Background: Gastric cancer (GC) is one of the leading malignancy diseases worldwide, especially in Asian. CAST is a potential oncogene in GC carcinogenesis process. The character of macrophage infiltration in GC microenvironment was also unaddressed. Methods: We first applied machine searching in gene candidate evaluation of GC. CAST expression was analyzed via the Human Protein Atlas (HPA) and Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. Protein-protein interaction (PPI) network was downloaded from STRING. We investigated the impact of CAST on clinical prognosis using Kaplan-Meier plotter. The correlations between CAST and Lgr5 and macrophage infiltration in GC was surveyed via TIMER 2.0. Finally, GeneMANIA was also used to evaluate the possible functional linkage between genes. Results: After machine-assisted searching, CAST expression was found signicant difference in the overall survival of GC patients. STRING revealed CAST related proteomics and transcriptomics associations, mainly about CAPN family. Moreover, CAST significantly impacts the prognosis of GC from other datasets validation. Notably, high CAST expression was correlated with worse overall survival in GC patients (hazard ratio = 1.59; logrank P = 9.4 x 10-8). CAST and Lgr5 expressions were both positively correlated with WNT 2 and WNT 2B. Among GC patients in several datasets, CAST and macrophage infiltration evaluated together showed no obvious trend toward poor clinical overall survival. Conclusion: CAST plays an important role in GC clinical prognosis and is associated with WNT 2/WNT 2B/Lgr5. Our study denmostrated that CAST in GC overall survival is regulated by macrophage infiltration.

We give a simple proof of the Chen inequality for the Chen invariant $\underbrace{\delta (2,...,2)}_{k\mbox{ terms}}$ of submanifolds in Riemannian space forms.

The Chen circuit system, a three-dimensional autonomous system with intriguing dynamics, has gained considerable attention due to its potential applications in diverse scientific fields. In this article, a Chen circuit-like system is defined and a comprehensive dynamics has been studied. The system exhibits chaotic dynamics, limit cycles, and bifurcations, making it a captivating subject of study. By employing numerical simulations and analytical techniques, we explore the system's stability and identify critical parameter values leading to qualitative changes. Notably, we delve Hopf bifurcations, which give rise to stability changes and the emergence of limit cycles. Furthermore, we analyze the fractal dimension of the system's attractor, providing insights into its complexity and self-similarity. Through a systematic examination of the Chen circuit-like system, we deepen our understanding of its intricate dynamics and offer valuable insights into the underlying mechanisms. The findings contribute to the field of dynamical systems and hold potential implications in areas such as chaos-based secure communications, signal processing, and nonlinear control. This work serves as a valuable reference for researchers and practitioners interested in the dynamics and bifurcation analysis of nonlinear systems.

The aim of this study is to investigate, by means of experimental measurements and full-wave simulations, the dominant factors for the very high-resolution (VHR) radar image speckles from exponential correlated rough surfaces. A Ka-band radar system was used to collect the return signal from such a surface sample fabricated by 3D printing, and that signal was further processed into images at different resolution scales, where the image samples were obtained by horizontally turning around the surface sample. To cross-validate the results and to further discuss the VHR speckle properties, full wave simulations by full 3D Finite Difference Time Domain (FDTD) method were conducted with 1600 realizations for the speckle analysis. At the considered very high resolution, speckle statistics show divergence from the fully developed Rayleigh distribution. The factors that impact on the high-resolution speckle properties from exponential correlated rough surface, are analyzed in views of the equivalent number of scatterers theory and scattering scales, respectively. From the data results and extended discussions, it is evident that both of the above factors matter for VHR speckle of backscattering, from the exponential correlated rough surface as a good representative for the ground surface.

There is a confusion in the original design concept for the tensioning of longitudinally connected reinforcement of CRTSII slab ballastless track. In order to clarify the effect of tension value of longitudinal reinforcement on mechanical characteristics of ballastless track, a three dimensional finite element model considering the nonlinear interaction between the track slab and CA mortar of CRTSII slab ballastless track was established. The mechanical characteristics of the track structure under longitudinal tension load and temperature gradient load of the longitudinal joint were calculated. A method of applying pre-stress to post-pouring concrete was proposed according to the concept of pre-stress loss of pretensioning pre-stressed concrete, reasonable tensile force value was proposed after the crack width and the reinforcement stress of the ballastless track in the operation stage were checked and calculated according to the concrete design principle. When the tension force is greater than 300 kN, it’s harmful to the bonding between the slab and mortar layer, which is prone to interlayer damage. In order to adding pre-stress to concrete of wide joints to ensure the longitudinal stability of ballastless track and the reinforcement stress and crack width to meet the design requirements. It is suggested that the tension force value should be 230 kN, and the temperature difference between reinforcement and concrete should be 30 °C before the initial curdle of wide joint concrete.

