Infectious keratitis (IK) represents a major cause of corneal blindness. This study aims to investigate the demographics, risk factors, microbiological characteristics and antibiotic susceptibility patterns of IK in Taiwan over the past 15 years. A retrospective population-based study was conducted using the Chang Gung Research Database. Patients with IK were identified by diagnostic codes for corneal ulcer from 2004 to 2019. Of 7807 included subjects, 45.2% of patients had positive corneal cultures. The proportion of contact lens-related IK declined, while that of IK related to systemic diseases grew. The percentage of isolated gram-positive bacteria surpassed that of gram-negative bacteria in the 15-year period. The prevalence of Pseudomonas aeruginosa showed a decreasing trend (p = 0.004), whereas coagulase-negative Staphylococcus (CNS) and Propionibacterium species were increasingly detected (p < 0.001). Overall, the trend of antibiotic susceptibility of both gram-positive and gram-negative bacteria did not change throughout the study period. The susceptibility to the test antibiotics maintained over 90% in gram-negative isolates during 15 years. Vancomycin preserved 100% susceptibility to all gram-positive isolates. Since most tested antibiotics exhibited stable susceptibility over decades, this study reinforced that fluoroquinolones and fortified vancomycin continue to be good empiric therapies for treating bacterial keratitis in Taiwan.

The twisted Wang transform distribution family, defined as the composition of parameter shifted inverse CDF function with an original CDF function, is found to be most suitable for matching low shape factor distributions, characterizing hard to fit or to simulate reinsurance portfolio losses for some perils from our previous study. Among them, the best form for matching a hard-to-fit empirical loss distribution for a specific peril, is the Exponential Fractional Extra Power 0 Distribution in (0,1) with CDF:.The simplest yet still a good form of this family is the Transformed Hyperbolic Tangent Distribution with CDF:,which has analytical formulas for the moments. The twisted Wang transform distribution family is compared and confirmed to be superior to all other well-known distribution families through extensive numerical optimization practice, distribution forms guesses, and computer-aided exploration experiments.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

This research uses ARM-based FPGA to implement the computation of a virtual-real fusion hardware system. It also evaluates the acceleration effect of virtual-real fusion execution speed after connecting related hardware acceleration and provides a reference for real-time information fusion system design. The hardware uses Xilinx Zynq UltraScale+ MPSoC ZCU102 Evaluation Kit. It also obtains color and depth images with Intel® RealsenseTM D435i depth cameras. This system receives image data through the Linux system built on the ARM and fed to the FPGA for object detection using CNN models. In addition, it develops a module for rapidly performing registration between the color images and the depth images. It can calculate the size and position of the display information on the transparent display according to the pixel coordinates and depth values of the human eye and the object. The fusion took about 47ms on a personal computer with a GPU RTX2060 and 25ms on the ZCU102. The acceleration is nearly 168%. Finally, the results were successfully transplanted into the retail display system for demonstration.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

Existing methods for 3D human pose estimation mainly divide the task into two stages. The first stage identifies the 2D coordinates of the human joints in the input image, namely the 2D human joint coordinates. The second stage uses the results from the first stage as input to recover the depth information of human joints from the 2D human joint coordinates to achieve 3D human pose estimation. However, the recognition accuracy of the two-stage method relies heavily on the results of the first stage and includes too many redundant processing steps, which reduces the inference efficiency of the network. To address these issues, we propose the EDD, a fully End-to-end 3D human pose estimation method based on transformer architecture with Dual Decoders. By learning multiple human poses, the model can directly infer all 3D human poses in the image using a pose decoder, and then further optimize the recognition result using a joint decoder based on the kinematic relations between joints. With the attention mechanism, this method can adaptively focus on the most relevant features to the target joint, effectively overcoming the feature misalignment problem in the human pose estimation task and greatly improving the model performance. Any complex post-processing step, such as non-maximum suppression, is eliminated, further improving the efficiency of the model. The results show that the method achieves an accuracy of 87.4% on the MuPoTS-3D dataset, significantly improving the accuracy of end-to-end 3D human pose estimation methods.

Background: Disulfidptosis, a recently identified form of cell death triggered by excessive cysteine accumulation and subsequent disulfide stress, has emerged as a novel mechanism of cell death. Despite its significance, the role of disulfidptosis in the tumor microenvironment (TME) remains poorly understood. Methods: In this study, we employed single-cell RNA sequencing data from 100,987 cells of 11 osteosarcoma (OS) patients. Using the non-negative matrix factorization (NMF) algorithm, we performed dimensionality reduction analysis to identify distinct subtypes characterized by 14 disulfidptosis-related genes across major cell types within the TME. Subsequently, we assessed the prognosis and immunotherapy response associated with each disulfidptosis-related subtype, leveraging publicly available databases comprising osteosarcoma data and immunotherapy cohorts. Results: We identified distinct subtypes within tumor-associated fibroblasts, tumor-infiltrating lymphocytes, and macrophages, which we named and annotated based on their characteristic genes. Furthermore, we observed a close association between disulfidptosis-related genes and key biological features of immune cells within the TME, elucidating inferred pseudotime trajectories. Notably, integrating bulk-seq data of osteosarcoma patients, we observed significant differences in overall survival rates among the disulfidptosis-related subtypes. Particularly, the disulfidptosis-related subtype within tumor-associated fibroblasts exhibited superior discriminatory ability in predicting the response of patients undergoing immunotherapy, surpassing other cell subtypes. Our cell-cell communication analysis highlighted extensive and specific interactions between disulfidptosis-related subtypes and osteosarcoma cells. Furthermore, we confirmed the histological localization of the CAPZB+CAF subtype within osteosarcoma tissue and osteoclastoma using immunofluorescence (IF) techniques. Conclusions: Collectively, our study sheds light on the intercellular communication facilitated by disulfidptosis in the TME, underscoring its involvement in the biological functions and immunotherapy response of osteosarcoma.

Using the 2011-2020 digital inclusive finance data released by Peking University and the index system constructed by the Blue Book of China Rural Revitalization and Development Index (2018), this paper analyzes the dynamic evolution of the digital inclusive finance and the rural revitaliza-tion from time and space dimensions with the help of kernel density estimation, Markov chain and Moran index. Using The Gini coefficient decomposition method to analyze the source of differ-ences in digital inclusive finance, and then using the spatial autoregressive (SAR) model and ge-ographically weighted regression (GWR) model to study the boosting effect of digital inclusive finance on rural revitalization from the perspective of spatial aggregation and spatial differentia-tion, respectively. The results show that: (1) The growth rate of China's digital inclusive finance slows down year by year, and the inter-provincial differences increase year by year and show gradient characteristics, indicating that there may be a trend of multipolar differentiation. The overall level of Rural Revitalization shows an increasing trend, and the gap between provinces is still apparent. (2) The evolution of digital inclusive finance and rural revitalization is a slow ad-justment process, and there has been no cross-level jump in the past ten years. In digital inclusive finance, the liquidity from the highest and lowest levels to the medium level is high. However, the liquidity in the states of rural revitalization development level is not high. (3) Rural revitalization has a positive spatial spillover effect. The level of rural revitalization in the western area is signif-icantly lower than in the eastern area. At the same time, there is no significant difference between the east and central areas. The depth of the use of digital inclusive finance has a significant positive impact on the revitalization and development of rural areas, indicating that the further promotion of digital inclusive finance business in rural areas can substantially boost the revitalization of rural areas. (4) The boosting effect of digital inclusive finance on rural revitalization shows prominent spatial differentiation characteristics. The depth of use and the degree of digitization generally show a positive impact. The central and eastern coastal cities have the highest impact, decreasing toward the southwest and northeast. The areas with the lowest usage depth impact are clustered in the northeast, and the areas with the lowest digitization impact are clustered in the southwest.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Natural products are an important source of antibacterial agents. Canthin-6-one alkaloids have displayed potential antibacterial activity based on our previous work. In order to improve the activity, twenty-two new 3-N-benzylated 10-methoxy canthin-6-ones were designed and synthesized through quaternization reaction. The in vitro antibacterial activity against three bacteria was evaluated by double dilution method. Four compounds (6f, 6i, 6p and 6t) displayed 2-fold superiority (minimum inhibitory concentration (MIC) = 3.91 µg/mL) against agricultural pathogenic bacteria R. solanacearum and P. syringae than agrochemical propineb. Moreover, the structure–activity relationships (SARs) were also carefully summarized in order to guide the development of antibacterial canthin-6-one agents.

Many studies have focused on the impacts of rainfall duration and intensity while overlooking the role of rainfall patterns on intensive tillage erosion in hilly agricultural landscapes. The objective of this study was to determine the combined effects of rainfall patterns and intensive tillage erosion on surface runoff and soil loss on sloping farmland in the purple-soil area of China. Five simulated rainfall patterns (constant, rising, falling, rising-falling, and falling-rising) with the same total precipitation were designed, and the intensive tillage erosion treatment (IT) and no-tillage treatment (NT) were subjected to simulated rainfall using rectangular steel tanks (2 m × 5 m) with a slope of 15°. To analyse the differences in the hydrodynamic characteristics induced by tillage erosion, we calculated the flow velocity (V), Reynolds number (Re), Froude number (Fr), and Darcy-Weisbach resistance coefficient (f). The results indicate that significant differences in surface runoff and soil loss were found among different rainfall patterns and stages (P < 0.05). The falling pattern and falling-rising pattern had faster runoff-initiating times and larger sediment yields than those of the other rainfall patterns. f varied from 0.30 to 9.05 for the IT and 0.48 to 11.57 for the NT and exhibited an approximately inverse trend to V and Fr over the course of the rainfall events. Compared with the NT, the mean sediment yield rates from the IT increased the dynamic range of 8.34%–16.21% among different rainfall patterns. The net contributions of the IT ranged from 2.77% to 46.39% on surface runoff and 10.14%–78.95% on soil loss on sloping farmland. Surface runoff and soil loss were positively correlated with rainfall intensity, V, and Fr but negatively correlated with f irrespective of tillage intensive (P < 0.05). For varying-intensity rainfall patterns, soil and water loss fluctuated during rainfall events, suggesting that the changes in rainfall intensity and tillage intensity would result in drastic variations in soil hydrological characteristics and sediment transport mechanisms. The time sequences of rainfall intensity in each rainfall pattern significantly affected surface runoff, soil erosion, and their contribution rates to total soil and water loss. Moreover, tillage erosion effects on soil and water loss were closely related to rainfall patterns in hilly agricultural landscapes. Our study not only sheds light on the mechanism of tillage erosion and rainfall erosion but also provides useful insights for developing tillage-water erosion prediction models to evaluate soil and water loss on cultivated hillslopes.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Fabry-Perot air chamber was constructed at the melting point (splicing location) of two single-mode fibers by glycerin assisted self-expansion method. The morphology of the Fabry-Perot air chamber was fabricated and optimized by modulating the splicing parameters (drawing process, discharging location, time and intensity) and the fibers’ end-face (plane or arc). The in-line or reflected Fabry-Perot cavities have been applied to determine the tensile strain in the range of 0-1.2 N. The train sensing performance of the spherical shaped FP cavity has been experimentally demonstrated with the best sensitivity of 3.628 nm/N, corresponding to the resolution of ~0.005 N. The proposed FP fiber sensor has the advantages of low cost, fast fabrication and easy-integration with the common fiber system.

