Alzheimer’s disease (AD) is a chronic neurodegenerative disease, and typical pathologic findings include abnormally hyperphosphorylated tau aggregation and neurofibrillary tangles. Insulin resistance and hyperglycemia have been assessed as risk factors for AD development. As the maintenance of optimal blood glucose levels is an important indicator of diabetes mellitus (DM) treatment, diet control is essential. AMPK is a crucial sensor of cellular bioenergetics for controlling anabolic and catabolic metabolism. Diet restriction to achieve euglycemia can increase AMPK activity in the liver and heart. Since AMPK is a direct regulator of tau phosphorylation, we hypothesized that strict diet control to achieve euglycemia affects tau protein phosphorylation through increased AMPK activity in the hippocampus of DM rats. To confirm this hypothesis, we generated insulin-deficient DM rats by subtotal pancreatectomy. Animals were categorized into the restriction (R) group, control (C) group and ad libitum (AL) group according to the diet. We found that tau phosphorylation was significantly increased in the R group compared with the C or AL group. AMPK activity in the R group significantly increased compared to that of the C group or AL group, as expected. Furthermore, the R group showed more critical tau pathology in the hippocampus than the other groups. These results suggest that diet control to achieve euglycemia in insulin-deficient DM conditions is harmful because of the increased possibility of AD development through increased tau phosphorylation by AMPK activation in the hippocampus. We propose that not only hyperglycemia but also euglycemia, which is beneficial in DM patients, must be considered a potential risk factor for AD development, especially when euglycemia is achieved by diet control during insulin deficiency.

In this study, various diamine monomers were used to synthesize aramid polymer films via a low-temperature solution condensation reaction with diacid chloride. For diamines with relatively high basicity, the reaction system became opaque because amine salt formation inhibited polymer synthesis. Meanwhile, low-basicity diamines with strong electron-withdrawing groups, such as CF3 and sulfone, were smoothly polymerized without amine salt formation to provide highly viscous solutions. The acid byproduct HCl generated during polymerization was removed by adding propylene oxide to the reaction vessel and converting the acid into highly volatile inert substances. The resulting solutions were used as varnishes without any additional purification, and polymer films with an excellent appearance were easily obtained through a conventional casting and convection drying process. The films neither tore nor broke when pulled or bent by hand; furthermore, even when heated up to 400°C, they did not decompose or melt. Moreover, polymers prepared from 2,2-bis (trifluoromethyl) benzidine (TFMB) and bis (4-aminophenyl) sulfone (pAPS) did not exhibit glass transition until decomposition. The prepared polymer films showed a high elastic modulus of more than 4.1 GPa and a high tensile strength of more than 52 MPa. In particular, TFMB-, pAPS-, and 2,2-bis (4-aminophenyl) hexafluoropropane-based polymer films were colorless and transparent, with very high light transmittances of 95%, 96%, and 91%, respectively, at 420 nm and low yellow indexes of 2.4, 1.9, and 4.3, respectively.

We report the development of an extrinsic self-healing coating system that shows no fluorescence from the intact coating, yellowish fluorescence in cracked regions, and greenish fluorescence in healed regions, thus allowing the separate monitoring of cracking and healing of coatings. This fluorescence monitoring self-healing system consisted of a top coating, an epoxy matrix resin containing mixed dye-loaded in single microcapsule. The dye-loaded microcapsules consisted of a poly(urea-formaldehyde) shell encapsulating a healing agent containing MAT-PDMS and styrene, a photo-initiator and a mixture of two dyes, one that fluoresces only in the solid state (DCM) and a second that fluoresces dramatically increased in the solid than solution state (4-TPAE). A mixture of the healing agent, photo-initiator and the two dyes was yellow due to fluorescence from DCM. On UV curing of this mixture, however, the color changed from yellow to green and the fluorescence intensity increased due to fluorescence from 4-TPAE in the solid state. When a self-healing coating embedded with microcapsules containing the DCM/4-TPAE dye mixture was scratched, the damaged region exhibited a yellowish color that changed to green after healing. Thus, the self-healing system reported here allows the separate monitoring of cracking and healing based on changes in fluorescence color.

Quantitative analysis of human gait is critical for early discovery, progressive tracking, and rehabilitation of neurological and musculoskeletal disorders, such as Parkinson’s Disease, stroke, and Cerebral Palsy. Gait analysis typically involves estimating gait characteristics, such as spatio-temporal gait parameters and gait health indicators (e.g., step time, length, symmetry, and balance). Traditional methods of gait analysis involve the use of cameras, wearables, and force plates, but are limited in operational requirements when applied in daily life - such as direct line-of-sight, carrying devices, and dense deployment. This paper introduces a novel approach for gait analysis by passively sensing footstep-induced floor vibrations during walking using vibration sensors mounted on the floor surface. Our approach is non-intrusive, scalable, and perceived as more privacy-friendly, making it suitable for continuous gait health monitoring in daily life. We developed a floor vibration-based gait analysis framework to estimate various gait parameters that are used as standard metrics in medical practices, including temporal parameters (step, stride, stance, swing, double-support, single-support time) and spatial parameters (step length, width, angle, stride length), and extracts gait health indicators (cadence/walking speed, left-right symmetry, gait balance, initial contact types). The main challenge is that floor vibrations are distinct across different floor types. To address this challenge, our approach develops floor-adaptive algorithms to extract floor-specific features and is designed to be generalizable to various settings, including homes, hospitals, and eldercare facilities. We evaluate our approach through real-world walking experiments with 20 adults with 12,231 labeled gait cycles across concrete and wooden floors. Our results show 90.5% (RMSE 0.08s), 71.3% (RMSE 0.38m), and 92.3% (RMSPE 7.7%) accuracy in estimating temporal, spatial parameters, and gait health indicators, respectively.

Perilla frutense var. acuta (Lamiaceae) has been used to treat indigestion, asthma, and allergies in traditional medicine. In this study, luteolin 7-O-diglucuronide (1), apigenin 7-O-diglucuronide (2), and rosmarinic acid (3) were isolated from the leaves of P. frutescens var. acuta. Various approaches were performed to investigate the anti-inflammatory activity of the isolated compounds (1-3) and their working mechanisms. In silico docking simulation demonstrated that 1-3 would work as a PPAR-α/δ/γ agonist, and in vitro PPAR-α/δ/γ transcriptional assay showed that the Perilla extract and 3 increased PPAR-α luciferase activity [1.71 and 1.61 times of the control (PPAR-α + PPRE, p < 0.001)]. In the NF-κB luciferase assay, 1 suppressed NF-κB activity the most (56.83 % at 5 µM; 74.96 % at 10 µM; 79.86 % at 50 µM). In addition, 1 and 2 inhibited the mRNA expression of NF-κB target genes, including Il6, Mcp1, and Tnfa, at 50 µM, and 3 suppressed the genes at the mRNA level in a dose-dependent manner. We report that 1 and 2 exert anti-inflammatory effects through NF-κB inhibition, and PPAR-α/NF-κB signaling pathway is related to the anti-inflammatory activity of 3.

The purpose of this study was to investigate the effect that Glycine max hydrolyzed with enzymes from Bacillus velezensis KMU01 has on dextran sulfate sodium (DSS)-induced colitis in mice. Hydrolysis improves functional health through the bioconversion of raw materials and increase in intestinal absorption rate and antioxidants. Therefore, G. max was hydrolyzed in this study using a food-derived microorganism, and its anti-inflammatory effect observed. Enzymatically hydrolyzed G. max (EHG) was orally administered once daily for four weeks before DSS treatment. Colitis was induced in mice through consumption of 5% (w/v) DSS in drinking water for eight days. Results showed that EHG treatment significantly alleviated DSS-induced body weight loss and decreased the disease activity index and colon length. In addition, EHG markedly reduced tumor necrosis factor-a, interleukin (IL)-1b, and IL-6 production, and increased that of IL-10. EHG improved DSS-induced histological changes and intestinal epithelial barrier integrity in mice. Moreover, we found that the abundance of 15 microorganisms changed significantly; that of Proteobacteria and Escherichia coli, which are upregulated in patients with Crohn’s disease and ulcerative colitis, decreased after EHG treatment. These results suggest that EHG has a protective effect against DSS-induced colitis and is a potential candidate for colitis treatment.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Predicting the tidal wave is essential not only to better understand hydrological cycle at the boundary between land and ocean but also to improve energy production in the coastal area. As affected by various factors such as astronomical, meteorological, and hydrological effects, predicting the tidal wave at the estuary remains uncertain. In this study, we present a novel method to improve short-term tidal wave predictions using a fixed-lag smoother based on sequential data assimilation (DA). The proposed method is implemented for the tidal wave predictions at the estuary of Nakdong River. As a result, the prediction accuracy was improved by 63.9% with DA and the calibration using the regression. Although the accuracy of DA diminished for increasing forecast lead times, the 1-hr lead forecast by DA had still 44.4% improvement over the open loop without DA. Plus, the optimal conditions for the fixed-lag smoother were analyzed in terms of the order of a smoothing function and the length of assimilation window and forecast lead time. It was suggested that the optimal DA configuration could be obtained with the 8th order polynomial as a smoothing function assimilated under 6-hr or longer past and future DA windows.

Background Telomere shortening is related to aging and unfavourable health outcomes. Obesity and metabolic diseases are important factors for accelerating aging. This study aimed to find out the association between obesity, metabolic disease, and telomere length in metabolically healthy adults. Methods 237 adults were enrolled with written consents at a health promotion centre of a tertiary hospital from February 2014 to March 2015. After excluding 99 subjects who met the exclusion criterion, a total of 130 metabolically healthy subjects were selected for final analysis. The subjects were divided into quartile groups according to the telomere lengths of their oral mucosal cells. Results The subjects consisted of 66 (50.8%) males with a mean age of 58.59 years. The body mass index (BMI, kg/m2) increased significantly along with the quartile groups (Q1, 23.00; Q2, 23.96; Q3, 23.70; Q4, 25.20; P-for trend=0.008). Waist circumference (WC, P-for trend=0.022), waist-to-hip ratio (WHR, P-for trend=0.005), and waist-to-height ratio (WHtR, P=0.001) also increased along with the quartile groups. Obesity prevalence (BMI ≥25 kg/m2), abdominal obesity (WC ≥90 cm for men, ≥85 cm for women), WHR 〉1.0 for men or 〉0.85 for women, and WHtR ≥0.5 increased significantly as the telomere length increased (P-for trend <0.05). After adjusting for covariates, the ORs for each obesity markers increased as the telomere length increased (P-for trend <0.05); and the ORs of WHtR were especially meaningful (Q1, 1.00; Q2, 2.53; Q3, 2.97; Q4, 7.81; P-for trend = 0.001). There were no significant trends for metabolic syndrome and its components along with the prevalence of fatty liver disease. Conclusion Obesity markers and telomere length had significant positive correlation despite the established theory. The obesity paradox may exist in metabolically healthy adults with regard to telomere length, However, further studies with larger sample sizes for the association between obesity and telomere length are needed.

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation &lt; 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

TGF-ꞵ signaling is a vital regulator for maintaining articular cartilage homeostasis. Runx transcription factors, downstream targets of TGF-ꞵ signaling, have been studied in the context of osteoarthritis (OA). Although Runx partner core binding factor β (Cbfβ) is known to play a pivotal role in chondrocyte and osteoblast differentiation, the role of Cbfβ in maintaining articular cartilage remains obscure. This study investigated Cbfβ as a novel anabolic modulator of TGF-ꞵsignaling and determined its role in articular cartilage homeostasis. Cbfβ significantly decreased in aged mouse articular cartilage and human OA cartilage. Articular chondrocyte-specific Cbfb-deficient mice (Cbfb△ac/△ac) exhibited early cartilage degeneration at 20 weeks old and developed OA at 12 months old. Cbfb△ac/△ac mice showed enhanced OA progression under the surgical-induced mice OA model. Mechanistically, forced expression of Cbfβ rescued Col2α1 and Runx1 expression in Cbfβ-deficient chondrocytes. TGF-ꞵ1-mediated Col2α1 expression failed despite the pSmad3 activation under TGF-ꞵ1 treatment in Cbfβ-deficient chondrocytes. Cbfβ protected Runx1 from proteasomal degradation through Cbfβ/Runx1 complex formation. These results indicate that Cbfβ is a novel anabolic regulator for cartilage homeostasis, suggesting that Cbfβ could protect OA development by maintaining the integrity of the TGF-ꞵ1 signaling pathway in articular cartilage.

