Agriculture (crop production, land use, and livestock) is the second most important greenhouse gas (GHG) emitting sector after the energy sector. Agriculture is also recognized as the source and sink of GHGs. Evidence demonstrates that the application of high amounts of nitrogen-rich fertilizers enhances methane (CH4) and nitrous oxide (N2O) emissions, which are potent GHGs with a high global warming potential (GWP). Considering its global contribution to the climate crisis, reducing GHG emissions in agriculture would considerably lower its share of the global GHG emission records, which may lead to enormous benefits for the environment and food production systems. Several diverging and controversial views questioning the actual role of plants in the current global GHG budget continue to nourish the debate globally. We must acknowledge that considering the beneficial roles of major GHGs to plants at a certain level of accumulation, implementing GHG mitigation measures from agriculture is indeed a complex task. This review seeks to provide key approaches for GHG mitigation in the literature (environmentally friendly crop cultivation and residue management practices, improvement of plants nutrients/fertilizer use efficiency, exploring the genetic diversity for low GHG emission, soil methane-producing bacteria, integrated soil fertility management, improved livestock feeding efficiency, and production, etc.). This work gathers key approaches from 275 peer-reviewed publications, including experimental research papers, review articles, and books, discussing greenhouse gas emissions mechanisms and mitigation to unravel effective strategies for GHG mitigation, proven to be effective or carry the potential to mitigate GHG generation from agriculture. This review also discusses in depth the significance and the dynamics of strategies regarded as game changers with a high potential to enhance, in a sustainable manner, the resilience of agricultural systems. Agricultural GHG mitigation approaches discussed in this work can serve as game changers in global efforts to reducing GHG emissions and alleviating the impact of climate change through sustainable agriculture and informed-decision making.

Rice production is a significant contributor to methane emissions, accounting for ap-proximately 11% of global anthropogenic emissions. However, methane emissions in rice fields could effectively be reduced by implementing proper management practices and careful cultivar selection. The impact of nitrogen fertilizers on methane emissions is mul-tifaceted, as these fertilizers enhance crop growth and influence the activity of me-thane-producing (methanogens) and methane-consuming microbes (methanotrophs), leading to complex outcomes in methane emissions. In this study, we used qPCR to quan-tify methanogens and methanotrophs using mcrA (methanogenesis-related gene) and pmoA (methane oxidation-related gene) primer sets under different nitrogen levels (0, 50, and 100%) and rice varieties. The results revealed that higher nitrogen input led to higher methanogen inhabitation in the rhizosphere. Additionally, the abundances of methano-gens and methanotrophs varied among the different rice varieties. Furthermore, it was observed that there may be an additive effect between the rice variety and nitrogen level used. These findings suggest that future breeding efforts should involve screening for me-thane-related microbes in rice cultivars adapted to low-nitrogen conditions. By identifying and selecting rice varieties that promote lower methanogen levels and higher metha-notroph inhabitation, significant steps can be taken to mitigate greenhouse gas emissions from rice cultivation.

Abstract: Rice production is a significant contributor to methane emissions, accounting for approximately 11% of global anthropogenic emissions. However, there is potential for effectively reducing methane emissions from rice fields through the implementation of proper management practices and careful cultivar selection. The impact of nitrogen (N) fertilizers on methane (CH4) emissions is multifaceted, as these fertilizers not only en-hance crop growth but also influence the activity of methane-producing microbes (Meth-anogens) and methane-consuming microbes (Methanotrophs), leading to complex out-comes in CH4 emissions. In this study, we utilized qPCR to quantify methanogens and methanotrophs using mcrA (methanogenesis-related gene) and pmoA (methane oxida-tion-related gene) primer sets under different nitrogen levels (0, 50, 100%) and rice varie-ties. The results revealed that higher nitrogen inputs led to higher methanogen inhabita-tion in the rhizosphere. Additionally, the abundances of methanogens and metha-notrophs varied among different rice varieties. Furthermore, through the analysis of two-way ANOVA, it was observed that there may be an additive effect between rice variety and nitrogen level. Furthermore, enhancing agronomic traits related to yield can reduce methanogen inhabitation. These findings suggest that future breeding efforts should in-volve the screening of methane-related microbes in rice cultivars adapted to low nitrogen conditions. By identifying and selecting rice varieties that promote lower methanogen lev-els and higher methanotroph inhabitation, we can take significant steps towards mitigating greenhouse gas emissions from rice cultivation.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Objectives: Essential thrombocythemia (ET) is a chronic myeloproliferative neoplasm characterized by elevated platelet counts and an increased risk of thrombotic events, including ischemic strokes. Methods: We conducted a retrospective analysis of data from consecutive ischemic stroke patients with ET between March 2014 and February 2023. Results: This case series describes the clinical presentation, radiological features, and management of five patients with ET-associated ischemic strokes, all harboring the JAK2 mutation. The diverse radiological findings suggest that both large and small vessel diseases may be influenced by the prothrombotic state induced by ET. A significant elevation in platelet count was observed to correlate with the emergence of new acute infarctions in some cases. Conclusions: The study highlights combined use of antiplatelet and cytoreductive therapy in preventing secondary stroke events in patients with ET and JAK2 mutations. The heterogeneity of stroke patterns in this population necessitates a comprehensive understanding of the underlying pathophysiological mechanisms and tailored therapeutic approaches.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

Organizing pneumonia (OP) can be diagnosed pathologically, and cryptogenic OP (COP) and secondary OP (SOP) have been classified by cause and underlying context. Because it is clinically difficult to differentiate between COP and SOP, this study investigated characteristics that could distinguish between COP and SOP. The medical records of patients who underwent lung biopsy from 2016 to 2018 were retrospectively reviewed. Eighty-five patients had pathologically proven OP, including 16 diagnosed with COP and 69 diagnosed with SOP. The most common cause of SOP was infectious pneumonia, observed in 57 (82.6%) of the 69 patients. Median time from symptom onset to hospital admission is shorter (P=0.006) and fever was more common (P=0.021) in the SOP. Some laboratory results differed significantly between the two groups. Lymphocyte in bronchoalveolar lavage fluid were higher in the COP (P=0.012). Radiologic findings showed that effusion was more common in the SOP (P=0.043). There were no between-group differences in steroid use, 30 day and in-hospital mortality rates, and rates of OP outcomes and recurrences. Infection is the main cause of SOP. Symptom onset is more rapid in patients with SOP. Pleural effusion was more common in the SOP but there were no differences in clinical course.

Ozonated sunflower oil (OSO) is well known functional oil with its antioxidant, antimi-crobial, anti-allergic, and skin-moisturizing properties. However, studies on the effects of OSO on high-cholesterol diet (HCD)-induced metabolic disorders have been scarce. In the current study, we aimed to determine the anti-inflammatory effects of OSO on lipid me-tabolism in adult hypercholesterolemic zebrafish and its embryo. Microinjection of OSO (final 2%, 10 nL) into zebrafish embryos under presence of carboxymethyllysine (CML, 500 ng) protected acute embryo death upto 61% survival, while sunflower oil (final 2%) showed much less protection around 42% survival. The microinjection of OSO was more effective than SO to inhibit reactive oxygen species (ROS) production and apoptosis in the CML induced embryo toxicity. Intraperitoneal injection of OSO under presence of CML protected acute death from CML-induced neurotoxicity with improved hepatic inflamma-tion, less detection of ROS and interleukin (IL)-6, and lowering blood total cholesterol (TC) and triglyceride (TG), while SO-injected group did not protect the CML-toxicity. Long-term supplementation of OSO (final 20%, wt/wt) with HCD for 6 months resulted higher sur-vivability than HCD alone group or HCD+SO group (final 20%, wt/wt) with significant lowering of plasma TC and TG levels. The HCD+OSO group showed the least hepatic in-flammation, fatty liver change, ROS, and IL-6 production. In conclusion, short-term treat-ment of OSO by injection exhibited potent anti-inflammatory activity against acute neuro-toxicity of CML in zebrafish and its embryo. Long-term supplementation of OSO in diet also revealed the highest survivability and blood lipid-lowering effect through potent an-ti-oxidant and anti-inflammatory activity.

The objective of this study is to design and synthesize substituted η6-chromium tricarbonyl metal complexes carrying o-carborane units as potential boron neutron capture therapy (BNCT) agents. In this study, 1,2-Diphenyl-o-carborane units were used as starting materials to generate biologically active species. We investigated how the structural changes of 1,2-diphenyl-o-carborane substituted with chromium(0) tricarbonyl affect the biological properties; [(CO)3Cr]Ph2C2 (2) and [(CO)3Cr]2Ph2C2 (3) species were produced in moderate yields. The molecular structures of compounds 1–3 were identified and established by infrared (IR), 1H, 11B, and 13C nuclear magnetic resonance (NMR), and X-ray crystallography analyses. Crystal structures of o-carboranyl chromium complexes 1 [a = 10.859(1) Å, b = 24.953(3) Å, c = 13.938(2) Å, β = 111.854(2)º], 2 [a = 10.621(3) Å, b = 17.056(5) Å, c = 12.174(4) Å, β = 106.622(5)º], and 3 [a = 17.540(2) Å, b = 18.060(2) Å, c = 19.484(4) Å, α = 105.746(2)º, β = 110.226(2)º, γ = 91.256(2)º] were obtained. In vitro study using B16 and CT26 cancer cells containing the triphenyl-o-carboranyl chromium (0) complexes Ph3C2BCr2 and Ph3C2BCr3, which we have previously reported, the compounds 2 and 3 accumulated at higher levels than compounds Ph3C2BCr2 and Ph3C2BCr3. However, the phenylated o-carboranyl chromium(0) complexes have been found to be more cytotoxic than p-boronophenylalanine (BPA).

Ozonated sunflower oil (OSO) is renowned for its diverse therapeutic benefits. Nonetheless, the consequences of extended dietary intake of OSO have yet to be thoroughly investigated. Herein, the effect of 2-year dietary supplementation of OSO was examined on the zebrafish survivability, obesity, skeletal deformities, swimming behavior, and liver, kidney, ovary, and testis function. Results showed that the zebrafish feed supplemented with 20% (wt/wt) OSO for 2 years emerged with higher survivability and body weight management compared to sunflower oil (SO) and normal diet (ND) supplemented zebrafish. Radio imaging (X-ray) based analysis revealed 2.6o and 15.2o lower spinal curvature in the OSO-supplemented groups than in SO and ND-supplemented groups; consistently, OSO-supplemented zebrafish showed better swimming behavior. The histology analysis of the liver revealed a least fatty liver change and interleukin 6 (IL-6) generation in the OSO-supplemented group. Additionally, a significantly lower level of reactive oxygen species (ROS), apoptotic, and senescent cells were observed in the liver of the OSO-supplemented zebrafish. Also, no adverse effect on the kidney, testis, and ovary morphology was detected during 2 years of OSO consumption. Moreover, lower senescence with diminished ROS and apoptosis was noticed in the kidney and ovary in response to OSO consumption. The OSO supplementation was found to be effective in countering age-associated dyslipidemia by alleviating total cholesterol (TC), triglycerides (TG), low-density lipoproteins (LDL-C) and elevating high-density lipoproteins (HDL-C)/TC levels. Conclusively, prolonged OSO consumption showed no adverse effect on the morphology and functionality of vital organs; in fact, OSO supplementation displayed a protective effect against age-associated detrimental effects on spinal deformities, vital organ functionality, cell senescence, and survivability of zebrafish.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

Ozonated sunflower oil (OSO) is an established therapeutic agent and nutraceutical harboring various therapeutic values, including antiallergic, derma-protective, and broad-spectrum antimicrobial activity. Conversely, the medicinal aspects of OSO for wound healing, tissue regeneration, and treatment of inflammation in dyslipidemia have yet to be fully elucidated. Herein, a comparative effect of OSO and sunflower oil (SO) was investigated to heal cutaneous wound and tissue regeneration of zebrafish impediment by carboxymethyllysine (CML) toxicity, following impact on hepatic inflammation and blood lipid profile. After OSO (final 2%, 1 μL) and SO's (final 2%, 1 μL) treatment, substantial healing was elicited by OSO in the cutaneous wound of zebrafish impaired by CML (final 25 mg). As an important event of wound healing, OSO scavenges the reactive oxygen species (ROS), rescues the wound from oxidative injury, and triggers the essential molecular events for the wound closer. Furthermore, the intraperitoneal injection of OSO was noted to counter the CML-induced adversity and prompt tissue regeneration in the amputated tail fin of zebrafish. Additionally, OSO counters the CML-induced neurotoxicity and rescues the zebrafish from acute mortality and paralysis, along with meticulous recovery of hepatic inflammation, fatty liver changes, and diminished ROS and proinflammatory interleukin (IL)-6 production. Besides, OSO efficiently ameliorated CML-induced dyslipidemia by alleviating the total blood cholesterol (TC), triglyceride (TG) and increasing high-density lipoproteins cholesterol (HDL-C). The outcome of multivariate assessment employing principal component analysis and hierarchical cluster analysis supports a superior therapeutic potential of OSO over SO against the clinical manifestation of CML. Conclusively, OSO owing to its antioxidant and anti-inflammatory potential, counters CML-induced toxicity and promotes wound healing, tissue regeneration, hepatoprotection, improved blood lipid profile, and survivability of zebrafish.

Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power wasted for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power conversion efficiency (PCE) of 90.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding PCE of 74.6%. The result shows that the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

This study aimed to elucidate the antibacterial efficacy and unique chemical compositions generated from plasma-activated water (PAW) when utilized a novel vaginal cleansing device. We conducted an analysis of antibacterial activity against probiotics and several chemical compositions including ions under various operational parameters of PAW, including electrical power (12 and 24 V), treatment duration (1, 10, and 20 min), and stay duration (immediate, 30 and 60 min). Our findings revealed that as treatment duration increased, hypochlorous acid (HOCl), Ca2+, and Mg2+ concentrations increased and Cl−concentrations decreased. Higher electrical power and longer treatment duration resulted in increased HOCl levels, which acts to prevent the growth of general microorganisms. Notably, PAW exhibited no antibacterial effects against a type of probiotic, Lactobacillus reuteri that produces lactic acid for vaginal health. This result demonstrated the ability of the vaginal cleaning device to generate ions, primarily HOCl and some cations (Ca2+ and Mg2+), thereby providing vaginal mucosa protecting and cleansing effects with the vaginal environment.

The introduction of electrical vehicle charging infrastructure including EV charger, renewable energy resource at secondary feeder in distribution system has been increased as one of countermeasure for global environmental issues. However, the Electric Vehicle Charging (EVC) infrastructure may act as the peak load in distribution system, which can adversely impact on the voltage stability when the electric vehicle is quickly charged. Therefore, to keep within the limit capacity of secondary feeder and allowable limit for feeder voltage, this paper proposes a stabilization method by the Energy Storage System (ESS) control strategy at secondary feeder in order to be not violated over than lower and upper limit. Also, this paper presents the estimation method to keep the proper standard value of State of Charge (SOC). From the simulation results, the voltage stabilization operation by ESS should make the feeder voltages of the distribution system(secondary feeder) introduced EVC Infra keep better voltage conditions, also estimation method to keep the proper standard value is confirmed that the SOC of ESS when is the standby condition could be exactly kept within the proper reference range.

Background: Angelica gigas Nakai, Korean dang-gui, has long been widely used in traditional treatment methods. There have been a number of studies of the health effects of A. gigas and related compounds, but studies addressing effects on blood triglycerides (TG) are lacking. To investigate the effects of A. gigas Nakai extract (AGNE) on TG in Korean subjects, we carried out a 12-week, randomized, double-blind, placebo-controlled clinical trial. Methods: Subjects who met the inclusion criterion (130 mg/dL ≤ fasting blood TG ≤ 200 mg/dL) were recruited for this study. One hundred subjects were assigned to the AGNE group (n=50) or the placebo group (n=50), who were given 1g/day of AGNE (as a gigas Nakai extract 200mg/d) in capsules, and the control group for 12 weeks. Outcomes were efficacy TG, lipid profiles, atherogenic index, and safety parameters were assessed initially for a baseline measurement and after 12 weeks. Results: After 12 weeks of supplementation, TG and very low-density lipoprotein cholesterol (VLDL-C) concentration and TG/HDL-C ratio in the AGNE group were significantly reduced compared to the placebo group (p <0.05). No significant changes in any safety parameter were observed. Conclusions: These results suggest that ingestion of AGNE may improve TG and be useful to manage or prevent hypertriglyceridemia.

Obesity and overweight are associated with many metabolic diseases, such as hypertension, diabetes, and dyslipidemia, which are closely related to a sedentary lifestyle and lack of exercise. Aerobic exercise effectively increases the high-density lipoproteins-cholesterol (HDL-C) levels and decreases the triglyceride (TG) levels. The consumption of Cuban policosanol (Raydel®) is also effective in enhancing the HDL-C quantity and HDL functionality to treat dyslipidemia and hypertension. On the other hand, no study has examined the effects of a combination of high-intensity exercise and policosanol consumption in obese subjects to improve metabolic disorders. In the current study, 17 obese subjects (average BMI 30.0±1.1 kg/m2, eight male and nine female) were recruited to participate in a program combining exercise and policosanol (20 mg) consumption for 12 weeks. After completion, their BMI, waist circumference, total fat mass, systolic blood pressure (SBP), and diastolic blood pressure (DBP) decreased by approximately 15% (p=0.022), 12.7% (p=0.008), 33% (p=0.006), 11% (p<0.046), and 13% (p=0.007), respectively. In the serum lipid profile, at week 12, they showed a remarkable decrease in the total cholesterol (TC) and triglyceride (TG) levels, up to 17% (p<0.019) and 54% (p<0.002) from the baseline, respectively. Although the serum HDL-C was increased by approximately +12% from the baseline, the percentage of HDL-C in TC, HDL-C/TC (%), was increased by up to +32% (p=0.007) at week 12. The serum coenzyme Q10 (CoQ10) level was increased 1.2-fold in all participants at week 12 from the baseline. In particular, the male participants showed a 1.4-fold increase (p=0.027) from the baseline. The larger increase in serum CoQ10 was correlated with the larger increase in the serum HDL-C during 12 weeks. The hepatic function parameters were improved; the serum -glutamyl transferase decreased at week 12 by up to 55% (p<0.007), while the aspartate aminotransferase and alanine transaminase levels decreased within the normal range. In the lipoprotein level, the extent of oxidation and glycation were reduced significantly in VLDL and LDL, with a remarkable decrease in the TG content in particles. The antioxidant abilities of HDL2 and HDL3, such as paraoxonase (PON) and ferric ion reduction ability (FRA), were enhanced significantly by up to 1.8-fold (p<0.001) and 1.6-fold (p<0.001) at week 12. The particle size and number of HDL2 were increased up to +10% during the 12 weeks with a remarkable decrease in the TG content, glycation extent, oxidation up to 32% (p=0.032), 18% (p=0.043), and 11% (p=0.023), respectively. The particle number and diameter of HDL3 were increased by up to +9% with a remarkable increase in the PON activity, FRA activity, and TC content of +82% (p<0.001), +56% (p<0.001), and +32% (p=0.009), respectively. Expression of apolipoproteinA-I in HDL2 and HDL3 were significantly elevated more in both gender around 30~48% with more distinct band intensity and less glycation at week 12. These improvements in HDL quality and functionality were linked to the higher survivability of adult zebrafish and their embryos. Under the co-presence of carboxymethyllysine (CML), a microinjection of HDL2 to zebrafish embryo from week 0 resulted in approximately 47% survivability with developmental defects and attenuated speed. On the other hand, the HDL2 microinjection from week 12 resulted in remarkably higher survivability (~ 70%). In conclusion, 12 weeks of Cuban policosanol (Raydel®, 20 mg) consumption with high-intensity exercise showed significant improvement in blood pressure, body fat mass, blood lipid profile without liver damage, CoQ10 metabolism, and renal impairment. At week 12, all participants showed a remarkable decrease in oxidation and glycation extent in the VLDL and LDL with a decrease in the TC and TG content. Significant enhancement of the qualities and functionalities in HDL2 and HDL3 by the policosanol consumption were also detected: increase in apoA-I content, TC content, particle size, and particle numbers along with antioxidant abilities, such as PON and FRA.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Autoantibodies against specific lung cancer-associated antigens have been suggested for lung cancer diagnosis. This study aimed to evaluate the diagnostic performance of anti-gen-autoantibody immune complex (AIC) against its free antigens for CYFRA21-1, ProGRP, NGAL, and NSE in non-small cell lung cancer (NSCLC). In total, 85 patients with NSCLC and 120 healthy controls (HCs) were examined using a 9G DNA chip method. The ratios of AICs to their antigens and combinations of ratios consisting of two to four markers were calculated. The levels of AICs for CYFRA21-1, ProGRP, NGAL, and NSE were higher than their free antigens in all participants. The levels of each free antigen distinguished patients with NSCLC from HCs. The ratios of AIC to its antigen and seven combinations consisting of two to four ratios were significantly higher in patients with NSCLC than those in HCs. Excellent diagnostic performance was observed for all combination ratios (C4-1), with 85.9% sensitivity and 86.7% specificity at cutoff 3.51. Higher sensitivity was observed in the very early stages (0–I) and adenocarcinoma than in stages II–IV and other pathological types. The combination of all ratios of AICs and their antigens for all four markers is useful in the diagnosis of NSCLC.

A programmable DC power supply with Real-time Digital Simulator (RTDS)-based photovoltaic (PV) Power Hardware-In-the-Loop (PHIL) simulators have been used to improve the control algorithm and reliability of PV Inverter. This paper proposes a supervisory control algorithm for PV PHIL simulator with non-RTDS device that is an alternative solution of high cost PHIL simulator. However, when such a simulator with conventional algorithm which is used in RTDS is connected to a PV inverter, the output is in the transient state and it makes it impossible to evaluate the performance of the PV Inverter. Therefore proposed algorithm controls the voltage and current target values according to the constant voltage (CV) and constant current (CC) modes to overcome the limitation of the Computing Unit, DC power supply and also uses a multi-rate system to account for the characteristics of each component of simulator. A mathematical models of a PV system, programmable DC power supply, isolated DC measurement device and Computing Unit are integrated to form a real-time processing simulator. Performance tests using a PV PHIL simulator which is applied proposed algorithm connected a PV inverter are carried out and proved superiority and utility of this method against conventional methods.

An 8-month-old, 3.4 kg, castrated male Toy Poodle was referred for progressive tetraparesis and respiratory disorder without a history of trauma. Diagnostic imaging, including dynamic CT and MRI, revealed concurrent atlanto-occipital dislocation (AOD) and atlantoaxial instability (AAI) with spinal cord compression. This case was unique due to its congenital nature and the absence of trauma. The surgical intervention involved precise removal of the C1 vertebra's ventral articular facet, which was compressing on the spinal cord, attributed to its fixed and malaligned position within the atlantooccipital joint. Following facetectomy, the stabilization of the occipital bone to the C2 vertebra was achieved by screws, wire, and polymethyl methacrylate. Postoperative recovery was monitored with CT and radiographs, showing successful decompression and gradual improvement in gait, despite mild residual ataxia. The dog experienced postoperative complications with screw loosening at 114 days, which was managed successfully by extracting the problematic screws. Postoperatively, the dog showed a near-normal gait and experienced no pain through 21 months of monitoring. This case represents the first report of concurrent congenital AOD and AAI treated with ventral surgical approach, contributing new insights to the understanding and management of such complex cranio-cervical junction disorders in veterinary neurosurgery.

TGF-ꞵ signaling is a vital regulator for maintaining articular cartilage homeostasis. Runx transcription factors, downstream targets of TGF-ꞵ signaling, have been studied in the context of osteoarthritis (OA). Although Runx partner core binding factor β (Cbfβ) is known to play a pivotal role in chondrocyte and osteoblast differentiation, the role of Cbfβ in maintaining articular cartilage remains obscure. This study investigated Cbfβ as a novel anabolic modulator of TGF-ꞵsignaling and determined its role in articular cartilage homeostasis. Cbfβ significantly decreased in aged mouse articular cartilage and human OA cartilage. Articular chondrocyte-specific Cbfb-deficient mice (Cbfb△ac/△ac) exhibited early cartilage degeneration at 20 weeks old and developed OA at 12 months old. Cbfb△ac/△ac mice showed enhanced OA progression under the surgical-induced mice OA model. Mechanistically, forced expression of Cbfβ rescued Col2α1 and Runx1 expression in Cbfβ-deficient chondrocytes. TGF-ꞵ1-mediated Col2α1 expression failed despite the pSmad3 activation under TGF-ꞵ1 treatment in Cbfβ-deficient chondrocytes. Cbfβ protected Runx1 from proteasomal degradation through Cbfβ/Runx1 complex formation. These results indicate that Cbfβ is a novel anabolic regulator for cartilage homeostasis, suggesting that Cbfβ could protect OA development by maintaining the integrity of the TGF-ꞵ1 signaling pathway in articular cartilage.