Abstract: This study was aimed to determine the influence of the volume fraction of steel fibers and on fracture parameters of concrete. Fifty notched steel fiber reinforced concrete (SFRC) beams and ordinary concrete beams with dimensions of 100mm×100mm×515mm were cast and tested via three-point bending test. Among them, the type of steel fiber is milling type (MF), and the volume fraction of steel fiber added is 0%, 0.5%, 0.5%, 1.5%, 1.5%, 2%, respectively. The effects of the steel fiber volume fraction (VF) on the critical stress intensity factor (KIC), fracture energy (GF), the deflection at failure(δ0), the critical crack mouth opening displacement (CMODC) and the critical crack tip opening displacement (CTODC)were studied. Through the analysis of test phenomena and test data such as load-deflection (P-δ) curve, load-crack mouth opening displacement (P-CMOD) curve and load-crack tip opening displacement (P-CTOD) curve following conclusions are drawn: With the increase of steel fiber volume fraction, some fracture parameters increase gradually and maintain a certain linear growth. The gain ratio of fracture parameters increases significantly, and the gain effect is obvious. Through this law of growth, the experimental statistical formulas of fracture energy and critical stress intensity factor are summarized.

The use of cemented aeolian sand-fly ash backfill (CAFB) material to fill the mining area to improve the surface subsidence damage caused by underground coal mining is in the development stage. Their performance with large overflow water and strength loss is not well understood. Few research has been conducted to understand the effects of aeolian sand and coal gangue on the rheological properties of CAFB with plasticizers. Therefore, the aim of this study is to investigate the effects of a plasticizer on the rheological properties, specifically yield stress and viscosity, of CAFB prepared with aeolian sand and coal gangue. CAFB mixes containing 0%, 0.05%, and 0.1% plasticizer were prepared, and yield stress and viscosity were determined at different time intervals over the period. Additional tests, such as thermal analysis and zeta potential analysis were also conducted. It was found that the rheological properties of CAFB is the comprehensive manifestation of the composite characteristics of various models. Reasonable particle size distribution and less amount of plasticizer can ensure the stability of slurry structure, reduce the slurry settlement and the risk of pipe blocking. The findings of this study will be beneficial in the design and production of CAFB material.

Epoxy powders offer a low-cost means of manufacturing thick section composite parts, such as those found in wind and tidal turbines. Currently, their processing cycle includes a lengthy drying stage (≥ 15 h) to remove ambient moisture. This prevents void defect formation and, thereby, a reduction in mechanical properties, however, it constitutes up to 60% of the processing time. Little research has been published on the study of this process or its optimisation. Experimental and simulated analyses are used to investigate the effects of hygroscopicity in epoxy powder composites. In particular, focus is given to the drying process, which is used to prevent void defect formation and, thereby, a reduction in mechanical properties. As such, tests are performed to quantify the void content of dried and undried laminates, and to measure its impact on transverse flexural strength. Dynamic vapour sorption analysis is used to study the sorption behaviour of the epoxy powder. Sorption data is fitted to a modified linear driving force model, and then implemented in existing process simulations tools. The drying of a thick epoxy powder composite section is simulated to investigate the influence of powder sintering on the duration required for drying. It is shown that the epoxy powder is slightly hygroscopic (1.36 wt%) and exhibits sorption behaviour that is characteristic of glassy polymers. This results in up to 4.8% voids (by volume) if processed in an undried state, leading to a 43% reduction in transverse flexural strength. Process simulations reveal that a standard drying cycle prematurely sinters the powder; inhibiting moisture release. By maintaining a powder state, simulations show that the drying cycle can be reduced to 5 h.

In this paper, the Fourier-based synchrosqueezing transform (FSST) method is introduced into the power system to realize low frequency oscillation identification. Firstly, the modal components of low frequency oscillation signal are separated by FSST, and calculating the instantaneous parameters including magnitude, frequency and phase of every mode component with Hilbert transform. Then , calculating the damping ration of every modal component based on above parameters and derived the formulas. Thus, it realized effective identification of of modal parameters of low frequency oscillation signal. The experimental results of simulated data and 16-generator system demonstrate the validity and correctness of the FSST method. Comparing with the classical Prony method shows that the FSST method is better in the identification accuracy when the low frequency oscillation signal is polluted by noise. Finally, the effectiveness of the FSST in Actual power grid is verified based on the real data from Sichuan power grid.

The Oryzaephilus surinamensis L. (Coleoptera: Silvanidae), is widely distributed all over the world, this beetle causes serious damage to stored products. Much attention has been paid to use food attraction or food volatile as a non-pollution method to achieve pest management. However, in this study, six most attractive food to O. surinamensis were selected among thirty eight food. Furthermore, the food mixture M17 with the best attractiveness were selected among the eighteen food mixtures combined by these six foods at different ratio. Subsequently food mixture M17 were tested in actual barn and compared with commercial attractant. We collected the volatile from food mixture, the volatile compounds attractive to this beetle also. We identified six electrophysio-logically active compounds responsible for the attraction of O. surinamensis, among the six chemically identified compounds, nonanal, dodecane, tridecaneand β-caryophyllene significantly attracted O. surinamensis when tested individually in behavioral assays. Blend of six chemicals according to food volatile concentration was most attractive to the beetles. The findings of this study reveal that food mixture M17 and food volatile can be potentially used for development of effective attractants for management of O. surinamensis.

In this paper, the fixed-time stabilization problem for a class of uncertain chained system is addressed by using a novel nonsingular recursive terminal sliding mode control approach. A fixed-time controller and an adaptive law are designed to guarantee the uncertain chained form system both Lyapunov stable and fixed-time convergent within the settling time. The advantage of the controller based on the sliding mode is that the settling time does not depend on the system initial state. Furthermore, we use RBF neural network to estimate the uncertainty of the system. Finally, the simulation results demonstrate the performance of the control laws.

In this research, a novel collector cetyl trimethyl ammonium chloride (CTAC) was used to separate hematite from quartz via reverse flotation for the first time. Micro-flotation tests showed that CTAC had a strong ability to selectively collect quartz and a separation of hematite from quartz could be accomplished with a concentration of 0.00263 mmol/L CTAC. Zeta-potential measurements indicated that the positive CTAC+ species could selectively increase the surface potential of quartz, but it had rather a weak effect on the hematite surface. X-ray photoelectron spectroscopy (XPS) detection indicated that CTAC had a stronger binding affinity to oxygen sites on the surface of quartz than that of hematite, resulting in a large amount of CTAC predominantly adsorbed on quartz rather than hematite.

Crop breeding is an important global strategy to meet sustainable food demand. CRISPR-Cas is a most promising gene-editing technology for rapid and precise generation of novel germplasm, and leads to revolutionary crop breeding innovation. In this review, we summarize recent advance of CRISPR/Cas technology in gene function analyses and generation of new germplasms with increased yield, improved product quality, and enhanced resistance to biotic and abiotic stress. We highlight their applications and breakthroughs in agriculture including crop de novo domestication, decoupling the gene pleiotropy tradeoff, crop hybrid seed conventional production, hybrid rice asexual reproduction, and double haploid breeding. Moreover, the challenges and development of CRISPR/Cas technology in crops are also discussed.

Compliant amplifying mechanisms are used widely in high-precision instruments driven by piezoelectric actuators, and the dynamic and static characteristics of these mechanisms are closely related to instrument performance. Although the majority of existing research has focused on analysis of their static characteristics, the dynamic characteristics of the mechanisms affect their response speeds directly. Therefore, this paper proposes a comprehensive theoretical model of compliant amplifying mechanisms based on the multi-body system transfer matrix method to analyze the dynamic and static characteristics of these mechanisms. The effects of the main amplifying mechanism parameters on the displacement amplification ratio and the resonance frequency are analyzed comprehensively using the control variable method. An iterative optimization algorithm is also used to obtain specific parameters that meet the design requirements. Finally, simulation analyses and experimental verification tests are performed. The results indicate the feasibility of using the proposed theoretical compliant amplifying mechanism model to describe the mechanism’s dynamic and static characteristics, which represents a significant contribution to the design and optimization of compliant amplifying mechanisms.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

We fabricated high-quality MAPbBr3 single crystals (SC) by introducing moderate amount electron-rich poly(propylene glycol bis(2-aminopropyl ether) (PEA) additives with an inverse temperature crystallization (ITC) method. The intramolecular vibrations and defective states of prepared MAPbBr3 single crystals were systemically studied by the in situ variable-temperature Fourier Transform Infrared (FTIR) Spectroscopy, X-ray photoelectron spectroscopy (XPS), and the synchrotron-based X-ray absorption near edge structure (XANES), et al. We infer that the proper amount of PEA additives would prevent the formation of intermediate states and crystal boundaries, passivating the density of defective states. The X-ray detection properties of single-crystal MAPbBr3 crystals were investigated, using both high dose and low dose X-ray photons at 40keV in synchrotron beamlines. The photocurrent of optimized PEA-treated MAPbBr3 single crystals demonstrate better performance compared with the as-prepared single crystals. Meanwhile, the decay time of MAPbBr3 single crystal is decreased from 460 ns to 210 ns by Time-resolved photoluminescence (TRPL) decay measurement, owing to the defect passivation by 0.5wt% PEA additives. The PEA-treated single crystals possess much faster decay time than the commercialized Ce:YAG scintillator (>500ns). These results help elucidate the passivation of defective states and contribute paths to manufacture high-quality single crystal perovskites for next-generation optoelectronic devices.

Intelligent systems are increasingly present in various areas of society, gaining special relevance in healthcare environments. In this work, grounded on previous developments proposed by the authors, the evolution and improvement of a novel intelligent system focused on the diagnosis of obstructive sleep apnea (OSA) is addressed. To do this, starting from two packages of information of a heterogeneous nature, and deploying a set of Machine Learning classification algorithms, focused each of them on different levels of the apnea-hypopnea index (AHI), as well as a set of cascaded expert systems, it is possible to obtain a series of risk metric pairs (Statistical Risk, Symbolic Risk) for each AHI level, understood as a warning forecast associated with the early detection of the pathology. The risk indicators of each pair are subsequently aggregated by means of a symbolic inference system, whose knowledge base was determined using the automatic rule generation approach proposed by Wang and Mendel. At the output of each inference system, a risk indicator is obtained for each AHI level, the Apnea Risk, whose interpretation makes it possible to discriminate between patients who could suffer OSA and those who do not, as well as to generate the appropriate recommendations. For the initial tests of the system, the design and development of a specific software artifact was carried out using data from 4,400 patients from the Álvaro Cunqueiro Hospital in Vigo, obtaining when applied to the test set AUC values within the range 0.74–0.88, which invites optimism and points to the benefits expected from the architecture of the proposed intelligent system.