Using the 2011-2020 digital inclusive finance data released by Peking University and the index system constructed by the Blue Book of China Rural Revitalization and Development Index (2018), this paper analyzes the dynamic evolution of the digital inclusive finance and the rural revitaliza-tion from time and space dimensions with the help of kernel density estimation, Markov chain and Moran index. Using The Gini coefficient decomposition method to analyze the source of differ-ences in digital inclusive finance, and then using the spatial autoregressive (SAR) model and ge-ographically weighted regression (GWR) model to study the boosting effect of digital inclusive finance on rural revitalization from the perspective of spatial aggregation and spatial differentia-tion, respectively. The results show that: (1) The growth rate of China's digital inclusive finance slows down year by year, and the inter-provincial differences increase year by year and show gradient characteristics, indicating that there may be a trend of multipolar differentiation. The overall level of Rural Revitalization shows an increasing trend, and the gap between provinces is still apparent. (2) The evolution of digital inclusive finance and rural revitalization is a slow ad-justment process, and there has been no cross-level jump in the past ten years. In digital inclusive finance, the liquidity from the highest and lowest levels to the medium level is high. However, the liquidity in the states of rural revitalization development level is not high. (3) Rural revitalization has a positive spatial spillover effect. The level of rural revitalization in the western area is signif-icantly lower than in the eastern area. At the same time, there is no significant difference between the east and central areas. The depth of the use of digital inclusive finance has a significant positive impact on the revitalization and development of rural areas, indicating that the further promotion of digital inclusive finance business in rural areas can substantially boost the revitalization of rural areas. (4) The boosting effect of digital inclusive finance on rural revitalization shows prominent spatial differentiation characteristics. The depth of use and the degree of digitization generally show a positive impact. The central and eastern coastal cities have the highest impact, decreasing toward the southwest and northeast. The areas with the lowest usage depth impact are clustered in the northeast, and the areas with the lowest digitization impact are clustered in the southwest.

Acute myeloid leukemia (AML) is a hematological malignancy that is the culmination of genetic and epigenetic alterations in the hematopoietic progenitor cells, leading to uncontrolled proliferation at the expense of normal hematopoiesis and bone marrow exhaustion. Although the outcomes for pediatric AML have improved in recent decades, at least one third of children still have relapses. Recent studies have notably highlighted the important role of dysregulated epi-genetic mechanisms in myeloid leukemogenesis. Epigenetic modifications are frequently reversible compared to genetic alterations, thus providing opportunities for targeted epigenetic therapy. In this review, we summarize the landscape of epigenetic alterations and the progress to date in epigenetic targeted therapy, and focus on the future role of epigenetic abnormalities in predicting relapse and the precision therapy in pediatric AML.

The cytosolic PNGase (peptide:N-glycanase; Png1 in yeast; NGLY1/Ngly1 in human/mice), also known as peptide-N4-(N-acetyl-beta-glucosaminyl)-asparagine ami-dase, is a well-conserved deglycosylation enzyme (EC 3.5.1.52) which catalyzes the non-lysosomal hydrolysis of an N(4)-(acetyl-β-D-glucosaminyl) asparagine residue into N-acetyl-β-D-glucosaminylamine and a peptide containing an aspartate residue. This enzyme (NGLY1) plays essential roles in clearance of misfolded or unassembled gly-coproteins through a process named ER-associated degradation (ERAD). Accumulating evidence also points out that NGLY1 deficiency can cause an autosomal recessive hu-man genetic disorder associated with abnormal development and congenital disorder of deglycosylation. In addition, the loss of NGLY1 can affect multiple cellular pathways, including but not limited to NFE2L1 pathway, Creb1/Atf1-AQP pathway, BMP path-way, AMPK pathway, and SLC12A2 ion transporter, which might be the underlying reasons for a constellation of clinical phenotypes of NGLY1 deficiency. The current comprehensive review indeed uncovers the detailed NGLY1’s structure and its im-portant roles for participation in ERAD, involvement in CDDG and potential treatment for NGLY1 deficiency.

