms and is considered to be a major health problem worldwide. Exercise is widely known as an effective strategy for the prevention and treatment of many chronic diseases. Importantly, the onset of complications arising from diabetes can be delayed or even prevented by exercise. Regular exercise is reported to have positive effects on diabetes mellitus and the development of DCM. The protective effects of exercise include the prevention of cardiac apoptosis, fibrosis, oxidative stress, and microvascular diseases, as well as improvement in cardiac mitochondrial function, and calcium regulation. The present review summarizes the recent findings to describe the potential mechanisms by which exercise may prevent DCM and heart failure.

The effects of simulated acid rain (SAR) on the photosynthetic performance of subtropical coniferous species have not been thoroughly investigated. In this study, we treated two coniferous species, Pinus massoniana (PM) and Cunninghamia lanceolata (CL), with SAR and then analyzed photosynthetic activities via the simultaneous measurement of prompt fluorescence(PF), delayed fluorescence(DF), and modulated reflection at 820 nm(MR820). Following the low-pH SAR treatment, the I–P phase of the OJIP curves of PM and CL decreased significantly and then the K-band and L-band were detectable. The delayed fluorescence for both PM and CL decreased as the pH of the SAR solution decreased, with a more significant decrease in the I1 peak than in the I2 peak. According to the MR820 curve, the exposure to SAR stress inhibited the rapid decrease and slow increase in the MR820 transients of PM and CL. The gradients of the decreasing and increasing phases were lower for CL than for PM at pH 2.5. In addition, SAR decreased the light energy captured per unit area (ABS/CSm) and the quantum yield of electron transfer per unit area (ETO/CSm), but it increased the accumulation of QA−, thereby decreasing primary photochemical efficiency (TRO/CSm, φPO). These changes in photosystem II (PSII) resulted in a decrease in the maximum quantum yield of PSII (Fv/Fm) and the performance index (PIABS). Moreover, PSII was protected from thylakoid membrane photodamages through the increase in heat dissipation per unit area (DIO/CSm) in response to SAR. The increase in δRO as the pH of the SAR solution decreased was observed for PM, but not for CL. Considered together, the study findings suggest that SAR treatments can decrease chlorophyll contents and damage the OEC in PM and CL, which obstructs the transfer of electrons on the donor and acceptor sides of PSII. However, PM is better able to withstand SAR stress than CL, likely because of the activation of a protective mechanism (reflected by the change in δRO). Therefore, in coniferous forest areas severely affected by acid rain, CL may need to be protected more than PM.

The loss of vitamin D3 upregulated protein 1 (VDUP1) has been implicated in the pathogenesis of various inflammation-related diseases. Notably, reduced expression of VDUP1 has been observed in clinical specimens of ulcerative colitis (UC). However, the role of VDUP1 deficiency in colitis remains unclear. In this study, we investigated the role of VDUP1 in dextran sulfate sodium (DSS)-induced experimental colitis in mice. VDUP1-deficient mice were more susceptible to DSS-induced colitis than their wild-type (WT) littermates after 2% DSS administration. VDUP1-deficient mice exhibited an increased disease activity index (DAI) and histological scores, as well as significant colonic goblet cell loss and an increase in apoptotic cells. These changes were accompanied by a significant decrease in MUC2 mRNA expression and a marked increase in proinflammatory cytokines and chemokines within damaged tissues. Furthermore, phosphorylated NF-B p65 expression was significantly upregulated in damaged tissues in the context of VDUP1 deficiency. VDUP1 deficiency also led to significant infiltration of macrophages into the site of ulceration. An in vitro chemotaxis assay confirmed that VDUP1 deficiency enhanced bone marrow-derived macrophage (BMDM) chemotaxis induced by CCL2. Overall, the loss of VDUP1 plays a critical role in the pathogenesis of UC, and blocking VDUP1 dissociation may represent a promising therapeutic strategy for the treatment of UC.

An understanding of the mechanism underlying fruit ripening is critical for fruit quality improvement. Although post-harvest ethylene application is known to enhance the onset of fruit ripening, exact mechanisms remain unclear. To characterize the fruit ripening process and mechanism, we investigated the effects of exposing kiwifruit cultivars ‘Hayward’ and ‘Gamrok’ to exogenous ethylene treatment post-harvest using comprehensive proteomic analyses. Comparative two-dimensional gel electrophoresis showed that most of the proteins aggregated in ethylene-treated samples compared to the control (non-treated). We observed that among all ethylene treatments, 95 proteins from ‘Hayward’ and 106 from ‘Gamrok’ were differentially expressed. Interestingly, among the elicited protein successfully identified by matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry, 50% from “Hayward’ and 60% from ‘Gamrok’ are associated with fruit ripening. Furthermore, 18% and 10% of proteins, respectively, are associated with defense response, whereas other major proteins are related to protein biosynthesis and photosynthesis/Calvin cycle. Interactions between identified proteins were demonstrated by bioinformatic analysis, providing insights into biological pathways and molecular functions in post-harvest kiwifruit ripening elicited by ethylene application. The present proteomic study in accordance with physiological analysis provides a quantitative evaluation of fruit ripening in response to exogenous ethylene in post-harvest kiwifruit.

In this research, we developed a wearable temperature-sensing element by dip dyeing threads in poly (3, 4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS) (p-type conducting polymer) solution. The PEDOT:PSS was used to dye the textile and it exhibited negative temperature coefficient characteristics in which the resistance decreases as the temperature increases. The fabricated temperature-detection thread achieved a sensitivity of 167.1 W/°C with 99.8% linearity in the temperature range of -50 to 80 °C. We anticipate that temperature sensors that apply our technology will be made as stitch- or textile-type for wearable devices, and they will be widely adopted for different applications such as in fitness, leisure, healthcare, medical treatment, infotainment, industry, and military applications, among others.

A recent systematic review for 19 selected articles after searching through to 30 September 2017 showed vitamin D deficiency was associated with ischemic stroke (IS), not hemorrhagic stroke (HS). But a heterogeneity would be introduced with comparing the lowest and highest category of vitamin D. The aim of this article was to conduct an updated meta-analysis (UMA) with searching through to 31 March 2019. An interval collapsing method as information extraction was applied in order to decrease a heterogeneity among studies. Additional articles were selected from cited lists from 19 selected articles using citation discovery tools. Random effect model was applied if I-squared value was over 50%. A funnel plot and Egger’s test were used to detect a publication bias. After 5 new studies were added, the summary RRs [and their 95% confidence intervals] (I-squared value) were 1.52 [1.33–1.74] (0.0%) in IS, and 2.44 [1.34–4.46] (69.7%) in HS. This UMA supported the hypothesis that serum vitamin D deficiency was associated with an increased risk of HS as well as IS. Diverse public health programs against vitamin D deficiency status would be needed for higher risk group, especially elderly people.

Placenta-derived mesenchymal stem cells (PD-MSCs) have been highlighted as therapeutic sources in several degenerative diseases. Recently, microRNAs (miRNAs) were mediated one of the therapeutic mechanisms of PD-MSCs in regenerative medicine. To enhance the therapeutic effects of PD-MSCs, we established functionally enhanced PD-MSCs with phosphatase of regenerating liver-1 overexpression (PRL-1(+)). However, the profile and functions of miRNAs induced by PRL-1(+) PD-MSCs in a rat model with hepatic failure prepared by bile duct ligation (BDL) remained unclear. Hence, the objectives of the present study were to analyze the expression of miRNAs and investigate their therapeutic mechanisms for hepatic regeneration via PRL-1(+) in a rat model with BDL. We selected candidate miRNAs based on microarray analysis. Under hypoxic conditions, compared with invaded naïve PD-MSCs, invaded PRL-1(+) PD-MSCs showed improved integrin-dependent migration ability through RHO family-targeted miRNA expression (e.g., hsa-miR-30a-5p, 340-5p, and 146a-3p). Moreover, rno-miR-30a-5p and 340-5p regulated engraftment into injured rat liver by transplanted PRL-1(+) PD-MSCs through the integrin family. Additionally, an increase in PDGFRA by suppressing rno-miR-27a-3p improved vascular structure in rat liver tissues after PRL-1(+) PD-MSCs transplantation. Furthermore, decreased rno-miR-122-5p was significantly correlated with increased proliferation of hepatocytes in liver tissues by PRL-1(+) PD-MSCs by activating IL-6 signaling pathway through the repression of rno-miR-21-5p. Taken together, these findings improve the understanding of therapeutic mechanisms based on miRNA-mediated stem cell therapy in liver diseases.

In this study, to reduce the use of cement and sand, porous feldspar with excellent economic efficiency was used as a substitute in heat storage concrete layer. When cement was replaced with porous feldspar, the compressive strength was approximately 16%–63% higher compared with when cement was replaced with silicate minerals. To compensate for the reduction in strength owing to the decreased cement content, mechanical and chemical activation methods were employed. When the specific surface area of porous feldspar was increased, the unit weight was reduced by approximately 30% and the compressive strength was increased by up to 90%. When chemical activation was applied using a solidifying agent, the strength was increased by approximately 30% even though 70% of the cement content was replaced with porous feldspar. When cement and sand were replaced with porous feldspar, the compressive strength was approximately two times that of ordinary cement mortar. When the heat storage concrete layer material was replaced with porous feldspar in a pilot scale experiment, the thermal conductivity and heat storage characteristics were better than those of ordinary cement mortar, and an energy-saving effect of approximately 57% was observed, confirming the excellent applicability of porous feldspar as a building material.

In an effort to enhance the efficiency and safety of open-pit mines, this study explores the optimization of end slope road parameters and slope structures, specifically focusing on unmanned driving lanes.A significant aspect of the study is the development of a truck trajectory offset model, which considers the different reaction times between automated sensors and human drivers in adapting to environmental changes. To test these concepts, the study uses numerical simulations to confirm the stability of the proposed end slope designs. Using Victory West Mine No. 1 as a case study, the research determines the optimized width for unmanned driving lanes and the maximum angle for safe steepening of end slopes. The findings indicate that the optimized unmanned lane width for NTE240 mining dump trucks is 1743 mm, allowing for a 2-degree increase in the slope angle at the south end slope. This optimization leads to a steep mining stripping volume of 3.2735 million m³ and a coal output of 2.49628 million tons, maintaining a stripping ratio of 1.31m³/t. These results demonstrate that the unmanned driving road width optimization not only ensures slope safety but also significantly boosts the economic benefits of steep mining in open-pit mines.