Plants of the genus Monochoria have long been utilized in food, cosmetics, and traditional herbal treatment. Thailand has the highest species diversity of this genus and a new member, Monochoria angustifolia (G. X. Wang) Boonkerd & Tungmunnithum has been recently described. This plant is called “Siam Violet Pearl” as a common name or “ไข่มุกสีม่วงแห่งสยาม” as its vernacular name in the same meaning in Thai language. Despite their importance, few researches on Monochoria species have been conducted. This study, thus, provided the results to fill in this gap by: i) determining flavonoids phytochemical profiles of 25 natural populations of M. angustifolia covering the whole floristic regions in Thailand, and ii) determining antioxidant activity using various antioxidant assays to investigate the probable mechanism. The results revealed that M. angustifolia presented a higher flavonoid content than the outgroup, M. hastata. Our results also revealed that flavonoids might be used to investigate Monochoria evolutionary connections and for botanical authentication. The various antioxidant assays revealed that M. angustifolia extracts preferentially act through a hydrogen atom transfer antioxidant mechanism. Pearson correlation analysis indicated significant correlations emphasizing that the antioxidant capacity is most probably the result of a complex phytochemical combinations rather than of a single molecule. Altogether, these results showed that this new species provide an attractive alternative starting material with phytochemical variety and antioxidant potential for the phytopharmaceutical industry.

Bacterial indole-3-acetic acid (IAA), an effector molecule in microbial physiology, plays an important role in plant growth-promotion. Here, we comprehensively analyzed about 7282 prokaryotic genomes representing diverse bacterial phyla, combined with root-associated metagenomic data to unravel the distribution of tryptophan-dependent IAA synthesis pathways and to quantify the IAA synthesis-related genes in the plant root environments. We found that 82.2% of the analyzed bacterial genomes were potentially capable of synthesizing IAA from tryptophan (Trp) or intermediates. Interestingly, several phylogenetically diverse bacteria showed a preferential tendency to utilize different pathways and tryptamine and indole-3-pyruvate pathways are most prevalent in bacteria. About 45.3% of the studied genomes displayed multiple coexisting pathways, constituting complex IAA synthesis systems. Furthermore, root-associated metagenomic analyses revealed that rhizobacteria mainly synthesize IAA via IAM and tryptamine (TMP) pathways and might possess stronger IAA synthesis abilities than bacteria colonizing other environments. The obtained results refurbished our understanding of bacterial IAA synthesis pathways and provided a faster and less labor-intensive alternative to physiological screening based on genome collections. The better understanding of IAA synthesis among bacterial communities could maximize the utilization of bacterial IAA to augment the crop growth and physiological function.

In this study, composite nanofiber films comprising polyvinyl alcohol, wheat gluten, and glucose (PWG) were fabricated using electrospinning, followed by cross-linking via the Maillard cross-linking. Various mass concentrations of ferulic acid (FA) were incorporated into the PWG films. The results indicate that the average diameter of the FA-PWG films decreased from 449 nm to 331 nm as the concentration of FA increased, until reaching a concentration of 12%, after which a significant increase in diameter was observed. Subsequent Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD) and differential scanning calorimetry (DSC) results suggested that FA was distributed in the sample films in an amorphous form through hydrogen and ester bonds. Additionally, release experiments and antimicrobial tests on FA-PWG sample films showed good con-trolled release of FA and excellent anti-Escherichia coli and Staphylococcus aureus activity of this film. These findings all indicate that the FA-PWG nanofiber film is a potential candidate for food active packaging.

Code summarization plays a vital role in aiding developers with program comprehension by generating corresponding textual descriptions for code snippets. While recent approaches have concentrated on encoding the textual and structural characteristics of source code, they often neglect the global hierarchical features causing limited code representation. Addressing this gap, our paper introduces the Statement-grained Hierarchy enhanced Transformer model (SHT), a novel framework that integrates global hierarchy, syntax, and token sequences to automatically generate summaries for code snippets. SHT is distinctively designed with two encoders to learn both hierarchical and sequential features of code. One relational attention encoder processes the statement-grained hierarchical graph, producing hierarchical embeddings. Subsequently, another sequence encoder integrates these hierarchical structures with token sequences. The resulting enriched representation is then fed into a vanilla Transformer decoder, which effectively generates concise and informative summarizations. Our extensive experiments demonstrate that SHT significantly outperforms state-of-the-art approaches on two widely used Java benchmarks. This underscores the effectiveness of incorporating global hierarchical information in enhancing the quality of code summarizations.

Satellite communication is expected to play a vital role in realizing Internet of Remote Things (IoRT) applications. This article considers an intelligent reflecting surface (IRS)-assisted downlink low Earth orbit (LEO) satellite communication network, where IRS provides additional reflective links to enhance the intended signal power. We aim to maximize the sum-rate of all the terrestrial users by jointly optimizing the satellite’s precoding matrix and IRS’s phase shifts. However, it is difficult to directly acquire the instantaneous channel state information (CSI) and optimal phase shifts of IRS due to the high mobility of LEO and the passive nature of reflective elements. Moreover, most conventional solution algorithms suffer from high computational complexity and are not applicable to these dynamic scenarios. A robust beamforming design based on graph attention networks (RBF-GAT) is proposed to establish a direct mapping from the received pilots and dynamic network topology to the satellite and IRS’s beamforming, which is trained offline using the unsupervised learning approach. The simulation results corroborate that the proposed RBF-GAT can achieve approximate performance compared to the upper bound with low complexity.

There is a confusion in the original design concept for the tensioning of longitudinally connected reinforcement of CRTSII slab ballastless track. In order to clarify the effect of tension value of longitudinal reinforcement on mechanical characteristics of ballastless track, a three dimensional finite element model considering the nonlinear interaction between the track slab and CA mortar of CRTSII slab ballastless track was established. The mechanical characteristics of the track structure under longitudinal tension load and temperature gradient load of the longitudinal joint were calculated. A method of applying pre-stress to post-pouring concrete was proposed according to the concept of pre-stress loss of pretensioning pre-stressed concrete, reasonable tensile force value was proposed after the crack width and the reinforcement stress of the ballastless track in the operation stage were checked and calculated according to the concrete design principle. When the tension force is greater than 300 kN, it’s harmful to the bonding between the slab and mortar layer, which is prone to interlayer damage. In order to adding pre-stress to concrete of wide joints to ensure the longitudinal stability of ballastless track and the reinforcement stress and crack width to meet the design requirements. It is suggested that the tension force value should be 230 kN, and the temperature difference between reinforcement and concrete should be 30 °C before the initial curdle of wide joint concrete.

Abstract: The chemical mechanical polishing (CMP) has been widely used for surface modification of critical materials and components and provided global planarization of topography with a low post-planarization slope high quality and efficiency. The colloidal silica slurries play an important role in the finishing processes of optical components. Monodisperse mesoporous silica nanospheres were synthesized with different surfactant by Stöber method. Their architectural features and texture parameters were characterized by XRD, FTIR, N2 adsorption–desorption isotherms, SEM, XPS, and TGA techniques. The spherical SiO2 products presented with the controllable 50-150 nm particle size and distribution. The AFM micrographs reveal that flat and smooth surfaces without distinct scratches residual particles are achieved by using the as-obtained composite particles as abrasives[The particle size of SiO2 slurry plays a critical role in the chemical-mechanical polishing process.

Recently, the phase-sensitive OTDR (Φ-OTDR) based vibration sensor system has gained the focus of many researchers and some efforts have been undertaken to push further the limitations imposed on the performance of the Φ-OTDR sensor system. Then, progress in the different areas of its performance evaluation factors such as: improvement of the signal-to-noise ratio (SNR), spatial resolution (SR) in the sub-meter range, enlargement of the sensing range, frequency response bandwidth over the conventional limit and phase signal demodulation for quantitative measurement have been realized. This paper presents an overview of the recent progress in the Φ-OTDR based vibration sensing system in the different areas mentioned above.

The decreasing width, increasing aspect ratio RDL presents significant challenges to design for reliability (DFR) of advanced package. Therefore, this paper proposes a ML based RDL modeling and simulation method. In the method, RDL is divided into blocks and subdivided into pixels of metal percentage, and the RDL is digitalized as tensors. Then, an ANN-based surrogate model is built and trained by a subset of tensors to predict the equivalent material properties of each block. Lastly, all blocks are transformed into elements for simulations. For validation, line bending simulations were conducted on an RDL, with the reaction force as accuracy indicator. The results show that neglecting layout impact causes critical errors as substrate thins. By the method, the reaction force error is 2.81% and the layout impact can accurately be considered with 200×200 elements. For application, the TCT maximum temperature state simulation was conducted on a CPU chip. The simulation indicates that for advanced package the maximum stress more likely occurs in RDL rather than bumps, both RDL and bumps are critical impacted by layouts, and RDL stress is also impacted by vias/bumps. The proposed method precisely concerns layout impacts with little resources, presents an opportunity of efficiency improvement.

An abdominal aortic aneurysm (AAA) is usually asymptomatic until rupture, which is associated with extremely high mortality. Consequently, early detection of AAAs is of paramount importance in reducing mortality; however, most AAAs are detected by medical imaging incidentally. The aim of this study was to investigate the feasibility of machine learning-based pulse wave (PW) analysis for the early detection of AAAs using a database of in silico PWs. PWs in the large systemic arteries were simulated using one-dimensional blood flow modelling. A database of in silico PWs representative of subjects (aged 55, 65 and 75 years) with different AAA sizes was created by varying the AAA-related parameters with major impacts on PWs – identified by parameter sensitivity analysis – in an existing database of in silico PWs representative of subjects without AAA. Then, a machine learning architecture for early detection of AAAs was proposed, which was trained and tested using the new in silico PW database. The parameter sensitivity analysis revealed that the AAA maximum diameter and stiffness of the large systemic arteries were the dominant AAA-related biophysical properties that significantly influence the PW. The simulated PW indexes extracted from the database showed that the PW was not only influenced by the presence of an AAA but was also significantly affected by multiple cardiovascular parameters that compromised the detection of AAAs by using individual PW indexes. Alternatively, the trained machine learning model performed well in classifying normal and AAA conditions using digital photoplethysmogram PWs from the database. These findings suggest that machine learning-based PW analysis is a promising approach for AAA screening using PW signals acquired by wearable devices.

With the development of engineering technology, engineering has higher requirements for the accuracy and the scale of simulation calculation. The computational efficiency of traditional se-rial program can not meet the requirements of engineering。Therefore, reducing the calcula-tion time of temperature control simulation program has important engineering significance for real-time simulation of temperature field and stress field, and then adopting more reasona-ble temperature control and crack prevention measures. GPU parallel computing is introduced into the temperature control simulation program of massive concrete to solve this problem and the optimization is carried out. Considering factors such as GPU clock rate, number of cores, parallel overhead and Parallel Region, The improved GPU parallel algorithm analysis indicator formula is proposed. It makes up for the shortcomings of traditional formula that focus only on time. According to this formula, when there are enough threads, the parallel effect is limited by the size of the parallel domain, and when the parallel domain is large enough, the efficiency is limited by the parallel overhead and the clock rate. This paper studies the optimal Kernel execu-tion configuration. Shared Memory is utilized to improve memory access efficiency by 155%. After solving the problem of bank conflicts, an accelerate rate of 437.5x was realized in the sub-routine of the matrix transpose of the solver. The asynchronous parallel of data access and logi-cal operation is realized on GPU by using CUDA Stream , which can overlap part of the data access time. On the basis of GPU parallelism, asynchronous parallelism can double the compu-ting efficiency. Compared with the serial program, the accelerate rate of inner product matrix multiplication of the GPU asynchronous parallel program is 61.42x. This study further proposed a theoretical formula of data access overlap rate to guide the selection of the number of CUDA streams to achieve the optimal computing conditions. The GPU parallel program compiled and optimized by CUDA Fortran platform can effectively improve the computational efficiency of the simulation program for concrete temperature control, and better serve for engineering computing.