Developing new energy is critical to China's green and low-carbon development. And the New Energy Demonstration City Policy (NEDCP) is a vital innovation policy that inspires the development of new energy. Is the NEDCP facilitating green and low-carbon development, if so, how? Employing unbalanced panel data from 2003 to 2017, the impact of NEDCP on green and low-carbon development was studied by using the "difference in difference" (DID) model. We find that this policy can take significantly role. After various robustness tests, our results are still valid. According to the heterogeneity analysis, non-resource and non-old industrial base cities have a greater positive impact from this policy. The mechanism analysis denotes that the positive policy effect works through upgrading the industrial structure and stimulating urban innovation. The substantial empirical evidence presented in this article supports the continued promotion and implementation of new energy demonstration cities.

Sodium-potassium (NaK) liquid alloy is a promising candidate for use as anode material in sodium batteries because of its fluidity, which effectively suppresses the growth of sodium or potassium dendrites. However, the poor wettability of the NaK liquid alloy on conventional metal substrates is unfavorable for cell fabrication due to its strong surface tension. In this paper, low-density and low-cost fluorinated aluminum foam is used as a substrate support material for NaK liquid alloy. By combining low surface tension NaK@C with fluorinated aluminum foam, we obtain a uniformly distributed and structurally stable electrode material. The composite electrode has a cycling stability of more than 3000 hours in a symmetrical cell. Furthermore, when coupled with a sulfurized polyacrylonitrile cathode in carbonate electrolyte, it maintains excellent stability even after 800 cycles, with 72% of capacity retention.

Background: Cigarette smoking (CS) is a global public health problem and a high-risk factor for various diseases. In December 2019, a novel coronavirus (HCoV-19) was identified in Wuhan, China. Because ACE2 has been identified as a receptor for HCoV-19, we hypothesize that CS affects the expression pattern of ACE2 in respiratory tract, causing differences in susceptibility to the virus. Methods: Three datasets (GSE994, GSE17913, and GSE18344), were downloaded from the Gene Expression Omnibus (GEO) database. Correlation and enrichment analysis were used to evaluate the function of ACE2. Also, the different expression of ACE2 in different groups of three datasets were analyzed. Results: Genes associated with ACE2 were enriched in important biological processes such as viral processes and immune response. Elevated ACE2 were found in intrapulmonary airways (GSE994) and oral epithelial cells (GSE17913) of smokers but not those of non-smokers or former smokers. Significant dose- and time-dependent relationships between CS and ACE2 expression were observed in mouse lung tissues, and long periods without smoking were found to significantly reduce ACE2 expression. Conclusions: Both human and rat data confirmed that CS could induce increased ACE2 in the respiratory tract, indicating that smokers have a higher susceptibility to HCoV-19.

Image encryption is increasingly becoming an important area of research in information security and network communications, as digital images are widely used in various applications and are vulnerable to various types of attacks. In this research work, a color image cryptosystem that is based on a 3-layer permutation-substitution network (PSN) is proposed. For every layer, an encryption key and an S-box are generated and utilized. Those are based on a four-dimensional (4D) dynamical Chen system of a fractional-order, the Mersenne Twister, OpenSLL, Rule 30 Cellular Automata and Intel’s MKL. The sequential application of Shannon’s ideas of diffusion and confusion for 3 times guarantees a total distortion of any input plain image, resulting in a totally encrypted one. Apart from the excellent and comparable performance to counterpart algorithms from the literature, showcasing resistance to visual, statistical, entropy, differential, known plaintext and brute-force attacks, the proposed image cryptosystem provides an exceptionally superior performance in 2 aspects: a vast key space of 2^1658 and an average encryption rate of 3.34 Mbps. Furthermore, the proposed image cryptosystem is shown to successfully pass all the tests of the NIST SP 800 suite.