Lipofibromatous hamartoma, first reported in 1953, is a rare, slowly-progressive soft tissue tumor, characteristics of which include enlargement of the affected nerve by epineurial and perineurial proliferation of adipose and fibrous tissues. Out of previously reported 200 cases of lipofibromatous hamartoma of the median nerve, there have been approximately 40 pediatric cases under the age of 18. Herein, we report a case of lipofibromatous hamatoma of the median nerve in a 3-year-old female patient, who was surgically decompressed by carpal tunnel release only and histologically confirmed. The patient was followed-up on outpatient clinic basis annually along with ultrasonography, and the postoperative 10th year follow-up did not show recurrence or any deficits in motor and sensory functions

A nanocomposite rod-shaped structure with single-walled carbon nanotube (SWCNT) embedded in polypyrrole (PPy) doped with nonafluorobutanesulfonic acid (C4F), SWCNT/C4F-PPy, was synthesized using emulsion polymerization. The hybrid ink was then directly coated on a polyimide film interdigitated with the Cu/Ni/Au electrodes via a screen-printing technique to create a flexible film sensor. The sensor film showed a response of 1.72% at 25 °C/atmospheric pressure when acetone gas of 5 ppm was injected, which corresponds to almost 95% compared to the Si wafer-based array interdigitated with the Au electrode. Additionally, C4F was used as a hydrophobic dopant of PPy to improve the stability of humidity and to produce a highly sensitive film-type gas sensor that provides stable detection even in humid conditions.

Antibiotics’ effect on Mycoplasma pneumoniae (MP) infection still remains controversial. A prospective study of 257 children with MP pneumonia during a recent epidemic (2015-2016) was conducted. All MP pneumonia patients were treated with corticosteroids within 24-36 h after admission. Initially, oral prednisolone (1 mg/kg) or intravenous methylprednisolone (IVMP) (1-2 mg/kg) was administered for mild pneumonia patients, and IVMP (5 -10 mg/kg/day) for severe pneumonia patients. If patients showed persistent fever for 36-48 hours or disease progression, additive IVMP (5 mg/kg or 10 mg/kg) was given. Eighty-five patients received only a broad-spectrum antibiotic without macrolide. The mean age and the male:female ratio were 5.6 ± 3.1 years, respectively. Seventy-four percent of patients (190/257) showed immediate defervescence within 24 h, and 95.7% (246/257) of patients showed defervescence within 72 h with improvements in clinical symptoms. Eight patients who received additive IVMP also showed clinical improvement within 48 h without adverse reactions. There were no clinical or laboratory differences between patients treated with a macrolide (n = 172) and without (n = 85). Early corticosteroid therapy might reduce disease morbidity and prevent disease progression in MP pneumonia patients without side effects, and antibiotics may have limited effects on MP infection.

Fluid flow in human body is generally known to influence a variety of cellular behaviors. Different nanoparticle properties as well as cell type, interaction with other cells and cellular environments also show significant effect on nanoparticle uptake and drug efficacy. The aim of this study was to evaluate the effect of shear stress on cellular behaviors of biocompatible and biodegradable nanoparticles to cancer cells (A549 cell lines) in a biomimetic microfluidic system. We prepared a gelatin-oleic conjugate (GOC) as an amphiphilic biomaterial to prepare self-assembled gelatin-oleic nanoparticles (GON). Coumarin-6 and paclitaxel were used as the fluorescence marker and model drug, respectively, and were loaded into GONs by incubation (C-GONs; PTX-GONs). Additionally, we evaluated the cellular uptake of fluorescence labeled C-GONs and the drug efficacy of PTX-GONs. The cellular uptake of C-GONs by A549 cells in the absence of shear stress revealed that the mean fluorescence intensity was slightly decreased compared to that in the presence of shear stress. The results also indicated that negatively charged PTX-GONs had a lower cancer killing effect under dynamic conditions than that under static conditions. It also suggested that fluidic shear stress did not significantly affect drug uptake and efficiency in case of PTX-GONs. The cellular interactions between nanoparticles and cells in drug delivery should be carefully examined according to the physicochemical properties of nanoparticles such as the type of materials, size and mainly surface charge in a biomimetic microfluidic condition.

Melanogenesis is a biosynthetic pathway for producing of the pigment melanin in human skin. Tyrosinase, a key enzyme, catalyzing is the first step in melanogenesis and the downregulation of the tyrosinase enzyme activity is the most reported method for anti-melanogenesis. According to the hyperpigmentation as an important issue in cosmetic industry, there is a big demand for melanogenesis inhibitors. In the present study, we identified the anti-melanogenic effect of Inonotus Obliquus in α-MSH-induced B16F10 mouse melanoma cells as a new inhibitor. Comparing with control and Inonotus Obliquus extracts treated B16F10, we identified melanin contents, tyrosinase activity, tyrosinase mRNA and protein expression, MITF activity using a constructed plasmid. As shown in these results, we demonstrated that Inonotus Obliquus extracts down-regulated melanin synthesis using down-regulating activity and expression of tyrosinase which is key enzyme to produce melanin. In addition, we revealed expression of tyrosinase is regulated by MITF through repressing MITF transcriptional activity. Inonotus Obliquus extracts has potential to repress melanogenesis and decreased of hyperpigmentation and to use as cosmetic ingredient.

Inflammation is natural protective response of the body tissue caused by various stimuli. Macrophages start and control the inflammatory response. Microalgae have high value of ingredients including carotenoids which are well known for anti-inflammatory properties and used for various products in functional food industries. A green microalgal, Tetraselmis species contains a various type of carotenoids such as lutein, violaxanthin, astaxanthin, fucoxanthin, α-carotene and β-carotene. Therefore, we studied whether carotenoids isolated from Tetraselmis sp. with different culture conditions in Raw 264.7 cells and zebrafish (Danio rerio) have an anti -inflammatory effect. Carotenoid extracts of natural seawater (NS) and magma seawater (MS) showed inhibitory activity of nitric oxide (NO) overproduction without toxicity. In addition, carotenoid extracts of NS and MS inhibited pro-inflammatory cytokines including tumor necrosis factor (TNF)-α, interleukin (IL)- 1β and IL-6. Inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2, which are inflammatory mediators also decreased by pretreatment of NS and MS. Carotenoid extracts of NS and MS pretreatment also reduced phosphorylation of mitogen-activated protein kinases (MAPKs) and nuclear factor-kB (NF-kB). In conclusion, the carotenoid extract of Tetraselmis sp. has an anti -inflammatory effect and can be potential industrial ingredient.

Background: The world-wide rate of obesity is increasing continuously, representing a serious medical threat since it is associated with a variety of diseases including type 2 diabetes, cardiovascular disease, and numerous cancers. Sophora japonica is used as a traditional herb for medicinal purposes in eastern Asia. However, the anti-obesity effects of S. japonica fruit have not been explored. Objective: The aim of this study is to investigate the inhibition of adipocyte differentiation and adipogenesis by an ethanol extract of S. japonica fruit (EESF) in 3T3-L1 pre-adipocytes. Methods: MTT assay, Oil Red O staining, and Triglyceride contents were used to investigate lipid accumulation in 3T3-L1 cells to clarify adipocyte differentiation. The expression levels of various molecular signals associated with adipogenesis and lipogenesis were examined by western blot analysis. Results: Our results demonstrate that EESF suppressed the terminal differentiation of 3T3-L1 pre-adipocytes in a dose-dependent manner, as confirmed by a decrease in lipid droplet number and lipid content through Oil Red O staining. EESF significantly reduced the accumulation of cellular triglyceride, which was associated with a significant inhibition of the levels of pro-adipogenic transcription factors, downregulated the expression levels of adipocyte-specific proteins. Furthermore, EESF treatment effectively increased the phosphorylation of AMPK and ACC. Conclusions: These results together indicate that EESF has significant effects on the inhibition of adipogenesis and acts by stimulating the AMPK signaling pathway. Further studies will be needed to identify the active compounds in S. japonica.

In present study, the effect of Inonotus Obliquus extracts used in traditional medicine was investigated on the expression of matrix metalloproteinases-1 (MMP-1) in the normal human dermal fibroblasts. As shown our results, extracts of Inonotus Obliquus decreased MMP1 expression in oxidative stress-exposed normal human dermal fibroblasts. Additionally, Inonotus Obliquus extracts decreased AP-1 transcriptional activity and phospho-JNK in oxidative stress exposed normal human dermal fibroblasts. The results suggest that Inonotus Obliquus extracts decreased MMP1 expression using decreasing AP-1 transcriptional activity and phospho-JNK. Therefore, Inonotus Obliquus extracts has potential to reduce formation of wrinkle and to use as a cosmetic ingredient.

The number of fishers working on commercial fishing vessels worldwide is approximately 159,800 according to the Food and Agriculture Organization of the United Nations. The International Labour Organization estimates that the mean annual number of deaths during fishing is approximately 24,000. Most guidelines for the prevention of marine accidents have been developed with a focus on vessels involved in international navigation. As these guidelines may have parts that are unsuitable for application in small-scale boats operating in coastal areas, appropriate modifications are required. This study analyzed quantitative data on 1,790 marine accidents that occurred in trap fishery, a globally common type of fishery, and data obtained through a survey of 101 fishers in South Korea. A guideline to reduce the rate of fatal accidents was developed using the Bayesian network, a method used for the analysis of accidents, as suggested in the formal safety assessment protocol. The results of data analysis and the developed guidelines are expected to be beneficial to all fishers involved in trap fishery across many countries worldwide.

To evaluate the anti-obesity effects of Smilax sieboldii (Smilacaceae), we screened methylene chlo-ride (CH2Cl2), ethyl acetate (EtOAc), aqueous-saturated n-butanol, and ethanol (EtOH) extracts of the whole plant at various concentrations to inhibit adipogenesis in adipocytes. The 3T3-L1 cell line with Oil red O staining with the help of fluorometry was used as an indicator of anti-obesity ac-tivity. Bioactivity-guided fractionation of the EtOH extract and subsequent phytochemical inves-tigation of the active CH2Cl2- and EtOAc-soluble fractions resulted in the isolation of 19 secondary metabolites (1–19), including a new α-hydroxy acid derivative (16) and two new lanostane-type triterpenoids (17 and 18). The structures of these compounds were characterized using various spectroscopic methods. All the isolated compounds were screened for adipogenesis inhibition at concentration of 100 μM. Of these, compounds 1, 2, 4-9, 15, and 19 significantly reduced fat ac-cumulation in 3T3-L1 adipocytes, especially compounds 4, 7, 9, and 19 showing 37.05 ± 0.95, 8.60 ± 0.41 15.82 ± 1.23, and 17.73 ± 1.28% lipid content, respectively, at a concentration of 100 μM. These findings provide experimental evidence that isolates from S. sieboldii extracts exert beneficial ef-fects regarding the regulation of adipocyte differentiation.

In the context of high-temperature water vapor treatment, Zn-Mg-Al alloy-coated steel sheets exhibit the emergence of a black surface. This study aims to explore the factors and mechanisms contributing to surface blackening by inducing black surfaces on Zn-Mg-Al alloy-coated steel sheets, which were fabricated through molten coating subjected to water vapor treatment at 150 degrees Celsius. The surfaced composition was predominantly identified as ZnO, a zinc oxide film, validated through X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Morphological analysis of the surface and cross-section post-water vapor treatment revealed a disrupted lamellar structure with diffused features, resulting in the formation of an oxide film. Optical properties analysis demonstrated an increased absorbance and a decreased bandgap energy after water vapor treatment, indicative of an augmented blackening effect. Consequently, the high-temperature water vapor treatment led to the formation of oxides on the surface, with the highly reactive Mg and Al extracting oxygen from the predominantly present ZnO surface. This process resulted in the creation of an oxygen-deficient oxide, ultimately causing surface blackening.