The service conditions of underground coal mine equipment are poor, and it is difficult to accurately extract the fault characteristics of rolling bearings. In order to better improve the accuracy of fault identification of rolling bearings, a fault detection method based on multiscale permutation entropy and SOA-SVM is proposed. First, the whale optimization algorithm is used to select the modal analysis number K and the penalty factor α of the variational mode decomposition algorithm. Then, the vibration signal of rolling bearings is dissolved according to the optimized variational mode decomposition algorithm, and the multi-scale permutation entropy of the main intrinsic mode function is calculated. Finally, the feature values of the matrix are entered into the SVM algorithm optimized by the seagull optimization algorithm to obtain the classification result. The experimental results based on the published rolling bearing datasets of Western Reserve University show that the identification success rate of the proposed method can reach 98.75%. The fault detection of the rolling bearings can be completed accurately and efficiently.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Abstract: Guanxi, a Chinese term that defines social networks of power and benefits, can be divided into inter-personal and inter-organizational relationships, and guanxi significantly influences construction innovation in China. Many studies have examined the relationship between guanxi and construction innovation at the project or organizational level. However, few of these studies explained how guanxi could affect an individual’s innovative behaviour from a double-level perspective. This paper builds on social capital theory and social exchange theory to examine guanxi’s role in motivating innovative behaviour in a China-specific construction context. It investigates the main effects of inter-personal relationships on innovative behaviour, the mediating effects of knowledge sharing, and the cross-level moderating effects of inter-organizational relationships. These elements were tested using a survey that received 178 responses from 35 different organizations. The results were analysed using Hierarchical Linear Modelling (HLM) and revealed that inter-personal relationships have positive influences on innovative behaviour, thus highlighting the partial mediating effects of knowledge sharing. In addition, the analyses showed that inter-organizational relationships augment inter-personal relationships and knowledge sharing on innovative behaviour by cross-level interaction. The research findings enhance an understanding of guanxi and innovative behaviour in China-specific construction project settings, as well as verifying the significance of guanxi in stimulating innovative behaviour.

For equivalent modeling of mixed wind farms (WFs), existing clustering indicators cannot consider the complex coupling characteristics between different types of wind turbines (WTs). This paper proposes a refined equivalent modeling method for mixed WFs based on artificial intelligence technology. Firstly, the electromechanical transient performance of mixed WFs is analyzed. The WT type, wind speed and direction, and voltage dip are considered the main factors affecting the external dynamic response of mixed WFs. Secondly, the equivalent node model is established, including the selection of independent and dependent variables. Then, the multiple artificial neural networks (ANNs) are trained one by one based on sample data, to explore the nonlinear relationship between the dependent variables and the independent variables. Finally, the electromechanical transient simulations of the power systems with a mixed WF is carried out by using the MATLAB platform. Simulation results show that the proposed model can reflect the external characteristics of the mixed WF in different wind scenarios and voltage dips.

The epistemology of the traditional risk assessment examined has a taxonomy based upon deterministic, behaviouristic and compatibilist methodologies which are likely driven by neo-liberal market related requirements for bigger, faster cheaper wind-turbines. Analysis of available risk assessments suggested that there is no conscious effort to deceive the reader although the intended audience is unclear. The language, and scoring mechanisms utilized indicates the presence of conformity bias, confirmation bias, and numerical inconsistency leading to data ossification. By reverse engineering risk assessment content, Pragmatic and Social Psychological aspects can be investigated, and the adequacy of the document can be evaluated using evidence-based models.

Periostracum cicadae, the cast-off shell of the cicada Cryptotympana pustulata Fabricius, is used in traditional Chinese medicine for its diaphoretic, anticonvulsive, sedative, antipyretic, and antiallergic effects. However, the exact pathogenesis of immunoglobulin A nephropathy (IgAN) remains unclear, thereby hindering investigations to identify novel therapeutic agents. A rat IgAN model was established by administration of bovine serum albumin, lipopolysaccharide, and carbon tetrachloride, which simultaneously established blood stasis and a heat syndrome model. The animals were sacrificed to detect changes in protein levels in urine and blood. Immunofluorescence was performed to assess IgA deposition in the glomeruli. Tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin 6 (IL-6) levels were measured in bronchoalveolar lavage fluid (BALF) by enzyme-linked immunosorbent assay. Hematology and eosin, periodic acid-Schiff, TUNEL, and immunohistochemical staining were performed to evaluate histopathological changes in kidney tissues. Additionally, target-related proteins were measured by western blotting. Periostracum cicadae resulted in a reduction in blood and urine protein levels. Serum TNF-α, IL-1β, and IL-6 levels significantly decreased in the periostracum cicadae-treated groups compared to the IgAN group. Furthermore, a reduction in MCP-1, TLR4, and IgA expression levels and a dose- dependent increase in caspace-3 expression were observed in response to periostracum cicadae treatment. TGF-β1 levels decreased, whereas that of Fas increased in the kidney tissues of the periostracum cicadae-treated groups. The findings of the present study indicate that periostracum cicadae induces apoptosis and improves kidney inflammation and fibrosis in IgA nephropathy rat models.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Accurate and reliable mid-long runoff prediction (MLTRP) is of great importance in water re-sources management. However the MLTRP is not suitable in each basin and how to evaluate the applicability of MLTRP is still a question. Therefore, the total mutual information (TMI) index is developed in this study based on the predictor selection method using mutual information (MI) and partial MI (PMI). The relationship between the TMI and the predictive performance of five models is analyzed by applying five models in 222 forecasting scenarios in Australia. The results over 222 forecasting scenarios demonstrate that, compared with the MI, the developed TMI index can better represent the available information in the predictors, and has more significant negative correlation with the RRMSE with the correlation coefficient between -0.62 and -0.85. This means the model's predictive performance will become better along with the increase of TMI, and there-fore the developed TMI index can be used to evaluate the applicability of MLTRP. When TMI is more than 0.1, the available information in the predictors can support the construction of MLTRP models. In addition, the TMI is used to partly explain the difference of predictive performance among five models. In general, the complex models, which can better utilize the contained infor-mation, are more sensitive to the TMI, and have more significant improvement in terms of predic-tive performance along with the increase of TMI. This research can provide support for the study of MLTRP.

In the process of oil and gas development and production, when the flow rate in the wellbore is large, the materials underground will be eroded, causing the operation to be unable to proceed smoothly and reducing the efficiency of oil and gas production. Therefore, optimizing the anti-erosion coating under high-speed flow conditions in wellbore is a very interesting thing. It can greatly improve operational efficiency. In this paper, laser cladding was used to prepare the new coating used in the PDC drill bit. Then, the effects of tungsten carbide and multi-layer graphene on the microstructure and properties of the tungsten carbide coating were studied. The research results indicate that, for new coatings, 60% tungsten carbide and 0.3% graphene are the optimal ratios. After adding WC, the hardness has significantly improved. However, when the WC content further increases more than 30%, the increase in hardness is relatively small. In addition, when the content of graphene is more than 0.3%, the branched structure became thicker, and not only the segregation of Cr, Si and W became very obvious again, but also the segregation of Fe occurred at the Ni enrichment site. The research results contribute to improving oil and gas production and operational efficiency under high-speed fluid flow conditions in the wellbore.

Aiming at the removal of radioactive cobalt ions from water by graphene oxide (GO), the adsorption mechanism of Co2+ on graphene oxide was analyzed using the quantum chemical calculation software Gaussian 16 based on the density functional theory. The influence of material structure factors such as carboxyl group, hydroxyl group, epoxy group and graphene sheet as well as external environmental factors such as pH, temperature and interfering ions on the adsorption effect was determined, and the influence of external environment was verified through experiments. Through calculation and experiment, it was found that the existence of oxygen-containing functional groups on graphene oxide can improve the adsorption efficiency of the materialappropriately,and increasing pH under acidic conditions was also helpful to improve the adsorption effect, and the material had certain selectivity for Co2+, the adsorption capacity and selectivity could be further improved when it was modified by increasing hydroxyl group.

The Giant Babax, an endemic bird in China and a nationally protected wildlife species of Class Ⅱ, is primarily distributed in southern and southeastern Tibet. To investigate the factors influencing nesting site selection, this study conducted research on nest characteristics and nesting site preferences at four sample sites around Lhasa from March to October 2023y, using systematic search methods, tracking methods, and sampling methods. The research findings are as follows: (1) The average nest depth was (7.70±1.47)cm, nest height was (19.58±2.97)cm, inner diameter was (10.64±1.73)cm, outer diameter was (24.65±4.8)cm, average weight was (162.3±13.5)g, and average nest spacing within the plot was 396.93m. (2) The nests of Giant Babax were predominantly found on vegetation such as Salix longistamina (38%), Hippophae gyantsensis (20%), Rosa sericea Lindl. (14%), and Populus szechuanica Schneid(11%). They showed a preference for artificial secondary forests as nesting sites. (3) Giant Babax exhibited a preference for habitats with robust trees that had high canopies while being distant from houses and roads, but close to water sources; moreover, the canopy of the nesting tree played a crucial role in their choice of nesting sites. (4) The reproductive success rate reached 76%, with key factors affecting it being the canopy coverage of the nesting tree and the number of helpers. These research results provide fundamental data support for population conservation efforts and ecological resource management strategies concerning the Giant Babax.

Most existing data synthesis methods are designed to tackle problems such as dataset imbalance, data anonymization and insufficient sample size. There is a lack of effective synthesis methods for the limited number of datasets which contain a large of features and unknown noise to expand the size of the dataset. We propose a data synthesis method, named Adaptive Subspace Interpolation for Sample Optimization (ASISO). The idea is to divide the original feature space into several subspaces with an equal number of samples, and then perform interpolation for the samples in the adjacent subspaces. This method can adaptively adjust the size of the dataset containing unknown noise, and the expanded data typically contain minimal error with actual. Moreover, it adjusts the structure of the samples, which can significantly reduce the proportion of samples with large errors. In addition, the hyperparameters of this method have an intuitive explanation and usually require little calibration. Experimental results on artificial data and benchmark data sets demonstrate that ASISO is a robust and stable method to optimize samples.