Cafestol, a bioactive compound found in coffee, has attracted considerable attention due to its potential impact on cardiovascular health. This review aims to comprehensively explore the association between cafestol and cardiovascular diseases. We delve into the mechanisms through which cafestol influences lipid metabolism, inflammation, and endothelial function, all of which are pivotal in cardiovascular pathophysiology. Moreover, we meticulously analyze epidemiological studies and clinical trials to elucidate the relationship between cafestol and cardiovascular outcomes. Through a critical examination of existing literature, we aim to provide insights into the potential benefits and risks associated with cafestol concerning cardiovascular health.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Cisplatin-based chemotherapy has long been viewed as the first-line chemotherapy for advanced and metastatic urothelial carcinoma (UC). However, many patients with UC have been classified as “cisplatin-ineligible patient”, which requires alternative chemotherapy due to their poor responses. In fact, vast majority of those who initially responded to cisplatin-based chemotherapy eventually progressed. Understanding of UC tumor immunology provided an immunopathogenic bases for immune checkpoint inhibitors, targeting PD-1 and CTLA-4, to treat cisplatin ineligible metastatic UC and patients with platinum-refractory metastatic UC. In 2020, data from the trail further showed that PD-L1 inhibitors benefit prolonged survival and progression-free survival as maintenance therapy. Besides immune-targeting therapies, manipulation of tumor microenvironment via metabolic pathways alternation, such as inhibiting tumor glycolysis, lactate accumulation and exogenous glutamine uptake, has been investigated in the past few years. In this comprehensive review, we started by introducing traditional chemotherapy of UC, and summarized current evidences supporting the use of immune checkpoint inhibitors and highlighted ongoing clinical trials. Lastly, we reviewed the tumor metabolic characteristic and the anti-tumor treatments targeting metabolic pathways.

Currently, the majority of industrial metal processing involves the use of taps for cutting. However, existing tap machines require relocation to specialized inspection stations and only assess the con-dition of the cutting edges for defects. They do not evaluate the quality of the cutting angles and the amount of removed material. Machine vision, a key component of smart manufacturing, is com-monly used for visual inspection. Taps are employed for processing various materials. Traditional tap replacement relies on the technician's accumulated empirical experience to determine the ser-vice life of the tap. Typically, inspecting tooth wear involves removing the tap and evaluating the degree of wear to determine if regrinding or replacement is necessary. Therefore, we propose the use of visual inspection of the tap's external features to determine whether replacement or regrinding is needed. We examined the bearing surface of the tap and utilized single images to identify the cutting angle, clearance angle, and cone angles. By inspecting the side of the tap, we calculated the wear of each cusp. We further investigated whether the cutting portion affected the length of the tool by measuring changes in tooth surface area and the amount of removed thread. This inspection process can facilitate the development of a tap life system, allowing for the estimation of the durability and wear of taps and nuts made of different materials. Statistical analysis can be employed to predict the lifespan of taps in production lines.

The accurate of model attitude angel plays an important role on the aerodynamic test results in the wind tunnel test. The original method applies the spherical coordinate system transformation to obtain attitude angel calculation. The model attitude angel is obtained by coordinate transformation and spherical surface mapping applying the nominal attitude angel (the balance attitude angel in the wind tunnel coordinate system) indicated by the mechanism. First, the coordinate transformation of this method is not only complex but also difficult to establish the transformed relationship between the space coordinate systems especially after many steps of coordinate transformation, moreover it cannot realize the iterative calculation of the interference relationship between attitude angels; Second, during the calculate process to solve the problem the arc is approximately used to replace the straight line, the angel for the tangent value, and the inverse trigonometric function is applied. Therefore, in the calculation of attitude angel, the process is complex and inaccurate, which can be solved approximately when calculating small attack angel. However, with the advancing development of modern aerodynamic unsteady research, the aircraft tends to develop high or super large attack angel and unsteady research field. According to engineering practice and vector theory, the concept of vector angel coordinate system is proposed for the first time, and the vector angel coordinate system of attitude angel is established. With the iterative correction calculation and avoiding the problem of approximate and inverse trigonometric function solution, the model attitude calculation process is carried out in detail, which validates that the calculation accuracy and accuracy of model attitude angels are improved. Based on engineering and theoretical methods, a vector angel coordinate system is established for the first time, which gives the transformation and angel definition relations between different flight attitude coordinate systems, that can accurately calculate the attitude angel of the corresponding coordinate system and determine its direction, especially in the channel coupling calculation, the calculation of the attitude angel between the coordinate systems is only related to the angel, and has nothing to do with the change order s of the coordinate system, which simplifies the calculation process.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Actuators are essential components for intelligent machines that can fulfill certain tasks in response to environmental stimuli. In recent years, actuators that can transform from a 2D ribbon shape to a 3D helical configuration under certain external stimuli have attracted significant attention due to the potential applications of the targeted helical structures in springs, propulsion generation, and artificial muscles. Inspired by the chiral opening of Bauhinia variegate‘s seedpods and the coiling of the Towel Gourd tendril with perversions, researchers have made significant breakthroughs in synthesizing state-of-the-art actuators capable of mimicking helical transformations. In this review, we give a brief overview of the shape evolution mechanisms of these two plant structures and then review recent progress in the fabrication of biomimetic helical actuators. These structures are categorized by the stimuli-responsive materials involved, including hydrogels, liquid crystal networks/elastomers, shape memory polymers, and multiwall carbon nanotubes. By providing this survey on important recent advances along with our perspectives, we hope to solicit new inspirations and insights on the development and fabrication of smart actuators, as well as the future development of interdisciplinary research at the interface of physics, engineering, and biology.