This study is focused on the development of criteria for night and visual line of sight (VLOS) flights, especially in the context of beyond visual line of sight (BVLOS) drone applications. While BVLOS technology is advancing globally, regulatory restrictions and conservative legal regulations often prohibit these flights. The goal is to provide experimental guidelines for operational procedures in night and BVLOS flights. The study aims to establish empirical criteria for physical distances in night and VLOS flights, using a test team composed of a pilot, recorder, and observers. The observers are tasked with assessing the identification and recognition distances, which are crucial for safe drone operations. The criteria established are based on different variables such as aircraft size, altitude, and visual acuity. This research involves extensive flight tests at varying altitudes using different types of drones and observers with differing visual acuities (20/20, 20/13.3, and 20/10). The study also examines the effect of communication equipment limitations on recognition distance and the use of lighting devices to minimize abnormal conditions during nighttime flights. Overall, the study's findings aim to contribute to the safe and efficient planning of BVLOS and night drone flights, especially considering the ever-evolving technology and regulatory landscape in this field.

Hyperbaric oxygen therapy (HBOT) is a well-established treatment for carbon monoxide (CO) poisoning. HBOT is performed in a hyperbaric chamber, which increases the atmosphere absolute (ATA) and oxygen concentration in the chamber. To ensure patient safety during HBOT, a gas monitoring system is used to monitor the oxygen levels, ATA, and other parameters. This study aims to perform the safety evaluation of the monoplace hyperbaric chamber compared to a gas monitoring system in the treatment of CO poisoning. In addition, it examined the clinical characteristics of the patients diagnosed with CO poisoning who performed HBOT. In the safety evaluation of the monoplace chamber, it was compared the values of oxygen (O2), carbon dioxide (CO2), humidity, and temperature were measured in the hyperbaric chamber and gas monitoring system when operating at 2.0 ATA and 3.0 ATA. Moreover, in the clinical characteristics of patients with CO poisoning who performed HBOT, 1,006 patients were analyzed by using the data registry. Under the condition at 3.0 ATA, the average CO2 was higher in the hyperbaric chamber than in the gas monitoring system (p&lt;0.001). Also, the average humidity was higher in the hyperbaric chamber than in the gas monitoring system (p=0.004). Under the condition at 2.0 ATA, the average humidity was higher in the hyperbaric chamber than in the gas monitoring system (p&lt;0.001). Also, the average temperature was lower in the hyperbaric chamber than in the gas monitoring system (p&lt;0.001). The mean age of the 1,006 CO poisoning patients who received HBOT was 44.93±19.78 years. According to the source of CO, 680 patients (67.6%) visited ER most commonly due to charcoal. The median maximal CO exposure time and time from rescue to ER were 4.0 hours and 3.09 hours, respectively. The median GCS score at the scene or ER was 15. According to the underlying comorbidities, psychiatric diseases (19.5%) were the most common, followed by hypertension (18.1%) and diabetes mellitus (11.5%). In the emergency room, some patients had appeared symptoms such as loss of consciousness (59.8%), shock (6.7%), or seizure (8.3%). The results of this study could be expected that HBOT can be effectively performed by monitoring the gas concentration change inside the hyperbaric chamber.

Phototherapy is an efficient strategy to respond to oxidative stress and has been in the spotlight in various therapeutic fields through its biological effect, but the exact molecular mechanism has not yet been established. As a result of irradiating RAW264.7 cells with a 630 nm or 850 nm LED with an energy intensity of 0.01J/cm2, cell viability was increased depend on the irradiation time. After H2O2 was added, 630 nm or 850 nm LEDs were irradiated for 10 min or 40 min to increase cell viability by about 1.7- or 1.6-fold, respectively. In addition, 630nm or 850nm LED irradiation showed a significant ROS scavenging effect and significantly reduced TUNEL-positive cells by 45.7% and 37.8%, respectively, compared to cells treated only with H2O2. In the result of flow cytometry, the number of cells in the late apoptosis stage was about 2.3- and 1.8-fold lower than that of the cells treated with H2O2 only, but there was no significance. The Bax/Bcl-2 ratio of cells irradiated with 630 nm or 850 nm LED was significantly lower than that of cells treated with H2O2 only, and the expression of procaspase-3 and cleaved PARP was also significantly expressed in the direction of suppressing cell death. In conclusion, the ROS scavenging activity by 630 nm or 850 nm LED irradiation, leading the expression of cell death pathway proteins in the direction of inhibiting cell death.

This study investigated the relationship of acrosome reactions and fatty acid composition on fertility in boar sperm. The acrosome reaction of sperm was induced via methyl-beta-cyclodextrin (MBCD), and acrosome reaction, plasma membrane integrity, and fertility were analyzed. The fatty acid composition of the excess acrosome reacted sperm was determined via gas chromatography. The results showed that the acrosome reaction in sperm was induced over 85% of the time by 60 mM MBCD treatment, and the plasma membrane integrity was significantly decreased and was dependent on the MBCD level. The acrosome reacted sperm resulted in significantly higher saturated fatty acids (SFAs) and lower unsaturated fatty acids (PUFAs) than the non-acrosome reaction group. Moreover, the acrosome reacted sperm from 60 mM MBCD significantly decreased in vitro fertility and blastocyst formation relative to non-acrosome reacted sperm, and the acrosome reaction was positively correlated with SFAs and negatively correlated with PUFAs. Of these fatty acids, C22:5n-6 (docosapentaenoic acid [DPA]) and C22:6n-3 (docosahexaenoic acid [DHA]) were directly negatively correlated with the acrosome reaction (r = -0.982 and -0.947, respectively). In conclusion, the excessive acrosome reactions may occur by reducing the PUFAs, which may then dramatically decrease sperm fertility in pigs.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

This study aimed to investigate the influence of urban garden activities on participants' Perceived restorativeness, resilience, sense of community, and stress reduction. Ninety individuals who agreed to participate to the experiment were divided into experimental and control groups. To collect data 16 sessions of urban garden activities were conducted every two weeks from May to November of 2022. Perceived Restorativeness Scale, Conner-Davidson Resilience Scale, Sense of Community Index, and Brief Encounter Psychosocial Instrument were employed to measure participants’ psychological effects. To evaluate physiological effect salivary cortisol tests were performed. The results of the study revealed that urban gardening activities influenced on participants' physiological and psychological reactions in positive ways.

Hydrogels incorporated with hydrophobic motifs have received considerable attention to recapitulate the cellular microenvironments, specifically for the bio-mineralization of a 3D matrix. Introduction of hydrophobic motifs into a hydrogel often results in irregular arrangement of the motifs, and further phase separation of hydrophobic domains, but limited efforts have been made to resolve this challenge in the hydrophobically-modified hydrogel. Therefore, this study presents an advanced integrative strategy to incorporate hydrophobic domains regularly in a hydrogel by self-assembling of polymer cross-linkers, building blocks of a hydrogel. Self-assemblies between polymer cross-linkers were examined as micro-domains to incorporate hydrophobic motifs in a hydrogel. The self-assembled structures in a pre-gelled solution were confirmed with the fluorescence analysis and the hydrophobicity of a hydrogel could be tuned by incorporating the motifs in a controlled manner. Overall, the results of this study would greatly serve to tuning performance of a wide array of hydrophobically-modified hydrogels in drug delivery, cell therapies and tissue engineering.

Cervi cornu has been extensively used in traditional medicine as an antioxidant and for the treatment of various disorders, including osteoporosis. However, since it is not easy to separate the active ingredient, absorption is not performed well. In this study, we extracted the low molecular weight (843Da) collagen NP-2007 from cervi cornu by enzyme hydrolyzation, and evaluated the therapeutic effect in a monosodium iodoacetate (MIA)-induced rat osteoarthritis model, and identified their molecular mechanisms. NP-2007 was orally administered at 50, 100, and 200 mg/kg for 21 d. Efficacy was evaluated based on serum parameters, inflammatory mediators, and mor-phological and histopathological analyses of knee joints. Production of matrix metalloproteinases, including MMP-2, MMP-3, and MMP-9, in the serum was higher in MIA-treated rats; however, these levels decreased after NP-2007 treatment. Serum levels of tumor necrosis factor-α, interleukin (IL)-1β, IL-6, and prostaglandin E2 were lower in the NP-2007 group than in the MIA group. Furthermore, the administration of NP-2007 resulted in effective preservation of both the synovial membrane and knee cartilage, and significantly decreased the transformation of fibrous tissue. This study indicates that NP-2007 can prevent and alleviate symptoms of osteoarthritis and have applications as a novel arthritis treatment.

Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power wasted for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power conversion efficiency (PCE) of 90.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding PCE of 74.6%. The result shows that the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.

Existing reinforced concrete buildings with seismically-deficient column details affect the overall behavior depending on the failure type of column. The purpose of this study is to develop and validate a machine learning-based prediction model for the column failure modes (shear, flexure-shear and flexure failure modes). For this purpose, artificial neural network (ANN), K-nearest neighbor (KNN), decision tree (DT), and random forest (RF) models were used considering previously-collected experimental data. Using four machine learning methodologies, we developed a classification learning model that can predict the column failure modes in terms of the input variables using concrete compressive strength, steel yield strength, axial load ratio, height-to-dept aspect ratio, longitudinal reinforcement ratio, and transverse reinforcement ratio. The performance of each machine learning model was compared and verified by calculating accuracy, precision, recall, F1-Score, and ROC. Based on the performance measurements of the classification model, the RF model represents the highest average value of the classification model performance measurements among the considered learning methods, and it can conservatively predict the shear failure mode. Thus, the RF model can rapidly predict the column failure modes with the simple column details. Additionally, it was demonstrated that the predicted failure modes from the selected model were exactly same as the failure mode determined from a code-defined equation (traditional method)

Optimum postharvest storage conditions increase the shelf life and postharvest quality of horticultural crops. The effects of forced-air precooling (FAP) and modified atmosphere packaging (MAP) on shelf life, physicochemical quality, and health-promoting properties of bell pepper (Capsicum annuum L. cv. Nagano) harvested at 90% and 50% coloring stages in May and July respectively, stored at 11℃, 95% relative humidity were assessed. Fruits were treated with FAP + 30 μm polyethylene liner (FOLO), FAP (FOLX), 30 μm polyethylene liner (FXLO), and control (FXLX). The quality attributes, viz. weight loss, firmness, color, SSC, soluble sugars, TPC, TFC, DPPH, and ABTS were evaluated. FOLO maintained sensory quality (weight loss, firmness, and color), physicochemical (soluble solids content and soluble sugars), and health-promoting properties compared to other treatments during storage. The investigated parameters differed significantly (p &lt; 0.05) among treatments except soluble sugars. The 50% coloring fruits had a huge variation between treatments than 90% coloring. The results revealed more TPC and antioxidant capacity in 50% than in 90% coloring fruits. The study highlights the need to consider the ideal fruit coloring stage at harvest under the effect of FAP and MAP treatments in preserving bell pepper's postharvest quality and shelf life.

Acoustic emission (AE) is caused by the sudden release of energy by a material as a result of material degradation related to deformation, crack, or fault within a solid. The same situation also occurs in leaks caused by turbulence in the fluid around the leak. In this study, analytical modeling for AE due to leakage through a circular pinhole in a gas storage cylinder was performed. The displacement fields responsible for AE, excited by the concentrated force (CF) associated with the turbulent flow though the pinhole, were derived by solving the Navier-Lamé equation. The CF as an excitation source was formulated in terms of a fluctuating Reynolds stress (FRS) and spatial Green’s function. In particular, a series of experiments were conducted under different operating conditions to explore the characteristics of the AE signals due to leak in a gas cylinder. Finally, the simulation and experimental results were compared to verify the accuracy of the simulation results.

The introduction of electrical vehicle charging infrastructure including EV charger, renewable energy resource at secondary feeder in distribution system has been increased as one of countermeasure for global environmental issues. However, the Electric Vehicle Charging (EVC) infrastructure may act as the peak load in distribution system, which can adversely impact on the voltage stability when the electric vehicle is quickly charged. Therefore, to keep within the limit capacity of secondary feeder and allowable limit for feeder voltage, this paper proposes a stabilization method by the Energy Storage System (ESS) control strategy at secondary feeder in order to be not violated over than lower and upper limit. Also, this paper presents the estimation method to keep the proper standard value of State of Charge (SOC). From the simulation results, the voltage stabilization operation by ESS should make the feeder voltages of the distribution system(secondary feeder) introduced EVC Infra keep better voltage conditions, also estimation method to keep the proper standard value is confirmed that the SOC of ESS when is the standby condition could be exactly kept within the proper reference range.