According to statistics from the Food and Agriculture Organization, the world population will increase to about 91 million (Asia 51 million, Africa 19 million). A rise in the world’s population means an increased need for food. However, climate change has caused desertification and unpredictable weather, creating problems in the supply and demand of food. Sweet potato (Ipomoea batatas) is an alternative to solving the food problem, as it is one of the world’s most important food crops, especially in developing countries. The tuberous roots of sweet potato are usually used as staple food, animal feed, industrial material, or raw material for alcohol production. In the future, more variations of sweet potato will be needed for breeding this crop. Recently, molecular markers developed for sweet potato have demonstrated good potential for use in genetic selection. In this study, a cDNA library was constructed from the total RNA of sweet potato leaves. A total of 789 copies of the cDNA were cloned in Escherichia coli by employing the pGEM-T Easy vector. Sequencing was carried out by Solgent Co. (Korea). As many as 579 expressed sequence tag–simple sequence repeat (EST-SSR) markers were designed (73.38%) from the known cDNA nucleotide base sequences. The lengths of the developed EST-SSR markers ranged from 100 to 499 bp (average length 238 bp). Their motif sequence types were varied, with most being dinucleotides and pentanucleotides, and the most commonly found motifs were CAGAAT (29.0%) and TCT (2.8%). Based on these SSR-containing sequences, 619 pairs of high-quality SSR primers were designed using WebSat and Primer3web. The total number of primers designed was 144. Polymorphism was evident in 82 EST-SSR markers among 20 Korean sweet potato cultivars tested and in 90 EST-SSR markers in the two parents of a mapping population, Yeseumi and Annobeny. In this study, the hexaploid sweet potato (2n = 6x = 90) EST-SSR markers were developed in the absence of full-sequence data. Moreover, by acting as a molecular tag for particular traits, the EST-SSR marker can also simultaneously identify information about the corresponding gene. These EST-SSR markers will allow the molecular analysis of sweet potato to be done more efficiently. Thus, we can develop high-quality sweet potato while overcoming the challenges from climate change and other unfavorable conditions.

Cervical cancer, primarily caused by high-risk human papillomavirus (HR-HPV) types 16 and 18, is a major global health concern. Persistent HR-HPV infection can progress from reversible pre-cancerous lesions to invasive cervical cancer, which is driven by the oncogenic activity of human papillomavirus (HPV) genes, particularly E6 and E7. Traditional screening methods, including cytology and HPV testing, have limited sensitivity and specificity. This review explores the ap-plication of p16/Ki-67 dual-staining cytology for cervical cancer screening. This advanced im-munocytochemical method allows for simultaneously detecting p16 and Ki-67 proteins within cervical epithelial cells, offering a more specific approach for triaging HPV-positive women. Dual staining and traditional methods are compared, demonstrating their high sensitivity and negative predictive value but low specificity. The increased sensitivity of dual staining results in higher detection rates of CIN2+ lesions, which is crucial for preventing cervical cancer progression. However, its low specificity may lead to increased false-positive results and unnecessary biopsies. The implications of integrating dual staining into contemporary screening strategies, particularly considering the evolving landscape of HPV vaccination and changes in HPV genotype prevalence are also discussed. New guidelines and further research are necessary to elucidate the long-term effects of integrating dual staining into screening protocols.

Surface area and pore size distribution of Eucalyptus samples pretreated by different methods were determined by the Brunauer-Emmett-Teller (BET) technique. Three methods were applied to prepare cellulosic biomass samples for BET measurements: air, freeze, and critical point drying (CPD). Air and freeze drying caused severe collapse of biomass pore structures, but CPD effectively preserved biomass morphology. Surface area of CPD prepared Eucalyptus samples was determined to be 58–161 m2/g, whereas air and freeze dried samples were 0.5–1.3 and 1.0–2.4 m2/g, respectively. Average pore diameter of CPD prepared Eucalyptus samples were 61–70Å. CPD preserved Eucalyptus sample morphology by replacing water with a non-polar solvent, CO2 fluid, which prevented hydrogen bond reformation in the cellulose.

Metabolic surgery can promote comprehensive physiological improvements to alleviate metabolic disorders, particularly for patients with type 2 diabetes. Nevertheless, the therapeutic scope has been limited owing to unexpectedly inconsistent surgical outcomes. Therefore, this study to overcome these obstacles by determining the fundamental mechanism underlying the conflicting outcomes. The surgical anatomy, clinical course, and outcomes of various metabolic surgeries, including modified duodenal-jejunal bypass (DJB) procedures, were compared to understand the specific surgical patterns from different perspectives comprehensively. Patients in the nonobese group were exclusively included to prevent confounding effects from overweight patients with type 2 diabetes. Following intestinal anastomosis, the epithelial identity of the succeeding intestine was replaced by that of the proximal epithelium owing to altered crosstalk between the epithelium and opposing mesenchymal cells. Subsequent intestinal compensatory proliferation and rapid turnover rate accelerate the spread of the replaced epithelium. The main factors contributing to inconsistent outcomes of metabolic surgery are inadequate duodenal exclusion and inappropriate biliopancreatic limb length. Replacement of enteroendocrine cells during regeneration can lead to inconsistent outcomes in metabolic surgery. The type and density of enteroendocrine cells distributed at the terminal end of the proximal intestine play a significant role in diverse outcomes of metabolic surgery.

Transcutaneous injection laryngoplasty is a well-known procedure for treating paralyzed vocal fold by injecting augmentation material into it. Hence, vocal fold localization plays a vital role in the preoperative planning as the fold location is required to determine the optimal injection route. In this communication, we propose a mirror environment based reinforcement learning (RL) algorithm for localizing the right and left vocal folds in preoperative neck CT. RL-based methods commonly showed noteworthy outcome in general anatomic landmark localization problem in the recent years. However, such methods suggest training individual agent for localizing each fold, though the right and left vocal folds are located in close proximity and have high feature-similarity. Utilizing the lateral symmetry between the right and left vocal folds, the proposed mirror environment allows for a single agent for localizing both the folds by treating the left fold as a flipped version of the right fold. Thus, localization of both folds can be trained using a single training session which utilizes the inter-fold correlation and avoids redundant feature learning. Experiment with 120 CT volumes showed improved localization performance and training efficiency of the proposed method compared with the standard RL method.

The present study investigated the effect of different ambient temperature and relative humidity (RH) but equal temperature-humidity index (THI) on laying performance, egg quality, heterophil to lymphocyte ratio (H/L ratio), corticosterone (CORT) concentration in blood, yolk and albumen, and plasma biochemical parameters in laying hens. One hundred and twenty commercial hens (Hy-Line Brown) aged 60 weeks were allocated into 2 environmental chambers. Laying hens were subjected to either one of two thermal treatments, i.e., 26ºC and 70% RH (LH75) and 30ºC and 30% RH (HL75) for 28 days. Both thermal treatments had equal THI being 75. Neither LH75 nor HL75 affected (P > 0.05) laying performance including egg production, egg weight, egg mass, feed intake, and feed conversion ratio. Plasma biochemical parameters such as total cholesterol, high-density lipoprotein cholesterol, triglyceride, calcium, magnesium, and phosphorus was not altered (P > 0.05) by thermal treatments. As to the stress indicators, both environment regimes failed (P > 0.05) to affect blood H/L ratio and CORT levels in plasma, yolk and albumen although albumen CORT levels were elevated (P < 0.05) in LH75 vs. HL75 at days 3, 7, and 28. In conclusion, our study suggests that laying hens performed and responded equally when they were exposed to equal THI environment conditioned from either 26ºC and 70% RH or 30ºC and 30% RH. The results of this study will be served as a scientific basis for management decisions and handling under thermally challenging conditions.

Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

In South Korea, demolition waste (DW) management has become increasingly significant owing to the rising number of old buildings. Effective DW management requires an efficient approach that accurately quantifies and predicts the generation of DW (DWG) of various types, which necessitates access to the required information or technology capable of achieving this. Hence, we developed an artificial intelligence-based model that predicts the generation of ten DW types, specifically from buildings in redevelopment areas. We used an artificial neural network algorithm with < 10 neurons in the hidden layer to derive individual input variables and optimal hyperparameters for each DW type. All DWG prediction models achieved an average validation and test prediction performance (R²) of 0.970 and 0.952, respectively, with their ratios of percent deviation ≥ 2.5, ver-ifying them as excellent models. Moreover, a Shapley additive explanations analysis revealed that DWG was most impacted by the floor area for all the DW types, with a positive correlation with DWG. Conversely, other factors showed either a positive or negative correlation with DWG de-pending on the DW type. The study findings will enable demolition companies and local gov-ernments in making informed decisions for efficient DW management and resource allocation by accurately predicting the generation of various types of DW.

Although the number of unwed mothers have mental health problems and intellectual disability, little research have focused on their mental and cognitive status. Since there has been public stigma of unwed mother in South Korea, they tend to conceal their status and less likely to seek psychiatric and psychological help. In this context, this study aims to assess current status of their mental health and intellectual characteristics. A total 48 unwed mothers from two shelter homes in South Korea were agreed to participate in the study. To compare mental health and intellectual abilities of unwed mothers with the general women population, reference data from national studies was used. Unwed mothers were more likely to have mood disorder, post traumatic stress disorder(PTSD), alcohol and nicotine use disorder, attention-deficit hyperactivity disorder (ADHD) than the general women population. Among 48 participants, 20 (41.7%) were lower than 70 Intelligence Quotient (IQ) and the mean of IQ (78.31) was significantly lower than normalized IQ mean of general women population. In logistic regression analysis, psychiatric disorders were associated intellectual disability. This study confirmed that unwed mothers dwelling in Korean shelter homes have more experience of mental disorders and lower intellectual ability than general women population.

Regulated autophagy is involved in the repair of renal ischemia-reperfusion injury (IRI). ω3-Polyunsaturated fatty acids (ω3-PUFAs) show protective effects against various renal injuries. It was recently reported that ω3-PUFAs regulate autophagy. We assessed whether ω3-PUFAs attenuated IR-induced acute kidney injury (AKI) and evaluated associated mechanisms. C57Bl/6 background fat-1 mice and wild-type mice (wt) were divided into four groups: wt sham (n = 10), fat-1 sham (n = 10), wt IRI (reperfusion 35 min after clamping both the renal artery and vein; n = 15), and fat-1 IRI (n = 15). Kidneys and blood were harvested 24 h after IRI. Renal histological and molecular data were collected. The kidneys of fat-1 mice showed better renal cell survival, renal function, and pathological damage than those of wt mice after IRI. In addition, fat-1 mice showed less oxidative stress and autophagy impairment; greater amounts of LC3, Beclin-1, and Atg7; lower amounts of p62; and higher levels of renal cathepsin D and ATP6E than wt kidneys. They also showed more AMPK activation, which resulted in the inhibition of phosphorylation of the mammalian target of rapamycin (mTOR). Collectively, ω3-PUFAs in fat-1 mice contributed to AMPK mediated autophagy activation, leading to a renoprotective response.

Background The purpose of this study was to evaluate the prevalence of velamentous cord insertion (VCI) and the actual association between pathologically confirmed VCI and perinatal outcomes in twins based on the chorionicity. Methods All twin pregnancies who received prenatal care at a specialty clinic for multiple pregnancies, from less than 12weeks of gestation until delivery in a single institution between 2015 and 2018 were included in this retrospective cohort study. Results A total of the 941 twins were included in the study. The prevalence of VCI in dichorionic (DC) twins and monochorionic diamniotic (MCDA) twins was 5.8% and 7.8%, respectively (p=0.251). In all study population, the prevalence of vasa previa and placenta accreta were higher in VCI group compared to that of non-VCI group (p=0.008 and 0.022). In MCDA twins with VCI, birth weight, 1 and 5-minute Apgar score were lower compared to DC twins with VCI (p=0.010, 0.002 and 0.000). There was no significant association between VCI and selective fetal growth restriction (p=0.708), twin-to-twin transfusion syndrome (p=0.400) and birth-weight discordance (>20% and >25%) (p= 0.378 and 0.161) in MCDA twins. Conclusion VCI in twins was not a risk factor for adverse perinatal outcomes and twin-specific complications.

Highly photoluminescent C-Dots are prepared by hydrothermal reaction of citric acid and piperazine as dual reason in both hydrolysis and surface passivation agent along with the N-doping agent. The resulting C-Dots without external passivation showed PL enhancement by electron transfer from C-Dots-donor to piperazine-acceptor with the maximum emission yields of more than 84%. After mixing the prepared C-Dots with the mixture of EtOH and acetone (1:1 vol %), a novel washing process was performed by centrifugation to remove the precursors and by-products. The resulting C-Dots showed much better stability than dialysis. For evaluating the possible application of the C-Dots as a fluorescent biological probe which possess the wide dosing window and multicolor properties. The C-Dots were localized in perinuclear vacuole-like structures with granular pattern in cytoplasm sparing the nucleus. No signs of any morphological deterioration like nuclear shrinkage were observed.