Acute lymphoblastic leukemia is the most common malignancy in children and is characterized by numerous genetic and epigenetic abnormalities. Epigenetic mechanisms, which involve DNA methylations and histone modifications, result in the heritable silencing of genes without a change in their coding sequence. Emerging studies are increasing our understanding of the epigenetic role of leukemogenesis and have demonstrated the potential of DNA methylations and histone modifications as a biomarker for lineage and subtypes classification, predicting relapse, and disease progression in ALL. Epigenetic abnormalities are relatively reversible when treated with some small molecule-based agents compared to genetic alterations. In this review, we conclude the genetic and epigenetic characteristics in ALL and discuss the future role of DNA methylation and histone modifications in predicting relapse, finally focus on the individual and precision therapy targeting epigenetic alterations.

We fabricated high-quality MAPbBr3 single crystals (SC) by introducing moderate amount electron-rich poly(propylene glycol bis(2-aminopropyl ether) (PEA) additives with an inverse temperature crystallization (ITC) method. The intramolecular vibrations and defective states of prepared MAPbBr3 single crystals were systemically studied by the in situ variable-temperature Fourier Transform Infrared (FTIR) Spectroscopy, X-ray photoelectron spectroscopy (XPS), and the synchrotron-based X-ray absorption near edge structure (XANES), et al. We infer that the proper amount of PEA additives would prevent the formation of intermediate states and crystal boundaries, passivating the density of defective states. The X-ray detection properties of single-crystal MAPbBr3 crystals were investigated, using both high dose and low dose X-ray photons at 40keV in synchrotron beamlines. The photocurrent of optimized PEA-treated MAPbBr3 single crystals demonstrate better performance compared with the as-prepared single crystals. Meanwhile, the decay time of MAPbBr3 single crystal is decreased from 460 ns to 210 ns by Time-resolved photoluminescence (TRPL) decay measurement, owing to the defect passivation by 0.5wt% PEA additives. The PEA-treated single crystals possess much faster decay time than the commercialized Ce:YAG scintillator (>500ns). These results help elucidate the passivation of defective states and contribute paths to manufacture high-quality single crystal perovskites for next-generation optoelectronic devices.

Post-training quantization is pivotal in deploying convolutional neural networks for mobile applications. Block-wise reconstruction with adaptive rounding, as employed in prior works like BrecQ and Qdrop, facilitates acceptable 4-bit quantization accuracy. However, adaptive rounding is time-intensive, and its constraint on weight optimization space curtails the potential for quantization performance. The optimality of block-wise reconstruction hinges on the quantization status of subsequent network blocks. In this investigation, we delve into the theoretical underpinnings of the limitations inherent in adaptive rounding and block-wise reconstruction. Our exploration leads to the development of a post-training quantization methodology, designated as AE-Qdrop. This algorithm operates in two distinct phases: block-wise reconstruction and global fine-tuning. The block-wise reconstruction phase introduces a progressive optimization strategy, superseding adaptive rounding, which not only augments quantization precision but also significantly improves quantization efficiency. To mitigate the risk of overfitting, we introduce a random weighted quantized activation mechanism. During the global fine-tuning phase, we account for interdependencies among quantized network blocks. The weight of each network block will be corrected with logit matching and feature matching. Extensive experiments validate that AE-Qdrop achieves high-precision and efficient quantization. For instance, in the case of 2-bit MobileNetV2, AE-Qdrop outperforms Qdrop by achieving a 6.26% enhancement in quantization accuracy and quintupling the quantization efficiency.