Rammed earth in a built environment has vapor diffusion characteristics and humidity control ability each of which are respectively attributed to the porous structures and the hydrophilic properties. Indeed, these structures and properties, which allows easily absorbing water parti-cles, hence, affecting the durability of a rammed earth wall. This paper presents the water repel-lency method for rammed earth walls which synthesizes siloxane copolymers containing fluo-rine. The water-repellent properties are investigated by measuring the contact angle, water ab-sorption rate, and compressive strength after spray coating with the synthesized siloxane co-polymers on the surface of the rammed earth specimens under study. The water contact angle of the specimen coated with a siloxane copolymer containing 10 mol.% of a silane monomer with a fluorine group is about 140o. The water absorption of the specimen obtained after immersing in water for 24 hours is low at about 3.5 wt.%. In addition, the compressive strength is remained more than 80% of the corresponding strength of the specimen which is not immersed into water. It is confirmed that the use of a 10% by volume of the siloxane copolymer containing the fluo-rine group may assure the water-repellent performance and the economic competitiveness.

The cyclic lipopeptide produced from Bacillus pumilus strain HY1 was isolated from Korean soybean sauce. The chemical structures of the surfactin isomers were analyzed using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and electrospray ionization tandem mass spectrometry (ESI-MS/MS). The five potential surfactin isoforms were detected with protonated masses of m/z 994.7, 1,008.7, 1022.7, 1036.7, and 1,050.7 and different structures in combination with Na+, K+, and Ca2+ ions. ESI-MS/MS analysis revealed that the isolated surfactin possessed the precise amino acid sequence LLVDLL and hydroxyl fatty acids with 12 to 16 carbons. The surfactin content during cheonggukjang fermentation increased from 0.3 to 51.2 mg/kg over 60 h of fermentation. The surfactin extraction of cheonggukjang inhibited the growth of two cancer cell lines. The growth of both MCF-7 and Caco-2 cells was strongly inhibited with 100 μg/μL surfactin. These results suggest that surfactins produced from strain HY1 have anticancer properties.

While the container crane is an important part of daily port operations, it has received little attention compared with other infrastructures, such as buildings and bridges. Crane collapse due to earthquake affects the operation of the port, and indirectly impacts the economy. This study proposes fragility analyses for various damage levels of the container crane that allow the port owner and partners to better understand the seismic vulnerability presented by container cranes. A large quantity of nonlinear time history analyses was applied for a three-dimensional (3D) finite element model to quantify the vulnerability of the container crane in considering the uplift and derailment behavior. The uncertainty of demand and capacity of the crane structures were also considered through random variables, i.e. elastic modulus of members, ground motion profile, and intensity. The results analyzed in the case of a Korean container crane showed that the probability of exceeding the first uplift with or without derailment is shown before the crane reaches the structure’s limit states. This means that under low seismic excitation, the crane might be derailed without any structural damage. But when the crane reaches the minor damage state, it is always coupled with a certain probability of uplift with or without derailment. This study also proposes the fragility curves developed for different structural periods to enable port stakeholders to assess the risk of their container crane.

Gastric cancer is the 5th most common disease in the world and the 4th most common cause of death. It is diagnosed through esophagogastroduodenoscopy with biopsy, however there are limitations in finding lesions in the early stages. Recently, research has been actively conducted to use liquid biopsy to diagnose various cancers, including gastric cancer. Various substances derived from cancer are reflected in the blood. By analyzing these substances, it was expected that not only the presence or absence of cancer but also the type of cancer can be diagnosed. However, the amount of these substances is extremely small, and even these have various variables depending on the characteristics of the individual or the characteristics of the cancer. To overcome these, we collected methylated DNA fragments using MeDIP and compared them with normal plasma to characterize gastric cancer tissue or patient’s plasma. And we attempted to diagnose gastric cancer using the characteristics of cancer reflected in the blood through the cancer tissue and patient’s plasma. As a result, we confirmed that the consistency of common methylated fragments between tissue and plasma was approximately 41.2%, and found the possibility of diagnosing and characterizing cancer using the characteristics of the fragments through SFR and 5'end-motif analysis.

Achievement of solid fusion of the lumbosacral junction (L5-S1 level) is an important factor in adult spinal deformity (ASD) surgery. The purpose of this study is to explore the effectiveness and feasibility of injectable rhBMP-2 (a combination of Eschericia coli-derived rhBMP-2 and hydrogel type β-TCP carrier; NOVOSIS Inject) as a bone substitute for the fusion of lumbosacral junction. 20 patients (average age 69.1 years) diagnosed with ASD with sagittal imbalance who underwent surgical treatment including anterior lumbar interbody fusion (ALIF) in the L5-S1 level were evaluated. Injectable rhBMP-2 was applied in L5-S1 ALIF and followed-up for 1-year. Solid fusion rates and changes of clinical outcomes (Oswestry Disability Index [ODI], Visual Analog Scale [VAS] of back and leg) were measured and analyzed at 6 and 12 months after surgery. All postoperative adverse events were evaluated about the association with injectable rhBMP-2. Fusion rates were 68.4% and 100% at 6 and 12 months after surgery. Compared to baseline, ODI were improved to 45.8% and 63.7%, VAS(back) were improved to 69.2% and 72.8%, and VAS(leg) were improved to 49.2% and 64.8% at 6 and 12 months after surgery (p&lt;0.001, respectively). There were no adverse events associated with injectable rhBMP-2. Thus, injectable rhBMP-2 may be a suitable choice of a bone graft substitute when achieving solid interbody fusion in the lumbosacral junction.

A programmable DC power supply with Real-time Digital Simulator (RTDS)-based photovoltaic (PV) Power Hardware-In-the-Loop (PHIL) simulators have been used to improve the control algorithm and reliability of PV Inverter. This paper proposes a supervisory control algorithm for PV PHIL simulator with non-RTDS device that is an alternative solution of high cost PHIL simulator. However, when such a simulator with conventional algorithm which is used in RTDS is connected to a PV inverter, the output is in the transient state and it makes it impossible to evaluate the performance of the PV Inverter. Therefore proposed algorithm controls the voltage and current target values according to the constant voltage (CV) and constant current (CC) modes to overcome the limitation of the Computing Unit, DC power supply and also uses a multi-rate system to account for the characteristics of each component of simulator. A mathematical models of a PV system, programmable DC power supply, isolated DC measurement device and Computing Unit are integrated to form a real-time processing simulator. Performance tests using a PV PHIL simulator which is applied proposed algorithm connected a PV inverter are carried out and proved superiority and utility of this method against conventional methods.

A nanocomposite rod-shaped structure with single-walled carbon nanotube (SWCNT) embedded in polypyrrole (PPy) doped with nonafluorobutanesulfonic acid (C4F), SWCNT/C4F-PPy, was synthesized using emulsion polymerization. The hybrid ink was then directly coated on a polyimide film interdigitated with the Cu/Ni/Au electrodes via a screen-printing technique to create a flexible film sensor. The sensor film showed a response of 1.72% at 25 °C/atmospheric pressure when acetone gas of 5 ppm was injected, which corresponds to almost 95% compared to the Si wafer-based array interdigitated with the Au electrode. Additionally, C4F was used as a hydrophobic dopant of PPy to improve the stability of humidity and to produce a highly sensitive film-type gas sensor that provides stable detection even in humid conditions.

Although corporate social responsibility (CSR) initiatives have gained increased significance within the restaurant industry during the pandemic, there is a lack of understanding of how customers’ perceived risks influence their dining intentions for effective crisis response. This study investigates the relationship between perceived CSR, restaurant image, and dining intentions during the crisis. In addition, the study examines three types of perceived risks (quality, health, and environmental) associated with restaurants and their influence on perceived CSR, restaurant image, and dining intentions during this period. The results demonstrate that perceived CSR positively impacts a restaurant’s image and concurrently reduces perceived risks among consumers during the coronavirus disease 2019 (COVID-19) pandemic. Furthermore, perceived health risks have a negative influence on customers’ dining intentions. This study offers valuable insights into the theoretical foundations and managerial implications of CSR’s effects and risk management, particularly in the context of future pandemics within the restaurant industry.

This research focuses on the knowledge-sharing intention of an expert with the purchasing decision-maker in a company as a marketing point for business-to-business transactions, where a company’s facilities expert connects the company’s purchasing decision-maker with the supplier. By providing information about the supplier’s products and companies to this decision-maker, the expert plays an important role in the purchasing decision-maker’s knowledge on suppliers. Therefore, this study aims to improve expert word-of-mouth (WOM) intentions and examines the strategies that influence them. Statistical verification is employed by considering the answers of 103 engineering experts, and a hierarchical multiple-regression analysis is used to test this study’s hypotheses. As a strategy for influencing expert WOM intentions, both the supplier’s and purchasing decision-maker’s expertise and the tie strength with the supplier are examined; the tie strength with the purchasing decision-maker is considered as the moderating variable. Three of the four hypotheses are supported. This paper gives advices to the facility suppliers who want sustained growth. they should not only appeal their expertise to the facility experts who visit their exhibition booth, but also specify who the visitors are and manage the relations with them personally with a long term perspective.

Background: Animal-assisted therapy has positive effects on cognitive function, depression, performance ability, and social functioning in elderly patients. The aim of this study was to evaluate the effects of rearing pet insects on the cognitive function of healthy elderly participants, with fMRI (functional magnetic resonance imaging) being used for this purpose. Methods: Community-dwelling elderly women (≥60 years) with normal cognitive function were enrolled during April 2015. They were randomized at a 1:1 ratio into two groups: insect-rearing and control (n=16) groups, with the insect-rearing group being further classified into two groups for analysis according to the subjects’ scores in the Wisconsin Card Sorting Test, WCST) at the first fMRI: insect-rearing group I with a relatively high score (n=13), and insect-rearing group II with a relatively low score (n=6). All subjects were educated on a healthy lifestyle for better cognitive function at every visit, and the insect-rearing groups received and reared crickets as pet insects. The fMRI was performed at baseline and after 8 weeks using the WCST as a stimulus. The WCST consisted of two variations, a high level baseline (HLB) and semi-WCST version. Results: There were no significant differences in the baseline characteristics among the three groups. There was a significant difference accuracy of the HLB–semi-WCST (p<0.05) in insect-rearing group II after 8 weeks from the baseline test. In the fMRI analysis involving the WCST reaction test, increased activation was observed in the right dorsal lateral prefrontal cortex and parietal cortex in insect-rearing group II when the semi-WCST, rather than the HLB, was performed. There were no significant differences in the other groups. Conclusion: The rearing of pet insects as an animal-assisted therapy is cost-effective, easy, and occupies little space. In this study, it showed positive effects on executive functions and performance improvement in elderly women. Further larger studies on the effects of pet insects on cognitive function are warranted.

The aim of this study is to propose and validate the state space mode decomposition technique for precise mode separation of non-classical damping systems and closely distributed modal systems. To assess the reliability and applicability of this technique, a 40-story building with a tuned mass damper is investigated, and acceleration responses measured by the building's health monitoring system are used for the verification of the technique. The mode separation results reveal that the separated modal power spectrum becomes distorted at neighboring natural frequency ranges when the performance index only considers the concentration of power spectral energy at the target natural frequency. However, by introducing an augmented performance index that includes a constraint condition to account for distortion, more accurate mode decomposition can be achieved.

Suppressing the charge recombination at the interface of photoanode/electrolyte is the crucial way to enhance the photovoltaic performance of quantum dot sensitized solar cells (QDSSCs). In this scenario, ZnS/SiO2 blocking layer was deposited on TiO2/CuInS2 QDs to inhibit the charge recombination at photoanode/electrolyte interface. As a result, the TiO2/CuInS2/ZnS/SiO2 based QDSSCs delivers a power conversion efficiency (η) value of 4.63%, which is significantly higher than the 2.15% and 3.23% observed for QDSSCs with a TiO2/CuInS2 device and TiO2/CuInS2/ZnS, respectively. Electrochemical impedance spectroscopy and open circuit voltage decay analyses indicate that ZnS/SiO2 passivation layer on TiO2/CuInS2 suppress the charge recombination at the photoanode/electrolyte interface and prolongs the electron lifetime.

Surgical techniques are gaining attention for treating physical diseases in aquaculture and aquarium fish. Sturgeon is a suitable species for surgical experiments due to its industrial significance. Maintaining homeostasis is crucial during surgical procedures, and the liver plays a major role in immune regulation. High temperature is suggested to improve physiological activity and wound healing. This study investigated differences in hepatectomy sturgeons' tolerance and histopathological responses of internal organs. Moreover, this study investigated the effects of high temperature on wound healing and hematopoietic recovery in fish undergoing surgical procedures. The liver condition was found to play a pivotal role in the analysis, and cortisol levels were affected by anesthesia. The results showed that high temperature facilitated hematopoietic recovery and wound healing, but excessive induction of physiological activity caused damage. Managing high temperatures and liver condition induced a remarkable improvement in wound healing. However, anesthesia itself can be a significant stressor for fish, and wound healing requires a greater amount of energy. Further research is needed to understand the stress factors caused by surgical procedures and anesthesia and to promote animal welfare in fisheries products.