As lung cancer shows the highest mortality in cancer related death, serum biomarkers are demanded for the lung cancer diagnosis and its treatment. To discover lung cancer protein biomarkers, secreted proteins from primary cultured lung cancer and adjacent normal tissues from patients were subjected to LC/MS-MS proteomic analysis. Quescin sulfhydryl oxidase(QSOX1) was selected as a biomarker candidate from the proteins enriched in the secretion of lung cancer cells. QSOX1levels were higher in 82% (51 of 62 tissues) of lung cancer tissues compared to adjacent normal tissues. Importantly, QSOX1 serum levels were significantly higher in cancer patients (p<0.05, AUC=0.89), when measured by multiple reaction monitoring(MRM). Higher levels of QSOX1 are also uniquely detected in lung cancer tissues among several other solid cancers by immunohistochemistry. QSOX1 knock-downed Lewis lung cancer (LLC) cells was less viable from oxidative stress and had reduced migration and invasion. In addition, LLC mouse models with QSOX1 knock-down also proved that QSOX1 functions in promoting cancer metastasis. In conclusion, QSOX1 might be a lung cancer tissue-derived biomarker and involved in the promotion of lung cancers, and thus can be a therapeutic target for lung cancers.

The deterioration of soil-cement in corrosive environment leads to the reduction of strength and the increase of permeability. Effective methods of determining deteriorated layer permeability coefficient of soil-cement are currently lacking. A laboratory test method for permeability coefficient of deteriorated layer was proposed using the modified permeability coefficient testing apparatus. According to the proposed method, the permeability coefficient of deteriorated layer can be obtained after testing the permeability coefficient of the soil-cement specimen in curing room and the equivalent permeability coefficient and deterioration depth of the soil-cement specimen in corrosion environment. Taking the marine dredger fill of Jiaozhou Bay for example, the deteriorated layer permeability coefficients of soil-cements with different cement contents were tested. It turned out that the permeability of deteriorated layer increases with the increase of age. At the beginning of curing age, larger cement content leads to smaller permeability coefficient of the deteriorated layer of soil-cement. As the curing age increases, the deteriorated layer permeability coefficient of the soil-cement with larger cement content becomes larger. The evolution of the permeability coefficient of deteriorated layer with age can be formulated as the Logistic function. This study provides a support for anti-permeability designs of soil-cement structures in corrosive environment.

Background: Inflammasomes recognize cytosolic danger signals, including pathogens, and subsequently induce the secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β. Studying inflammasomes in the red fox (Vulpes vulpes) is crucial from a wildlife veterinary and public health perspective, as it can be used to help control and prevent the transmission of zoonotic pathogens. The understanding of how diversity in inflammasomes across species affects pathogen carriage in the red fox is still limited. Methods: We investigated the activation and intracellular mechanisms of three inflammasomes (NLRP3, AIM2, and NLRC4) in fox peripheral blood mononuclear cells (PBMCs), using established triggers and inhibitors derived from humans and mice. Results: Fox PBMCs exhibited normal activation and induction of IL-1β secretion in response to representative inflammasome triggers (ATP and nigericin for NLRP3, dsDNA for AIM2, flagellin for NLRC4). However, in inhibitor studies, MCC950, a selective NLRP3 inhibitor, suppressed IL-1β secretion mediated by the fox AIM2 and NLRC4 inflammasomes. Conclusions: These findings suggest that NLRP3 may have a common role in dsDNA- and flagellin-mediated inflammasome activation in the red fox. In conclusion, this fox inflammasome biology can be applied to the control of zoonotic infections and the treatment of inflammasome-mediated diseases in the red fox.

Stereotactic radiosurgery (SRS) is considered the initial treatment for lung cancer patients with small-sized and limited number of brain metastases. The objective of this study was to assess clinical outcomes of SRS treatment using CyberKnife (CK) for recursive partitioning analysis (RPA) class II/III patients with one to three brain metastases from lung cancer and identify which patients in the high RPA class could benefit from SRS. A total of 48 lung cancer patients who received CK-based SRS for their metastatic brain lesions from 2010 to 2017 were retrospectively analyzed. Radiographic response was evaluated during follow-up period. Overall survival (OS) and intracranial progression-free survival (IPFS) were calculated and prognostic variables associated with OS and IPFS were evaluated. Median follow-up time was 6.6 months. Local control rates at 6 months and 1-year following SRS were 98% and 92%, respectively. The median OS of all patients was 8 months. One-year and 2-year OS rates were 40.8% and 20.9%, respectively. In multivariate analysis, uncontrolled primary disease (p = 0.008) and ECOG performance status of 2 or 3 (p = 0.001) were independent prognostic factors for inferior OS. These two factors were also significantly associated with inferior IPFS. In subgroup analysis according to RPA class, primary disease status was the only prognostic factor, showing statistically significant OS differences in both RPA class II and III (controlled vs. uncontrolled: 41.1 vs. 12.3 months in RPA class II, p = 0.031; 26.9 vs. 4.1 months in RPA class III, p = 0.011). Our results indicated that SRS could be an effective treatment option for RPA class II/III patients with brain metastases from lung cancer in the modern treatment era. SRS might be particularly considered for patients with controlled primary disease.

In this paper, we investigate the structural, microstructural, dielectric, and energy storage properties of Nd and Mn co-doped Ba0.7Sr0.3TiO3 [(Ba0.7Sr0.3)1-xNdxTi1-yMnyO3 (BSNTM) ceramics (x = 0, 0.005, and y = 0, 0.0025, 0.005, and 0.01)] via a defect dipole engineering method. The complex defect dipoles (MnTi"-VO∙∙)∙ and (MnTi"-VO∙∙) between acceptor ions and oxygen vacancies capture electrons, enhancing the breakdown electric field and energy storage performances. XRD, Raman spectroscopy, and microscopic investigations of BSNTM ceramics revealed the formation of a tetragonal phase, increased oxygen vacancies, and reduced grain size with Mn dopant, respectively. The BSNTM ceramics with x=0.005 and y=0 exhibit a high dielectric constant of 2058 and a dielectric loss of 0.026 at 1 kHz. These values gradually decreased to 1876 and 0.019 for x=0.005 and y=0.01 due to the Mn2+ ions at Ti4+-site, which facilitates the formation of oxygen vacancies, and prevents the decrease of Ti4+. In addition, the defect dipoles act as a driving force for depolarization to tailor the domain formation energy and domain wall energy, which provides a high difference between the maximum polarization of Pmax and remnant polarization of Pr (ΔP=10.39 µC/cm2). Moreover, the complex defect dipoles with optimum oxygen vacancies in BSNTM ceramics can provide not only a high ΔP but also reduce grain size, which together improve the breakdown strength from 60.4 to 110.6 kV/cm, giving rise to a high energy storage density of 0.41 J/cm3 and high efficiency of 84.6% for x=0.005 and y=0.01. These findings demonstrate that defect dipoles engineering is an effective method to enhance the energy storage performance of dielectrics for capacitor applications.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Background: Health insurance (HI) run by government is providing health care service to large population. Due to poor accountability, participation and sustainability, cooperative health insurance is becoming more popular and effective in low and middle income and some high-income countries too. In Nepal, there are public and cooperative HI is in practice. The aim of this study is to compare the effectiveness of public (government) and cooperative HI in relation to benefit packages, population coverage, inclusiveness, health care utilization, and promptness for treatment in these two health insurance models in Nepal. Method: This is an institution based concurrent mixed study consists of qualitative and quantitative variables from public and cooperative groups. We included all public HI operated by government hospitals and cooperatives groups those purchased hospital service in contract. Two separate study tools were applied to access the effectiveness of insurance models. The key questions were asked for the representatives of government and private health insurance. The numeric information consisted of in quantitative data and subjective response was included in qualitative approach. Descriptive statistics and Mean Whitney U test was applied in numeric data and qualitative information were analyzed by inductive approach Results: The study revealed that new enrolment was not increased, health care utilization rate was increased and the benefit package was almost same in both groups. The overall inclusiveness was higher for the government HI, but enrolment from the religious minority, proportion of negotiated amount during treatment were significantly higher (p<0.05). During illness, the response time to reach hospital was significantly faster in cooperative health insurance than government health insurance. Qualitative findings showed that level of participation, accountability, transparency and recording system was better in cooperative health insurance than public. Conclusion: Cooperative HI could be more sustainable and accountable to the community for all; low, middle and high-income countries.

Background: Disparity in adult mortality (AM) with reference to social dynamics and health care has not been sufficiently examined. This study aimed to identify the gap in the understanding of AM in relation to religion, political stability, economic level, and universal health coverage (UHC). Methods: A cross-national study was performed with different sources of data, using the administrative record linkage theory. We created a new data set using data from the 2013 World Bank data catalogue by region, The Economist (Political instability index 2013), Stuckler David et al. (Universal health coverage, 2010), and religious categories of all UN country members. Descriptive statistics, a t-test, an ANOVA followed by a post hoc test, and a linear regression were used where applicable. Result: The average AM rate for males and females was 0.20 ± 0.10 and 0.14 ± 0.10, respectively. AM was significantly higher in economically weak countries, countries with political instability, countries with traditional religion, without achievement of UHC, and Sub-Saharan Africa (p<0.01). There was high disparity of AM between countries with and without UHC (F = male: 61.89, female: 51.85, p<0.001) and between groups with low and high income (F = male: 36.33, female: 42.39, p<0.001). UHC and political stability would significantly reduce AMR by > 0.41 in both sexes and high economic status would reduce male AMR by 0.44, and female AMR by 0.70, in relation to countries without UHC, with political instability, and low economic status. Conclusions: Disparities in AM can be reduced after the achievement of UHC and economically productive activities for those adults affected by conflict and political unrest.

The so-called “Chinese pyramids” are huge burial mounds covering the tombs of the Emperors of the Western Han dynasty. If we include also the mounds of the members of the royal families, these monuments sum up to more than 40, scattered throughout the western and the southern outskirts of modern Xi'an. They are mostly unexcavated and poorly known although, taken together, they form a fascinating sacred landscape, which was conceived as a perennial witness of one of the most magnificent Chinese dynasties. This sacred landscape is today encroached by the frenetic urban development of the Xi’an urban area. We discuss and elaborate here some of the results of a recent, new satellite-imagery survey of these monuments, highlighting the aspects which may contribute to solutions for a sustainable and compatible development within this important ancient landscape.