Soy protein isolate (SPI) based materials are abundant, biocompatible, renewable, and biodegradable. In order to improve the tensile strength (TS) of SPI films, we prepared a novel composite film modified with microcrystalline cellulose (MCC) and metal nanoclusters (NCs) in this research. The effects of the modification of MCC on the properties of SPI-Cu NCs and Zn NCs films were investigated. Attenuated total reflectance-Fourier transformed infrared spectroscopy analyses and X-ray diffraction patterns characterized the strong interactions and reduction of the crystalline structure of the composite films. Scanning electron microscope showed the enhanced cross-linked and entangled structure of modified films. Compared with untreated SPI film, the tensile strength of the SPI-MCC-Cu and SPI-MCC-Zn films increased from 2.91 MPa to 13.95 and 6.52 MPa, respectively. Moreover, the results also indicated their favorable water resistance with higher water contact angle. Meanwhile, the composite films exhibited increased initial degradation temperatures, demonstrating their higher thermostability. The results suggested that MCC could effectively improve the performance of SPI-NCs films, which would provide a novel preparation method for environmentally friendly SPI-based films in the applications of packaging materials.

In recent years, the consumption of over-the-counter probiotics used to promote health has grown rapidly worldwide and become an industry. In medicine, various studies have proven that probiotics can help improve the immune system and intestinal health. They are usually safe, but in some rare cases, they may cause concerning adverse reactions. Although the use of probiotics has been widely popularized in the public, the results of many probiotics clinical trials are contradictory. Especially for the cancer patients, the feasibility of probiotics management to provide benefits by targeting cancer and lessening anti-cancer side effects requires further investigations. And this review summarizes the interactions between probiotics and the host and current pros and cons of applying probiotics in the cancer patients.

In this paper, the experimental study of heating in 2 h lunch mode of air-conditioned bed system is carried out. The results show that the power consumption of heat conduction heating is only 0.34 kW·h, and the average heat dissipation is 81.3 W, while the power consumption of convection heating is 1.43 kW·h, with an average heat dissipation of 748.7 W. Regardless of power consumption or heat dissipation, convection heating is significantly higher than heat conduction heating, resulting in the room air temperature of the former increased from 12.3 °C to 17.3 °C, while the latter only increased from 14.4 °C to 15.2 °C. The study found that the water temperature of heat conduction heating can meet the thermal comfort needs of the human body in the range of 38~40 °C, while convection heating requires a higher temperature range, In contrast, the grade of hot water required for heat conduction heating is lower. Through the experiment, it is also found that the temperature of convection heating rises fast, but it is easy to appear dry feeling after a long time, while heat conductive heating has a slow temperature rise. there is a cool feeling within 20 min after the heating starts, and then the thermal comfort is better. The air conditioning system in this paper is used for the heating experiment in the winter lunch break mode, compared with convection heating, the overall thermal comfort of heat conduction heating is better and more energy efficient. it is suggested to adopt heat conduction heating mode in the winter heating of this system.

Oil agents produced from degreasing treatment of synthetic fibers are typical pollutants in printing and dyeing wastewater, which may cause large-scale environmental pollution without proper treatment. How to purify oily dye wastewater with low cost is a key problem at present. In this study, the biochar microspheres with oil removal ability were prepared deriving from waste bamboo chips using hydrothermal method. The structure of biochar microsphere was regulated by the activation and modification processes. The biochar microspheres were characterized and their adsorption behaviors for oily dye wastewater were explored. The results showed that the adsorption efficiency of biochar microspheres for oily dye wastewater (DTY) was improved significantly after the secondary pyrolysis and lauric acid grafting reaction. The maximum COD removal quantity of biochar microspheres for DTY was 889 mg/g with removal rate of 86.06% in 30 min. Besides, the kinetics showed that the chemisorption was the main adsorption manner. The application of biochar microspheres can decrease the costs of oily wastewater treatment and avoid environmental pollution.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