In spite of unique structural, spectroscopic and redox properties, the synthetic variants of the planar, antiaromatic hexaphyrin (1.0.1.0.1.0) derivatives 2, has been limited due to the low yields and difficulty in access to the starting material. A chemical modification of the meso-substituents could be good alternative overcoming the synthetic barrier. Herein, we report a regio-selective nucleophilic aromatic substitution (SNAr) of meso-pentafluorophenyl group in rosarrin 2 with catechol. The reaction afforded benzodioxane fused rosarrin 3 as single product with high yield. The intrinsic antiaromatic character of the starting rosarrin 2 retained throughout the reactions. Clean, two electron reduction was achieved by treatment of 3 with SnCl2•2H2O affording 26pi-electron aromatic rosarrin 4. The synthesized compounds exhibited noticeable changes in photophysical and redox properties compared with starting rosarrin 2. .

The bark of Rhus verniciflua Stokes (RVS) is used as a food additive and herbal medicine for various inflammatory disorders and cancer in Eastern Asia. RVS exerted anti-inflammatory effects in lipopolysaccharide (LPS)-stimulated RAW264.7 cells, but whether this effect occurs in macrophages after oral administration has not been determined. We used a thioglycollate-induced peritonitis model to obtain macrophages from mice given RVS. We examined the systemic inflammatory response to intraperitoneal LPS. RVS-treated mice had an increased population of peritoneal exudate cells expressing CD11b and SRA. Increased uptake of Alexa Fluor 488-labeled acetylated lipoprotein was observed in monocyte-derived macrophages from RVS-treated mice. When these cells from the RVS group were stimulated with LPS, the levels of tumor necrosis factor (TNF)- and interleukin (IL)-6 in the supernatant decreased, but the level of IL-12 increased. The surface expression of CD86 was reduced, but surface expression of class II MHC molecules was increased. RVS suppressed the serum levels of LPS-induced TNF- and IL-6. RVS enhanced monocyte differentiation in thioglycollate-induced peritonitis by increasing scavenger receptor expression and activity. Macrophages isolated from mice given RVS responded differently to LPS. These findings demonstrate that RVS confers selective anti-inflammatory activity without causing the overall inhibitory effects on immune cells.

Using morphological characteristics and SSR markers, we evaluated the morphological and genetic variation of 200 Perilla accessions collected from the five regions of South Korea and other region. In morphological characteristics analysis, particularly, leaf color, stem color, degree of pubescence, leaf size were found to be useful for distinguishing the characteristics of native Perilla accessions cultivated in South Korea. A total of 137 alleles were identified in the 20 simple sequence repeat (SSR) markers, and the number of alleles per locus ranged from 3 to 13, and the average number of alleles per locus was 6.85. The average gene diversity (GD) was 0.649, with a range of 0.290-0.828. From analysis of SSR markers, accessions from the Jeolla-do and Gyeongsang-do regions showed comparatively high genetic diversity values compared with those from other regions in South Korea. In the unweighted pair group method with arithmetic mean (UPGMA) analysis, the 200 Perilla accessions were found to cluster into three major groups and an outgroup with a genetic similarity of 42%, and did not showed a clear geographic structure from the five regions of South Korea. Therefore, it is believed that landrace Perilla seeds are frequently exchanged by farmers through various routes between the five regions of South Korea. The results of this study are expected to provide useful information for conservation of these genetic resources and selection of useful resources for the development of varieties for seeds and leafy vegetables of cultivated var. frutescens of Perilla crop in South Korea.

Spectral image analysis has the potential to replace traditional approaches for assessing plant responses to different types of stress including herbicide, through non-destructive and high-throughput screening (HTS). Therefore, this study was conducted to develop a rapid bioassay method using a multi-well plate and spectral image analysis for diagnosis of herbicide activity and mode of action. Crabgrass (Digitaria ciliaris) as a model weed was cultivated in multi-well plates and subsequently treated with 6 herbicides with different modes of action when they reached the 1-leaf stage, using only a quarter of the recommended dose. To detect plant response to herbicides, plant spectral images were acquired after herbicide treatment using RGB, infrared (IR) thermal, and chlorophyll fluorescence (CF) sensors and analyzed for diagnosing herbicide efficacy and mode of action. Principal Component Analysis (PCA) using all spectral data successfully distinguished herbicides and clustered depending on their modes of action. The performed experiments have shown that the multi-well plate assay combined with spectral image analysis can be successfully applied for herbicide bioassay. In addition, the use of spectral image sensors, especially in CF image, would facilitate HTS by enabling rapid observation of herbicide response, as early as 3 hours after herbicide treatment.

Background and Objectives: There is a need to effectively manage the healthy aging of the rapidly increasing number of elderly people in an ultra-elderly society. The purpose of this study was to analyze the mediating effects of social networks and wisdom on the relationship between lifestyle habits and healthy aging in older adults with chronic diseases. Materials and Methods: Participants were 120 community-dwelling older adults aged 65 and older with at least one chronic disease. Data were collected from elderly people who met the criteria by visiting nursing care worker training centers, senior centers, social gatherings, and home welfare centers in D, G, and S cities from May 24 to June 23, 2023, with a questionnaire consisting of lifestyle habits, social networks, wisdom and healthy aging, and general characteristics. Results: The degree of healthy aging of the subjects was 3.56 out of 5, and there were differences in the degree of healthy aging according to age (F=3.76, p=0.026), spousal relationship (t=3.11, p=0.002), education (F=9.08, p&lt;0.001), number of diseases (F=8.65, p&lt;0.001), and economic level (t=-2.45, p=0.016). The most common diseases among the subjects were hypertension, hyperlipidemia, joint diseases and diabetes mellitus. Healthy aging was highly correlated with lifestyle habits (r=0.63, p&lt;0.001), social networks (r=0.65, p&lt;0.001), and wisdom (r=0.73, p&lt;0.001). Social networks (β=0.46, p&lt;0.001) and wisdom (β=0.55, p&lt;0.001) had partial mediating effects (z=4.15, p&lt;0.001; z=5.11, p&lt;0.001) on the relationship between subjects' lifestyle habits and healthy aging. Conclusions: In order to increase the degree of healthy aging of the subjects, it is necessary to establish a mediating intervention program that manages to have a good lifestyle habits in daily life, increase social networks, and become wise.

In the context of high-temperature water vapor treatment, Zn-Mg-Al alloy-coated steel sheets exhibit the emergence of a black surface. This study aims to explore the factors and mechanisms contributing to surface blackening by inducing black surfaces on Zn-Mg-Al alloy-coated steel sheets, which were fabricated through molten coating subjected to water vapor treatment at 150 degrees Celsius. The surfaced composition was predominantly identified as ZnO, a zinc oxide film, validated through X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Morphological analysis of the surface and cross-section post-water vapor treatment revealed a disrupted lamellar structure with diffused features, resulting in the formation of an oxide film. Optical properties analysis demonstrated an increased absorbance and a decreased bandgap energy after water vapor treatment, indicative of an augmented blackening effect. Consequently, the high-temperature water vapor treatment led to the formation of oxides on the surface, with the highly reactive Mg and Al extracting oxygen from the predominantly present ZnO surface. This process resulted in the creation of an oxygen-deficient oxide, ultimately causing surface blackening.

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI–TOF MS) is a commonly used technique for analyzing large biomolecules. However, the utilization of organic matrices limits the small-molecule analysis because of the interferences in the low-mass region and reproducibility issues. To overcome these limitations, a surface-assisted laser desorption/ionization (SALDI), which utilizes nanostructured metallic surfaces, has been developed. Herein, a novel approach for SALDI–MS was proposed using nanoengineered gold shell with nanogaps on the silica core (SiO2@Au NGS), which is an emerging material due to its excellent heat-generating capabilities. The gold shell thickness was controlled by adjusting the concentration of gold precursor for the growth of gold nanoparticles. SALDI-MS measurements were performed on a layer formed by drop-casting a mixture of SiO2@Au NGS and analytes. At the optimized process, the gold shell thickness was observed to be 17.2 nm, which showed the highest absorbance. The ion desorption efficiency was confirmed with a survival yield upon fragmentation. Based on the enhanced SALDI capability, SiO2@Au NGS was utilized to detect various small molecules including amino acids, sugars, and flavonoids. The limits of detection, reproducibility, and salt tolerance of SiO2@Au NGS demonstrate its potential as an effective and reliable SALDI material for small-molecule analyses.

An understanding of the mechanism underlying fruit ripening is critical for fruit quality improvement. Although post-harvest ethylene application is known to enhance the onset of fruit ripening, exact mechanisms remain unclear. To characterize the fruit ripening process and mechanism, we investigated the effects of exposing kiwifruit cultivars ‘Hayward’ and ‘Gamrok’ to exogenous ethylene treatment post-harvest using comprehensive proteomic analyses. Comparative two-dimensional gel electrophoresis showed that most of the proteins aggregated in ethylene-treated samples compared to the control (non-treated). We observed that among all ethylene treatments, 95 proteins from ‘Hayward’ and 106 from ‘Gamrok’ were differentially expressed. Interestingly, among the elicited protein successfully identified by matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry, 50% from “Hayward’ and 60% from ‘Gamrok’ are associated with fruit ripening. Furthermore, 18% and 10% of proteins, respectively, are associated with defense response, whereas other major proteins are related to protein biosynthesis and photosynthesis/Calvin cycle. Interactions between identified proteins were demonstrated by bioinformatic analysis, providing insights into biological pathways and molecular functions in post-harvest kiwifruit ripening elicited by ethylene application. The present proteomic study in accordance with physiological analysis provides a quantitative evaluation of fruit ripening in response to exogenous ethylene in post-harvest kiwifruit.

This study compared condylar volume, length, and articular eminence (AE) characteristics in normal individuals and those with unilateral and bilateral juvenile idiopathic osteoarthritis (JOA). The 116 patients were divided into four groups: control (n=16), affected condyle of unilateral JOA (Aff-Uni) (n=36), non-affected condyle of JOA (NonAff-uni) (n=36), and bilateral JOA (Bi-JOA) (n=28). Volume and length differences in the condyle and AE were analyzed using ANOVA and Bonferroni post hoc tests. The results showed that Bi-JOA had significantly different condylar volume, especially in the condylar head (p&lt;0.01), specifically the middle, anterior, and medial parts (p&lt;0.05). Condylar length also differed among the groups, with differences observed between the control group and the other three groups, as well as between the bilateral group and the other three groups (p&lt;0.01). AE total volume differed between the control group and Aff-Uni. In the detailed comparison, Aff-Uni and NonAff-Uni were smaller than the control group in the posterior, lateral, and medial sections (p&lt;0.05). In conclusion, depending on the involvement of unilateral or bilateral JOA, there were differences in condylar volume and AE compared to the normal control group. Therefore, prognosis should be evaluated by distinguishing between patients with unilateral and bilateral JOA.

Agriculture (crop production, land use, and livestock) is the second most important greenhouse gas (GHG) emitting sector after the energy sector. Agriculture is also recognized as the source and sink of GHGs. Evidence demonstrates that the application of high amounts of nitrogen-rich fertilizers enhances methane (CH4) and nitrous oxide (N2O) emissions, which are potent GHGs with a high global warming potential (GWP). Considering its global contribution to the climate crisis, reducing GHG emissions in agriculture would considerably lower its share of the global GHG emission records, which may lead to enormous benefits for the environment and food production systems. Several diverging and controversial views questioning the actual role of plants in the current global GHG budget continue to nourish the debate globally. We must acknowledge that considering the beneficial roles of major GHGs to plants at a certain level of accumulation, implementing GHG mitigation measures from agriculture is indeed a complex task. This review seeks to provide key approaches for GHG mitigation in the literature (environmentally friendly crop cultivation and residue management practices, improvement of plants nutrients/fertilizer use efficiency, exploring the genetic diversity for low GHG emission, soil methane-producing bacteria, integrated soil fertility management, improved livestock feeding efficiency, and production, etc.). This work gathers key approaches from 275 peer-reviewed publications, including experimental research papers, review articles, and books, discussing greenhouse gas emissions mechanisms and mitigation to unravel effective strategies for GHG mitigation, proven to be effective or carry the potential to mitigate GHG generation from agriculture. This review also discusses in depth the significance and the dynamics of strategies regarded as game changers with a high potential to enhance, in a sustainable manner, the resilience of agricultural systems. Agricultural GHG mitigation approaches discussed in this work can serve as game changers in global efforts to reducing GHG emissions and alleviating the impact of climate change through sustainable agriculture and informed-decision making.