Wool quality and yield are important economic traits of livestock. In this study, the skin tissues of the upper scapula of Super Merino sheep (SM) and Small-Tailed Han sheep (STH) during the growing period were studied. Differentially expressed (DE) long non-coding RNAs (lncRNAs) and messenger RNAs (mRNA) were identified via histopathological observation and high-throughput RNA sequencing. Gene ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) were used to analyze differentially expressed genes. Reverse transcription quantitative Polymerase Chain Reaction (RT-qPCR) was used to verify nine selected DE lncRNAs and five DE mRNAs. Significant differences were found in the expression levels of LOC114113396 (KRTAP15-1), CRABP1, KRT10, KRTAP1-3, KRTAP4.3, KRT2, FGF1, IGF-1, and KIT in SM and STH skin tissues. These results indicate that these mRNAs may play an important role in the growth and development of hair follicles and the regulation of hair fiber traits. Differentially expressed lncRNA target genes and mRNAs were mainly enriched in biological processes and pathways related to skin development and fiber traits, which is consistent with previous studies. LncRNA MSTRG.9225.1, MSTRG.124320.1, MSTRG.96951.1, MSTRG.91685.1, MSTRG.122229.1, MSTRG.89255.1, MSTRG.98769.1, and MSTRG.84658.1 may indirectly participate in the growth and development of sheep hair follicles and the regulation of hair fiber diameter by regulating the expression of their respective target genes. These candidate lncRNAs and mRNAs may provide a basis for the study of sheep hair follicle growth and development and hair fiber traits.

Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

Background and Objectives: Light therapy (LT) is used as an adjunctive treatment for sleep problems. This study evaluates the impact of LT on sleep quality and sleep-related parameters in patients with sleep disorders. Materials and Methods: We performed a pilot randomized, open-label clinical trial. Fourteen patients aged 20–60 years with sleep disorders for more than three months were randomized into the control and LT groups (1:1 ratio). The LT group was instructed to use a device that provides bright LT (6000 K, 380 lux, wavelength 480 nm) for at least 25 minutes before 09:00 am for two weeks. A self-reported questionnaire was used to evaluate circadian preference, mood, and sleep-related parameters. We analyzed serum cortisol levels and clock genes expression. Results: The Epworth Sleepiness Scale (ESS), insomnia severity index, and Pittsburgh Sleep Quality index were significantly improved within the LT group only after the two-week period. When comparing the two groups, only the change in ESS significant was significant (mean difference; control: -0.14 vs LT: -1.43, p=0.021) after adjusting for baseline characteristics. There were no significant differences in serum cortisol or clock genes expression. Conclusions: LT can improve daytime sleepiness in patients with sleep disorders; however, further well-designed studies are warranted to confirm its efficacy.

The aim of this paper is to compare the taxonomic composition and species diversity of the macrozoobenthos in Maritsa River (Bulgaria) and Han River (South Korea). Samples were collected at 15 selected sites in each river, including some of their main tributaries in 2020 and 2021. The number of the taxa recorded in Maritsa River was more than twice as great as in Han River: 192 taxa belonging to 19 systematic groups compared to 88 taxa belonging to 18 groups respectively. The order Ephemeroptera had the highest species richness: 31 taxa in the Bulgarian rivers and 26 taxa in the South Korean ones. The macrozoobenthic communities responded and adapted to the various conditions and impacts in the water environment with changes in the species composition and structure. The analysis of the similarity in the taxonomic composition showed low resemblance between all study sites but displayed distinct separations between the rivers and the two years. In general, the species structure of the macrozoobenthic communities in Maritsa River and its studied tributaries was better than in Han River. In both years, high species diversity was recorded at the reference sites in the rivers, characterized by conditions closely resembling natural environments. The species richness and the evenness of macrozoobenthos were very low at sites downstream subjected to considerable anthropogenic pressure. Some of the communities in Han River were almost destroyed completely.

(1) Background: Gamma-aminobutyric acid (GABA) is one of the inhibitory neurotransmitters with beneficial effects including sedative property. However, despite various clinical trials, scientific evidence regarding the impact of orally ingested GABA, whether natural or synthesized through biological pathways, on sleep is not clear.; (2) Methods: The present study work evaluated GABA-A biding affinity of GABALAGEN(GBL), a low-molecular-weight collagen infused with GABA, through receptor binding assays. The sedative effects of GBL were investigated through electroencephalography (EEG) analysis in the electro foot shock (EFS) stress-induced sleep animal model and then we examined the expression orexin, GABAA receptor in the brain region using immunohistochemistry.; (3) Results: We found that on the binding assay, GBL displayed high affinity to GABAA receptor (IC50 value, 31.5µg/mL)). Also, after treatment of GBL, percent of total time of REM and NREM were significantly and dose-dependently increased compared to the Con group. Consistent with behavioral results, the GBL-treated groups showed that the expression of GABAA receptor immune-positive cells in the VLPO were markedly and dose-dependently increased compared to the Con group. Also, the GBL-treated groups showed that the expression of orexin immune-reactive cells in the LH were significantly decreased compared to the Con group.; (4) Conclusions: In conclusion, GBL showed efficacy and potential to be used as an anti-stress therapy to treat sleep deprivation through antagonism of GABA receptors and consequent inhibition of orexin activity.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

In Korea, rice is a major staple grain and is mainly cultivated using various agricultural machinery. Air pollutants emitted from agricultural machinery have their origins mainly from the exhaustion of internal combustion engines. In this study, emission characteristics of five main air pollutants by European Environment Agency's Tier 1 method for rice cultivation was analyzed. Diesel is a main fuel for agricultural machinery and gasoline is generally used only for rice transplanters as a fuel in Korea. Tractors consume 46% of total fuel consumption and 56% of diesel fuel consumption. Gasoline used for rice transplanters accounts for 17% of total fuel consumption each year. Tractors and rice transplanters are emitting 82% of all total pollutants. From 2011 to 2019, the total amount of air pollutant emissions was decrease by 15%. That accounted for the reduction of rice cultivation fields in those periods. Rice transplanting operation was in charge of 42% of total emissions. Then, harrowing, harvesting, tilling, leveling, and pest control operations generated 10%, 10%, 8%, 8% and 7% of total emissions, respectively. The contribution of each air pollutant held 54% of CO, 39% of NOx, 5% of NMVOC, and 2% of TSP from the total emission inventory. The three major regions emitting air pollutants from mechanized agricultural practices were Jeollanam-do, Chungcheongnam-do, and Jeollabuk-do, which consume 55% of total fuel usage in rice farming. The total amount of air pollutant emissions from rice cultivation practices in 2019 was calculated as 8,448 Mg in Korea.

Antibiotics’ effect on Mycoplasma pneumoniae (MP) infection still remains controversial. A prospective study of 257 children with MP pneumonia during a recent epidemic (2015-2016) was conducted. All MP pneumonia patients were treated with corticosteroids within 24-36 h after admission. Initially, oral prednisolone (1 mg/kg) or intravenous methylprednisolone (IVMP) (1-2 mg/kg) was administered for mild pneumonia patients, and IVMP (5 -10 mg/kg/day) for severe pneumonia patients. If patients showed persistent fever for 36-48 hours or disease progression, additive IVMP (5 mg/kg or 10 mg/kg) was given. Eighty-five patients received only a broad-spectrum antibiotic without macrolide. The mean age and the male:female ratio were 5.6 ± 3.1 years, respectively. Seventy-four percent of patients (190/257) showed immediate defervescence within 24 h, and 95.7% (246/257) of patients showed defervescence within 72 h with improvements in clinical symptoms. Eight patients who received additive IVMP also showed clinical improvement within 48 h without adverse reactions. There were no clinical or laboratory differences between patients treated with a macrolide (n = 172) and without (n = 85). Early corticosteroid therapy might reduce disease morbidity and prevent disease progression in MP pneumonia patients without side effects, and antibiotics may have limited effects on MP infection.

Fluid flow in human body is generally known to influence a variety of cellular behaviors. Different nanoparticle properties as well as cell type, interaction with other cells and cellular environments also show significant effect on nanoparticle uptake and drug efficacy. The aim of this study was to evaluate the effect of shear stress on cellular behaviors of biocompatible and biodegradable nanoparticles to cancer cells (A549 cell lines) in a biomimetic microfluidic system. We prepared a gelatin-oleic conjugate (GOC) as an amphiphilic biomaterial to prepare self-assembled gelatin-oleic nanoparticles (GON). Coumarin-6 and paclitaxel were used as the fluorescence marker and model drug, respectively, and were loaded into GONs by incubation (C-GONs; PTX-GONs). Additionally, we evaluated the cellular uptake of fluorescence labeled C-GONs and the drug efficacy of PTX-GONs. The cellular uptake of C-GONs by A549 cells in the absence of shear stress revealed that the mean fluorescence intensity was slightly decreased compared to that in the presence of shear stress. The results also indicated that negatively charged PTX-GONs had a lower cancer killing effect under dynamic conditions than that under static conditions. It also suggested that fluidic shear stress did not significantly affect drug uptake and efficiency in case of PTX-GONs. The cellular interactions between nanoparticles and cells in drug delivery should be carefully examined according to the physicochemical properties of nanoparticles such as the type of materials, size and mainly surface charge in a biomimetic microfluidic condition.

The phenolics concentrations of rapeseed are important because they are antinutritional com-pound or directly positive related to antioxidant actives. In this study, single nucleotide poly-morphisms (SNPs) identified from genotyping-by-sequencing (GBS), and genome-wide associa-tion study of phenolic contents were investigated in 95 rapeseed mutant lines derived from gamma rays and their original cultivar. A total of 3,196,318 SNPs were detected, identifying a set of 70,208 union SNPs used to perform association studies. Six phenolics and glucosinolate (pro-goitrin) were identified, sinapine was the major phenolic compound (91.2–99.2%) in all geno-types. The association study was conducted for six phenolic compounds, progoitrin, total sinap-ine content (TSC), total phenolic content (TPC) and seed yield. The association study identified 241 SNPs that were significantly associated with six phenolic compounds, progoitrin, TSC and TPC. Based on the detected SNP markers, BnaA06g31740D, a gene associated progoitrin, BnaC-nng39930D, a gene associated trans-sinapine 1, BnaA07g31720D, a gene associated trans-sinapine 2, BnaC03g31950D and BnaA06g09180D, a gene associated TSC, and BnaAnng27700D, a gene associ-ated TPC, were selected as candidate genes. The SNP makers associated major phenolic com-pounds identified and could be used as targets for breeding programs aimed at improving anti-oxidant contents and reducing antinutritional components.