Abstract: High step-up voltage gain nonisolated DC-DC converter have attracted much attention in photovoltaic, fuel cells and other renewable energy system applications. In this paper, by combining input current ripple-free boost cell with coupled-inductor voltage-doubler cell, an input current ripple-free high voltage gain nonisolated converter is proposed. In addition, passive lossless clamp circuit is adopted to recycle the leakage inductor energy and to reduce the voltage spike across the power switch. By utilizing voltage-doubler cell consisting of diode and capacitor, the voltage stress of switch is further reduced and the resonance between the leakage inductor and the stray capacitor of the output diode is eliminated. A low switch-on-resistance low-voltage-rated MOSFET can therefore be employed to reduce the conduction loss and cost. The reverse recovery loss of output diode is reduced, and the efficiency of converter can be improved. Furthermore, the proposed converter can achieve nearly zero input current-ripple and make the design of electromagnetic interference (EMI) filter easy. Steady state analysis and operation mode of the converter is performed. Finally, experimental results are presented to verify the analysis results of the proposed converter.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

To investigate the effects of organic fertilizer combined with reduced chemical fertilizer on radish yield, quality, and soil environment in high mountainous areas (elevation: 1800 m), and to mitigate the environmental pollution caused by excessive use of chemical fertilizers. The field trial was conducted to study the effects of different fertilizer treatments. (Control:local fertilizer application rate: 375 kg·hm² reduction in chemical fertilizer + 4500 kg·hm² organic fertilizer; T1:12% reduction in chemical fertilizer + 4500 kg·hm² organic fertilizer; T2:20% reduction in chemical fertilizer + 4500 kg·hm² of organic fertilizer; T3:28% reduction in chemical fertilizer + 4500 kg·hm² organic fertilizer). Four different fertilizer ratios were studied to assess their impacts on radish quality, yield, and soil environment. The findings showed that T2 significantly increased radish yield by 12.92%. Moreover, it led to significant improvements in the content of vitamin C, soluble sugars, soluble solids, soluble proteins, titratable acidity, and glucosinolates, which increased by 10.62%, 2.15%, 50.00%, 26.90%, 43.90%, and 44.57%, respectively. Treatment T2 also significantly increased soil nutrient content, with a 7.69% and 14.29% increase in total nitrogen and total phosphorus content compared to the control (Control) treatment, and a significant reduction of 21.64% in soil bulk density . T2 treatment significantly enhanced soil urease activity, sucrase activity, alkaline phosphatase activity, and catalase activity, showing an improvement of 28.97%, 55.92%, 52.08%, and 17.47% compared to the control, respectively (p<0.05). Moreover, treatment T2 resulted in a relative abundance increase of 12.25% and 10.43% in Proteobacteria and Actinobacteria respectively. Thus, the combined application of T2:20% reduction in chemical fertilizer + 4500 kg·hm² of organic fertilizer improved the quality and yield of radish while optimizing the soil environment. T2 effectively promoted radish growth, enhanced radish yield and quality, and improved the soil environment.

Despite empirical findings that prosociality can prevent children and adolescents from developing psychological maladjustment, little is known about the underlying mechanisms. The goal of the present study was to examine the mediating effects of peer preference and self-perceived social competence on the associations between prosociality and psychological maladjustment (i.e., depressive symptoms and loneliness). Participants were 951 students (Mage = 11 years, 442 girls) in Grades 3~7 from Shanghai, China. They completed peer nominations of prosociality and peer preference, and self-report measures of self-perceived social competence, depressive symptoms, and loneliness. Multiple mediation analyses revealed that: (a) both peer preference and self-perceived social competence mediated the relations between prosociality and psychological maladjustment; and (b) a serial indirect pathway (i.e., prosociality  →  peer preference  →  self-perceived social competence →  psychological maladjustment) emerged when controlling for grade and gender. These findings point to potential targets in the prevention and intervention of adolescent internalizing problems.