Metabolic surgery can promote integrated physiologic improvement to ameliorate metabolic illness, particularly type 2 diabetes. Nevertheless, the therapeutic scope has been limited by unexpectedly inconsistent surgical outcomes. Therefore, the purpose of this study is to overcome the obstacles by determining the core mechanism of conflicting results. The surgical anatomy, clinical course, and outcomes of various metabolic surgeries, including modified types of duodenal-jejunal bypass procedures, were compared to comprehend specific surgical patterns from distinctive perspectives. Patients in exclusively nonobese groups are subjected to avoid compounding by weight fluctuations. During intestinal anastomosis, the epithelial identity of the succeeding intestine is replaced by that of the proximal epithelium through altered crosstalk between the epithelium and opposing mesenchymal cells. The rapid turnover rate and compensatory proliferation of the succeeding intestine accelerate the propagation of the replaced epithelium. Propagation of replaced epithelium could provoke inconsistent outcomes of metabolic surgery. The major determinants of the conflicting results of metabolic surgery are inadequate duodenal exclusion and inappropriate length of the biliopancreatic limbs. The replaced enteroendocrine cells during regeneration provoke inconsistent outcomes of metabolic surgery. The critical factors are the type and density of enteroendocrine cells distributed at the terminal end of the preceding proximal intestine.

This study examines the impact of executives implicated in fraud on firms' investment decisions using AAERs in the US, aiming to address the underexplored aspect of rationalization within the fraud triangle. Executives implicated in fraud often display abnormal attitudes to justify accounting irregularities, prompting an investigation into how abnormal investment decisions are used for rationalizing fraud, given their critical role in a firm's long-term sustainability. Analysis of AAERs spanning from 1981 to 2013 reveals that implicated executives, particularly CEOs and CFOs, tend to make abnormal investment decisions, and that collusive fraud exacerbates this behavior. Notably, such executives lean towards overinvestment, particularly in R&amp;D expenditures, to hide or justify fraud; the duration of fraud amplifies its impact on investment decisions. By shedding light on the rationalization aspect of the fraud triangle, this research contributes valuable insights for investors, regulators, and academia emphasizing the significance of public disclosure of fraud to enhance transparency in capital markets and the importance of ethics-focused education in accounting to prevent corporate fraud.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

In this study, we propose the Signal Integration Reconstruction Peak Detection (SIRPD) algorithm for reliable Cardiac Beat Interval (CBI) measurement using functional Near-Infrared Spectroscopy (fNIRS) signals. This algorithm enhances reliability by identifying a regular waveform in cerebral blood flow associated with heartbeats. The SIRPD algorithm assesses the Signal Quality Index (SQI) per channel, discards signals from unavailable channels, and interpolates oxygenated and total hemoglobin concentration signals, thereby boosting resolution and integrating the signal into a single channel. The integrated and smoothed signal is transformed to identify the most significant periodic waveform, from which the CBI is extracted. Validated with data from 20 healthy subjects who simultaneously recorded fNIRS and ECG signals, our findings confirm the equivalence of the CBI derived from ECG and calculated through the SIRPD algorithm from fNIRS (R^2 = .98, RMSE = .011, ICC = .991). We also extracted heart rate variability (HRV) features, confirming no significant difference in all features between ECG and fNIRS devices. Uniquely, this study regards the fNIRS heart signal not as an artifact source but as a valuable bio signal. The proposed method, which allows for the detection of cardiac beat intervals from cerebral blood flow oscillations, suggests the potential clinical applicability of fNIRS as an auxiliary indicator for various cardiovascular factors.

In this study, the literature on varnish contamination is investigated among the various con-taminations of lubricant. As the period of use of lubricant increases, the lubricant deteriorates and becomes contaminated. The varnish causes filter plugging, sticking of hydraulic valves and fuel injection pumps, obstruction of flow, reduction of clearance, poor heater and cooler perfor-mance, and increase of friction and wear in various lubrication systems. These problems also cause mechanical system failure, performance degradation, and increased maintenance and re-pair cost. To improve the problems causes by the varnish, an adequate understanding of varnish is required. Therefore, in this literature review, definitions and characteristics, generating ma-chinery, generating mechanisms, causes, measurement methods, and prevention or removal methods are summarized. Most of the data are reports of companies related to lubricant and machine maintenance, and are included in some papers. We hope that this summary of varnish will be helpful to those who are engaged in reducing or preventing varnish problems.

Background: Oenothera biennis (evening primrose) produces bioactive substances with a diverse range of pharmacological functions. However, it is currently unknown whether extract prepared from the aerial parts of O. biennis (APOB) can protect the skin against oxidative stress. To investigate the protective effects of APOB against oxidative stress-induced damage in human skin keratinocytes (HaCaT) and elucidate the underlying mechanisms. Methods: We pretreated HaCaT cells with various concentrations of APOB or the antioxidant N-acetyl-L-cysteine before applying H2O2. We then compared the cell viability, intracellular reactive oxygen species (ROS) production, and DNA and mitochondrial damage between pretreated and untreated control cells using a range of assays, flow cytometry, and Western blot analysis and also examined the reducing power and DPPH free radical-scavenging activity of APOB. Results: APOB pretreatment significantly increased cell viability, effectively attenuated H2O2-induced comet tail formation, and inhibited H2O2-induced phosphorylation of the histone γH2AX, as well as the number of apoptotic bodies and Annexin V-positive cells. APOB was found to have a high reducing power and DPPH radical-scavenging activity and also exhibited scavenging activity against intracellular ROS accumulation and restored the loss of mitochondrial membrane potential caused by H2O2. APOB pretreatment almost totally reversed the enhanced cleavage of caspase-3, the degradation of poly (ADP-ribose)-polymerase (PARP), DNA fragmentation that usually occurs in the presence of H2O2 and increased the levels of heme oxygenase-1 (HO-1), a potent antioxidant enzyme that is associated with the induction of nuclear factor-erythroid 2-related factor 2 (Nrf2). Conclusions: APOB can protect HaCaT cells from H2O2-induced DNA damage and cell death by blocking cellular damage related to oxidative stress via a mechanism that affects ROS elimination and by activating the Nrf2/HO-1 signaling pathway.

Epoxy was blended with benzoxazine resin and aluminum trihydrate (ATH) additive to render flame retardancy while maintaining mechanical properties. The ATH was modified using three different silane coupling agents and then added to 60/40 epoxy/benzoxazine mixtures. The effect of blend compositions and surface modification on flame retardant and mechanical properties of the composites was investigated by UL94, tensile, and shear tests. Resin mixtures containing more than 40 wt% benzoxazine revealed a UL94 V-1 rating with enhanced tensile and shear strength. Upon addition of 20 wt% ATH to 60/40 epoxy/benzoxazine, a V-0 rating was achieved. The lowered tensile and adhesive properties of the composites in the presence of ATH were improved by modifying the ATH surface using silane coupling agents.

Surface treatment of implants facilitates osseointegration, with nanostructured surfaces exhibiting accelerated peri-implant bone regeneration. This study compared bone-to-implant contact (BIC) in implants with hydroxyapatite (HA), sand-blasted and acid-etched (SLA), and SLA with calcium (Ca)-coated (XPEED®) surfaces. Seventy-five disk-shaped grade 4 Ti specimens divided into three groups were prepared, with 16 implants per group tested in New Zealand white rabbits. Surface characterization was performed using X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM), digital microscopy, and a contact angle analyzer. Cell viability, proliferation, and adhesion were assessed using MC3T3-E1 cells. Apatite formation was evaluated using modified simulated body fluid (m-SBF) incubation. After 4 weeks of healing, the outcomes reviewed were BIC, bone area (BA), removal torque tests, and histomorphometric evaluation. Microstructure analysis revealed irregular pores across all groups, with the XPEED group exhibiting a nanostructured Ca-coated surface. Surface characterization showed a crystalline CaTiO3 layer on XPEED surfaces, with evenly distributed Ca penetrating the implants. All surfaces provided excellent environments for cell growth. The XPEED and SLA groups showed significantly higher cell density and viability with superior osseointegration than HA (p &lt; 0.05); XPEED exhibited the highest absorbance values. Thus, XPEED surface treatment improved implant performance, biocompatibility, stability, and osseointegration.

Kim(2015) introduced the degenerate Cauchy numbers of the second kind and gave some identities of them. In this paper, by using the modified polyexponential functions which are introduced by Kim-Kim(2019), we define the degenerate poly-Cauchy polynomials of the second kind and investigate some properties of them. Furthermore, we consider the degenerate unipoly-Cauchy polynomials of the second kind and discuss some properties of them.

Despite accumulating evidence for the pro-apoptotic role for X-linked inhibitor of apoptosis-associated factor 1 (XAF1), its involvement in endoplasmic reticulum (ER) stress response remains undefined. Here, we report that XAF1 enhances cell sensitivity to ER stress and acts as a switch in unfolded protein response (UPR)-mediated cell-fate decisions favoring apoptosis over adaptive autophagy. XAF1 interacts with and destabilizes ER stress sensor GRP78 through the assembly of zinc finger protein 313-mediated destruction complex. Moreover, XAF1 gene transcription is activated by ER stress through PERK-Nrf2 signaling to direct an adaptive to apoptotic switch of stress response by blocking C-terminus of Hsc70-interacting protein (CHIP)-mediated K63-linked ubiquitination and subsequent phosphorylation of inositol-required enzyme-1α (IRE1α). In tumor xenograft assays, XAF1-/- tumors display substantially lower regression compared to XAF1+/+ tumors in response to cytotoxic dose of ER stress inducer. XAF1 and GRP78 expression show an inverse correlation in human cancer cell lines and primary breast carcinomas. Collectively this study uncovers an important role for XAF1 as a linchpin to govern the sensitivity to ER stress and the outcomes of UPR signaling, illuminating the mechanistic consequence of XAF1 inactivation in tumorigenesis.

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

Hepatic fibrosis is the wound-healing process of chronic hepatic disease that leads to end-stage of hepatocellular carcinoma and demolition of hepatic structures. EMT has been identified to phenotypic conversion of the epithelium to mesenchymal phenotype that occurred during fibrosis. Smad decoy oligodeoxynucleotide (ODN) is a synthetic DNA fragment containing complementary sequence of Smad transcription factor. Thus, this study evaluated the anti-fibrotic effects of Smad decoy ODN on carbon tetrachloride (CCl₄)-induced hepatic fibrosis in mice. As shown in histological results, CCl₄ treatment triggered hepatic fibrosis and increased Smad expression. On the contrary, Smad decoy ODN administration suppressed fibrogenesis and EMT process. The expression of Smad signaling and EMT-associated protein was markedly decreased in Smad decoy ODN treatment mice compared with CCl₄-injuried mice. In conclusion, these data indicate the practicability of Smad decoy ODN administration for preventing hepatic fibrosis and EMT processes.

Accurate expression of bracket prescription is important for successful orthodontic treatment. The aim of this study was to evaluate the accuracy of digital scan images of brackets produced by four different intraoral scanners (IOSs) in terms of the height, position, and angle of the bracket slot when scanning the surface of dental model attached with bracket materials made from different composition of materials. Brackets made from stainless steel, polycrystalline alumina, composite and composite/stainless steel slot were considered, which have been scanned from 4 different IOSs (Primescan, Trios, CS3600 and i500). SEM images were used as references. Each bracket axis was set in the reference scan image, and the axis was set identically by superimposing with the IOS image, and then only the brackets were divided and analyzed. The difference between the manufacturer's nominal torque and bracket slot base angle was 0.39 in SEM, 1.96 in Primescan, 2.04 in Trios, and 5.21 in CS3600 (P <0.001). The parallelism, which is the difference between the upper and lower angles of the slot wall, was 0.55 in SEM, 7.55 in Primescan, 6.74 in Trios3, 6.59 in CS3600, and 24.95 in i500 (p <0.001). This study evaluated the accuracy of the bracket only and it must be admitted that there is some error in recognizing slots through scanning in general

Fluorescent bioprobes are invaluable tools for visualizing live cells and deciphering complex biological processes by targeting intracellular biomarkers without disrupting cellular functions. In addition to protein-binding concepts, fluorescent probes utilize various mechanisms, including membrane, metabolism, and gating-oriented strategies. This study introduces a novel fluorescent mechanism distinct from existing ways. Here, we developed a B-cell selective probe, CDrB, with unique transport mechanisms. Through SLC-CRISPRa screening, we identified two transporters, SLCO1B3 and SLC25A41, by sorting out populations exhibiting higher and lower fluorescence intensities, respectively, demonstrating contrasting activities. We confirmed that SLCO1B3, with comparable expression levels in T and B cells, facilitates the transport of CDrB into cells, while SLC25A41, overexpressed in T lymphocytes, actively exports CDrB. The observation suggests that SLC25A41 plays a crucial role in discriminating between T and B lymphocytes. Furthermore, it reveals the potential for reversible localization of SLC25A41 to demonstrate its distinct activity. This study is the first report to unveil a novel strategy of SLC by exporting the probe. We anticipate that this research will open up new avenues for developing fluorescent probes.