Based on the fractional order of nonlinear system for love model with a periodic function as an external force, analyzed the characteristics of the chaotic dynamic in this study. The relationship between the chaotic dynamic of the fractional-love model with the external force and the fractional-order system was analyzed when the parameters are fixed. Further, we also studied the relationship between the chaotic systemic dynamic and the parameters when the fractional-order system is fixed. The results show that when the parameters are fixed, the fractional-order system exhibited segmented chaotic states for the different fractional orders of the system. When fixed the fractional-order system, the system exhibited the periodic and chaotic states as parameter changes.

Disposable absorbent hygiene products have evolved for superior performance, enhancing the convenience of daily lives. Yet the use of disposable hygiene pads has brought safety concerns on chemical exposure, and significant efforts have been made to assess the potential risks associated with use of hygiene pads. This article intends to overview the safety assessment framework of diapers and feminine pads, which includes hazard identification, hazard characterization, exposure assessment, risk characterization, and postmarket risk management. Risk assessment of various constituents are reviewed for quantification methods and conservative estimation of exposure parameters. By reviewing the up-to-date considerations in risk assessment, we aim to provide insightful discussion on safety evaluation of current versions of disposable absorbent products. More clinical testing and postmarket surveillance are needed for continuous monitoring of potential health impacts of advanced products and constituents.

This work compared the performance of three methods for constructing a regional ensemble prediction system (EPS) for wind speed forecasts: dynamical downscaling, breeding of growth modes (BGM), and blending method. The Weather Research and Forecasting (WRF) model was used to downscale the European Centre for Medium-range Weather Forecast (ECMWF) EPS. In addition, as the BGM method needs observation data for generating scaling factors, an alternative method for generating scaling factors was proposed to eliminate dependence on observation data. One-month tests between October 1st and October 30th, 2020, were implemented to evaluate the performance of three methods in the Gansu province of China. The results demonstrate that the blending method outperforms the other two methods. Furthermore, the difference in performance is evident mainly in early forecast lead time and becomes negligible as forecast time increases.

Commiphora molmol myrrh resin extracts, which have different physical properties such as polarity and dielectric constant, were prepared by immersion in extraction solvents (hot water, DMSO, hexane, ethanol, and methanol). Methanolic myrrh resin extracts showed broad antibacterial activity against isolated airborne bacteria. Furanoeudesma-1,3-diene and curzerene, as the main terpenoids in the methanolic myrrh resin extract, were analyzed using GC-MS, and the methanolic myrrh resin extracts were found to have antiviral activity (81.2% viral RNA inhibition) against H1N1 influenza virus. Biochars (wood powder-and rice husk-derived) coated with myrrh resin extracts also showed antiviral activity (22.6% and 24.3% viral RNA inhibition), due to the adsorption of terpenoids onto biochar. Myrrh resin extract using methanol as the extraction solvent is a promising agent with antibacterial and antiviral efficacy, and it can be utilized as a novel material via adsorption onto biochar for air filtration processes, cosmetics, fertilizers, drug delivery, and corrosion inhibition.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

Metabolic-associated fatty liver disease (MAFLD) and diabetic kidney disease (DKD) share various pathophysiological factors, and epidemiological evidence suggests that these two diseases are associated. Albuminuria and the estimated glomerular filtration rate, which are conventional biomarkers of DKD, are reportedly associated with the risk or severity of MAFLD. Recently, novel DKD biomarkers reflecting renal tubular injury have been introduced to complement conventional DKD markers. In this article, we looked at previous studies that showed an association between MAFLD and DKD and also reviewed the significance of DKD biomarkers as predictive risk factors for MAFLD.

TVs and monitors are among the most widely used displays in various environments. However, they have limitations in their physical display conditions, such as a fixed size/position and a rigid/flat space. In this paper, we suggest a new "Display In the Wild" (DIW) concept to overcome the aforementioned problems. Our proposed DIW system allows us to display a flexibly large screen on dynamic non-planar surfaces at an arbitrary display position. To implement our DIW concept practically, we choose a projector as the hardware configuration in order to a generate screen anywhere with different sizes. However, distortion occurs when the projector displays content on a surface that is dynamic and/or non-planar. Therefore, we propose a distortion correction method for DIW to overcome the aforementioned surface-constraints. Since projectors are not capture devices, we propose using a depth camera to determine the distortions on the surfaces quickly. We also propose DIW-specific calibration and fast/precise correction methods. Our calibration method is constructed to easily and quickly detect the projection surface, and also allows our proposed system to accommodate the intrinsic parameters such as a display resolution and field of view. We accomplish a fast undistortion process of the projector by considering only surface boundary pixels, which enables our method to run in real time. In our comprehensive experiments, the proposed DIW system generates undistorted screens such as TVs and monitors on dynamic non-planar surfaces at an arbitrary display position with Unmanned Aerial Vehicles (UAVs) in a fast and accurate manner, demonstrating its usefullness in practical DIW scenarios.

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation &lt; 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

Objectives: To assess clinical implications of increased nuchal translucency (INT) in twin pregnancies based on the chorionicity. Methods: This was a retrospective review of the twin pregnancies who underwent first trimester ultrasound with nuchal translucency (NT) measurement at 11-13 weeks of gestation from January 2006 to December 2014. Data were collected using the OB database and the chart review. Pregnancy outcomes including gestational weeks at the delivery, abnormal fetal karyotypes, fetal structural anomalies, twin specific complications were analyzed. Results: A total of 1,622 twin pregnancies with INT≥95th percentile in one or both fetuses were identified. In all twin pregnancies with INT, abnormal fetal karyotypes were identified in 17 (8.6%) patients (odds ratio=13.28, CI=5.990-29.447, P=0.000) and twin-specific complications were identified in 23 (11.6%) patients (odds ratio=2.398, CI=1.463-3.928, P=0.001) compared to those with normal NT. Among the INT group, when the groups were subdivided into monochorionic (MC) and dichorionic (DC) pregnancies, 14.8% and 29.6% of the MC pregnancies had structural anomalies in one or both fetuses (odds ratio=5.774, 95% CI=1.445-23.071, P=0.01) and twin-specific complications (odds ratio=4.379, 95% CI=1.641-11.684, P=0.03), respectively, compared to DC pregnancies. The prevalence of abnormal fetal karyotypes was not statistically different in patients with INT when compared between MC and DC pregnancies (P=0.329). Conclusions: INT was associated with a higher rate of twin-specific complications and fetal structural anomalies in MC twin pregnancies rather than abnormal fetal karyotype. Therefore, NT measurement in MC twin pregnancies can be a useful tool for prediction of adverse pregnancy outcomes. Appropriate counseling and surveillance based on the chorionicity is imperative in prenatal care of twin pregnancies.

Rapeseed (Brassica napus L.) is one of the most oil crop, and its commercial value is contingent upon its agronomic characteristics and oil quality. In this study, 73,226 single nucleotide polymorphisms (SNPs) across 95 rapeseed mutant lines derived from gamma rays and their original cultivar (‘Tamra’) obtained from genotyping-by-sequencing (GBS) was investigated gene ontology (GO) analysis and genome-wide association study (GWAS). GWAS was conducted on agronomic (plant height, ear length, thousand seed weight and seed yield) and oil (fatty acid and crude fat) traits. GO analysis showed that many genes displaying SNPs were involved in cellular processes, intracellular anatomical structures and organic cyclic compound binding. A total of 149 significant SNPs were associated with the agronomic traits (76 SNPs) and oil traits (73 SNPs). Bna.A05p02350D (SFGH) and Bna.C02p22490D (MDN1) were selected as novel candid genes for thousand seed weight. In addition, Bna.C03p14350D (EXO70) and Bna.A09p05630D (PI4Kα1) were selected as novel candidate genes for the erucic acid and crude fat content, respectively. These findings could facilitate the identification of optimal genotypes for breeding new cultivars, and association studies represent an economically efficient tool for mutant screening and the selection of elite rapeseed-breeding lines.

Radar observation data with high temporal and spatial resolution are used in the data assimilation experiment to improve precipitation forecast of a numerical model. The numerical model considered in this study is Weather Research and Forecasting (WRF) model with double-moment 6-class microphysics scheme (WDM6). We calculated radar equivalent reflectivity factor using higher resolution WRF and compared with radar observations in South Korea. To compare the precipitation forecast characteristics of three-dimensional variational (3D-Var) assimilation of radar data, four experiments are performed based on different precipitation types. Comparisons of the 24-h accumulated rainfall with Automatic Weather Station (AWS) data, Contoured Frequency by Altitude Diagram (CFAD), Time Height Cross Sections (THCS), and vertical hydrometeor profiles are used to evaluate and compare the accuracy. The model simulations are performed with and with-out 3D-VAR radar reflectivity, radial velocity and AWS assimilation for two mesoscale convective cases and two synoptic scale cases. The radar data assimilation experiment improved the location of precipitation area and rainfall intensity compared to the control run. Especially, for the two convective cases, simulating mesoscale convective system was greatly improved.

Magnetoelectric (ME) sensor is a new type magnetic sensor with ultrahigh sensitivity, low power consumption, and suitable for the measurement of low frequency weak magnetic field. In this study, metglas/PZT-5B ME sensor with a mechanical resonance frequency f_res of 60.041 kHz was prepared. It is interesting to note that its magnetic field resolution reaches 0.20 nT at f_res and 0.34 nT for DC field, respectively. In order to measure the ultralow frequency AC magnetic fields, a frequency upconversion technique was employed. Under this technique, a limit of detection (LOD) of AC magnetic field lower than 1 nT at 8 Hz is obtained, and the minimum LOD of 0.51 nT is achieved at 20 Hz. The high resolution ME sensor with sub-pT level is promising in the field of low frequency weak magnetic field measurement technology.