This study investigates the impact of brand lovemark on three customer behavioral outcomes (i.e., green brand loyalty, willingness to pay a deposit, and machine use intention) in coffee shops’ CSR practices. We used a scenario-based experimental design on CSR practices in two coffee shop brands (i.e., Starbucks and Dunkin'). The study demonstrates that consumers with a high level of brand lovemark respond more positively to CSR practices of coffee shops than do customers with a low level of brand lovemark. In addition, the interactions between brand lovemark and gender appear to be important in all three behavioral outcomes. Specifically, it confirms that men and women show different levels of behavior outcomes depending on their level of brand lovemark. Theoretical and managerial implications are also suggested with the direction for future study.

In this study, we evaluated the antibacterial effect against Staphylococcus aureus and Salmonella Typhimurium in fried fish paste using floating electrode-dielectric barrier discharge (FE-DBD) plasma (1.1 kV, 43 kHz, N2 1.5 m/s, 1-60 min). In addition, quality evaluation (pH, VBN) of fried fish paste was conducted after FE-DBD plasma treatment. When FE-DBD plasma was treated for 1, 5, 10, 20, 30 and 60 min, S. aureus decreased by 0.16-1.13 log10 CFU/g, and S. Typhimurium decreased 0.25-1.13 log10 CFU/g. Both decreased &gt; log10 CFU/g at 60 min. The D-value was 58.92 and R2 was 0.97 for S. aureus using first-order kinetics, and the D-value was 43.60 and R2 was 0.97 for S. Typhimurium using the Weibull model. There was no significant difference in pH after FE-DBD plasma treatment (p &gt; 0.05). However, volatile basic nitrogen (VBN) significantly decreased as the treatment time increased (p &lt; 0.05), and it was the lowest at 60 min to 3.46. Therefore, FE-DBD plasma treatment could be considered as a technology for preserving the quality of processed foods.

Conclusions: The mortality rate of people with disabilities from all causes did not significantly increase compared to the pre-COVID-19 era. However, COVID-related deaths among people with disabilities increased significantly.

Ranging from traditional food packaging, clothing, and furniture to the current small and large electronic devices and automobiles, plastics serve to fulfill diverse demands in our daily lives. However, the global plastic waste generation is dramatically escalating, currently standing at approximately 150 million metric tonnes annually. While some of regenerated plastics recycled by mechanical methods can be used as their parent plastics, cost and energy savings are limited by multiple preliminary processes such as plastic sorting, shredding, washing, and drying. Moreover, the continuous mechanical recycling process degrades the physical properties of the materials. In this context, chemical recycling is emerging as a promising alternative method due to its high efficiency, simple preliminary steps, reducing reliance on fossil resources, and conversion of plastic waste into value-added chemicals. This review provides a state-of-the-art overview of contemporary chemical recycling of polymeric materials via i) depolymerization: “polymers to small valuable molecules” and ii) closed-loop cycles: “polymers to monomers, and/or to polymers”, by encompassing both traditional/advanced depolymerization chemistries and the remaining challenges. These recycling approaches are contextualized within the present industrial technologies, key design principles, and specific recycling case studies related to distinct polymeric materials.

Purpose: To report the early clinical outcomes of combining intensity‐modulated radiation therapy (IMRT) and intensity‐modulated proton therapy (IMPT) in comparison with IMRT alone in treating the oropharynx cancer (OPC) patients. Materials and Methods: The medical records of 148 OPC patients were retrospectively reviewed, who underwent definitive radiotherapy (RT) with concurrent systemic therapy, from January 2016 till December 2019 at Samsung Medical Center. During the 5.5 weeks’ RT course, the initial 16 (or 18) fractions were delivered by IMRT in all patients, and the subsequent 12 (or 10) fractions were either by IMRT in 81 patients (IMRT only) or by IMPT in 67 (IMRT/IMPT combination), respectively, based on comparison of adaptive re-plan profiles and availability of equipment. Propensity‐score matching (PSM) was done on 76 patients (38 from each group) for comparative analyses. Results: With the median follow‐up of 24.7 months, there was no significant difference in overall survival and progression free survival between groups, both before and after PSM. Before PSM, IMRT/IMPT combination group experienced grade ≥3 acute toxicities less frequently: mucositis in 37.0% and 13.4% (p<0.001); and analgesic quantification algorithm (AQA) in 37.0% and 19.4% (p=0.019), respectively. The same trends were observed after PSM: mucositis in 39.5% and 15.8% (p=0.021); and AQA in 47.4% and 21.1% (p=0.016), respectively. In multivariate logistic regression, grade ≥3 mucositis was significantly less frequent in IMRT/IMPT combination group, both before and after PSM (p=0.027 and 0.024, respectively). AQA score ≥3 was also less frequent in IMRT/IMPT combination group, both before and after PSM (p=0.085 and 0.018, respectively). Conclusions: In treating the OPC patients, with comparable early oncologic outcomes, more favorable acute toxicity profiles were achieved following IMRT/IMPT combination than IMRT alone.

Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

Non-alcoholic steatohepatitis (NASH) is diagnosed by the occurrence of fat buildup, inflammation, and fibrotic changes within the liver. NASH has the capacity to proceed to the advancement of decompensated cirrhosis and carcinoma by inflammation and oxidative stress. Although Agrimonia pilosa has traditionally been used medicinal purposes, its effects on the liver remains incompletely elucidated. In this research, we assessed the therapeutic outcomes of Agrimonia pilosa extract (APE) on free fatty acid (FFA)-treated HepG2 cellular hepatic steatosis and in a choline-deficient, L-amino acid-defined, high-fat diet with 0.1% methionine (CDAHFD)-induced NASH mouse model. In FFA-treated cells, APE inhibited intracellular lipid accumulation, and regulated the mRNA and protein expressions of modulators of fatty acid (FA) synthesis as well as FA oxidation proteins, through down-regulation of the AMP-activated protein kinase/sirtuin 1 signaling pathway. In the CDAHFD-induced NASH mouse model, APE significantly enhanced liver histology and serum levels of liver damage. APE also significantly attenuated hepatic expression of mRNA and proteins related to FA synthesis, inflammation, and fibrosis. Furthermore, APE mitigated the expression levels of oxidative stress and endoplasmic reticulum stress. Overall, these discoveries indicate that Agrimonia pilosa has the potential to treat NASH by regulating hepatic lipid metabolism, alleviating inflammation, and mitigating oxidative stress.

β-apopicropodophyllin (APP), a derivative of podophyllotoxin (PPT), has been identified as a potential anti-cancer drug. This study tested whether APP acts as an an-ti-cancer drug and can sensitize colorectal cancer (CRC) cells to radiation treatment. APP had an anti-cancer effect against the CRC cell lines HCT116, and DLD-1, SW480 and COLO320DM with IC50 values of 7.88 nM, and 8.22 nM, 9.84 nM and 7.757 nM, respec-tively induction of DNA damage. Colonogenic and cell counting assays indicated that the combined treatment of APP and γ-ionizing radiation (IR) showed greater retardation of cell growth than either alone, suggesting that APP sensitizes CRC cells to IR. Annexin V-propidium iodide (PI) assays and immunoblot analysis showed that the combined treatment of APP and IR increased apoptosis in CRC cells compared with either APP or IR alone. Results obtained from the xenograft experiments also indicated that the combination of APP and IR enhanced apoptosis in in vivo animal model. Apoptosis induction by the combined treatment of APP and IR resulted from reactive oxygen species (ROS). Inhibition of ROS by N-acetylcysteine (NAC) restored cell viability and decreased the induction of apoptosis by APP and IR in CRC cells. Taken together, these results indicate that a combined treatment of APP and IR might promote apoptosis by inducing ROS in CRC cells.

Ovarian cancer poses a significant therapeutic challenge owing to the lack of specific targets for treatment. New treatment strategies are needed to improve patient outcomes and reduce the toxicity of existing therapies. This study aimed to investigate the synergistic effects of recombi-nant human apurinic/apyrimidinic endonuclease 1/redox factor 1 (rhAPE1/Ref-1) and aspirin on PEO14 and CAOV-3 ovarian cancer cells and human umbilical vein endothelial cells (HUVECs). Specifically, this study examined the mechanisms underlying the effect of rhAPE1/Ref-1 and as-pirin on cell death and the associated pathways. Cell viability was assessed using the MTT assay, and flow cytometry analysis and caspase-3/7 activity assays were conducted to determine apop-tosis. Western blotting was performed to evaluate the cleavage of poly(ADP-ribose) polymerase (PARP). Exposure to aspirin (3 mM) for 24 h did not affect cell viability in PEO14. Co-incubation of aspirin with rhAPE1/Ref-1 in PEO14 cells led to rhAPE1/Ref-1 acetylation and intracellular hyperacetylation. Co-treatment with aspirin (3 mM) and rhAPE1/Ref-1 induced a rhAPE1/Ref-1 concentration-dependent increase in cell death, particularly in PEO14 cells, as well as apoptosis, caspase-3/7 activation, and PARP cleavage. Furthermore, this combination treatment significantly increased paclitaxel-induced PEO14 cell death. Therefore, co-administration with rhAPE1/Ref-1 and aspirin is a potential strategy for ovarian cancer treatment.

As lung cancer shows the highest mortality in cancer related death, serum biomarkers are demanded for the lung cancer diagnosis and its treatment. To discover lung cancer protein biomarkers, secreted proteins from primary cultured lung cancer and adjacent normal tissues from patients were subjected to LC/MS-MS proteomic analysis. Quescin sulfhydryl oxidase(QSOX1) was selected as a biomarker candidate from the proteins enriched in the secretion of lung cancer cells. QSOX1levels were higher in 82% (51 of 62 tissues) of lung cancer tissues compared to adjacent normal tissues. Importantly, QSOX1 serum levels were significantly higher in cancer patients (p<0.05, AUC=0.89), when measured by multiple reaction monitoring(MRM). Higher levels of QSOX1 are also uniquely detected in lung cancer tissues among several other solid cancers by immunohistochemistry. QSOX1 knock-downed Lewis lung cancer (LLC) cells was less viable from oxidative stress and had reduced migration and invasion. In addition, LLC mouse models with QSOX1 knock-down also proved that QSOX1 functions in promoting cancer metastasis. In conclusion, QSOX1 might be a lung cancer tissue-derived biomarker and involved in the promotion of lung cancers, and thus can be a therapeutic target for lung cancers.

Acetic acid bacteria (AAB) are major contributors to the production of fermented vinegar, offering various cultural, culinary, and health benefits. Although the residual unpasteurized AAB after vinegar production are not pathogens, these are necessary the safety evaluations including antibiotic resistance for the use as starters. In this research, we investigated the antibiotics resistance profiles of 26 AAB strains, including various species of Komagataeibacter and Acetobacter, against ten different antibiotics using the E-test method. All strains exhibited resistance to aztreonam and clindamycin. Komagataeibacter species demonstrated a 50% resistance rate to ciprofloxacin, analogous to Acetobacter species, but showed twice the resistance rates to chloramphenicol and erythromycin. Genomic analysis of K. saccharivorans CV1 identified intrinsic resistance mechanisms, such as multidrug efflux pumps, thereby enhancing our understanding of antibiotic resistance in acetic acid-producing bacteria. These findings enhance understanding of antibiotic resistance in AAB for food safety and new antimicrobial strategies, suggesting the need for standardized testing methods and molecular genetic study.

Lindera obtusiloba Blume has several activities, such as anti-inflammatory, anti-allergic, anti-tumor, anti-wrinkle, and antioxidant activities. Interleukin-6 (IL-6) is a classic pro-inflammatory cytokine that is associated with various functions, such as proliferation, invasion, inflammatory responses and functions within antioxidant defence systems. In this study, we investigated IL-6-induced STAT3 activation of lignan compounds isolated from L. obtusiloba. The structures of the isolated compounds were elucidated via spectroscopic nuclear magnetic resonance (NMR) and electrospray ionization mass spectrometry (ESI-MS). As a result, seven lignans were identified from L. obtusiloba. All the isolated compounds (1-7) were evaluated for their IL-6-induced STAT3 inhibitory effects in Hep3B cells using a luciferase reporter assay. Of the isolates, compounds 1 and 5 showed inhibitory effects against IL-6-stimulated STAT3 activation. Furthermore, the mRNA expression levels of inflammation-related genes such as CRP, IL-1b, and SOCS3 were significantly reduced by exposure to compound 1 and 5. The protein levels of p-STAT3, p-JAK2 in IL-6 induced U266 cells were regulated in the presence of lignans derived from Lindera obtusiloba by western blot assay. Based on the results, this study of L. obtusiloba demonstrates that the species has promise as a bioactive candidate for the treatment of IL-6-induced STAT3-related disease.