In South Korea, in line with the increasing need for a reliable water supply following the continuous increase in water demand, the Smart Water Grid Research Group (SWGRG) was officially launched in 2012. With the vision of providing water welfare at a national level, SWGRG incorporated information and communications technology in its water resource management, aiming at the development of core technologies for a Smart Water Grid consisting of intelligent microgrids and a demonstration and tests of the developed technologies through a field operation in a living lab. The living lab was built in Block 112 of YeongJong Island, Incheon, South Korea (area of 17.4 km2, population of 8,000), where Incheon International Airport, a hub of Northeast Asia, is located. In this location, water is supplied through a single submarine pipeline, making the place optimal for responses to water crises and the construction of a water supply system during emergencies. From 2017 to 2019, ultrasonic wave type smart water meters and IEEE 802.15.4g advanced metering infrastructure (AMI) networks were installed at 527 sites of 958 consumer areas in the living lab, and core element technologies (intelligent water source management and distribution system, smart water distribution network planning/control/operation strategy establishment, AMI network and device development, integrated management of bi-directional smart water information), and operation solutions (smart water statistics information, real-time demand-supply analysis, decision support system, real-time hydraulic pipeline network analysis, smart DB management, and water information mobile application) were developed through a field operation and testing.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Owing to the large ratio of consumption in the building sector, energy saving strategies are required. Energy feedback is an energy-saving strategy that consumers to change their energy-consumption behaviors. The strategy has been principally focused on providing energy-consumption information. However, realization of energy savings using only consumption information remains limited. In this paper, a building-energy three-dimensional (3D) visualization solution is thus proposed. This solution includes the process of diagnosing a building and providing prediction of energy requirements if a building improvement is undertaken. Accurate diagnostic information is provided by real-time measurement data from sensors and building models using a close-range photogrammetry (CRP) method without depending on blueprints. The information is provided by employing visualization effects to increase the energy-feedback efficiency. The proposed strategy is implemented on two testbeds, and building diagnostics are performed accordingly. For the first testbed, the predicted energy improvement amount resulting from the facility upgrade is provided. The second testbed is provided with a 3D visualization of the energy information. The aim is to determine if the building manager will replace the facility after our recommendation is given to improve the building energy efficiency driven from the energy information. Unlike existing systems, which provide only ambiguous data that lack quantitative information, this study is meaningful because it provides energy information with the aid of visualization effects before and after building improvements.

Hispidulin is a natural bioactive flavonoid that has been studied for its potential therapeutic properties, including its anti-inflammatory, antioxidant, and neuroprotective effects. The aim of this study was to explore whether hispidulin could inhibit endothelial inflammation triggered by Porphyromonas gingivalis (P. gingivalis) lipopolysaccharide (LPS). The adhesion of monocytes to vascular endothelium was evaluated by in vitro and ex vivo monocyte adhesion assays. We analyze the migration of monocytes across the endothelial layer using transmigration assay. The result showed that treatment with hispidulin decreased P. gingivalis LPS-induced the adhesion of monocytes to endothelial cells and their migration by suppressing P. gingivalis LPS-triggered expression of intercellular adhesion molecule-1 (ICAM-1) through downregulating nuclear factor-қB (NF-қB). In addition, hispidulin inhibited P. gingivalis LPS-induced mitogen-activated protein kinases (MAPKs) and AKT in endothelial cells. Altogether, the results indicate that hispidulin suppresses vascular inflammation induced by P. gingivalis LPS. Mechanistically, it prevents the adhesion of monocytes to the vascular endothelium and migration and inhibits NF-қB, MAPKs, and AKT signaling in endothelial cells.

River flood routing computes changes in shape of a flood wave over time as it travels downstream along a river. Conventional flood routing models, especially hydrodynamic models require high quality and quantity of input data such as measured hydrologic time series, geometric data, hydraulic structures and hydrological parameters. Unlike physically based models, machine learning algorithms, which are data driven models, do not require much knowledge about underlying physical processes and can identify complex nonlinearity between inputs and outputs. Due to the higher performance, less complexity, and low computation cost, novel machine learning methods as a single application or hybrid application were introduced by researchers to achieve more accurate and efficient flood routing. This paper reviews the recent application of machine learning methods in river flood routing.

Recently, e-commerce companies have been adopting and continuously enhancing personalized product recommendation systems, and there is active research in this field within academia. However, personalized product recommendations in offline retail stores have not yielded significant outcomes thus far. Especially for small-format offline retail businesses like convenience stores, where customer information might be limited, providing personalized product recommendations poses even greater challenges. To address this issue, this study aimed to find a solution by shifting the perspective on recommendation methods and altering the target of recommendations in existing personalized recommendation models. In this study, recommending products that customers need in an offline store was defined as suggesting products that should be introduced and displayed within the store. In other words, the recommendation focus shifted from individuals to the stores themselves. This recommendation system proposes products that individual stores have not yet introduced but are anticipated to be purchased by customers among the products managed by the headquarters. Building upon this, we devised a store-based product recommendation system. The widely used user-based collaborative filtering model, a common technique in existing recommendation systems, was adapted into a store-based collaborative filtering model. Furthermore, various rules and logic pertinent to store operations and business considerations for convenience stores were integrated to implement this store product recommendation system. The accuracy and effectiveness of the system were demonstrated through its application in actual convenience stores. Results from the pilot implementation of the system showed that 88% of the newly recommended products in individual stores were sold based on one week of sales data, and the sales revenue was 1.75 times higher than the average sales revenue of those products across the entire company. Survey results on business owners' satisfaction yielded a score of 4.2 out of 5, indicating a high level of contentment. Additional observed effects included the expansion of product range and reduction in order lead times. However, 12% of the total recommended SKUs did not sell within one week, and 34% of the SKUs did not meet the overall average sales quantity. This research holds significance in extending the scope of personalized recommendation studies from primarily online platforms to offline retail businesses like convenience stores. It provides tangible methodologies and outcomes that can be implemented in real-world settings through the construction and validation of an actual system. The study also suggests avenues for future research to address some of the identified limitations.

In this study, deep neural network (DNN) and transfer learning (TL) techniques were employed to predict the viscous resistance and wake distribution based on the positions of flow control fins (FCFs) applied to containerships of various sizes. Both methods utilized data collected through Computational Fluid Dynamics (CFD) analysis. The position of the flow control fin (FCF) and hull-form information were utilized as input data, and the output data included viscous resistance coefficients and components of propeller axial velocity. The base DNN model was trained and validated using a source dataset from a 1000 TEU containership. Grid search cross-validation technique was employed to optimize the hyperparameters of the base DNN model. Then, transfer learning was applied to predict the viscous resistance and wake distribution for containerships of varying sizes. To enhance the accuracy of feature prediction with a limited amount of dataset, learning rate optimization was conducted. Transfer learning involves retraining and reconfiguring the base DNN model, and the accuracy was verified based on the fine-tuning method of the learning model. The results of this study can provide hull designers for containerships with performance evaluation information by predicting wake distribution, without relying on CFD analysis.

Background and Objectives: There is a need to effectively manage the healthy aging of the rapidly increasing number of elderly people in an ultra-elderly society. The purpose of this study was to analyze the mediating effects of social networks and wisdom on the relationship between lifestyle habits and healthy aging in older adults with chronic diseases. Materials and Methods: Participants were 120 community-dwelling older adults aged 65 and older with at least one chronic disease. Data were collected from elderly people who met the criteria by visiting nursing care worker training centers, senior centers, social gatherings, and home welfare centers in D, G, and S cities from May 24 to June 23, 2023, with a questionnaire consisting of lifestyle habits, social networks, wisdom and healthy aging, and general characteristics. Results: The degree of healthy aging of the subjects was 3.56 out of 5, and there were differences in the degree of healthy aging according to age (F=3.76, p=0.026), spousal relationship (t=3.11, p=0.002), education (F=9.08, p&lt;0.001), number of diseases (F=8.65, p&lt;0.001), and economic level (t=-2.45, p=0.016). The most common diseases among the subjects were hypertension, hyperlipidemia, joint diseases and diabetes mellitus. Healthy aging was highly correlated with lifestyle habits (r=0.63, p&lt;0.001), social networks (r=0.65, p&lt;0.001), and wisdom (r=0.73, p&lt;0.001). Social networks (β=0.46, p&lt;0.001) and wisdom (β=0.55, p&lt;0.001) had partial mediating effects (z=4.15, p&lt;0.001; z=5.11, p&lt;0.001) on the relationship between subjects' lifestyle habits and healthy aging. Conclusions: In order to increase the degree of healthy aging of the subjects, it is necessary to establish a mediating intervention program that manages to have a good lifestyle habits in daily life, increase social networks, and become wise.

This study evaluated the antimicrobial activity of Leptospermum scoparium (Mānuka) and Cryptomeria japonica (Sugi) essential oils and assessed the effect of seasonal chemical variation on the oils’ antimicrobial efficacies. Plate based assays were conducted to elucidate the oils’ spectrum of in vitro antimicrobial activity and to determine the oils’ minimum inhibitory concentrations (MIC) as a measure of antimicrobial efficacy. Gas chromatography – mass spectrometry was adopted to chemically profile oils distilled in different seasons. The resultant compositional information in conjunction with MIC data was used to evaluate the effect of seasonal variation on the oils’ antimicrobial efficacy. Both Mānuka and Sugi essential oils were active against all classes of target microorganisms. However, limited activity was observed against Gram-negative bacteria. The oils displayed consistent chemotypic characteristics regardless of the time of distillation. Nonetheless, there were quantitative differences in compound abundance in both essential oils. Significant differences in the MIC of Sugi essential oil was observed against target microorganisms as a result of seasonal variation in constituent abundances while Mānuka essential oil’s antimicrobial efficacy was unaffected. This study demonstrates that seasonal chemical variation is an important quality assurance parameter to consider for future application of essential oils as antimicrobial agents in consumer products.

The etiological agent of various viral diseases has been identified, and clinical characteristics and complications of each disease are well known. In general, a viral disease appears as acute systemic inflammatory disease, but after acute infection, some patients remain asymptomatic carriers or suffer chronic viral diseases, suggesting that the phenomena are unavoidable processes for viruses’ coexistence with their hosts as virome in microbiota of human species. Although each viral disease has been described as having different pathophysiology, the host's control systems, including immune systems, against the insults from any viral infections, have the same components in previously healthy hosts. Therefore, considering the characteristics of the life cycle of viruses being dependent on the host cell and the same immune components of the host, it is reasonable assumption that there is a common immune mechanism to respond to the insults from all viral diseases. The authors discuss on the characteristics of virus infection and unresolved issues in viral diseases and propose a rationale of early immune modulators for acute insults from viral diseases based on our clinical experiences and the protein-homeostasis-system hypothesis.