Falls, highly common in the constantly increasing global aging population, can have a variety of negative effects on their health, well-being, and quality of life, including restricting their capabilities to conduct Activities of Daily Living (ADLs), which are crucial for one’s sustenance. Timely assistance during falls is highly necessary, which involves tracking the indoor location of the elderly during their diverse navigational patterns associated with ADLs to detect the precise location of a fall. With the decreasing caregiver population on a global scale, it is important that the future of intelligent living environments can detect falls during ADL.s while being able to track the indoor location of the elderly in the real world. Prior works in these fields have several limitations, such as – the lack of functionalities to detect both falls and indoor locations, high cost of implementation, complicated design, the requirement of multiple hardware components for deployment, and the necessity to develop new hardware for implementation, which make the wide-scale deployment of such technologies challenging. To address these challenges, this work proposes a cost-effective and simplistic design paradigm for an Ambient Assisted Living system that can capture multimodal components of user behaviors during ADLs that are necessary for performing fall detection and indoor localization in a simultaneous manner in the real world. Proof of concept results from real-world experiments are presented to uphold the effective working of the system. The findings from two comparison studies with prior works in this field are also presented to uphold the novelty of this work. The first comparison study shows how the proposed system outperforms prior works in the areas of indoor localization and fall detection in terms of the effectiveness of its software design and hardware design. The second comparison study shows that the cost for the development of this system is the least as compared to prior works in these fields, which involved real-world development of the underlining systems, thereby upholding its cost-effective nature.

Due to growing concerns about environmental pollution from plastic waste, plastic recycling research is gaining momentum. Traditional methods, such as incorporating inorganic particles, increasing cross-linking density with peroxides, and blending with silicone monomers, often improve mechanical properties but reduce flexibility for specific performance requirements. This study focuses on synthesizing silica nanoparticles with vinyl functional groups and evaluating their mechanical performance when used in recycled plastics. Silica precursors, namely sodium silicate, and vinyltrimethoxysilane (VTMS), combined with a surfactant, were employed to create pores, increasing silica's surface area. Early-stage introduction of vinyl functional groups prevented the typical post-synthesis reduction in surface area. Porous silica was produced in varying quantities of VTMS, and the synthesized porous silica nanomaterials were incorporated into recycled Polyethylene to induce cross-linking. Despite a decrease in surface area with increasing VTMS content, a significant surface area of 883 m2/g was achieved. In conclusion, porous silica with the right amount of vinyl content exhibited improved mechanical performance, including increased tensile strength, compared to conventional porous silica. This study shows that synthesized porous silica with integrated vinyl functional groups effectively enhances the performance of recycled plastics.

Rice bran (RB) is a promising food ingredient that can improve biological function. In this study, we investigated the effects of RB, both unfermented (RB30) and fermented (RBF30) with five different microorganisms on the neurobehavioral activity in zebrafish larvae. Analytical methods such as UV spectrum and MS scan were performed. Interestingly, niacin content, which is known to improve brain functions such as cognition and emotion, was found to be higher in RBF30 than in RB30. Furthermore, niacin content was highly increased in the RBF30-exposed fish, compared to those in control fish. Therefore, we profiled behavioral patterns and various neurochemistry in zebrafish larvae following supplementation with RBF30 as well as performed calcium imaging on Tg (huC:GAL4-VP16);(UAS:GCaMP7a) zebrafish larvae to determine the correlation of neural activity. RBF30 revealed greater stimulation of locomotor activity without negatively affecting decision-making behavior in zebrafish larvae, as compared to RB30 or niacin. Its behavioral activation is mainly linked with the elevations of neural activity and several neurochemicals such as serotonergic and dopaminergic systems that are implicated in the control of anxiety and stress. Taken together, these results suggest that RBF30 could be a food material that improve the behavioral health by modulating neural activity and brain neurochemistry.

The Huichang fault Basin in Jiangxi Province exhibits high terrestrial heat flow values and a dense concentration of hot springs. However, existing research is limited to individual geothermal fields without a comprehensive basin-wide analysis of geothermal water origins. This study investigates the source of geothermal water across five representative geothermal fields using hydrochemical components and isotopic analyses. The findings indicate: (1) The hydrochemical type transitions from bicarbonate sulphate-sodium-calcium in the north to bicarbonate sodium-calcium in the south; (2) Major chemical components of the geothermal water derive from evaporative salt rocks (Cretaceous sand conglomerate cover) and siliceous formations (granite/metamorphic rock basement); (3) The recharge elevation for geothermal water is approximately 1 km, sourced from adjacent hills. The central basin's geothermal water has an apparent age of about 26,000 years, with δ¹³C indicating participation in deep circulation; (4) Thermal reservoir temperatures range from 74 to 113℃, with the lowest temperatures at the basin's edges (Anzishan and Shangjin geothermal fields) and higher temperatures towards the center, suggesting increased warming and a circulation depth of 1.5 to 2.5 km; (5) Simulation results of reverse water-rock interaction indicate that mineral precipitation-dissolution processes are governed by the basin's main thermal control structures. The geothermal fields are predominantly influenced by reduction alterations associated with granite and are closely linked to paleo-geothermal waters in the enclosed basin, with the formation of these fields heavily reliant on the heat production or conduction from radioactive elements in granite.

UAV cooperative control has been an important issue in UAV-assisted sensor network, thanks to the considerable benefit obtained from cooperative mechanism of UAVs being applied as a flying base station. In coverage scenario, the tradeoff between coverage performance and transmission performance often makes deployment of UAVs fall into a dilemma, since both indexes are related to the distance between UAVs. To address this issue, UAV coverage and data transmission mechanism is analyzed in this paper, then an efficient multi-UAV cooperative deployment model is proposed. The problem is also modeled as a coalition formation game (CFG). The CFG with Pareto order is proved to have a stable partition. Then, an effective approach consisting of coverage deployment and coalition selection is designed, wherein UAVs can decide strategies cooperatively to achieve better coverage performance. Combining analysis of game approach, a coalition selection and position deployment algorithm based on Pareto order (CSPDA-PO) is designed to execute coverage deployment and coalition selection. Finally, simulation results are shown to validate the proposed approach based on efficient multi-UAV cooperative deployment model.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Concrete cracks and local damage can affect the bond performance between concrete and steel bars, thereby reducing the durability of reinforced concrete structures. Compared with general concrete crack repair methods, biomineralization repair not only has effective bonding capabilities but is also particularly environmentally friendly. In view of this, this study aimed to apply biomineralization technology to repair damaged fiber-reinforced lightweight aggregate concrete (LWAC). Two groups of LWAC specimens were prepared. The control group used lightweight aggregates (LWAs) without bacterial spores and nutrient sources, and the experimental group used LWAs containing bacterial spores and nutrient sources. These specimens were first subjected to compression tests and pull-out tests, respectively, and thus were damaged. After the damaged specimen healed itself in different ways for 28 days, secondary compression and pull-out tests were conducted. The self-healing method of the control group involved placing the specimens in an incubator. The experimental group was further divided into experimental group I and experimental group II. The self-healing method of experimental group I was the same as that of the control group. The self-healing method of experimental group II involved soaking the specimen in a mixed solution of urea and calcium acetate for two days, and then taking it out and placing it in an incubator for two days, with a cycle of four days. The test results showed that, compared with the control group specimens, the relative bond strength ratio of the experimental group II specimens increased by 17.9%. Moreover, the EDS and XRD analysis results confirmed that the precipitate formed at the crack was calcium carbonate, which improved the compressive strength and bond strength after self-healing. This indicates that the biomineralization maintenance method used in experimental group II is more effective.

The purpose of this study is to develop and evaluate a self-microemulsifying drug delivery system (SMEDDS) to improve the oral absorption of poorly water-soluble Olaparib. Through the solubility test of Olaparib in various oils, surfactants and co-surfactants, pharmaceutical excipients for use in SMEDDS manufacturing were selected. Self-emulsifying regions were identified by mixing the selected materials at various ratios, and a pseudoternary phase diagram was constructed by synthesizing these results. Various physicochemical properties of microemulsion incorporating Olaparib were confirmed by investigating the particle morphology, particle size, zeta potential, drug content and stability. In addition, the improved dissolution and oral absorption of Olaparib were also confirmed through a dissolution test and a pharmacokinetic study. An optimal microemulsion was generated in the formulation of Capmul MCM EP/NF 10%, Labrasol 80% and PEG 400 10%. Fabricated nano-sized microemulsions were well-dispersed in aqueous solutions, and it was also confirmed that it was maintained well without any problems of either physical or chemical stability. The 5 min initial dissolution of Olaparib in fabricated formulations was improved by 10.6 times (pH1.2), 14.8 times (pH6.8) and 14.8 times (distilled water) compared to the values of Olaparib powder. The dissolution at 120min was 45.4±4.0%(pH1.2), 53.5±1.1% (pH6.8) and 58.1±1.00% (distilled water) in Olaparib powder but has been significantly improved by 1.7 times (74.8±1.9%), 1.6 times (84.2±0.3%) and 1.5 times (81.2±0.7%) in SMEDDS. Associated with the high dissolutions of Olaparib in fabricated microemulsions, the pharmacokinetic parameters were also greatly improved. The Cmax and AUCinf of Olaparib in the prepared microemulsion were increased 4.2- and 3.2-fold, respectively, compared to powder. Taken together with the results mentioned above, the microemulsion system could be an effective tool as an oral delivery formulation for Olaparib. Additionally, our results demonstrate that the SMEDDS systems comprising Capmul MCM, Labrasol and PEG 400 could be a useful option for improvement of several other poorly water-soluble drugs with physico-chemical properties similar to Olaparib.