Stereotactic radiosurgery (SRS) is considered the initial treatment for lung cancer patients with small-sized and limited number of brain metastases. The objective of this study was to assess clinical outcomes of SRS treatment using CyberKnife (CK) for recursive partitioning analysis (RPA) class II/III patients with one to three brain metastases from lung cancer and identify which patients in the high RPA class could benefit from SRS. A total of 48 lung cancer patients who received CK-based SRS for their metastatic brain lesions from 2010 to 2017 were retrospectively analyzed. Radiographic response was evaluated during follow-up period. Overall survival (OS) and intracranial progression-free survival (IPFS) were calculated and prognostic variables associated with OS and IPFS were evaluated. Median follow-up time was 6.6 months. Local control rates at 6 months and 1-year following SRS were 98% and 92%, respectively. The median OS of all patients was 8 months. One-year and 2-year OS rates were 40.8% and 20.9%, respectively. In multivariate analysis, uncontrolled primary disease (p = 0.008) and ECOG performance status of 2 or 3 (p = 0.001) were independent prognostic factors for inferior OS. These two factors were also significantly associated with inferior IPFS. In subgroup analysis according to RPA class, primary disease status was the only prognostic factor, showing statistically significant OS differences in both RPA class II and III (controlled vs. uncontrolled: 41.1 vs. 12.3 months in RPA class II, p = 0.031; 26.9 vs. 4.1 months in RPA class III, p = 0.011). Our results indicated that SRS could be an effective treatment option for RPA class II/III patients with brain metastases from lung cancer in the modern treatment era. SRS might be particularly considered for patients with controlled primary disease.

The main focus of this paper is to propose a comprehensive framework for the cognitive meas-urement and modelling of the built environment. This will involve exploring and measuring neural mechanisms. The aim is to create a foundation for further studies in this field that are consistent and rigorous. Additionally, this framework will facilitate collaboration with cognitive neuroscientists by establishing a shared conceptual basis. The goal of this research is to develop a human-centric approach for urban design that is scientific and measurable, producing a set of urban design guidelines that incorporate cognitive measurement and modelling. By doing so, the broader intention is to design urban spaces that prioritize human needs and well-being, mak-ing them more liveable.

Prevention and management of cytomegalovirus (CMV) reactivation is important to improve outcome of allogeneic hematopoietic cell transplantation (allo-HCT) recipients. The aim of this study was to analyze real-world data for incidence and characteristics of CMV infections until 1-year after allo-HCT under 100-day letermovir prophylaxis. A single-center retrospective study was conducted between November 2020 and October 2021. During the study period, 358 patients underwent allo-HCT, 306 of whom received letermovir prophylaxis. Cumulative incidence of clinically significant CMV infection (CS-CMVi) was 11.4%, 31.7%, and 36.9% at 14-weeks, 24-weeks, and 1-year post-HCT, respectively. In multivariate analysis, risk of CS-CMVi increased with graft-versus-host disease (GVHD) ≥ grade 2 (adjusted odds ratio 3.640 [2.036–6.510]; P &lt; 0.001). One-year non-relapse mortality was significantly higher in letermovir breakthrough CS-CMVi patients than those with subclinical CMV reactivation who continued letermovir (P = 0.002). There were 18 (15.9%) refractory CMV infection in this study population. In summary, letermovir prophylaxis is effective in preventing CS-CMVi until day 100, which increased after cessation of letermovir. GVHD is still a significant risk factor in letermovir prophylaxis era. Further research is needed to establish individualized management strategies especially in patients with significant GVHD or letermovir breakthrough CS-CMVi.

During the recent decades, global warming by greenhouse gas evolution has attracted worldwide attention and evermore strict regulations thereon have become institutionalized as international policies. In the process, more environment-friendly power generation technologies have been developed utilizing fossil fuels with a view to timely commercialization. As one of such “clean coal” technology, Integrated Gasification Fuel Cell system is a promising power generation means and COS hydrolysis reactor is installed downstream of coal syngas to remove acidic gas constituents such as H2S and COS. The most significant design parameters affecting performance of the COS hydrolysis reactor were selected to be GHSV, (catalytic) reaction temperature, and length ratio and numerical modeling was performed considering heat and fluid flow transfer as well as chemical reaction kinetics. Effect of the selected design parameters on the variation of conversion rate and reactant gas mixture concentration were comprehensively investigated to predict performance of COS hydrolysis reactor. Stochastic modeling of reactor performance was finally performed using Monte Carlo simulation and linear regression fitting.

Sperm during the freezing and thawing process is damaged by oxidative stress. Thus, its antioxidant scavenger is essential for sperm survival and death in frozen-thawed semen. We used melatonin and silymarin in experiments. Our study aimed to identify the effect of melatonin and silymarin on the motility and viability of sperm, reactive oxygen species (ROS), and nitric oxide (NO) production in frozen-thawed boar semen. Melatonin and silymarin were treated alone and co-treated in the fresh boar semen. Boar semen was collected using the gloved-hand method from ten crossbred pigs, and the age of the experimental ten male pigs was 28.7 ± 3.2 months. We evaluated sperm viability using SYBR-14 and PI kit, and ROS and NO production were detected by DCF-DA and DAF-2, respectively. The sperm motility was not significantly different between non-treatment and treatment. ROS and NO production in frozen-thawed sperm were decreased by melatonin and silymarin (P < 0.05). Moreover, silymarin significantly reduced NO production more than melatonin (P < 0.05). Melatonin (46.37 ± 1.10) and silymarin (46.13 ± 0.80) enhanced the viability of sperm (P < 0.05). We suggest that melatonin and silymarin are essential antioxidants in semen cryopreservation for protecting sperm damage and maintaining sperm viability. Melatonin and silymarin may be useful antioxidants in freezing boar sperm.

Background and Objectives: This study aimed to evaluate the effects of subtalar joint axis-based balance exercises on the anterior talofibular ligament (ATFL) thickness, ankle strength, and ankle stability after an arthroscopic modified Broström operation (AMBO) for chronic ankle instability (CAI). Materials and Methods: The study included 47 patients diagnosed with CAI who underwent AMBO and were randomly divided into three groups: control (n=11), general balance exercise (n=17), and subtalar joint axis balance exercise (n=19), regardless of the affected area. Participants in the exercise rehabilitation group performed exercises for 60 min twice a week for 6 weeks, starting 6 weeks after AMBO. ATFL thickness, ankle strength, and ankle dynamic stability were measured using musculoskeletal ultrasonography, Biodex, and Y-balance test, respectively, before and after treatment. Results: Compared with the remaining groups, the subtalar joint axis balance exercise group had reduced ATFL thickness (p = 0.000), improved ankle strength for eversion (p = 0.000) and inversion (p = 0.000), and enhanced ankle stability (p = 0.000). Conclusions: The study results suggests that subtalar joint axis-based balance exercises may contribute to the early recovery of the ankle joint after AMBO.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

Ral-interacting protein 76 (RLIP76) is a potential factor with vascular endothelial growth factor (VEGF) in the corpus luteum and tumor angiogenesis. RLIP76, VEGF, and hypoxia-inducible factor-1 (HIF-1) are proteins that activate angiogenic functions in tumor and endothelial cells. RLIP76 is a main factor in tumor growth, and VEGF is a major endothelial cell protein for angiogenesis. Also, RLIP76 regulates a small GTPase (R-Ras, oncogene) in cell survival, spreading, and migration. HIF-1 is important in the corpus luteum, tumor angiogenesis, and tumor growth. VEGF and HIF-1 regulate the angiogenic function of RLIP76, and RLIP76 controls vascular growth in endothelial and tumor cells. RLIP76, R-Ras, VEGF, and HIF-1 may be useful in the research of corpus luteum and cancer therapy and the study of mechanisms of tumor angiogenesis. This review will help to elucidate the roles of RLIP76/R-Ras and VEGF via HIF-1 in corpus luteum and tumor angiogenesis, tumorigenesis, and the specific regulation of RLIP76 in luteal, tumor, and endothelial cells. Thus, we reviewed the angiogenesis of the corpus luteum and tumor in the ovarian and tumor microenvironment.

In tire tread applications, achieving enhanced abrasion resistance, wet grip, and rolling resistance is crucial for optimizing overall performance. To realize improvements in these attributes for silica-filled tire tread compound, it becomes imperative to improve dispersity of silica filler with investigating the effect of each component in tire tread compound. In this work, we study the effect of styrene content within solution styrene butadiene rubber (SSBR) on the properties of tire tread compounds. A higher styrene segment within SSBR contributes to increased silica dispersion and crosslink density. Thus, tire tread compounds featuring SSBR with increased styrene content not only improve physical and mechanical properties but also enhance major characteristics tailored for tire tread applications. These findings provide valuable insights into advancing the reinforced performance of tire tread compounds through the strategic utilization of SSBR enriched in styrene content.

While appropriate nutrient intake is important for older adults, various oral problems cause de-creased masticatory function. This cross-sectional study aimed to identify the factors associated with decreased masticatory performance in older adults. Oral examinations were performed on 80 participants (mean age: 75.10 ± 5.64 years) to determine the number of functional tooth units (FTUs). Symptoms of periodontal and temporomandibular diseases were evaluated via a ques-tionnaire. The tone, elasticity, and dynamic stiffness of the masseter muscle were measured using the Myoton® PRO device. The mixing ability test was used to assess the masticatory performance and the mixing ability index (MAI) was calculated. The analysis of covariance test was performed to adjust for confounding factors and multiple logistic regression analysis was performed to identify the risk factors affecting MAI. A lower MAI was significantly associated with higher tone (p = 0.006) and lower elasticity (p = 0.013). The number of FTUs (adjusted odds ratio [OR] = 0.724, p = 0.029), tone (adjusted OR = 1.215, p = 0.016), and elasticity (adjusted OR = 4.789, p = 0.038) were independently associated with the MAI. Muscle function training and prosthetic treatments may help increase masticatory performance in older adults, which will improve overall health.

Powdery mildew disease, caused by Sphaerotheca fusca, is a major disease affecting cucumbers cultivated in greenhouses. This study was conducted to find defense genes induced by DL-3-amino-butyric acid (BABA) and powdery mildew in cucumber. The 2000 and 5000 mg/L BABA treated cucumber exhibited disease severity of 25% and 5%, respectively, whereas the water treated cucumber leaves were severely infected, with a disease severity of 90%. BABA did not effect spore germination of the powdery mildew pathogen,. showing BABA is not antifungal agent against the pathogen. In quantitative real-time PCR analysis, BABA treated cucumber upregulated transcriptional level of the defense genes CsPAL, CsPR3,CsPR1, CsLOX1, CsLOX23, Cs LecRK6.1, CsWRKY20, and Cupi4 in cucumber to maximum levels at 48 h, whereas CsLecRK6.1 reached maximum expression after 24 h and futher salicylic acid (SA) levels were significantly increased in BABA-treated cucumber plants. In addition, the infected cucumber with powdery mildew enhanced the expression levels from1.6 to 47.3 fold of the defense genes PAL, PR3, PR1, Lox1, Lox 23, LecRK6.1, WRKY20, and Cupi4 compared to heathy cucumber. The results suggests the BABA induced defense response is associated with SA signal pathway-dependent systemic acquired resistance (SAR) in cucumber, which is involved in plant resistance mechanisms.

The gut microbiota has been suggested as an important factor in the pathogenic mechanisms of amyotrophic lateral sclerosis (ALS). This study aimed to investigate whether the intake of different kinds of dietary fiber was related to the disease progression rate (∆FS) and survival time. In total, 272 sporadic ALS patients diagnosed according to the revised EI Escorial criteria were recruited from March 2011 and were followed-up until the occurrence of events or the end of September 2020. The events included percutaneous endoscopic gastrostomy, tracheostomy, and death. Dietary fiber intake was calculated based on a 24-hour dietary recall and classified according to five major fiber-rich foods: vegetables, fruits, grains, legumes, and nuts/seeds. Among the total participants, the group with ∆FS values lower than the mean ∆FS (0.75) was noted in the highest tertiles of total and vegetable fiber intake. Participants with the highest tertile of vegetable fiber intake showed longer survival in the Kaplan–Meier analysis (p = 0.033). Notably, vegetable fiber intake was negatively correlated with pro-inflammatory cytokine (interleukin [IL]-1β, IL-6, and monocyte chemoattractant protein-1) levels in the cerebrospinal fluid. This study showed that vegetable fiber intake could influence the disease progression rate and survival time. Further clinical trials are needed to confirm whether dietary fiber supplementation improves the prognosis of ALS.