The synchronous generator, as the main component of power systems, plays a key role in these system’s stability. Therefore, utilizing the most effective control strategy for modeling and control the synchronous generator results in the best outcomes in power systems’ performances. The advantage of using a powerful controller is to have the synchronous generator modeled and controlled as well as its main task i.e. stabilizing power systems. Since the synchronous generator is known as a complicated nonlinear system, modeling and control of it is a difficult task. This paper presents a sum of squares (SOS) approach to modeling and control the synchronous generator using polynomial fuzzy systems. This method as an efficacious control strategy has numerous superiorities to the well-known T–S fuzzy controller, due to the control framework is a polynomial fuzzy model, which is more general and effectual than the well-known T–S fuzzy model. In this case, a polynomial Lyapunov function is used for analyzing the stability of the polynomial fuzzy system. Then, the number of rules in a polynomial fuzzy model is less than in a T-S fuzzy model. Besides, derived stability conditions are represented in terms of the SOS approach, which can be numerically solved via the recently developed SOSTOOLS. This approach avoids the difficulty of solving LMI (Linear Matrix Inequality). The Effectiveness of the proposed control strategy is verified by using the third-part Matlab toolbox, SOSTOOLS.

To prepare an edible coating with a good preservative effect on sweet cherries, carboxymethyl chitosan (CMCS) and gelatin (GL) were selected as the film-forming matrix in this experiment, and CaCl2 and ascorbic acid (AA) were added as crosslinking agents and antioxidants, respectively. First, the film was prepared by the casting method, and the film formula with better mechanical and barrier performance was filtered out by one-factor and response surface optimization test, and the differences in the preservation effect of different film formulations (CMCS-GL, CaCl2- CMCS-GL, AA -CaCl2- CMCS-GL) on sweet cherries were compared. and then the different film formulations were compared. The difference in film formulation on the preservation effect of sweet cherries was investigated. The results showed that the optimal formulation for an edible film based on CMCS-GL with good performance was CMCS: GL (w:w)=2:1, with the additional amount of 1% glycerol, 2% CaCl2, 0.1% Tween-20, 2% AA, the tensile strength, elongation at break, oxygen permeability and water vapor permeability of the film obtained with this formula were: 16.28 MPa, 71.46%, 1.39×10-12 g- cm/(cm2-s-Pa), 5.10×10-11 cm3-cm/(m2-s-Pa), respectively. In the preservation of sweet cherries, all three film formulations effectively reduced the rotting rate and weight loss during storage while preserving the high hardness and skin color of the fruit. Among them, the formulation AA -CaCl2- CMCS-GL showed the best preservation effect and can be used as a new method for postharvest preservation of sweet cherries.

An ultra-low anti-reflection optical coating on both surfaces of a plastic cover slip was studied for use in confocal image measurement. The optical reflectance at a wavelength of 632.8 nm was less than 0.1% when the coated sample was placed in a liquid having a refractive index of 1.34 close to the aqueous solution of the biomaterial. The high- and low-index coating films, Substance-2 (PrTiO3) and silicon dioxide (SiO2), were measured by an ellipsometer to determine their optical refraction indices and extinction coefficients. Theoretically, when the two layer thicknesses are designed using the optical admittance diagram of the cover slip to approach the equivalent index of 1.34, a reflectance of 1.6×10-5% in the liquid could be obtained. Experimentally, the reflectance of the sample deposited on the two faces of the cover slip was 4.223±0.145% as measured in the air; and 0.050±0.002% as measured by a He-Ne laser in the liquid.

Multimodal remote sensing data classification can enhance the model’s ability to distinguish land features through multimodal data fusion. In this context, how to help models understand the relationship between multimodal data and target tasks is the focus of researchers. Inspired by human feedback learning mechanisms, causal reasoning mechanisms, and knowledge induction mechanisms, this paper integrates causal learning, reinforcement learning, and meta learning into a unified remote sensing data classification framework and proposed the causal meta-reinforcement learning (CMRL). First, based on feedback learning mechanisms, we have overcome the limitations of traditional implicit optimization of fusion features and customized a reinforcement learning environment for multimodal remote sensing data classification tasks. Through feedback interactive learning between agents and the environment, we help them understand the complex relationships between multimodal data and labels, thereby achieving full mining of multimodal complementary information. Second, based on the causal inference mechanism we designed causal distribution prediction action, classification reward, and causal intervention reward, capturing pure causal factors in multimodal data and cutting off false statistical associations between non-causal factors and class labels. Finally, based on the knowledge induction mechanism, we designed a bi-layer optimization mechanism based on meta-learning. By constructing a meta training task and meta validation task simulation model in the generalization scenario of unseen data, we helped the model induce cross-task shared knowledge, thereby improving its generalization ability for unseen multimodal data. The experimental results on multiple sets of multimodal datasets show that the proposed method achieved state-of-the-art performance in multimodal remote sensing data classification tasks.

Background: Atypical teratoid/rhabdoid tumor (AT/RT) is an uncommon and aggressive pediatric central nervous system neoplasm. However, a universal clinical consensus or reliable prognostic evaluation system for this malignancy is lacking. Our study aimed to develop a risk model based on comprehensive clinical data to assist in clinical decision-making. Methods: We conducted a retrospective study by examining data from the Surveillance, Epidemiology, and End Results (SEER) repository, spanning 2000 to 2019. The external validation cohort was sourced from the Children's Hospital Affiliated to Chongqing Medical University, China. To discern independent factors affecting overall survival (OS) and cancer-specific survival (CSS), we applied Least Absolute Shrinkage and Selection Operator (LASSO) and Random Forest (RF) regression analyses. Based on these factors, we structured nomogram survival predictions and initiated a dynamic online risk-evaluation system. To contrast survival outcomes among diverse treatments, we used propensity score matching (PSM) methodology. Molecular data with the most common mutations in AT/RT were extracted from the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Results: The annual incidence of AT/RT showed an increasing trend (APC, 2.86%; 95% CI:0.75-5.01). Our prognostic study included 316 SEER database participants and 27 external validation patients. The entire group had a median OS of 18 months (range 11.5 to 24 months) and median CSS of 21 months (range 11.7 to 29.2). Evaluations involving C-statistics, DCA, and ROC analysis underscored the distinctive capabilities of our prediction model. An analysis via PSM highlighted that individuals undergoing triple therapy (integrating surgery, radiotherapy, and chemotherapy) had discernibly enhanced OS and CSS. The most common mutations of AT/RT identified in the COSMIC database were SMARCB1, BRAF, SMARCA4, NF2, and NRAS. Conclusions: In this study, we devised a predictive model that effectively gauges the prognosis of AT/RT and briefly analyzed its genomic features, which might offer a valuable tool to address existing clinical challenges.

Meat serves as a vital component of the human diet, offering a rich source of protein and essential trace elements. China stands as both a significant producer and consumer of meat on a global scale, leading the world in terms of total meat production and consumption. As the standard of living within the country continues to rise, there is a growing emphasis on the nutritional value and safety of meat consumption. The tenderness of meat is a critical factor influencing its overall quality. Traditionally, tenderness has been assessed through shear force testing, a method that is inherently destructive, inefficient, and results in considerable sample wastage. In light of these drawbacks, non-destructive testing techniques have emerged as a preferred alternative, promising greater accuracy, efficiency, and convenience without compromising the integrity of the samples. This paper delves into the application of five advanced non-destructive testing technologies in the realm of meat tenderness assessment. These include near-infrared spectroscopy, hyperspectral imaging, Raman spectroscopy, airflow optical fusion detection, and nuclear magnetic resonance detection. Each technology is scrutinized for its respective strengths and limitations, providing a comprehensive overview of their current utility and potential for future development. Moreover, the integration of these techniques with the latest advancements in artificial intelligence (AI) technology is explored. The fusion of AI with non-destructive testing offers a promising avenue for the development of more sophisticated, rapid, and intelligent systems for meat tenderness evaluation. This integration is anticipated to significantly enhance the efficiency and accuracy of quality assessment in the meat industry, ensuring a higher standard of safety and nutritional value for consumers. The paper concludes with a set of technical recommendations aimed at guiding the future direction of non-destructive, AI-enhanced meat tenderness detection, thereby contributing to the ongoing improvement of the meat industry in China and beyond.

Flavonoids are major secondary metabolites in plants, which play important roles in maintaining the cellular redox balance in cells. Chalcone synthase (CHS) is the key enzyme in the flavonoids biosynthesis pathway, and has been proved to monitor the changes to drought stress tolerance. In this work, we overexpressed a CHS gene in tobacco (Nicotiana tabacum). The transgenic tobacco plants were more tolerant than the control plants to drought stress. The transcription levels of the key genes involved in the flavonoids pathway and the contents of seven flavonoids were also significantly raised in the transgenic tobacco plants. In addition, overexpression of the CHS gene lead to a lower concentration of the oxidative stress product malondialdehyde. Overall, the NtCHS gene studied in this work was considered as a candidate gene for genetic engineering to enhance drought tolerance of plants and improve response to oxidative stress.

This paper aims to build up a preference function to evaluate the public benefits of the type of agricultural farming, biodiversity, water provisions, land use type, ecotourism modes, and a monetary attribute (environmental trust fund and willingness to contribute) associated with an ecosystem service and land use program in a forest park. This study used the choice experiments to build a random utility model, analyze the average preference for the above land use attributes based on the conditional logit and used a latent class model to test the resident’s heterogeneous preferences for land use planning in the forest park. We also estimated the welfare derived from various land use programs. The empirical result had shown that: (1) increasing organic farming area, maintaining the status quo of species biodiversity, increasing the surface water provision, increasing the area of custom flora, increasing the wetland area, and setting up an integrated framework for ecotourism increase the public’s preference for the land use program; (2) we found that farmer and non-farmer haven’t the same land use preferences; (3) the ecotourism development program incorporating biodiversity, organic farming, ethnobotany, and wetland area with integrated ecotourism are more preferred than other land use program scenarios.

Background: This study aimed to identify the association between occupational stress and depression-well-being by proposing a comprehensive and flexible job burden-capital model with its corresponding hypotheses. Methods: For this research, 1618 valid samples were gathered from the electronic manufacturing service industry in Hunan Province, China; self-rated questionnaires were administered to participants for data collection after obtaining their written consent. The proposed model was fitted and tested through structural equation model analysis. Results: Single-factor correlation analysis results indicated that coefficients between all items and dimensions had statistical significance. The final model demonstrated satisfactory global goodness of fit (CMIN/DF=5.37, AGFI=0.915, NNFI=0.945, IFI=0.952, RMSEA=0.052). Both the measurement and structural models showed acceptable path loadings. Job burden and capital were directly associated with depression and well-being or indirectly related to them through personality. Multi-group structural equation model analyses indicated general applicability of the proposed model to basic features of such a population. Gender, marriage and education led to differences in the relation between occupational stress and health outcomes. Conclusions: The job burden-capital model of occupational stress-depression and well-being was found to be more systematic and comprehensive than previous models.

The deterioration of soil-cement in corrosive environment leads to the reduction of strength and the increase of permeability. Effective methods of determining deteriorated layer permeability coefficient of soil-cement are currently lacking. A laboratory test method for permeability coefficient of deteriorated layer was proposed using the modified permeability coefficient testing apparatus. According to the proposed method, the permeability coefficient of deteriorated layer can be obtained after testing the permeability coefficient of the soil-cement specimen in curing room and the equivalent permeability coefficient and deterioration depth of the soil-cement specimen in corrosion environment. Taking the marine dredger fill of Jiaozhou Bay for example, the deteriorated layer permeability coefficients of soil-cements with different cement contents were tested. It turned out that the permeability of deteriorated layer increases with the increase of age. At the beginning of curing age, larger cement content leads to smaller permeability coefficient of the deteriorated layer of soil-cement. As the curing age increases, the deteriorated layer permeability coefficient of the soil-cement with larger cement content becomes larger. The evolution of the permeability coefficient of deteriorated layer with age can be formulated as the Logistic function. This study provides a support for anti-permeability designs of soil-cement structures in corrosive environment.