This paper presents the findings of an exploratory study on the continuously generating Big Data on Twitter related to the sharing of information, news, views, opinions, ideas, knowledge, feedback, and experiences about the COVID-19 pandemic, with a specific focus on the Omicron variant, which is the globally dominant variant of SARS-CoV-2 at this time. A total of 12028 tweets about the Omicron variant were studied, and the specific characteristics of tweets that were analyzed include - sentiment, language, source, type, and embedded URLs. The findings of this study are manifold. First, from sentiment analysis, it was observed that 50.5% of tweets had the ‘neutral’ emotion. The other emotions - ‘bad’, ‘good’, ‘terrible’, and ‘great’ were found in 15.6%, 14.0%, 12.5%, and 7.5% of the tweets, respectively. Second, the findings of language interpretation showed that 65.9% of the tweets were posted in English. It was followed by Spanish or Castillian, French, Italian, Japanese, and other languages, which were found in 10.5%, 5.1%, 3.3%, 2.5%, and <2% of the tweets, respectively. Third, the findings from source tracking showed that “Twitter for Android” was associated with 35.2% of tweets. It was followed by “Twitter Web App”, “Twitter for iPhone”, “Twitter for iPad”, “TweetDeck”, and all other sources that accounted for 29.2%, 25.8%, 3.8%, 1.6%, and <1% of the tweets, respectively. Fourth, studying the type of tweets revealed that retweets accounted for 60.8% of the tweets, it was followed by original tweets and replies that accounted for 19.8% and 19.4% of the tweets, respectively. Fifth, in terms of embedded URL analysis, the most common domains embedded in the tweets were found to be twitter.com, which was followed by biorxiv.org, nature.com, wapo.st, nzherald.co.nz, recvprofits.com, science.org, and other URLs. Finally, to support similar research and development in this field centered around the analysis of tweets, we have developed an open-access Twitter dataset that comprises tweets about the SARS-CoV-2 omicron variant since the first detected case of this variant on November 24, 2021.

Yttrium oxide (Y2O3) resistive random-access memory (RRAM) devices were fabricated using the sol–gel process on indium tin oxide/glass substrates. These devices exhibited conventional bipolar RRAM characteristics, without requiring a high voltage forming process. The effect of current compliance on the Y2O3 RRAM devices was investigated and revealed that as the set current compliance values increased, the resistance values gradually decreased. Consequently, intermediate resistance values were obtained, which are suitable for multi-level cell (MLC) switching. The fabricated Y2O3 RRAM devices were capable of functioning as an MLC with a capacity of 2 bits in one cell, utilizing three low resistance states and one common high resistance state. The potential of the Y2O3 RRAM for neural networks was further explored through numerical simulations. Hardware neural networks based on the Y2O3 RRAM demonstrated effective digit image classification with a high accuracy rate of approximately 88%, comparable to the ideal software-based classification (~92%). This suggests that the proposed RRAM has the potential to be utilized as a memory component in practical neuromorphic systems.

The Giant Babax, an endemic bird in China and a nationally protected wildlife species of Class Ⅱ, is primarily distributed in southern and southeastern Tibet. To investigate the factors influencing nesting site selection, this study conducted research on nest characteristics and nesting site preferences at four sample sites around Lhasa from March to October 2023y, using systematic search methods, tracking methods, and sampling methods. The research findings are as follows: (1) The average nest depth was (7.70±1.47)cm, nest height was (19.58±2.97)cm, inner diameter was (10.64±1.73)cm, outer diameter was (24.65±4.8)cm, average weight was (162.3±13.5)g, and average nest spacing within the plot was 396.93m. (2) The nests of Giant Babax were predominantly found on vegetation such as Salix longistamina (38%), Hippophae gyantsensis (20%), Rosa sericea Lindl. (14%), and Populus szechuanica Schneid(11%). They showed a preference for artificial secondary forests as nesting sites. (3) Giant Babax exhibited a preference for habitats with robust trees that had high canopies while being distant from houses and roads, but close to water sources; moreover, the canopy of the nesting tree played a crucial role in their choice of nesting sites. (4) The reproductive success rate reached 76%, with key factors affecting it being the canopy coverage of the nesting tree and the number of helpers. These research results provide fundamental data support for population conservation efforts and ecological resource management strategies concerning the Giant Babax.

Dendritic cells (DCs) are the professional antigen-presenting cells that recognize and present antigens to naïve T cells to induce antigen-specific adaptive immunity. Among the T-cell subsets, T helper type 2 (Th2) cells produce the humoral immune responses required for protection against helminthic disease by activating B cells. DCs induce a Th2 immune response at a certain immune environment. Basophil, eosinophil, mast cells, and type 2 innate lymphoid cells also induce Th2 immunity. However, in the case of DCs, controversy remains regarding which subsets of DCs induce Th2 immunity, which genes in DCs are directly or indirectly involved in inducing Th2 immunity, and the detailed mechanisms underlying induction, regulation, or maintenance of the DC-mediated Th2 immunity against allergic environments and parasite infection. A recent study has shown that a genetic defect in DCs causes an enhanced Th2 immunity leading to a severe atopic dermatitis. We summarize the Th2 immune-inducing DC subsets, the genetic and environmental factors which involved in DC-mediated Th2 immunity, and current therapeutic approaches for Th2-mediated immune disorders. This review is to provide an improved understanding of DC-mediated Th2 immunity and Th1/Th2 immune balancing, leading to control over their adverse consequences.

A fern, Polypodium aureum, possesses a specialized spore-releasing mechanism like a catapult induced by quick expansion of vaporized bubbles. This study introduces lipid-coated perfluorocarbon droplets to enable repeatable vaporization-condensation cycles, inspired by the repeatable vaporization of Polypodium aureum. Lipid-perfluorocarbon droplets have been considered not to exhibit repeatable oscillations due to bubble collapse by low surface tension of lipid layers. However, a single lipid-dodecafluoropentane droplet with a diameter of 9.17 µm shows expansion-contraction oscillations over 4,000 cycles by changing lipid composition and applying low power of 1.7 MHz ultrasound to induce partial vaporization of droplets. The optimal combinations of shell composition, droplet fabrication, and acoustic conditions can minimize damage on shell structure and quick recovery of damaged shell layers. The highly-expanding oscillatory microbubbles provide a new direction for fuel-free micro or nanobots as well as biomedical applications of contrast agents and drug delivery.

We are introducing a highly efficient 48-channel ultrasound beamforming system ideal for ultrasound endoscopy applications. The system includes a transmitter and a receiver, which allow for low-area, high-resolution imaging acquisition. The transmitter uses a charge redistribution HV (high voltage) scheme to generate three-level pulses that actuate the transducer, implemented with the standard CMOS process for optimal cost and power savings. Meanwhile, the receiver features a sub-array structure and a delay generator that reduces area usage. To achieve high-resolution ultrasound imaging acquisition with low computational power, we developed the Shift Coherence Factor (SCF) algorithm, which is hardware-friendly. This approach delivers a lateral resolution over 20% better than the conventional delay and sum (DAS) algorithm, with a contrast ratio of over 30 dB. The system was implemented in a 180 nm standard CMOS process with an area of 24.98 mm2, power consumption of 8.23 mW per channel, achieving a delay resolution of 8.33 ns, and a low-area implementation of 0.52 mm2 per channel. The system offers high-quality imaging acquisition with minimal additional area and power consumption, which has great potential for 3D imaging or catheterized ultrasound systems.

This study empirically analyzes how R&D expenditures affect firm value using a regression model for listed firms in Shandong Province, China. The dependent variable is measured by To-bin Q, which measures firm value, and the experimental variable among the independent varia-bles is R&D expenditure. In addition, financial leverage and firm size, which have been found to have a significant impact on firm value in previous studies, were selected as control variables. The study sample consisted of 554 data points analyzed over a nine-year period from 2010 to 2018. Without controlling for variables that affect firm value, the correlation analysis shows that R&D expenditures of listed firms in Shandong Province, China have a significant positive impact on firm value at the 1% level. For a more precise analysis, we ran a multivariate regression analysis controlling for other variables that affect firm value and found that R&D expenditure has a significant positive impact on firm value at the 1% level. These findings suggest that man-agers of listed companies in Shandong Province, China, need to actively engage in R&D activi-ties to increase firm value. Companies in Shandong Province, China, are currently experiencing very strong growth, and this study, which shows that R&D is the key to increasing the value of these companies, can help companies in Shandong formulate their business strategies.

The supply of feed has a significant effect on fish growth and operation costs, making it a critical factor in aquaculture. Owing to the repetitive nature of feed supply, feeding techniques have undergone a shift from manual feeding to systems allowing operators to set feed quantities and timing, reducing labor efforts. However, unlike manual feeding, automatic systems cannot ad-just the amount of feed supplied according to the feeding activities of fish, potentially resulting in overfeeding or underfeeding. Such overfeeding causes marine pollution and increases operational costs, whereas underfeeding hinders fish growth. In this paper, we present an intelligent feeding system that observes the depth-specific feeding behavior of red seabream during the feeding process and determines whether feed supply must be continued. The performance of the feeding algorithm is evaluated by comparing the feed loss rate measured during a feeding experiment at a red seabream sea cage farm with that of the traditional manual feeding method. The results reveal that the feed supply per unit time of the manual method and the developed intelligent feed supply system is at an equivalent level. Moreover, the difference in the average feed loss rate is a negligible 1.16%, confirming that the new system is slightly more advantageous.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Trans-arterial radioembolization (TARE) is a form of radiation therapy performed for hepatocellular carcinoma (HCC) via selective intra-arterial injection of Yttrium-90 loaded microspheres. This was a multicenter retrospective study of consecutive patients with HCC who underwent TARE between July 2009 and May 2019. Using pre-treatment computed tomography imaging, the total cross-sectional area (cm2) of the abdominal skeletal muscle at the third lumbar vertebra was measured. The skeletal muscle index (SMI) was calculated by normalizing the muscle area to patient height. In total, 347 patients (median age, 65 years; 284 male) were included in the study. A total of 108 (31.1%) patients had portal vein tumor thrombus (PVTT) and 126 (36.3%) were classified as sarcopenic. The median overall survival (OS) was 28.1 months (95% CI, 24.8-35.7) and median progression-free survival was 8.0 months (95% CI, 6.4-9.4). Multivariate Cox regression analysis revealed that sarcopenia (hazard ratio [HR], 1.36; 95% CI, 1.00-1.85, p = 0.05), PVTT (HR, 1.82; 95% CI, 1.33-2.49, p &lt; 0.01), alpha-fetoprotein (AFP) (≥200 ng/mL) (HR 1.41; 95% CI, 1.04-1.92, p = 0.03), and albumin-bilirubin grade (2-3) (HR 1.74; 95% CI, 1.24-2.43, p &lt; 0.01) were independently associated with poor OS. TARE provided favorable long-term outcomes for patients with advanced HCC. Pre-treatment sarcopenia independently associated with survival, suggesting its utility as a surrogate biomarker for identifying TARE candidates.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

This study examined if people who reside in different regions of South Korea exhibit different WTP for the mitigation of PM2.5 emissions from coal power plants by restricting the operation of such plants during the winter and spring when air pollution becomes severe. A contingent valuation method combined with a double bounded dichotomous choice was used to derive people’s WTP for the mitigation of PM2.5 emissions. Sample group was divided into central, western, eastern, and southern regions. It is known that the eastern region is affected by northwesterly winds in the winter and spring seasons, so air pollutants in the eastern areas fly to the eastern sea. According to the estimation results, respondents who live in eastern regions showed significantly lower WTP than the average WTP. We suggest that the mitigation policy on PM2.5 emissions should consider regional differences in the contributions of coal power plants to PM2.5 emissions.