It is crucial to forecast the water demand accurately for supplying water efficiently and stably in a water supply system. In particular, accurately forecasting short-term water demand helps in saving energy and reducing operating costs. With the introduction of the Smart Water Grid (SWG) in a water supply system, the amount of water consumption is obtained in real time through an advanced metering infrastructure (AMI) sensor, which can be used for forecasting the short-term water demand. The models widely used for water demand forecasting include the autoregressive integrated moving average, radial basis function-artificial neural network, quantitative multi-model predictor plus, and long short-term memory. However, there is a lack of research on assessing the performance of models and forecasting the short-term water demand by applying the data on the amount of water consumption by purpose and the pipe diameter of an end-use level of the SWG demonstration plant in each demand forecasting model. Therefore, in this study, the short-term water demand was forecasted for each model using the data collected from the AMI, and the performance of each model was assessed. The Smart Water Grid Research Group installed ultrasonic-wave-type AMI sensors in the block 112 located in YeongJong Island, Incheon, and the actual data used for operating the SWG demonstration plant were adopted. The performance of the model was assessed by using the residual, root mean square error (RMSE), normalized root mean square error (NRMSE), Nash–Sutcliffe efficiency (NSE), and Pearson correlation coefficient (PCC) as indices. The water demand forecast was slightly underestimated in models that employed the assessment results based on the RMSE and NRMSE. Furthermore, the forecasting accuracy was low for the NSE due to a large number of negative values; the correlation between the observed and forecasted values of the PCC was not high, and it was difficult to forecast the peak amount of water consumption. Therefore, as the short-term water demand forecasting models using only time and the amount of water consumption have limitations in reflecting the characteristics of consumers, a water supply system can be managed more precisely if other factors (weather, customer behavior, etc.) influencing the water demand are applied.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Although many policosanols from different sources, such as sugar cane, rice bran, and insects, have been marketed worldwide, there has been no comparative study of the in vivo efficacy using a hyperlipidemic animal model. This study compared the efficacy of treating dyslipidemia with four different policosanols, including one sugar cane wax alcohol from Cuba (Raydel®) and three policosanols from China (Xi’an Natural sugar cane, Xi’an Realin sugar cane, and Shaanxi rice bran) in hyperlipidemic zebrafish. After 12 weeks of consumption of each policosanol (final 0.1% in diet, wt/wt) and high cholesterol diet (HCD, final 4%, wt/wt) in a tetrabit, the Raydel policosanol group and Xi’an Natural policosanol group showed the highest survivability of approximately 81%, whereas the Xi’an Realin policosanol group and Shaanxi policosanol group showed 57% and 67% survivability, respectively. Among five HCD groups, the Raydel policosanol group showed the lowest serum total cholesterol (TC, p<0.001 versus HCD control) and triglyceride (TG, p<0.001 versus HCD control) with the highest percentage of high-density lipoproteins (HDL)-C in TC. The Raydel policosanol group also showed the lowest serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels with the least infiltration of inflammatory cells and interleukin-6 production in hepatocytes. In the ovary, the Raydel policosanol group also showed the highest contents of mature vitellogenic oocytes with the lowest production of reactive oxygen species and cellular apoptosis in ovarian cells. In the testis, the Raydel policosanol group also showed the healthiest morphology for spermatogenesis with the least interstitial area and reactive oxygen species (ROS) production in testicular cells. In conclusion, 12 weeks of Raydel policosanol consumption resulted in remarkable improvement of the blood lipid profile, amelioration of inflammation in the liver, and enhancement of the cell morphology in the ovary and testis with the highest survivability under the HCD.

The grain size of CVD (Chemical Vapor Deposition) graphene was controlled by changing the precursor gas flow rates, operation temperature, and chamber pressure. Graphene of average grain sizes of 4.1 µm, 2.2 µm, and 0.5 µm were synthesized in high quality and full coverage. The possibility to tailor the thermoelectric conversion characteristics of graphene has been exhibited by examining the grain size effect on the three elementary thermal and electrical properties of σ, S, and k. Electrical conductivity (σ) and Seebeck coefficients (S) were measured in a vacuum for supported graphene on SiO₂/Si FET (Field Effect Transistor) substrates so that the charge carrier density could be changed by applying a gate voltage (V_G). Mobility (µ) values of 529~1042, 459~745, and 314~490 cm²/V·s for the three grain sizes of 4.1 µm, 2.2 µm, and 0.5 µm, respectively, were obtained from the slopes of the measured σ vs. V_G graphs. The power factor (PF), the electrical portion of the thermoelectric figure of merit (ZT), decreased by about one half as the grain size was decreased, while the thermal conductivity (k) decreased by one quarter for the same grain decrease. Finally, the resulting ZT increased more than two times when the grain size was reduced from 4.1 µm to 0.5 µm.

Infusions of Camellia sinensis leaves have been known for their health benefits. The ABC method is a method of enriching organic infusion leaves (from Camellia. sinensis) with organic dry and concentrated extracts using organic acacia gum and its application to white tea has provided Qi cha tea®. In the present study, we assessed the content of tea polyphenols and caffeine, and biochemical properties of Qi cha tea® and its botanical constituents. Antioxidant and cell viability activities were determined by the 1,1-diphenyl-2-picrylhydrazyl assay and MTT assay in Caco-2 and human HCT-116 cell lines, respectively. The caffeine, catechin, epicatechin composition of Qi cha tea® was modified with less caffeine and gallic acid and more EGCG than the original white tea. The majority of the tested botanical samples including Qi cha tea® at 50 µg/mL showed similar antioxidant activities, with the exception of Echinacea. The greatest effect was found for white tea. The antioxidant power of the Qi cha tea® (90% at 50 µg/mL for pressurized liquid extraction (PLE) was divided by approximately a factor of 2 (61% at 50 µg/mL for pressurized liquid extraction products (PLEP)) which corresponds to the 48.3 % (mass/mass) white tea original content in the Qi cha tea®. Qi cha tea® showed the lowest activity in the viability of the two cell lines. The application of the ABC (Bio Concentrate Assets®) method to Qi cha tea® using various botanicals and dry extract with the acacia gum as blinder has allowed the development a new innovative functional health beverages which comply with European health claims.

Conventional fluorescent lamps used in tissue culture are costly light sources showing excessive wavelength emission-bandwidth that must be replaced by alternative, less costly and much lower power-consuming energy sources. The use of Light-Emitting Diodes (LEDs) is the best option due to their potential role as elicitors of secondary metabolite production in many plant models. Gynura procumbens(G. procumbens) is widely used for treating various diseases. Here, leaf explants were cultivated in MS medium supplemented with 0.5 mg/L of NAA and 2.0 mg/L of BAP for 30 days under white, blue, and red LEDs. Secondary metabolites were analyzed by HPLC and LC-MS. Blue LEDs elicited the highest antioxidant activity, total flavonoid, and phenolic content. Furthermore, the content of cyanidin-monoglucosides increased significantly increased under blue light.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Redox mediators comprising I–, Co3+, and Ti3C2Tx MXene were applied to dye-sensitized solar cells (DSCs). In the as-prepared DSCs (I-DSCs), wherein hole conduction occurred via the redox reaction of I−/I3− ions, the power conversion efficiency (PCE) was not altered by the addition of Ti3C2Tx MXene. The I-DSCs were exposed to light to produce Co2+/Co3+-based cells (Co-DSCs), wherein the holes were transferred via the redox reaction of Co2+/Co3+ ions. A PCE of 9.01% was achieved in a Co-DSC with Ti3C2Tx MXene (Ti3C2Tx-Co-DSC), which indicated an improvement from the PCE of a bare Co-DSC without Ti3C2Tx MXene (7.27%). It was also found that the presence of Ti3C2Tx MXene in the redox mediator increased the hole collection, dye regeneration, and electron injection efficiencies of the Ti3C2Tx-Co-DSC, leading to an improvement in both the short-circuit current and the PCE when compared with those of the bare Co-DSC without MXene.

The purpose of this study is to develop and evaluate a self-microemulsifying drug delivery system (SMEDDS) to improve the oral absorption of poorly water-soluble Olaparib. Through the solubility test of Olaparib in various oils, surfactants and co-surfactants, pharmaceutical excipients for use in SMEDDS manufacturing were selected. Self-emulsifying regions were identified by mixing the selected materials at various ratios, and a pseudoternary phase diagram was constructed by synthesizing these results. Various physicochemical properties of microemulsion incorporating Olaparib were confirmed by investigating the particle morphology, particle size, zeta potential, drug content and stability. In addition, the improved dissolution and oral absorption of Olaparib were also confirmed through a dissolution test and a pharmacokinetic study. An optimal microemulsion was generated in the formulation of Capmul MCM EP/NF 10%, Labrasol 80% and PEG 400 10%. Fabricated nano-sized microemulsions were well-dispersed in aqueous solutions, and it was also confirmed that it was maintained well without any problems of either physical or chemical stability. The 5 min initial dissolution of Olaparib in fabricated formulations was improved by 10.6 times (pH1.2), 14.8 times (pH6.8) and 14.8 times (distilled water) compared to the values of Olaparib powder. The dissolution at 120min was 45.4±4.0%(pH1.2), 53.5±1.1% (pH6.8) and 58.1±1.00% (distilled water) in Olaparib powder but has been significantly improved by 1.7 times (74.8±1.9%), 1.6 times (84.2±0.3%) and 1.5 times (81.2±0.7%) in SMEDDS. Associated with the high dissolutions of Olaparib in fabricated microemulsions, the pharmacokinetic parameters were also greatly improved. The Cmax and AUCinf of Olaparib in the prepared microemulsion were increased 4.2- and 3.2-fold, respectively, compared to powder. Taken together with the results mentioned above, the microemulsion system could be an effective tool as an oral delivery formulation for Olaparib. Additionally, our results demonstrate that the SMEDDS systems comprising Capmul MCM, Labrasol and PEG 400 could be a useful option for improvement of several other poorly water-soluble drugs with physico-chemical properties similar to Olaparib.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Adlay seed samples were collected from 3 adlay growing regions (Yeoncheon, Jeonnam and Eumseong regions) in Korea during 2012. Among all the samples collected, 400 seeds were tested for fungal occurrence by standard blotter and test tube agar methods and different taxonomic groups of fungal genera were detected. The most predominant fungal genera encountered were Fusarium, Phoma, Alternaria, Cladosporium, Curvularia, Cochliobolus and Leptosphaerulina. The occurrence of Fusarium species were 45.6% and based on the combined sequences of two protein coding genes, EF-1a, Beta-tubulin and phylogenetic analysis, 10 species were characterized as F. incarnatum (11.67%), F. kyushense (10.33%), F. fujikuroi (8.67%), F. concentricum (6.00%), F. asiaticum (5.67%), F. graminearum (1.67%), F. miscanthi (0.67%), F. polyphialidiom (0.33%), F. armeniacum (0.33%) and F. thapsinum (0.33%). The ability of these isolates to produce mycotoxins fumonisin (FUM) and zeralenone (ZEN) were tested by ELISA quantitative analysis method. The result revealed that fumonisin (FUM) was produced only by F. fujikuroi and zeralenone (ZEN) by F. asiaticum & F. graminearum. Mycotoxigenic species were then examined for their morphological characteristics to confirm their identity. Morphological observations of the species correlated well with their molecular identification and confirmed as F. asiaticum, F. fujikuroi and F. graminearum.

Abstract Purpose: To analyze the correspondence between refractive astigmatism and corneal astigmatism in pseudophakic eyes with non-toric intraocular lenses. Setting: Yeouido St. Mary hospital, Seoul, South Korea Design: Evaluation of a diagnostic test instrument. Methods: This retrospective study included 95 eyes of 95 patients. Corneal astigmatism was measured with an automated keratometer (RK-5, Canon) and Scheimpflug tomography (Pentacam HR, Oculus). Refractive astigmatism was compared to keratometric astigmatism (based on anterior corneal measurements only), Equivalent K Reading and total corneal astigmatism (both based on anterior and posterior corneal measurements). Vector analysis was carried out by Næser’s polar value method. The accuracy was defined as the average magnitude of the vectorial difference in astigmatism (DA). Each corneal measurement was optimized in retrospect by a multiple linear regression equation between refractive and corneal astigmatism. Results: Keratometric astigmatism overestimated with-the-rule (WTR) refractive astigmatism and underestimated against-the-rule (ATR) refractive astigmatism. Several measurements based on both corneal surfaces values did not show any statistically significant difference with respect to refractive astigmatism. The mean corneal astigmatism by total corneal refractive power (TCRP) at 4.0 mm (zone/pupil) produced the lowest mean arithmetic DA and the highest percentage of eyes with a DA ≤0.50 diopter. After optimization, the accuracies of automated KA and TCRP 4.0 mm (zone/pupil) were similar. Conclusions: Total corneal astigmatism measured by the Scheimpflug tomography at 4.0 mm zone centered on pupil, accurately reflects the refractive astigmatism in pseudophakic eyes. However, the accuracy of total corneal astigmatism is not different from automated KA after optimization.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

During early embryonic development, fertilized one-cell embryos develop into preimplantation blastocysts and subsequently establish three germ layers through gastrulation during post-implantation development. In recent years, stem cells have emerged as a powerful tool to study embryogenesis and gastrulation without the need for eggs, allowing the generation of embryo-like structures known as synthetic embryos or embryoids. These in vitro models closely resemble early embryos in terms of morphology and gene expression and provide a faithful recapitulation of early pre- and post-implantation embryonic development. Synthetic embryos can be generated through a combinatorial culture of three blastocyst-derived stem cell types, such as embryonic stem cells, trophoblast stem cells, and extraembryonic endoderm cells, or totipotent-like stem cells alone. This review provides an overview of the progress and various approaches in studying in vitro embryogenesis and gastrulation using stem cells. Furthermore, recent findings and breakthroughs in synthetic embryos and gastruloids are outlined. Despite ethical considerations, synthetic embryo models hold promise for understanding mammalian (including human) embryonic development and have potential implications for regenerative medicine and developmental research.