A phenomenological constitutive model is developed to describe the uniaxial transformation ratcheting behaviors of super–elastic shape memory alloy (SMA) by employing a cosine–type phase transformation equation with the initial martensite evolution coefficient that can capture the feature of the predictive residual martensite accumulation evolution and the nonlinear hysteresis loop on a finite element (FE) analysis framework. The effect of the applied loading level on transformation ratcheting are considered in the proposed model. The evolutions of transformation ratcheting and transformation stresses are constructed as the function of the accumulated residual martensite volume fraction. The FE implementation of the proposed model is carried out for the numerical analysis of transformation ratcheting of the SMA bar element. The integration algorithm and the expression of consistent tangent modulus are deduced in a new form for the forward and reverse transformation. The numerical results are compared with those of existing model and the experimental results to show the validity of the proposed model and its FE implementation in transformation ratcheting. Finally, a FE modeling is established for a repeated preload analysis of SMA bolted joint

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

A single fracture is the basic unit of fracture medium, and the roughness of fracture wall surface is an important factor influencing hydraulic characteristics of the flow in bedrock fracture. However, effects of the shape and density of roughness elements (various bulges/pits on rough fracture wall surfaces) on water flow in a single rough fracture have not been thoroughly discovered. Thus the water flow in single fracture with different shapes and densities of roughness elements was simulated by using Fluent software in this study. The results show that in wider fractures the flow rate mainly depends on fracture aperture, while in narrow and close fracture medium the surface roughness of fracture wall is the main factor of head loss of seepage; there is a negative power exponential relation between the hydraulic gradient index and the average fracture aperture, i.e. with the increase of fracture aperture, the relative roughness of fracture and the influence weight of hydraulic gradient both decrease; and in symmetrical-uncoupled fractures there is a super-cubic relation between the discharge per unit width and average aperture. Above results would help to deepen the understanding of rough fracture seepage.

Formaldehyde (HCHO) is one of the most important carcinogenic air contaminants. However, the lack of global surface concentration of HCHO monitoring is currently hindering research on outdoor HCHO pollution. Traditional methods are either restricted to small areas or data- demanding for a global scale of research. To alleviate this issue, we adopted neural networks to estimate surface HCHO concentration with confidence intervals in 2019, where HCHO vertical column density data from TROPOMI, in-situ data from HAPs (harmful air pollutants) monitoring network and ATom mission are utilized. Our result shows that the global surface HCHO average concentration is 2.30 μg/m3. Furthermore, in terms of regions, the concentration in Amazon Basin, Northern China, South-east Asia, Bay of Bengal, Central and Western Africa are among the highest. The results from our study provides a first dataset of the global surface HCHO concentration. In addition, the derived confidence interval of surface HCHO concentration adds an extra layer for the confidence to our results. As a pioneer work in adopting confidence interval estimation into AI-driven atmospheric pollutant research and the first global HCHO surface distribution dataset, our paper will pave the way for the rigorous study on global ambient HCHO health risk and economic loss, thus providing a basis for pollutant controlling policies worldwide.

The base excitation of mechanical equipment can result in pipeline system vibration which seriously affects the safe operation of the equipment. Particle damping technology is based on the particle collision dissipation principle to realize the structural vibration energy dissipation. This paper introduces the particle damping method into the vibration control of pipeline system. A particle damper has been designed for the structural characteristics of the pipeline. The influence of the material and structure of the pipeline particle damper, the external excitation and other parameters on the energy dissipation characteristics of particle damping are revealed. The energy dissipation mechanism of the pipeline particle collision damper under various parameter is analyzed. A pipeline vibration reduction test system with particle damping has been established. The effects of different excitation conditions, damper materials and number of unit structures of particle damper on the vibration damping effect of pipeline systems are investigated comparatively. The influence of damper parameters on the vibration suppression of pipeline system is obtained. The research in this paper can provide technical references for vibration suppression of pipeline systems.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The electroencephalogram (EEG) is a record of brain activity. Brain Computer Interface (BCI) technology formed by the EEG signal has become one of the hotspots at present. How to extract the feature signal of EEG is the most basic research of BCI technology. In this paper, A new method of recognizing fatigue, conscious, concentrated state of human brain is proposed by the combination of discrete wavelet transform and the neural network based on EEG signal. First of all, the law signal is preprocessed by the wavelet denoising method because the law EEG signal contains a large number of high frequency noise, which is decomposed into multi-layer high frequency signal and low frequency signal. thus, δ wave, θ wave, α wave, β wave are obtained by the wavelet transform. And then, frequency band energy of the different wave is regards as the feature signal of EEG. In the experiment, the feature signal is classified by radial basic function (RBF) and annealed chaotic competitive learning network (ACCLN). RBF and ACCLN networks are trained with 500 sets of sample data and are tested by 100 sets of samples in different mental states. The experimental results show that the average accuracy of RBF network under three conditions are 88.75%, 88.25%, 88.5%, respectively, and the correct rate of ACCLN network is 97%, 98%, 98%, respectively.

A large number of studies have concluded that since housing pressure will affect the mobility of highly skilled young migrants (HSYM) in Chinese cities and regions, it is necessary to apply corresponding housing policies to adjust housing unaffordability for HYSM. This study uses a survey data conducted in China's Zhejiang Province of China, where specific policies have been implemented to attract talent and found that housing does crowds out the HSYM from a city, but the HSYM who have a master's degree or above or who work in government organizations or state-owned enterprises are more tolerant of housing unaffordability. The unmarried or those staying in the city for a long period are less tolerant of housing unaffordability. Meanwhile, there are the heterogeneous impacts of factors on the HSYM's tolerance for housing unaffordability across cities of different levels. Therefore, housing policies should highlight urban differences and intra-group differences.

The response of boreal vegetation to global warming has shown a weakening trend over the last three decades. However, in previous studies, models of vegetation activity responses to temperature change have often only considered changes in mean daily temperature (Tmean), with the diurnal temperature range (DTR) being neglected. The goal of this study is to evaluate the temporal trends of the relationships between two temperature factors (Tmean and DTR) and vegetation activity across the boreal regions on both annual and seasonal timescales, by simultaneously employing satellite and climate datasets. We found that the interannual partial correlation between growing season (GS) NDVI and Tmean (RNDVI−Tmean) showed a significant decreasing trend over the last 34 years. At the seasonal scale, RNDVI−Tmean shows a significant upward trend in the spring, while in the summer and autumn, RNDVI−Tmean exhibits a significant downward trend. The temporal trend characteristics of the partial correlation between NDVI and DTR (RNDVI−DTR), at both the GS and seasonal scales, are fully consistent with RNDVI−Tmean. The area with a significant decrease in GS RNDVI−Tmean and RNDVI−DTR accounted for approximately 44.40% and 41.21% of the boreal region with the 17-year moving window, respectively. In stark contrast, the area exhibiting a significant increasing trend in GS RNDVI−Tmean and RNDVI−DTR accounted for only approximately 14.65% and 13.59% of the boreal region with the 17-year moving window, respectively. With respect to the seasonal patterns of RNDVI−Tmean and RNDVI−DTR, the area with a significant upward trend in spring was greater than that with a significant downward trend. Nevertheless, more areas had a significant downward trend of RNDVI−Tmean and RNDVI−DTR in summer and autumn than had a significant upward trend. Overall, our research reveals a weakening trend in the impact of temperature on vegetation activity in the boreal regions, and contributes to a deeper understanding of the vegetation response to global warming.

Concrete is more stable than filler as a false roof in a downward approach type infill quarry, but the mechanical model of a concrete false roof is not clear. As a result, there has been limited application. Therefore, it is necessary to establish the mechanical model of a concrete artificial false roof to enhance the stability of the downward approach infill quarry. This paper combines theoretical analysis, model derivation, finite element analysis and field application methods. Firstly, the basic assumptions of thin plate theory and elasticity mechanics are used as the premise to establish the differential equations of the deflection curve of the concrete thin plate false roof. Then, the three types of bending moment generation of the concrete thin plate false roof are explored. Secondly, the relationship between the location of dangerous surface and dangerous point in hard-supported weak-slab structure and soft-supported weak-slab structure is analyzed, and the type of uniform load and calculation model of concrete thin-slab false roof are improved. Finally, according to the established mechanical model of thin slab false roof, finite element analysis and field application were carried out. The results show that there are three types of deflection curve differential equations in the concrete thin slab false roof perpendicular to the strike, and three extreme points exist in the middle section of the thin slab and on both sides of the surrounding rock. The hazardous surface of the hard-supported weak-slab structure is present at the intersection of the encircling rock and the thin-slab fake ceiling, with the perilous point situated on the top of this surface. The hazardous surface of the soft-supported weak-slab structure can be found in the centre section of the thin-slab fake ceiling, with the perilous point being located at the bottom of this surface. Moreover, the damage mode for both structures is that of maximum tensile stress damage. Upon conducting a finite element analysis, the results indicate that the concrete's maximum tensile stress is significantly high.

Background: Cigarette smoking (CS) is a global public health problem and a high-risk factor for various diseases. In December 2019, a novel coronavirus (HCoV-19) was identified in Wuhan, China. Because ACE2 has been identified as a receptor for HCoV-19, we hypothesize that CS affects the expression pattern of ACE2 in respiratory tract, causing differences in susceptibility to the virus. Methods: Three datasets (GSE994, GSE17913, and GSE18344), were downloaded from the Gene Expression Omnibus (GEO) database. Correlation and enrichment analysis were used to evaluate the function of ACE2. Also, the different expression of ACE2 in different groups of three datasets were analyzed. Results: Genes associated with ACE2 were enriched in important biological processes such as viral processes and immune response. Elevated ACE2 were found in intrapulmonary airways (GSE994) and oral epithelial cells (GSE17913) of smokers but not those of non-smokers or former smokers. Significant dose- and time-dependent relationships between CS and ACE2 expression were observed in mouse lung tissues, and long periods without smoking were found to significantly reduce ACE2 expression. Conclusions: Both human and rat data confirmed that CS could induce increased ACE2 in the respiratory tract, indicating that smokers have a higher susceptibility to HCoV-19.