Aminoacyl-tRNA synthetases (ARSs) are essential enzymes for translating amino acids for protein synthesis. Their function in pathogen-derived infectious diseases has been well established, which has led to development of small molecule therapeutics. The applicability of ARS inhibitors for other human diseases such as fibrosis has recently been explored in the clinical setting. There are active studies to find small molecule therapeutics for cancers. Studies on central nervous system (CNS) disorders are burgeoning as well. In this regard, we present a concise analysis of the recent development of ARS inhibitors based on small molecules from the discovery research stage to clinical studies as well as a recent patent analysis from the medicinal chemistry point of view.

Global Positioning System (GPS) stations located along coastal areas have the ability to measure tide gauge (TG) records by reflected signal reception from the sea water surface. In this study we used the GPS signal-to-noise ratio (SNR) data from the SEPT station (44.63 ⁰N, 124.05 ⁰W) located at South Beach, Oregon, USA, to estimate the TG records using only a few measurements. First, we derived the TG record from a GPS station (GPS-TG) and used traditional TG data from the National Water Level Observation Network (NWLON) sentinel station (Station ID: 9435380) located in Oregon for validation purposes because it was closest to the SEPT station. Our results show that the GPS-TG and NWLON-TG correlate well with the correlation coefficient (CC) of 0.942 and the root mean square (RMS) of their residuals was about 12.90 cm. The corresponding TG prediction by autoregressive moving average (ARMA-TG) and singular spectrum analysis (SSA-TG) models are evaluated for their effectiveness over the station. The comparative analysis demonstrates that the GPS-TG has improved correlation with ARMA-TG (CC of ~0.981 CC, RMS of ~4.80 cm), and SSA-TG (CC of ~0.998 CC, RMS of ~ 0.88 cm) compared to the NWLON-TG (CC of ~0.942 CC, RMS of ~12.90 cm) values. We believe the outcomes from this study contribute to a better understanding of the numerical modeling of TG records as well as other measurements based on reflectometry techniques.

The objective of this study was to assess the effects of parity and lactation stage on the content and conversion rate of DHA in milk from dairy cows fed ruminally protected algae powder. A total of 800 cows were blocked by parity and divided into eight groups (n = 100, three groups of primiparous cows and five groups of multiparous cows) in a six-month experimental period. The lactation period was divided into three stages: 16 – 100 d, 101 – 200 d, and 201–305 d. All cows were fed 100 g of DHA-rich algae powder twice a day, with the DHA content > 13%. Milk samples were collected monthly, and daily milk yield and dry matter intake were recorded. Using infrared spectroscopy, we determined the content of protein, fat, lactose, and total solids in milk and calculated the DHA conversion rate. The results showed that parity and lactation stage had no significant effects on milk composition. However, milk yield and dry matter intake were higher in multiparous cows than in primiparous cows. The DHA content and conversion rate in milk were not significantly different between parity groups but were positively correlated with lactation stage and negatively correlated with milk fat content.

In this paper, the sol−gel method was used to synthesize powders of LaMnO3 (LMO), La0.85Ca0.15MnO3 (LCM), and La0.85Sr0.15MnO3 (LSM). We investigated the impact of substituting Ca and Sr at the A−site on the perovskite crystal structure and electrochemical capabilities of LMO. LCM retained its orthogonal structure in comparison to the parent LMO components, whereas LSM transitioned to a rhombic structure. At 0.5 A/g, the specific capacitance of LCM and LSM electrodes is 185.5 F/g and 248 F/g, respectively.The specific capacitance of LCM was more three times than that of the LMO electrode. Among the three samples (LMO, 22.25 m2 g−1; LSM, 31.56 m2 g−1), the LCM sample exhibited the highest specific surface area of 38.79 m2 g−1. The charge transfer resistances of the LMO, LCM, and LSM are 0.48 Ω, 0.36 Ω, and 0.38 Ω, correspondingly. The LCM electrode exhibits the greatest capacitance performance due to its more refined morphology, increased concentration of oxygen vacancy, and more complete utilization of the perovskite bulk structure. The above results demonstrate that Ca or Sr substitution of A−site compounds has great potential for supercapacitor applications.

Tuning fork gyroscopes (TFGs) are promising for potential high-precision applications. This work proposes and experimentally demonstrates a novel high-Q dual mass tuning fork microelectro-mechanical system (MEMS) gyroscope utilizing three-dimensional (3D) packaging techniques. Except for two symmetrically-decoupled proof masses (PM) with synchronization structures, a symmetrically-decoupled lever structure is designed to force the antiparallel, antiphase drive-mode motion and basically eliminate the low-frequency spurious modes. The thermoelastic damping (TED) and anchor loss are greatly reduced by the linearly-coupled, momentum- and torque-balanced antiphase sense mode. Besides, a novel 3D packaging technique is used to realize high Q-factors. A composite substrate encapsulation cap, fabricated by through-silicon-via (TSV) and glass-in-silicon (GIS) reflow processes, is anodically bonded to the sensing structures at wafer scales. A self-developed control circuit is adopted to realize loop control and characterize gyro-scope performances. It is shown that a high-reliability electrical connection together with a high-air-impermeability package can be fulfilled with this 3D packaging technique. Furthermore, the Q-factors of the drive and sense modes reach up to 51947 and 49249, respectively. This TFG realizes a wide measurement range of ±1800° /s and a high resolution of 0.1° /s with a scale-factor nonlinearity 720 ppm after automatic mode-matching. Besides, the long-term zero-rate output (ZRO) drift can be effectively suppressed by temperature compensation, inducing a small angle random walk (ARW) of 0.923°/√h and a low bias instability (BI) of 9.270°/h.

With the development of designing and manufacturing level for micro-electromechanical system (MEMS) gyroscopes, the control circuit system becomes a key point to determine their internal performances. Nevertheless, phase delay of electron components may result in some serious hazards. This paper describes a real-time circuit phase delay correction system for MEMS vibratory gyroscopes. A detailed theoretical analysis is provided to clarify the influences of circuit phase delay on the in-phase and quadrature (IQ) coupling characteristics and zero rate output (ZRO) utilizing force-to-rebalance (FTR) closed-loop detection and quadrature correction system. By deducing the relationship between amplitude-frequency, phase-frequency of MEMS gyroscope and the phase relationship of the whole control loop, a real-time correction system is proposed to automatically adjust the phase reference value of phase-locked loop (PLL) and thus compensate for the real-time circuit phase delay. The experimental results show that the correction system can accurately measure and compensate the circuit phase delay in real time. Furthermore, the unwanted IQ coupling can be eliminated and the ZRO is decreased by 755% to 0.095°/s. This correction system realizes a small angle random walk of 0.978°/√h, and a low bias instability of 9.458°/h together with a scale factor nonlinearity of 255 ppm at room temperature. Besides, the thermal drift of ZRO is reduced to 0.0034°/s/°C at a temperature range from -20°C to 70°C.

Background The purpose of this study was to evaluate the prevalence of velamentous cord insertion (VCI) and the actual association between pathologically confirmed VCI and perinatal outcomes in twins based on the chorionicity. Methods All twin pregnancies who received prenatal care at a specialty clinic for multiple pregnancies, from less than 12weeks of gestation until delivery in a single institution between 2015 and 2018 were included in this retrospective cohort study. Results A total of the 941 twins were included in the study. The prevalence of VCI in dichorionic (DC) twins and monochorionic diamniotic (MCDA) twins was 5.8% and 7.8%, respectively (p=0.251). In all study population, the prevalence of vasa previa and placenta accreta were higher in VCI group compared to that of non-VCI group (p=0.008 and 0.022). In MCDA twins with VCI, birth weight, 1 and 5-minute Apgar score were lower compared to DC twins with VCI (p=0.010, 0.002 and 0.000). There was no significant association between VCI and selective fetal growth restriction (p=0.708), twin-to-twin transfusion syndrome (p=0.400) and birth-weight discordance (>20% and >25%) (p= 0.378 and 0.161) in MCDA twins. Conclusion VCI in twins was not a risk factor for adverse perinatal outcomes and twin-specific complications.

Highly photoluminescent C-Dots are prepared by hydrothermal reaction of citric acid and piperazine as dual reason in both hydrolysis and surface passivation agent along with the N-doping agent. The resulting C-Dots without external passivation showed PL enhancement by electron transfer from C-Dots-donor to piperazine-acceptor with the maximum emission yields of more than 84%. After mixing the prepared C-Dots with the mixture of EtOH and acetone (1:1 vol %), a novel washing process was performed by centrifugation to remove the precursors and by-products. The resulting C-Dots showed much better stability than dialysis. For evaluating the possible application of the C-Dots as a fluorescent biological probe which possess the wide dosing window and multicolor properties. The C-Dots were localized in perinuclear vacuole-like structures with granular pattern in cytoplasm sparing the nucleus. No signs of any morphological deterioration like nuclear shrinkage were observed.