Quality-changed behavior of ultraviolet light absorber (UVA: UV-326) in polymers (PP, HDPE, LDPE, PLA and PS) over time during degradation was studied with an enhanced degradation method (EDM) using sulfate ion radical in seawater. EDM was employed to homogeneously degrade the entire polymer samples containing the UVA. The PP and PS samples containing 5-phr UVA films whitened rapidly due to formation of numerous grooves or crushed particles. The UVA loss rate of PS with the higher Tg was much slower. The crystalline polymers, with the exception of PS, were similar in the behavior of the change in UVA loss rate with respect to degradation time. The significant increase in initial loss rate observed during EDM degradation was due to microplasticization. A similar increase in microplasticization rate occurred with the PS, but the intermolecular interaction between UVA and PS did not result in as pronounced its increase in loss rate as with other polymers. The UVA chemical structure was not altered by EDM degradation. These results revealed that the UVA leaching from the polymer matrix was the primary cause of the loss.

Mumps is the second-most reported infectious disease in South Korea; however, due to the low pathogen confirmation rate in laboratory diagnoses, we proposed a method for reevaluating the high incidence rate via the laboratory verification of other viral diseases. In 2021, 63 cases of pharyngeal or cheek mucosal swabs of suspected mumps cases in Gwangju, South Korea, were assessed for causative pathogens using massive simultaneous pathogen testing (TaqManTM Array Cards). More than one respiratory virus was detected in 60 cases (95.2%), 44 (73.3%) of which were co-detected. Human rhinovirus was detected in 47 cases, followed by human herpesvirus (HHV)6 in 30; HHV4 (17), human bocavirus (17), HHV5 (10), and human parainfluenza virus 3 (6) were also detected. Our findings suggest the need for further investigations on the pathogenesis of diseases mimicking mumps, which are considered to aid with appropriate public health responses, treatment, and the prevention of infectious disease outbreaks.

Preproenkephalin (PPE) is a precursor molecule for multiple endogenous opioid peptides Leu-enkephalin (ENK) and Met-ENK, which are involved in a wide variety of modulatory functions in the nervous system. Despite the functional importance of ENK in the brain, the effect of brain-derived factor(s) on PPE expression is unknown. We report the dual effect of neural epidermal growth factor (EGF)-like-like 2 (NELL2) on PPE gene expression. In cultured NIH3T3 cells, transfection of NELL2 expression vectors induced an inhibition of PPE transcription intracellularly, in parallel with downregulation of protein kinase C signaling pathways and extracellular signal-regulated kinase. Interestingly, these phenomena were reversed when synthetic NELL2 was administered extracellularly. The in vivo disruption of NELL2 synthesis resulted in an increase in PPE mRNA level in the rat brain, suggesting that the inhibitory action of intracellular NELL2 predominates the activation effect of extracellular NELL2 on PPE gene expression in the brain. Biochemical and molecular studies with mutant NELL2 structures further demonstrated the critical role of EGF-like repeat domains in NELL2 for regulation of PPE transcription. These are the first results to reveal the spatio-specific role of NELL2 in the homeostatic regulation of PPE gene expression.

Using the culture-work-health model, this study investigates the factors influencing the quality of life of maritime workers. This study conducted a survey of 320 maritime workers who have experience living and working on a ship for more than six months. This self-administered questionnaire included questions on organizational culture and support, self-efficacy, perceived fatigue, as well as the quality of work life. Organizational culture and self-efficacy were identified as factors affecting the quality of work life, while organizational support was found to have an indirect effect after passing through self-efficacy and perceived fatigue. The final model accounts for 63.1% of the variance in maritime workers’ quality of life. As such, this study shows that self-efficacy is important for the quality of life of maritime workers, having both direct and indirect effects. Moreover, organizational support may prove the primary intervention point for relieving perceived fatigue and enhancing self-efficacy, thus improving the quality of work life.

Safety management assessment systems for national level units’ in South Korea focus on responding capacity to cope with impending accident occurrence and danger occurrence. Since the four stage systems for prevention-preparation-response-recovery, which are core elements of national disaster management, assess the capacities by item such as those of individuals, disaster management departments, institutions, and management networks, there is no assessment function for the organic operation states of the entire systems. Therefore, for efficient disaster management, systematic evaluation indices that will enable active pre-checks in departments in organizations should be developed in place of the existing simply checking methods. In this study, an assessment model that will enable active disaster management centered on practice was developed using resilience engineering techniques. This model consists of disaster management items from the viewpoint of proactive responses instead of prevention. A total of 56 items that constitute four capacities; which are prediction (13 items), monitoring (14 items), proactive response (15 items), and safety learning (14 items) capacities were adopted in this model through Delphi analysis. Institutional capacities for infectious disease disaster management were evaluated based on this model and the resultant scores were prediction 4.41, monitoring 4.63, proactive response 4.69, safety learning 4.56 out of the full score of 5.0 points with an overall average of 4.51. This is an excellent capacity management score comparable to the score 4.57 of diagnosis of similar capacities by the WHO\_JEE (The Joint External Evaluation) in 2017. In fact, in 2015, when infectious disease capacity management was poor, in case of MERS (Middle East Respiratory Syndrome) infectious disease spread in South Korea, 36 patients died and 6,729 patients were isolated. However, through capacity reinforcement, in the case of MERS occurrence in South Korea in September 2018, a management capacity that prevented spread was shown as one confirmed case was completely cured in 10 days and 21 contacts were isolated and tested negative. Therefore, this capacity management assessment model is judged to be usable in enhancing disaster response and management capacities.

This study was conducted to investigate the correlations between social-emotional competence (SEC) and academic achievement (AA) among nursing students and to compare students’ level of each core skill of SEC (critical thinking disposition, self-directed learning, creativity, emotional intelligence, problem-solving, and collaboration) and academic achievement (clinical performance and subjective academic achievement). A cross-sectional design was adapted. Data were collected from 195 nursing students in the junior and senior years who had participated in clinical practicum from four universities in South Korea. General characteristics, levels of critical thinking disposition, self-directed learning, creativity, emotional intelligence, problem-solving, collaboration, and academic achievement were collected via self-reported questionnaire. Canonical correlation analysis was performed to evaluate the relationship between SEC and AA. The canonical correlation coefficient between SEC and AA was .762. Critical thinking disposition (Rs = .89), problem-solving (Rs = .86), cooperation (Rs = .80) made the most important contributions to SEC. Clinical performance (Rs=.95) and subjective AA (Rs=.57) were correlated with AA. SEC should be addressed to improve the AA of nursing students. All core skills of SEC should be regularly promoted. It is particularly urgent for nursing students to improve their creativity.

The wind observations for multiple levels (40–200 m) have been conducted for a long time (2016–2020) on Jeju Island of South Korea. This study aims at understanding the vertical and temporal characteristics of lower atmosphere. Jeju Island is a region located at mid-latitude and is affected by seasonal monsoon wind. The maximum wind speed appears in the lower layer during day time and is delayed in the upper layer during latter time in diurnal cycle. In summer season, the surface layer increases up to 160 m during day time via dominant solar radiation effect, which is higher than those for other seasons. However, the maximum wind speed in winter season appears irregularly among altitudes, and the surface layer is ~100 m, which is lower than that in summer season. It can be attributed to the increase in the mean wind speed in diurnal cycle caused by the strong northwestern wind for winter season. These results imply that the relationship between near-surface and higher altitudes is primarily affected by solar radiation and seasonal monsoon winds. These results are expected to contribute to site selection criteria for wind farms and to the assessment concerning planetary boundary layer modeling.

Unavoidable exposure to radiosensitive normal tissues around cancerous tumor during the radiotherapy can cause side effects such as self-limited acute toxicities, mild chronic symptoms, or severe organ dysfunction. Nevertheless, clinical use of currently available radiation protective agents is limited because of their generic cytotoxicity. A study on radiation protective effect of delphinidin was conducted with proton-beam-exposed human colon cells (CCD-18Co). The measurement in changes of survival fractions of CCD-18Co with/without delphinidin administration at different radiation doses were measured by 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) assay. The changes in expression of reactive oxygen species (ROS) and in activities of antioxidant enzymes were measured by colorimetric assays using pertinent assay kits. The measurement of pro-apoptosis/pro-survival protein expressions using Western blot assay and the measurement of DNA damage using comet assay were also fulfilled to evaluate the molecular level of radiation damages in CCD-18Co cells. The experimental results revealed that the pre-administration of delphinidin regulated antioxidant enzymes, reduced ROS, decreased DNA damage, regulated pro-apoptosis/pro-survival proteins, and eventually reduced apoptosis of CCD-18Co cells. In conclusion, it is claimed that delphinidin is nontoxic natural radiation protective compound, and thus delphinidin can be used to protect normal colon tissues during the proton beam therapy.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Flammability was evaluated and the results showed the values of critical flux at extinguishment (CFE) as 49.5kW/㎡ on average, total heat release (Qt) as 0.21MJ on average, and peak heat release rate (Qp) as 0.66kW on average, which satisfied all of the thresholds presented by the IMO. Therefore, flame-retardant plywood, of which the flame-retardant performance was evaluated, was determined to be an applicable finishing material that satisfies fire safety standards.

Rice production is a significant contributor to methane emissions, accounting for ap-proximately 11% of global anthropogenic emissions. However, methane emissions in rice fields could effectively be reduced by implementing proper management practices and careful cultivar selection. The impact of nitrogen fertilizers on methane emissions is mul-tifaceted, as these fertilizers enhance crop growth and influence the activity of me-thane-producing (methanogens) and methane-consuming microbes (methanotrophs), leading to complex outcomes in methane emissions. In this study, we used qPCR to quan-tify methanogens and methanotrophs using mcrA (methanogenesis-related gene) and pmoA (methane oxidation-related gene) primer sets under different nitrogen levels (0, 50, and 100%) and rice varieties. The results revealed that higher nitrogen input led to higher methanogen inhabitation in the rhizosphere. Additionally, the abundances of methano-gens and methanotrophs varied among the different rice varieties. Furthermore, it was observed that there may be an additive effect between the rice variety and nitrogen level used. These findings suggest that future breeding efforts should involve screening for me-thane-related microbes in rice cultivars adapted to low-nitrogen conditions. By identifying and selecting rice varieties that promote lower methanogen levels and higher metha-notroph inhabitation, significant steps can be taken to mitigate greenhouse gas emissions from rice cultivation.

Abstract: Rice production is a significant contributor to methane emissions, accounting for approximately 11% of global anthropogenic emissions. However, there is potential for effectively reducing methane emissions from rice fields through the implementation of proper management practices and careful cultivar selection. The impact of nitrogen (N) fertilizers on methane (CH4) emissions is multifaceted, as these fertilizers not only en-hance crop growth but also influence the activity of methane-producing microbes (Meth-anogens) and methane-consuming microbes (Methanotrophs), leading to complex out-comes in CH4 emissions. In this study, we utilized qPCR to quantify methanogens and methanotrophs using mcrA (methanogenesis-related gene) and pmoA (methane oxida-tion-related gene) primer sets under different nitrogen levels (0, 50, 100%) and rice varie-ties. The results revealed that higher nitrogen inputs led to higher methanogen inhabita-tion in the rhizosphere. Additionally, the abundances of methanogens and metha-notrophs varied among different rice varieties. Furthermore, through the analysis of two-way ANOVA, it was observed that there may be an additive effect between rice variety and nitrogen level. Furthermore, enhancing agronomic traits related to yield can reduce methanogen inhabitation. These findings suggest that future breeding efforts should in-volve the screening of methane-related microbes in rice cultivars adapted to low nitrogen conditions. By identifying and selecting rice varieties that promote lower methanogen lev-els and higher methanotroph inhabitation, we can take significant steps towards mitigating greenhouse gas emissions from rice cultivation.