Advanced high-strength steels (AHSS) have a wide range of applications in equipment safety and lightweight design, and enhancing the strength of AHSS to the ultra-high level of 2 GPa is currently a key focus. In this study, a new process of thermo-mechanical control process followed by direct quenching and partitioning (TMCP-DQP) is developed based on Fe-0.4C-1Mn-0.6Si (wt.%) low-alloy steel, and the effects of microstructure evolution on mechanical properties under TMCP-DQP process and conventional hot rolled quenched and tempered process (HR-QT) are comparatively studied. The results show that the TMCP-DQP process not only shortened the processing steps but also achieved outstanding comprehensive mechanical properties. The TMCP-DQP steel exhibits a tensile strength of 2.23 GPa, accompanied by 11.9% elongation and a Brinell hardness of 624 HBW, with an impact toughness of 28.5 J at -20 ℃. In contrast, the HR-QT steel exhibits tensile strengths ranging from 2.16 GPa to 1.7 GPa and elongations between 5.2% and 12.2%. The microstructure of TMCP-DQP steel primarily consists of lath martensite, containing thin-film retained austenite (RA), nanoscale rod-shaped carbides, and a minor number of nanoscale twins. The volume fraction of RA reaches 7.7%, with an average carbon content of 7.1 at.% measured by three-dimensional atom probe tomography (3DAP). Compared to the HR-QT process, the TMCP-DQP process results in finer microstructure, with a prior austenite grain (PAG) size of 11.91 μm, forming packets and blocks with widths of 5.12 μm and 1.63 μm. The TMCP-DQP process achieves the ultra-high strength of low-alloy steel through the synergistic effects of grain refinement, dislocation strengthening, and precipitation strengthening. The dynamic partitioning stage stabilizes the RA through carbon enrichment, while the relaxation stage reduces a small portion of the dislocations generated by thermal deformation, and the self-tempering stage eliminates internal stresses, all guaranteeing considerable ductility and toughness. The TMCP-DQP process may offer a means for industries to streamline their manufacturing processes and provide a technological reference for producing 2.2 GPa grade AHSS.

An experiment was conducted to investigate the role of single nucleotide polymorphisms of the gene RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T with carcass and meat quality traits of Chinese Simmental-cross steers. METHOD: We performed sequencing and restriction enzyme digestion to detect genotypes of RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T. Then, we analyzed the association of novel single nucleotide polymorphisms in intron regions of the RNF128 gene and in the 3′UTR region of RNF34 and meat quality traits of Chinese Simmental-cross steers. RESULTS: Statistical analyses revealed that SNP of RNF128 (I1-2380C>T) was significantly associated with dressed weight, forepaw weight, carcass depth, carcass brisket depth, hind legs length (P<0.05), etc. And RNF34 (3′UTR-588 G>A) were significantly associated with testis weight, kidney weight, tare weight (P<0.05), etc. CONCLUSION: Our findings suggest that polymorphisms in RNF34 and RNF128 might be important genetic factors that influence carcass and meat quality in beef cattle. Thus, they might be useful markers for meat quality traits in future marker-assisted selection programs in beef cattle breeding and production.

The SK model proposed by Sherrington and Kirkpatrick is an important mean field model for spin glasses. The dependence structure of Hamiltonians of the SK model is considered in this paper. We have investigated the covariance matrix of Hamiltonians of the SK model, and establish a relationship between the rank of the corresponding covariance matrix and the dimension of the space spanned by the Hamiltonians. Finally, we also give an upper bound for the rank of the covariance matrix, which might be the best.

A portable laser photoacoustic sensor based on a Field-Programmable Gate Array (FPGA) is reported for methane detection. A tunable DFB diode laser in the 1654 nm wavelength range is used as an excitation source. The photoacoustic signal processing was implemented by a FPGA device. A small resonant photoacoustic cell is designed. The minimum detection limit (1σ) of 10 ppm for methane (CH₄) is demonstrated.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Gastric cancer (GC) is one of the leading malignancy diseases worldwide, especially in Asian. CAST is a potential oncogene in GC carcinogenesis process. The character of macrophage infiltration in GC microenvironment was also unaddressed. Methods: We first applied machine searching in gene candidate evaluation of GC. CAST expression was analyzed via the Human Protein Atlas (HPA) and Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. Protein-protein interaction (PPI) network was downloaded from STRING. We investigated the impact of CAST on clinical prognosis using Kaplan-Meier plotter. The correlations between CAST and Lgr5 and macrophage infiltration in GC was surveyed via TIMER 2.0. Finally, GeneMANIA was also used to evaluate the possible functional linkage between genes. Results: After machine-assisted searching, CAST expression was found signicant difference in the overall survival of GC patients. STRING revealed CAST related proteomics and transcriptomics associations, mainly about CAPN family. Moreover, CAST significantly impacts the prognosis of GC from other datasets validation. Notably, high CAST expression was correlated with worse overall survival in GC patients (hazard ratio = 1.59; logrank P = 9.4 x 10-8). CAST and Lgr5 expressions were both positively correlated with WNT 2 and WNT 2B. Among GC patients in several datasets, CAST and macrophage infiltration evaluated together showed no obvious trend toward poor clinical overall survival. Conclusion: CAST plays an important role in GC clinical prognosis and is associated with WNT 2/WNT 2B/Lgr5. Our study denmostrated that CAST in GC overall survival is regulated by macrophage infiltration.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Currently, in some domestic and foreign mines, the backfill drilling pipeline experience a rupture phenomenon even when the wear degree is low. This results in a delay in production due to the filling becoming 'sick'. This paper presents, for the first time, the damage mechanism from a mechanical perspective and re-derives the anti-extrusion strength model of the backfill drilling pipeline. We investigate the influence of law on the anti-extrusion strength of pipelines from the perspective of stratum and cement ring. We then verify the theoretical and simulation results through engineering examples. The results demonstrate that the Mises stress criterion is a suitable modification principle for the anti-extrusion strength model of the backfill drilling pipeline. The anti-extrusion strength of the pipeline is related to the elastic modulus and Poisson's ratio of the stratum, and the thickness of the cement ring. It is negatively affected by the depth of the stratum. For hard strata, a cement ring with a smaller elastic modulus is suitable, while for soft stratum, a cement ring with a larger elastic modulus is recommended. When the missing angle of the cement ring is less than 60°, the stress concentration factor increases up to 2.2. The stress unloading capacity of the cement ring ranges from 32.7% to 37.8%, and optimal performance of the cement ring is achieved when it has high strength and low rigidity. The backfill filling pipeline of a copper mine abroad was destroyed due to external extrusion force exceeding its anti-extrusion strength value. The modified pipeline anti-extrusion strength model is 18.2% higher than the casing API strength value. This finding can inform the design of the backfill filling pipeline for China's kilometer-deep wells in the future.

To facilitate the computation of the uniaxial compressive strength value of the cemented paste backfill under the condition of high sand-cement ratio, and to analyze the size effect of the cemented paste backfill with high sand-cement ratio under varied aspect ratios, the cemented paste backfill specimens with sand-cement ratios of 8:1-24:1 and aspect ratios of 0.5, 1, and 2 were prepared. Through response surface experiments and finite element analysis, the influence of three aspect ratios on the cemented paste backfill strength was explored, and the failure characteristics and size effect mechanisms of cemented paste backfill with various aspect ratios were analyzed. The model of strength conversion between cemented paste backfill with different aspect ratios was established. The results show that the compressive strength of the cemented paste backfill decreases with the increase of the aspect ratio under the same mass concentration and sand-cement ratio. When the aspect ratio is 0.5 and 1, the splitting failure is the main factor; when the aspect ratio is 2, the shearing failure is the main factor. The three-dimensional stress caused by the end effect of the cemented paste backfill is the main reason for the high strength when the aspect ratio is 0.5. Due to the one-dimensional stress zone generated in the middle of the cemented paste backfill with an aspect ratio of 2 in the laboratory, its strength value is closer to the actual uniaxial compressive strength value of the cemented paste backfill. The strength values of the cemented paste backfill with aspect ratios of 0.5 and 1 were higher than the actual uniaxial compressive strength values in the laboratory. The rationality of the theoretical analysis was verified by the ABAQUS analysis results. According to the experimental results, a strength conversion model between different aspect ratios is established, which can provide a reference for the design of the uniaxial compressive strength of the cemented paste backfill.

The objective of this study was to assess the effects of parity and lactation stage on the content and conversion rate of DHA in milk from dairy cows fed ruminally protected algae powder. A total of 800 cows were blocked by parity and divided into eight groups (n = 100, three groups of primiparous cows and five groups of multiparous cows) in a six-month experimental period. The lactation period was divided into three stages: 16 – 100 d, 101 – 200 d, and 201–305 d. All cows were fed 100 g of DHA-rich algae powder twice a day, with the DHA content > 13%. Milk samples were collected monthly, and daily milk yield and dry matter intake were recorded. Using infrared spectroscopy, we determined the content of protein, fat, lactose, and total solids in milk and calculated the DHA conversion rate. The results showed that parity and lactation stage had no significant effects on milk composition. However, milk yield and dry matter intake were higher in multiparous cows than in primiparous cows. The DHA content and conversion rate in milk were not significantly different between parity groups but were positively correlated with lactation stage and negatively correlated with milk fat content.

Enterovirus 71 (EV71) infection hand-foot-mouth disease (HFMD), meningoencephalitis, neonatal sepsis, and even fatal encephalitis in children, thereby representing a serious public health hazard. It is important to determine the mechanisms underlying the regulation of EV71 infection. In this study, we initially reveal that the interleukin enhancer binding factor 2 (ILF2) down-regulates EV71 50% tissue culture infective dose (TCID50), attenuates EV71 plaque formation unit (PFU), thereby repressing EV71 infection. Moreover, we reveal a distinct mechanism by which EV71 antagonizes ILF2-mediated antiviral effects. Chip data analyses show that ILF2 mRNA is reduced upon EV71 infection. Cellular studies indicate that EV71 infection represses ILF2 mRNA expression and protein production in human leukemic monocytes (THP-1) differentiated macrophages and in human rhabdomyosarcoma (RD) cells. Additionally, EV71 non-structural protein 2B interacts with ILF2 in human embryonic kidney (HEK293T) cells. Interestingly, in the presence of EV71 2B, ILF2 is translocated from the nucleus to the cytoplasm and co-localizes with 2B in the cytoplasm. Therefore, we reveal a distinct mechanism by which EV71 antagonizes ILF2-mediated antiviral effects by inhibiting ILF2 expression and promoting ILF2 translocation from the nucleus to cytoplasm through its 2B protein.

Marine mortar was the goal material and its multi-scale physical-chemical-mechanical characteristics were the principal interest in this study. The on-line multi-scale damage detection experiments art was designed to quantify the characteristics mathematically and graphically. The normal cylinder specimen with 70-day age was produced and investigated by dynamically global MSHCT scan and local detection of EDS, SEM and XRD. The experiments results indicated that the marine mortar offered the appreciable strength at the early age at least, although some saline minerals were generated during the preparation. The micro-interfacial behavior and the parental foci controlled the damage development of the marine mortar the performance of which was still the adjustable one by the composition optimization.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Although the regulatory function of miRNAs and their targets have been characterized in model plants, a possible underlying role in the cotton response to herbivore infestation has not been determined. To investigate this, we performed small RNA and degradome sequencing between resistant and susceptible cotton cultivar following infestation with the generalist herbivore whitefly. In total, 260 miRNA families and 241 targets were identified. Quantitative-PCR analysis revealed that several miRNAs and their corresponding targets exhibited dynamic spatio-temporal expression patterns. Moreover, 17 miRNA precursors were generated from 29 long intergenic non-coding RNA (lincRNA) transcripts. Genome-wide analysis also led to the identification of 85 phased small interfering RNA (phasiRNA) loci. Among these, nine PHAS genes were triggered by miR167, miR390, miR482a, and two novel miRNAs, including those encoding a leucine-rich repeat (LRR) disease resistance protein, an auxin response factor (ARF) and MYB transcription factors. Through combined modeling and experimental data, we explored and expanded the miR390-tasiARF cascade during the cotton response to whitefly. Virus-induced gene silencing (VIGS) of ARF8 in whitefly-resistant cotton plants increased auxin and jasmonic acid (JA) accumulation, resulting in an increased tolerance to whitefly infestation. These results highlight the provides a useful transcriptomic resource for plant-herbivore interaction.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Driving factors of smart city construction are exploratively studied by grounded theory method based on text sources from journal papers in SCI and CSSCI databases. Initial scale of driving factors about smart city construction is obtained on the basis of above analyses. This paper modifies measuring items of the initial scale with a small sample pretest and reliability test, then forms final items by exploratory factor analysis. According to the above scale, questionnaires are designed to obtain empirical data, and confirmatory factor analysis is used to verify further validity and reliability of the scale. The results show that driving factors of smart city construction include three main dimensions: problem-oriented factors, business- or technology-driven factors and endogenous development requirements.