Bone growth plate abnormalities and skull shape defects are seen in hypophosphatasia, a heritable disorder in humans that occurs due to deficiency of Tissue Nonspecific Alkaline Phosphatase (TNAP, Alpl) enzyme activity. Abnormal development of the cranial base growth plates (synchondroses) and abnormal skull shapes have also been demonstrated in global TNAP-/- mice. To distinguish local vs. systemic effects of TNAP on skull development, we utilized P0-Cre to knockout TNAP only in cranial neural crest derived tissues using TNAP flox mice. Here we show that TNAP deficiency in cranial neural crest leads to leads to skull shape defects and deficient growth of the intersphenoid synchondrosis (ISS). ISS chondrocyte abnormalities included increased proliferation in resting and proliferative zones with decreased apoptosis in hypertrophic zones. ColX expression is increased, indicative of premature differentiation in the absence of TNAP. Sox9 expression is increased in both resting and prehypertrophic zones of mutant mice. Expression of PTHrP and IHH were also increased. Finally, cranial base organ culture revealed that inorganic phosphate (Pi) and pyrophosphate (PPi) have specific effects on cell signaling and phenotype changes in the ISS. Together, these results demonstrate that TNAP expression in growth plate chondrocytes is essential for normal development, and that the mechanism likely involves Sox9, PTHrP, IHH and PPi.

The antioxidant and anti-inflammatory abilities of beeswax alcohol (BWA) are well reported in animal and human clinical studies, with a significant decrease in malondialdehyde (MDA) in blood, reduction of liver steatosis, and decrease in insulin. On the other hand, there is insufficient information to explain the in vitro antioxidant activity of BWA because it is extremely insoluble in aqueous buffer system. The BWA mixture was incorporated into reconstituted HDL (rHDL) with apoA-I, and the physiological functions of BWA in a water system were evaluated. After synthesis of rHDL with palmitoyloleoyl phosphatidylcholine (POPC), cholesterol, apolipoprotein A-I (apoA-I), and the BWA at molar ratios of 95:5:1:0 (rHDL-0), 95:5:1:0.5 (rHDL-0.5), and 95:5:1:1 (rHDL-1) for POPC:FC:apoA-I:BWA, the particle size of rHDL-1 was increased 15% compared to rHDL-0. rHDL-1 exhibited the strongest anti-glycation activity, up to 18% less glycation than rHDL-0 treated HDL3, with the highest protection of apoA-I from proteolytic degradation: a 28% larger band intensity than that of rHDL-0 treated HDL3 in the presence of fructose (final 250 mM). The antioxidant ability to inhibit cupric ion-mediated LDL oxidation increased as the BWA content in rHDL increased. The rHDL-1-treated LDL exhibited the smallest oxidation extent in electromobility with the least quantification of oxidized species (MDA). The antioxidant activities of HDL, ferric ion reduction ability (FRA), and paraoxonase (PON) were enhanced by the BWA in rHDL treatment with a concomitant increase in the molar ratio. rHDL-1-treated HDL showed 20–22% higher FRA and PON activities than rHDL-0-treated HDL. A microinjection of each rHDL into zebrafish embryos was performed in the presence of carboxymethyllysine (CML). The rHDL-1 injected embryo exhibited the highest survivability (~63%), whereas the CML alone group showed 28% survivability. A higher BWA content in rHDL helped neutralize the CML toxicity, resulting in higher survivability and normal developmental morphology. In contrast, the CML alone injected embryo showed severe retardation of the developmental speed and morphological defect. The CML-alone group showed the highest extent of reactive oxygen species (ROS) production and cellular apoptosis in embryos, but a co-injection of rHDL-1 resulted in a remarkable decrease in ROS and apoptosis. The dermal application of rHDL containing BWA resulted in higher potent wound-healing activity in a dose-dependent manner with decreased reactive oxygen species and cellular apoptosis in the cutaneous wound area in the presence of CML. Conclusively, incorporating BWA in rHDL significantly enhanced the anti-glycation and antioxidant activities in rHDL via more stabilization of apoA-I with a larger particle size. The rHDL containing BWA facilitated enforced inherent antioxidant ability of HDL and anti-inflammatory activity to suppress the CML toxicities in zebrafish embryos and to ameliorate CML-aggravated chronic wounds in adult zebrafish.

Prompt removal of misfolded membrane proteins and misassembled membrane protein complexes is essential for membrane homeostasis. However, the elimination of these toxic proteins from the hydrophobic membrane environment has high energetic barriers. Transmembrane FtsH is the only known ATP-dependent protease responsible for this task, unlike other well-studied soluble ATP-dependent proteases. The mechanisms by which FtsH recognizes, unfolds, translocates, and proteolyzes its substrates remain unclear. Here, we report the crystal structures of the Thermotoga maritima FtsH periplasmic domain (PD) in an associative trimeric state at a 1.5-1.95 Å resolution. We also describe the pH-dependent oligomerization states of the isolated PD using dynamic light scattering. These observations help us understand how FtsH recognizes membrane-anchored misfolded proteins.

Conventional traceability systems in Cambodian agriculture, such as Rubber Supply Chain Management (RSCM), often struggle to provide timely data and fair market prices, leading to mistrust among stakeholders, exploitation by intermediaries, and hindering progress towards ethical sourcing and sustainable practices. This research aims to showcase the potential of integrating blockchain technology, the Internet of Things (IoT), the InterPlanetary File System (IPFS), and Differential Privacy (DP) methods to empower Cambodian rubber farmers. By enhancing transparency, facilitating fair pricing, and promoting sustainable methods in the rubber industry, this integrated approach leverages Hyperledger Fabric (HLF) to create a decentralized and secure system for tracking rubber from its source to the end consumer. Integration with IPFS ensures secure and easily accessible data storage, further enhancing the system’s reliability. Additionally, the implementation of differential privacy techniques safeguards confidential data during information sharing among farmers and supply chain stakeholders, minimizing potential privacy concerns. This comprehensive system encourages consumers to make ethical and sustainable alternative options by providing accessible information on harvesting methods, processing procedures, labor conditions, and environmental impacts. The potential benefits extend beyond Cambodia, serving as a model for other developing countries aiming to modernize and enhance the agricultural distribution networks. Our results show that transaction send rates (TPS) and throughput in systems with and without differential privacy grow with increased transaction volumes. However, the system without differential privacy achieves greater scalability and efficiency above a certain threshold. However, it offers a slightly reduced latency, reflecting a trade-off between privacy and performance efficiency in blockchain-based agricultural traceability systems.

Genus Clematis is one of the largest within Ranunculaceae. Here we report the chloroplast genome of two Clematis species, C. brachyura and C. trichotoma endemic to Korea. The chloroplast genome lengths of C. brachyura and C. trichotoma are 159,532 bp and 159,170 bp, respectively. Gene contents in the complete chloroplast genomes of these two Clematis species are identical to that of most Ranunculaceae and other angiosperms. However, our data results demonstrated that genus Clematis has inversion and rearrangement events concerning gene rps4 gene, rps16 to trnH region, and trnL to ndhC region, and IR regions expansion. Comparison of IR regions among Ranunculaceae species revealed that Clematis species contained six protein coding genes (infA, rps8, rpl14, rpl16, rps3, and rpl22) usually found in the long single copy (LSC) region of other species. Phylogenetic analysis demonstrated that genus Clematis is closely related to genus Ranunculus. Differences in repeat structure, substitution rates, and IR expansion in genera Clematis and Ranunculus, explained their relationship. Clematis species showed slightly higher tandem repeats content than Ranunculus species. The six protein-coding genes showed lower synonymous substitution rates in the IR of Clematis species than in the LSC of Ranunculus species. Overall, the chloroplast genomes and results presented here provide important information on the evolution of Ranunculaceae.

This study presents the comparison of heat transfer capacity and pressure drop characteristics between a basic fin-tube heat exchanger and a modified heat exchanger with the structural change of branch tubes and coiled turbulators. All experiments were carried out using an air-enthalpy type calorimeter based on the method described in ASHRAE standards, under heat exchanger experimental conditions. 14 different kinds of heat exchangers were used for the experiment. Cooling and heating capacities of the turbulator heat exchanger were excellent, compared to the basic one. As the insertion ratio of the coiled turbulator and the number of row increased, the heat transfer performance increased. However, the capacity per unit area was more effective in 4 rows than 6 rows, and the cooling performance of the 6 row turbulator heat exchanger (100% turbulator insert ratio) was down to about 6% than that of 4 row one. As the water flow rate and the turbulator insertion ratio increased, the pressure drop of the water side increased. This trend was more pronounced in 6 rows. In the cooling condition, the pressure drop on the air side was slightly increased due to the generation of condensed water, but was insignificant under the heating condition. The power consumption of the pump was more affected by the water flow rate than the coiled turbulator. The equivalent hydraulic diameter of a tube by the turbulator was reduced and then the heat transfer performance was improved. Thus, the tube diameter was smaller, the heat flux was better.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Hemifacial spasm (HFS) is a rare disorder characterized by involuntary facial muscle contractions. The primary cause is mechanical compression of the facial nerve by nearby structures. Lateral spread response (LSR) is an abnormal muscle response observed during electromyogram (EMG) testing and is associated with HFS. Intraoperative monitoring of LSR is crucial during surgery to confirm successful decompression. Proper anesthesia and electrode positioning are important for accurate LSR monitoring. Stimulation parameters should be carefully adjusted to avoid artifacts. The disappearance of LSR during surgery is associated with short-term outcomes, but its persistence does not necessarily indicate poor long-term outcomes. LSR monitoring has both positive and negative prognostic value, and its predictive ability varies across studies. Early disappearance of LSR can occur before decompression and may indicate better clinical outcomes. Further research is needed to fully understand the implications of LSR monitoring in HFS surgery.

This study aimed to examine the vitamin D status of professional volleyball athletes and to determine its correlation with shoulder muscle strength. We finally included 52 healthy male professional volleyball players (23.2 ± 4.5 years), who were categorized by vitamin D status (<20 ng/mL: deficiency, 20-30 ng/mL: insufficiency, and >30 ng/mL: sufficiency). We examined the strength of the internal rotator (IR) and external rotator (ER) muscles of the shoulder by using isokinetic dynamometer. Fourteen players (26.9%) had vitamin D deficiency, 24 players (46.2%) were vitamin D insufficient, and 14 players (26.9%) were vitamin D sufficient. There was no significant correlation between the vitamin D level and shoulder muscle strength at 60°/s (IR, r = 0.159, p = 0.26; ER, r = 0.245, p = 0.08), and at 180°/s (IR, r = - 0.093, p = 0.51; ER, r = - 0.037, p = 0.79). Moreover, the isokinetic shoulder strengths were not significantly different across the three groups in all settings. In conclusion, vitamin D insufficiency was common in elite volleyball players. Though not being associated with isokinetic muscle weakness, vitamin D should be regularly monitored and supplemented in young elite athletes, considering its importance on musculoskeletal health.

The utilization of gold nanoparticles (AuNPs) has garnered significant attention in recent times, particularly in the field of biomedical research. The utilization of AuNPs in chemical synthesis procedures raises apprehensions regarding their potential toxicity in living organisms, which is inconsistent with their purported eco-friendly and cost-effective aspects. In this investigation, AuNPs were synthesized via the green synthesis approach utilizing Jeju Hallabong peel extract (HPE), a typical fruit variety indigenous to South Korea. The visible-range absorption spectrum of gold nanoparticles from green synthesis (HAuNPs) that are red wine in color occurs at a wavelength of λ = 517 nm. The morphology and particle size distribution were analysed using transmission electron microscopy (TEM) and ImageJ software. The TEM images reveal that the HAuNPs exhibit a high degree of dispersion and uniformity in their spherical shape, with an average size of approximately 7 nm. Moreover, elevating the initial pH level of the mixed solution has an impact on the decrease in particle dimensions, as evidenced by the blue shift observed in the UV-visible spectroscopy absorbance peak. Elevating the reaction temperature may accelerate the synthesis duration. However, it does not exert a substantial impact on the particle dimensions. The outcomes of an avidin-biocytin colorimetric assay provide preliminary analyses of possible sensor tunability using HAuNPs. The cytotoxicity of HAuNPs was evaluated through in vitro studies using the MTT assay on RAW 264.7 cell lines. The results indicated that the HAuNPs exhibited lower cytotoxicity compared to both chemically reduced gold nanoparticles (CAuNPs) and commercially available gold nanoparticles (SAAuNPs).