According to Hofstede’s theory of cultural dimensions, cultures differ in cultural values and norms; values and norms that may influence differences in trendsetting, creative traits and behaviors, and pro-environmental behaviors. Further, because men and women have been socialized within particular cultures, gender differences may exist in trendsetting, creative traits and behaviors, and pro-environmental behaviors. Trendsetters have characteristics that are interrelated with creative traits and behaviors, perhaps inclining them to endorse pro-environmental behaviors. However, the interrelationships among these variables remain unexplored. Thus, the purpose of this study was to examine these three variables among college students in South Korea and the United States, specifically looking at cultural and gender differences. Participants were 225 Korean college students and 221 U.S. college students. Questionnaires included demographic items and scales measuring trendsetting, creative traits and behaviors, and pro-environmental behaviors. Data analyses included descriptive statistics, Cronbach’s alpha reliability, MANOVA, ANOVA and SNK posthoc test. Results show that U.S. (vs Korean) students indicated greater trendsetting and creative traits and behaviors but not greater pro-environmental behaviors. Fashion trendsetting groups in both Korea and the U.S. differed in creative traits and behaviors and pro-environmental behaviors. Among Korean trendsetting groups, reluctant adopters scored lowest on creative traits and behaviors and pro-environmental behaviors. Among U.S. trendsetting groups, trendsetters scored highest on creative traits and behaviors and pro-environmental behaviors; reluctant adopters scored lowest on pro-environmental behaviors. Theoretical and practical implications are provided for researchers and marketers.

Nowadays, in order to improve asphalt pavement performance, durability and reduce environmental pollution caused by asphalt binder, many researchers are studying to modify asphalt concrete (AC) and find alternative paving materials to extend service life of asphalt pavement. One of the successful materials used in a modification of AC are fibers. Different types of fibers have been reinforced in AC mixture and improvements have been observed. This research studies the performance of glass wool fiber reinforced in a dense-graded asphalt mixture. Generally, glass fibers are known to have excellent mechanical properties such as high tensile modulus, 100% elastic recovery and a very high tolerance to heat. The glass wool fibers are commonly used as a thermal insulation material. In this research to evaluate the performance of glass wool fiber in AC, laboratory tests Marshall mix design test, Indirect tensile strength (IDT), Tensile strength ratio (TSR) and Kim test were conducted to determine a proper mix design, tensile properties, moisture susceptibility, rutting and fatigue behaviors. Results show that addition of glass wool fibers does affect the properties of AC mixture. The use of glass wool fibers showed a positive consistence results, in which it improved the moisture susceptibility and rutting resistance of the AC. Also result showed addition of fiber increased tensile strength and toughness which indicates that fibers have a potential to resist distresses that occur on a surface of the road as a result of heavy traffic loading. The overall results showed that addition of glass wool fiber in AC mixture is beneficial in improving properties of AC pavements.

According to statistics from the Food and Agriculture Organization, the world population will increase to about 91 million (Asia 51 million, Africa 19 million). A rise in the world’s population means an increased need for food. However, climate change has caused desertification and unpredictable weather, creating problems in the supply and demand of food. Sweet potato (Ipomoea batatas) is an alternative to solving the food problem, as it is one of the world’s most important food crops, especially in developing countries. The tuberous roots of sweet potato are usually used as staple food, animal feed, industrial material, or raw material for alcohol production. In the future, more variations of sweet potato will be needed for breeding this crop. Recently, molecular markers developed for sweet potato have demonstrated good potential for use in genetic selection. In this study, a cDNA library was constructed from the total RNA of sweet potato leaves. A total of 789 copies of the cDNA were cloned in Escherichia coli by employing the pGEM-T Easy vector. Sequencing was carried out by Solgent Co. (Korea). As many as 579 expressed sequence tag–simple sequence repeat (EST-SSR) markers were designed (73.38%) from the known cDNA nucleotide base sequences. The lengths of the developed EST-SSR markers ranged from 100 to 499 bp (average length 238 bp). Their motif sequence types were varied, with most being dinucleotides and pentanucleotides, and the most commonly found motifs were CAGAAT (29.0%) and TCT (2.8%). Based on these SSR-containing sequences, 619 pairs of high-quality SSR primers were designed using WebSat and Primer3web. The total number of primers designed was 144. Polymorphism was evident in 82 EST-SSR markers among 20 Korean sweet potato cultivars tested and in 90 EST-SSR markers in the two parents of a mapping population, Yeseumi and Annobeny. In this study, the hexaploid sweet potato (2n = 6x = 90) EST-SSR markers were developed in the absence of full-sequence data. Moreover, by acting as a molecular tag for particular traits, the EST-SSR marker can also simultaneously identify information about the corresponding gene. These EST-SSR markers will allow the molecular analysis of sweet potato to be done more efficiently. Thus, we can develop high-quality sweet potato while overcoming the challenges from climate change and other unfavorable conditions.

Background: Young adults, particularly university students might be at greater risk of developing psychological distress, and exhibiting symptoms of anxiety and depression during the COVID-19 pandemic. Objective: The primary objective of this study was to explore and compare the determinants and predictors of mental health (anxiety and depression) during and after COVID-19 lockdown among university students. Methods: This was an observational, cross-sectional study with a sample size of 417 students. An online survey utilizing International Physical Activity Questionnaire–Short Form (IPAQ-SF), General Anxiety Disorder–7 (GAD-7) and Patient Health Questionnaire-9 (PHQ-9) was distributed to Universiti Tunku Abdul Rahman students via Google forms. Results: During lockdown, family income [χ² (1, n=124) = 5.155, p=0.023], and physical activity [χ² (1, n=134) = 6.366, p=0.012] were associated with anxiety, while depression was associated with gender [χ² (1, n=75) = 4.655, p=0.031]. After lockdown, family income was found to be associated with both anxiety [χ2 (1, n=111) = 8.089, p=0.004], and depression [χ2 (1, n=115) =9.305, p=0.002]. During lockdown, family income (OR=1.60, p=0.018), and physical activity (OR=0.59, p=0.011) were predictors for anxiety, and gender (OR=0.65, p=0.046) being the only predictor for depression. After lockdown, family income was a predictor for both anxiety (OR=1.67, p=0.011), and depression (OR=1.70, p=0.009). Conclusion: Significant negative effects attributed to the COVID-19 lockdown, and certain factors predisposed to the worsening of mental health status in university students. Family income, physical activity level, and gender were some of the major determinants that influenced the anxiety and depression.

To decrease oral pathogens and increase the number of beneficial bacteria, probiotics and bioactive compounds made via microbial bioconversion are recently used. In addition, the interest regarding probiotics-mediated bioconversion with popular medicinal plants is increasing. These compounds produced during the process exhibit synergistic effect and enhance a variety of biological activities including pathogen inhibition in host. Therefore, we developed bioconverted milk with high inhibitory activity against oral pathogens and α-glucosidase. Lactiplantibacillus plantarum SMFM2016-RK was chosen as the probiotic due to its beneficial characteristics such as high acid and bile tolerance, antioxidant activity, and α-glucosidase inhibition. Based on the minimal bactericidal concentration against three oral pathogens, the following appropriate concentrations of Artemisia herba-alba extract were added to milk: 5 mg/mL of A. herba-alba ethanol extract and 25 mg/mL of A. herba-alba hot-water extract. Four bioconverted milks (BM), BM1, BM2, BM3, and BM4, were produced by combining L. plantarum SMFM2016-RK alone, L. plantarum SMFM2016-RK and ethanol extract, L. plantarum SMFM2016-RK and hot-water extract, and L. plantarum SMFM2016-RK with both extracts. As a result of antimicrobial activity, BM3 inhibited the growth of Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis the most, and BM4 suppressed the growth of Fusobacterium nucleatum the most. In addition, bioconverted milk containing A. herba-alba (BM2, BM3, and BM4) inhibited α-glucosidase more effectively than BM1. In conclusion, A. herba-alba-added milk bioconverted by L. plantarum SMFM2016-RK displayed the growth inhibitory effect on oral pathogens and the α-glucosidase inhibitory activity, thus it necessitates to evaluate the effects on the alleviation of oral diseases and glycemic control through future animal experiments.

If an algebra of type $A$ contains a subalgebra which is also an algebra of type $B$, then it is a Smarandache $B$-type $A$-algebra provided the subalgebra of type $B$ contains at least two elements. This generalizes the notion of Smarandache group, where the group of order $\geq 2$ is a subsemigroup of a semigroup. In this paper we investigate a number of such pairings and we deduce a number of conclusions as a consequence.

In this paper, we observe that if X is a set and (Bin(X), □) is the semigroup of binary systems on X, then its center ZBin(X) consists of the locally-zero-semigroups and that these can be modeled as (simple) graphs and conversely. Using this device we show that we may obtain many results of interest concerning groupoids by reinterpreting graph theoretical properties and at the same time results on graphs G may be obtained by considering them as elements of centers of the semigroups of binary systems (Bin(X), □) where X = V(G), the vertex set of G.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Cisplatin induces early-onset ototoxicity, resulting in hearing loss. The exact mechanism by which cisplatin causes ototoxicity remains unclear. The purpose of this study was to identify the involvement of receptor-interacting protein kinase(RIP)3-dependent necroptosis in cisplatin-induced ototoxicity in animal models. Sprague–Dawley rats (SD, 8 week) were treated via intraperitoneal (i.p) injection with cisplatin (16 mg/kg for 1 day), and their hearing thresholds were was measured by the auditory brainstem response (ABR) method. Hematoxylin and eosin (H-E) staining, immunohistochemistry, and western blots were performed to determine the effect of cisplatin-induced ototoxicity on cochlear morphology. H-E stains outlined necroptotic changes in the organ of Cortis (OCs) and spiral ganglion neurons (SGNs). Additionally, immunohistochemistry and western blot analysis showed overexpression of RIP3 in the OCs and SGNs that were treated with cisplatin. These results suggest that RIP3-dependent necroptosis was substantial in cisplatin-induced ototoxicity; inner cochlear regions, the OCs, and SGNs were especially sensitive to necroptosis.

Detecting the presence of explosives is important to protect human lives in military conflicts and peacetime. Gas-phase detection of explosives can make use of the change of material properties, which can be sensitive to environmental conditions such as temperature and humidity. This paper describes a remote-controlled automatic shutter method for environmental impact assessment of photoluminescence (PL) sensors under near-open conditions. Utilizing the remote-sensing method, we obtained environmental effects without being exposed to sensing vapor molecules, and explained how PL intensity was influenced by the temperature, humidity, and exposure time. We also developed a theoretical model including the effect of exciton diffusion for PL quenching, which worked well under limited molecular diffusions. Incomplete recovery of PL intensity, or degradation effect, was considered as an additional factor in the model.

Development of bioresponsive extrudable hydrogels for 3D bioprinting is imperative to address the growing demand for scaffold design and efficient and reliable methods of tissue engineering and regenerative medicine. This study proposed genipin-crosslinked gelatin-hyaluronic acid hydrogel bioink with different amounts of gelatin tailored for 3D bioprinting, focusing on high cell density loading and less artificial extra-cellular matrix (ECM) effect, as well as exploring their potential applications in tissue engineering. The bioresponsiveness of these hydrogel scaffolds was successfully evaluated in different physiological conditions. 3D and four-axis printing of complex structures such as shapes of hollow tube, star, pyramid, and four-axis tubular scaffolds prove the hydrogel’s high extrusion ability and post-printing shape fidelity. Cytocompatibility and high cell density 3D bioprinting using this moderately stable hydrogel exhibit high potential for precise cell-delivery modes in tissue engineering as well as regenerative medicine.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In federated learning (FL), clients train models locally without sharing raw data, ensuring data privacy. In particular, federated distillation transfers knowledge to clients regardless of the model architecture. However, when groups of clients with different data distributions exist, sharing the same knowledge among all clients becomes impractical. To address this issue, this paper presents an approach that clusters clients based on the output of a client model trained using their own data. The clients are clustered based on the predictions of their models for each label on a public dataset. Prior knowledge of the number of groups is not required. Evaluations on the MNIST dataset showed that our method accurately identified these group structures and improved accuracy by 15–75% compared with traditional federated distillation algorithms when distinct group structures were present. Additionally, we observed significant performance improvements in smaller client groups, bringing us closer to fair FL.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This study analyzed eye examination data from the 5th Korea National Health and Nutrition Examination Survey to investigate the relationship between cataract prevalence and sunlight exposure among Koreans. Out of 952 individuals from 192 districts surveyed from January to December, statistical analyses using SPSS version 26, including chi-square tests and logistic regression, were conducted. Results: Results showed that the incidence of cataracts was higher in people exposed to sunlight for more than 5 hours. Regarding gender, the incidence of cataracts was higher in female in the 2-5 hours of sunlight exposure group, and in male in the group exposed to sunlight for more than 5 hours. Age significantly increased cataracts after age 45 in both groups. Additionally, the prevalence was higher among college graduates in the 2 to 5 groups, and among elementary school graduates in the more than 5 hours usage group. In urban areas, the cataract prevalence rate was higher in the 2-5-hour usage group, and in rural areas, the cataract prevalence was higher in the more than 5-hour usage group. In conclusion, prolonged sunlight exposure, particularly over 5 hours, correlated with higher cataract prevalence among Koreans, with various demographic factors influencing incidence rates.