An eight-sided prism sample, obtained from a hot-rolled AZ31 magnesium alloy sheet, was compressed at room temperature along the transverse direction to investigate the influence of local strain on twinning behavior using electron backscatter diffraction (EBSD) measurements. The octagonal surface of the sample was divided into distinct regions based on hardness distribution and metallographic observations. The EBSD maps of different areas show significant variations, suggesting that these areas experienced different local strain conditions. The EBSD measurements provided detailed data from three distinct regions, with the strain state known in two regions and uncertain in the third. The combined analysis of the Schmid factor (SF) and the strain compatibility factor (m') was employed to study twin variant selection. The comparison of twinning behavior in different regions showed that the strain compatibility factor offered a more comprehensive explanation for the observed twinning pattern in the region with local shear strain.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Regeneration of biological tissues in medicine is challenging, and 3D bioprinting offers an innovative way to create functional multicellular tissues. One common way in bioprinting is bioink which is one type of the cell-loaded hydrogel. For clinical application, however, the bioprinting still suffers from satisfactory performance, e.g. in vascularization, effective antibacterial, immunomodulation and regulation of collagen deposition. Many studies have incorporated different bioactive materials into the 3D printed scaffolds to optimize the bioprinting. Here, we review a variety of additives added to the 3D bioprinting hydrogel. The underlying mechanisms and methodology for biological regeneration are important and will provide useful basis for future research.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

The nuclear factor-ĸB (NF-ĸB) transcriptional system is a major effector pathway involved in inflammatory responses. Previous studies found that a Gardenia decoction (GD) inhibited the expression of NF-κB in a lipopolysaccharide (LPS)-stimulated mouse intestinal injury model. Herein, we hypothesized that geniposide (GE), a component of Gardenia jasminoides Ellis, also exerts anti-inflammatory effects and inhibits NF-ĸB activity in LPS-induced intestinal epithelial cells (IEC-6). IEC-6 cells were stimulated with LPS, following which the effects of GE on NF-ĸB signaling in the IEC-6 cells were examined by western blotting to detect IĸB phosphorylation/degradation. The expression of NF-κB was determined by immunofluorescence assay (IFA). Enzyme-linked immunosorbent assay (ELISA) was used to detect the inhibitory effect of GE on the release of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) activated by LPS in IEC-6 cells. In addition, the migration ability of IEC-6 cells was observed by the scratch method. These results showed that GE dose-dependently downregulated levels of the proinflammatory cytokines TNF-α, IL-6 and IL-1β that had been upregulated by LPS and suppressed the phosphorylation of IĸB and NF-ĸB induced by LPS. Our findings indicated that GE could reduce LPS-induced NF-ĸB signaling and proinflammatory expression in IEC-6 cells and significantly enhance the migration of IEC-6 cells. Moreover, GE inhibited the expression of NF-κB, nuclear transfer, and transcriptional activity in IEC-6 cells. GE could block the synthesis of inflammatory factors of IEC-6 cells by inhibiting activation of the IĸB/NF-κB signaling pathway induced by LPS.

This study was first time designed to investigate the effect of oxidation on protein digestion and transport properties in boiled sea cucumber body wall (BSCBW) via simulated digestion combine with everted-rat-gut-sac models. Boiling heat treatments led to protein oxidation in SCBW, manifested by increases in free radical intensity, thiobarbituric acid reactive substances, carbonyl groups, disulfide bonds, dityrosine bonds, advanced glycation end products, protein hydrophobicity and aggregation, declines in free sulfhydryl group, and secondary structure transition from α-helix to β-sheet. Boiling for 2 h caused the anti-digestion collagen unfolding, provided the action site for protease, and improved the protein digestion and transport levels. On the contrary, excessive oxidative modification of 4 h-BSCBW resulted in decreased protein digestion and transport levels. From the perspective of texture, digestion and transport properties, boiling for 2 h can obtain sea cucumber products with better edible and digestible properties, which is considered to be a better processing condition.

The effects of simulated acid rain (SAR) on the photosynthetic performance of subtropical coniferous species have not been thoroughly investigated. In this study, we treated two coniferous species, Pinus massoniana (PM) and Cunninghamia lanceolata (CL), with SAR and then analyzed photosynthetic activities via the simultaneous measurement of prompt fluorescence(PF), delayed fluorescence(DF), and modulated reflection at 820 nm(MR820). Following the low-pH SAR treatment, the I–P phase of the OJIP curves of PM and CL decreased significantly and then the K-band and L-band were detectable. The delayed fluorescence for both PM and CL decreased as the pH of the SAR solution decreased, with a more significant decrease in the I1 peak than in the I2 peak. According to the MR820 curve, the exposure to SAR stress inhibited the rapid decrease and slow increase in the MR820 transients of PM and CL. The gradients of the decreasing and increasing phases were lower for CL than for PM at pH 2.5. In addition, SAR decreased the light energy captured per unit area (ABS/CSm) and the quantum yield of electron transfer per unit area (ETO/CSm), but it increased the accumulation of QA−, thereby decreasing primary photochemical efficiency (TRO/CSm, φPO). These changes in photosystem II (PSII) resulted in a decrease in the maximum quantum yield of PSII (Fv/Fm) and the performance index (PIABS). Moreover, PSII was protected from thylakoid membrane photodamages through the increase in heat dissipation per unit area (DIO/CSm) in response to SAR. The increase in δRO as the pH of the SAR solution decreased was observed for PM, but not for CL. Considered together, the study findings suggest that SAR treatments can decrease chlorophyll contents and damage the OEC in PM and CL, which obstructs the transfer of electrons on the donor and acceptor sides of PSII. However, PM is better able to withstand SAR stress than CL, likely because of the activation of a protective mechanism (reflected by the change in δRO). Therefore, in coniferous forest areas severely affected by acid rain, CL may need to be protected more than PM.

Ostreid herpesvirus 1 (OsHV-1) is one of the most economically important pathogens of Pacific oysters. Understanding the pathogenesis of this virus is critical to developing tools to control outbreaks on shellfish farms. OsHV-1 is genetically related to vertebrate herpesviruses, which have a lytic and a latent stage, with the latent stage capable of being reactivated to the lytic stage. Here, OsHV-1 latency in Pacific oysters was investigated in experimentally and naturally infected oysters. Lytic infection in one-year-old oysters injected with the Tomales Bay strain of OsHV-1 was detectable between 1 and 4 days post-infection (dpi) but was not detectable after 5 dpi. The infected oysters shed 1102 to 1104 DNA copies/ml during the 4-day acute phase. At 21 dpi, the recovered oysters were temperature and chemically stressed and were found to shed 1104 to 1105 DNA copies/ml over a period of 48 h. Lytic shedding was not detectable in two-year-old oysters injected similarly with the same strain of OsHV-1; however, the OsHV-1 genome was detectable by qPCR in the adductor muscle, gill, mantle, and hemocytes within the first 3 dpi, after which it became undetectable. No OsHV-1 was detectable in the adductor muscle, gill, or mantle from experimentally infected oysters on days 15 and 21 post-infection or from oysters sampled 9 months after surviving an OsHV-1 mortality event; however, OsHV-1 DNA could be detected in hemocytes of both experimentally infected oysters at 21 dpi and naturally infected oysters. In addition, lytic viral gene transcription was detectable in hemocytes of experimentally infected oysters between 1 and 21 dpi and in hemocytes of naturally infected oysters.

Ischemic stroke is one of the most disabling diseases and a leading cause of death globally. Despite advances in medical care, the global burden of stroke continues to grow, as no effective treatments to limit or reverse ischemic injury to the brain are available. However, recent preclinical findings have revealed the potential role of transient receptor potential cation 6 (TRPC6) channels as endogenous protectors of neuronal tissue. Activating TRPC6 in various cerebral ischemia models has been found to prevent neuronal death, whereas blocking TRPC6 enhances sensitivity to ischemia. Evidence has shown that Ca2+ influx through TRPC6 activates cAMP response element-binding protein (CREB), an important transcription factor linked to neuronal survival. Additionally, TRPC6 activation may counter excitotoxic damage resulting from glutamate release by attenuating the activity of NMDA receptors of neurons by posttranslational means. Unresolved though, are the roles of TRPC6 channels in non-neuronal cells such as astrocytes and endothelial cells. Moreover, TRPC6 channels may have detrimental effects on the blood-brain barrier, although their exact role in neurovascular coupling requires further investigation. This review discusses evidence-based cell-specific aspects of TRPC6 in the brain to assess the potential targets for ischemic stroke management.

The carbonyl iron particles were dispersed in a polychloroprene rubber (CR) matrix under an external magnetic field for practical application as microwave absorption composites film. The film prepared under external magnetic field with a thickness of only 0.54 mm showed least reflection loss of -15.98 dB and the reflection loss value less than -10.0 dB over the frequency range of 11.4~14.8 GHz. In comparison with the microwave absorption properties of calculation by transmission line theory based on the tested relative complex permittivity and permeability and film prepared by general route without external magnetic field, the film made with external magnetic field exhibited more excellent microwave absorption properties, strongly depending on the increment of anisotropy and rearrangement of magnetic particles. The results indicated the composite film made under external magnetic field have excellent microwave absorption properties, which suggest that the composites thin film could be used as a thinner and lighter microwave absorber.

This literature review paper delves into the synergies between Climate-Smart Agriculture (CSA) and the effective management of food losses. With the escalating challenges posed by climate change and the pressing need to address food security concerns, the intersection of these two critical domains becomes paramount for sustainable agricultural practices. The review explores existing research on the implementation of climate-smart agricultural techniques and their impact on mitigating food losses throughout the agricultural value chain. The paper synthesizes findings related to climate-resilient crop varieties, precision farming, water-use efficiency, and sustainable soil management, highlighting their contributions to reducing post-harvest losses and enhancing overall food security. In addition to summarizing current knowledge, this paper identifies gaps in the literature and proposes avenues for future research. This review serves as a foundation for researchers, policymakers, and practitioners seeking to contribute to the advancement of climate-smart agriculture and the reduction of food losses, paving the way for a more sustainable and resilient global food system.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.