This study analyzes the effect of economic growth and income distribution on health inequality using data from the Organization for Economic Cooperation and Development (OECD). A panel analysis was conducted by combining 21 years of data (from 2000 to 2020) from 38 OECD countries. Life expectancy and avoidable mortality were set as the dependent variables; gross domestic product and poverty gap were set as the independent variables; body mass index, consumption, smoking rate, healthcare personnel, number of beds in health service facilities, national medical expenses, and unemployment were set as control variables. First, economic growth and poverty gap significantly affect life expectancy and avoidable mortality. It has been confirmed that to resolve health inequality, growth during growth and distribution must be prioritized. Second, it has been confirmed that as the poverty gap increases, life expectancy increases and the avoidable mortality rate decreases. A mechanism different from the existence of a medical security system targeting the lowest class or an increase in the welfare of society worked. In conclusion, as a policy proposal to alleviate health inequality, this study suggests that policy intervention is necessary to block or alleviate the negative impact of income inequality in health care policies.

Species have shown their habital variations in responding to climate change, especially during the spring and summer spawning seasons. The species distribution model (SDM) is considered the most favorable tool to study the potential effects of climate change on species distribution. Therefore, we developed the ensemble SDM to predict the changes in species distribution of Portunus trituberculatus among different seasons in 2050 and 2100 under the climate scenarios RCP4.5 and RCP8.5. The results of SDM indicate that the distribution of this species will move northward and have obviouse seasonal variations. Meanwhile, the suitable habitat for the species will be significantly reduced in summer, with loses rates ranging from 45.23% (RCP4.5) to 88.26% (RCP.8.5) by 2100s. Habitat reduction will mainly occur in the East China Sea and southern part of the Yellow Sea, while there will be a small increase in the northern Bohai Sea. These findings will be important to manage the ecosystem and fishery, provide an information forecast of this species in the future, and maintain species diversity if the seawater temperature rises.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Substrate binding proteins (SBP) bind to specific ligands in the periplasmic region and bind to membrane proteins to participate in transport or signal transduction. Typical SBPs consist of two α/β domains and recognize the substrate by hinge motion between two domains. Conversely, short length Rhodothermus marinus SBP (named as RmSBP) exists around the methyl-accepting chemotaxis protein. We previously determined the crystal structure of RmSBP consisting of a single α/β domain, but the substrate recognition mechanism is still unclear. To better understand the short length RmSBP, we performed comparative structure analysis, computational substrate docking, and X-ray crystallographic study. RmSBP shares a high level of similarity in α/β domain with other SBP proteins, but it has a distinct topology in the C-term region. The substrate binding model suggested that conformational change in the peripheral region of RmSBP was required to recognize the substrate. We determined the crystal structures of RmSBP at pH 5.5, 6.0, and 7.5. RmSBP showed structural flexibility of the β1-α2 loop, β5-β6 loop, and extended C-term domain based on the electron density map and temperature B-factor analysis. These results provide information that will further the understanding of the function of the short length SBP.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The critical period (CP) phenomenon in language development ranks among the 125 conundrums facing scientists in the 21st century, according to Science. While the phenomenon itself has been noncontroversial in first language acquisition, it still warrants an adequate explanation. Predicated on language acquisition as a complex process, questions among the first to be raised include: How do children accomplish this remarkable feat in such a short amount of time? And how do nature and nurture come together to influence language learning? In second language acquisition, however, both the notion of CP, albeit popular, and its empirical evidence have remained contested to this date - among the questions, whether the observed evidence counts as CP-specific and/or whether or not it warrants an isomorphic attribution to maturational constraints. Entwined in this debate are two well-established facets of inter-learner differential attainment. The first is that there exists a stark difference in ultimate attainment between younger and older learners. A second facet is the vast differences in ultimate attainment among older learners. In this article, adopting a social physics approach, we mathematically establish both the relationship between nature and nurture contributions and the presence of a critical period, and, at once, tender a parsimonious and probable theory for the twin phenomena of inter-learner differential attainment.

The pathogenicity of grapevine geminivirus A (GGVA), a recently identified DNA virus, to grapevine plants remains largely unclear. Here, we report a new GGVA isolate (named GGVAQN) obtained from grapevine ‘Queen Nina’ plants with severe disease symptoms; the infectious clone of GGVAQN (pXT-GGVAQN) was also constructed. Infection assays indicated that Nicotiana benthamiana plants inoculated with GGVAQN display upward leaf curling and chlorotic mottling symptoms. Direct injection of Agrobacterium tumefaciens cells carrying pXT-GGVAQN into roots of in vitro-grown ‘Red Globe’ grape plantlets by syringe led to systemic infection with GGVAQN, and the plants exhibited chlorotic mottling symptoms on their upper leaves, and downward curling, interveinal yellowing, and leaf-margin necrosis symptoms on their lower leaves. Our results provide insights into the pathogenicity of GGVA, and a simple and efficient inoculation method to deliver infectious viral clones to woody perennial plants.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

The objective of this study is to design an optimal model predictive control (MPC) strategy using manipulated variables to control the production of a sufficient amount of hydrogen through low temperature autothermal reforming of dimethyl ether (DME), a reforming reaction performed using PdO/ZnO/γ-Al2O3 catalysts coated on honeycomb cordierite ceramics. Experiments and simulation have verified that the optimal activity temperature of the catalyst is 400 °C, and the hydrogen volume fraction in syngas is over 43%. In the implementation of the hydrogen production system, the MPC controller can precisely determine the feed rates of DME, high-purity air, and water based on the space state equation of the reformer, to achieve the anti-disturbance of the reformer temperature. Thus, the reduction of hydrogen yield and sintering of the catalyst as a result of overheating are prevented. As the static and dynamic performance of hydrogen production exhibits excellent tracking of the setpoints, an autonomous, automated, and reliable continuous system was designed to meet the desired hydrogen demand situation. This study shows that an autonomous, automated, and reliable continuous hydrogen production reforming system can be designed to actively respond to the on-board hydrogen usage situation.

We investigated the response of the Manila clam Venerupis philippinarum to possible temperature and salinity changes in a holding facility. First, clams were exposed to four temperatures for 15 days. Valve closure and survival of clams exposed to seawater at 18℃ were higher than that of those exposed to seawater at 24℃. Second, clams were exposed to six salinities for 15 days. Survival of clams exposed to two salinity fluctuation conditions (24–30 and 27–24 psu) was lower than that of clams exposed to constant 30 psu conditions. Valve closures of clams exposed to constant low salinity conditions (24 psu) and two salinity fluctuation conditions (24–30 and 27–24 psu) were higher than of those exposed to constant 30 psu conditions. Lastly, clams were exposed to two different temperatures and three different salinities conditions for 8 days. Valve closure and survival decreased significantly under the combination of 24℃ and 18 psu. These results suggest that an increase in temperature or a wider range of salinity fluctuations are detrimental to the survival of the Manila clam. The synergistic effect of temperature and salinity stressors may decrease the survival period of clams compared to the effect of a single stressor.

Fluorine naturally occurs in soil and rocks; however, concerns arise when human activities or specific compounds increase its levels or bioavailability. South Korea faces challenges in managing soil fluorine contamination even though existing regulations based on total fluorine content are stricter than those in many developed countries. However, these regulations can be economically impractical because of Korea's naturally high background levels of fluorine in the soil. This study examined the international landscape of soil fluorine management and explored potential solutions that balance environmental protection with economic considerations. We propose a shift towards regulating specific and harmful fluorine compounds and prioritizing remediation based on bioavailability assessments. This approach can guide Korea towards a more effective and sustainable strategy for managing soil fluorine contamination.

Suppressors of cytokine signaling (SOCS) influence cytokine and growth factor signaling by negatively regulating the JAK-STAT pathway. This maintains homeostasis during host immune response. However, functional characterization of SOCS family members in invertebrates is limited. In this study, we discovered the Type-I subfamily of the SOCS genes in the mealworm beetle, T. molitor. The full-length ORFs of TmSOCS5, TmSOCS6, and TmSOCS7 consisted of 1,389, 897 and 1,458 nucleotides, encoding polypeptides of 462, 297 and 485 amino acids, respectively, The C-terminal region of TmSOCS was highly conserved in the SH2 and SOCS box domains. Phylogenetic analysis revealed that the three SOCS genes clustered within the same sub-family and the highest amino acid identity was with the Tribolium castaneum SOCS genes (TcSOCS). While the expression of TmSOCS5 and TmSOCS6 was low in larval, pupal, and adult stages of the insect, TmSOCS7 showed higher expression. The expression of TmSOCS5 and TmSOCS6 was higher in larval hemocytes and adult ovary. The microbes expressed the three TmSOCS genes to varying degrees. C. albicans elicited the strongest response in the host with highest 15-fold expression in TmSOCS7 3 h post-inoculation. Collectively, these data suggest that the Type I TmSOCS could play a role in eliciting host immunity.

Citrus peel has been used in Asian traditional medicine for the treatment of cough, asthma, and bronchial disorders. However, the anti-inflammatory effect of quercetogetin (QUE), a polymethoxylated flavone isolated from the peel of citrus unshui is poorly understood. We investigated the anti-inflammatory effect and the molecular mechanisms of QUE in lipopolysaccharide (LPS)-induced RAW264.7 cells. QUE inhibited the production of NO and prostaglandin E2 by suppressing the LPS-induced expression of inducible nitric oxide synthase and cyclooxygenase-2 at both the mRNA and protein levels. QUE suppressed the production of proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α. QUE also inhibited the translocation of the nuclear factor kappa B subunit, p65, into the nucleus by interrupting the phosphorylation of IκB-α in LPS-induced RAW 264.7 cells. Based on the finding that QUE significantly decreased p-ERK protein expression in LPS-induced RAW264.7 cells, we confirmed that suppression of the inflammatory process by QUE was mediated through the MAPK pathway. This is the first report on the strong anti-inflammatory effects of QUE, which is a compound that can potentially be used as a therapeutic agent for inflammatory diseases.

Since large articulated vehicles have uncertainties in trailer articulation angle as well as dynamic complexity, it is not easy to accurately establish a reliable motion plan. In this paper, two geometric path plans constructed based on the empirical rules of driving experts are presented so that articulated vehicles can automatically perform perpendicular parking on a reverse path. By analyzing the empirical parking methods of professional drivers, these path plans were constructed by appropriately combining several standardized simple basic motions to facilitate implementation in real vehicles. In addition, path plans included appropriate complementary motions to effectively respond to uncertainties arising from articulation angles, etc. The complementary motions developed in this study are based on the results of qualitative analysis on the behavior of articulated vehicles. The usefulness of the proposed articulated vehicle parking method has been proven through hundreds of experimental tests using a 1:10 ratio model automated vehicle.