Background: Atypical teratoid/rhabdoid tumor (AT/RT) is an uncommon and aggressive pediatric central nervous system neoplasm. However, a universal clinical consensus or reliable prognostic evaluation system for this malignancy is lacking. Our study aimed to develop a risk model based on comprehensive clinical data to assist in clinical decision-making. Methods: We conducted a retrospective study by examining data from the Surveillance, Epidemiology, and End Results (SEER) repository, spanning 2000 to 2019. The external validation cohort was sourced from the Children's Hospital Affiliated to Chongqing Medical University, China. To discern independent factors affecting overall survival (OS) and cancer-specific survival (CSS), we applied Least Absolute Shrinkage and Selection Operator (LASSO) and Random Forest (RF) regression analyses. Based on these factors, we structured nomogram survival predictions and initiated a dynamic online risk-evaluation system. To contrast survival outcomes among diverse treatments, we used propensity score matching (PSM) methodology. Molecular data with the most common mutations in AT/RT were extracted from the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Results: The annual incidence of AT/RT showed an increasing trend (APC, 2.86%; 95% CI:0.75-5.01). Our prognostic study included 316 SEER database participants and 27 external validation patients. The entire group had a median OS of 18 months (range 11.5 to 24 months) and median CSS of 21 months (range 11.7 to 29.2). Evaluations involving C-statistics, DCA, and ROC analysis underscored the distinctive capabilities of our prediction model. An analysis via PSM highlighted that individuals undergoing triple therapy (integrating surgery, radiotherapy, and chemotherapy) had discernibly enhanced OS and CSS. The most common mutations of AT/RT identified in the COSMIC database were SMARCB1, BRAF, SMARCA4, NF2, and NRAS. Conclusions: In this study, we devised a predictive model that effectively gauges the prognosis of AT/RT and briefly analyzed its genomic features, which might offer a valuable tool to address existing clinical challenges.

This study was undertaken to investigate and analyze noise pollution in a large Chinese governmental hospital’s medical intensive care unit and compare to the WHO guidelines.This cross-sectional study was conducted in a MICU at a public governmental teaching hospital in Fujian province between July and August of 2017. A WENSN® WS1361 Integrated Sound Level Meter (China) was used for continuous every five seconds one week noise levels recording. After this measurement, the decibel meter was used for recording different location of isolation rooms and open bays, including occupied and unoccupied patient, and recording sound events occurs in the ICU to identify sources of noise. Peak and average noise levels were obtained from the meter, and data were downloaded from the WS1361 into a laptop computer. The measured mean equivalent sound pressure levels (L) and standard Aeq deviation over one week period were 66.64±7.57 dB(A), with acute spikes reaching 119.7 dB(A), the average sound level for a 24 hour period in a work day was 68.03±5.07 dB(A). These are higher than the current daytime environmental noise limit of 40-45 decibels in China and WHO. Mean work day noise was significantly louder than weekend time, there was a significant difference in work days and weekend (t=16.85;P=0.000).There was a statistical difference between the day time and night time shifts (t=34.67;P=0.000). The isolation rooms were significantly quieter than the open-bay rooms(t=46.15; p=0.00), sound levels in the occupied and unoccupied rooms also had significant difference(t=17.26; P=0.000).Two types of noise resources, including twenty kinds sources were identified and measured, mean noise levels ranged from of 61.33 to 79.21 dB(A). This study shows noise levels in intensive care units were exceeded the recommended. The study of the influence of noise on patient and staff is needed, and noise reduction strategies must be conduct in ICU.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The degree of ore rock fragmentation of mine blasting is an important index for evaluating the effect of engineering blasting. In order to study the effect of millisecond delayed blasting on the internal fragmentation of the ore rock, LS-DYNA numerical simulation software was used to obtain the damage characteristics of the ore rock in the blasting area using the RHT model. The Mohr-Coulomb strength damage criterion was applied to analyze the internal stress state of the ore rock, and the effects of 25ms, 50ms and 75ms delay time conditions on ore rock fragmentation were studied. The results show that, within a certain range of delay time, the degree of rock fragmentation increases with the increase of delay time. The stress state in the ore rock due to blasting is strengthened with the increase of delay time in the direction of the blast hole, which shows that the stress concentration is strengthened from the excavation face to the interior of the ore rock. The damage and the degree of fragmentation show a characteristic relationship of 25ms＜50ms＜75ms, which is verified by carrying out blasting experiments on site.

In forests, the microbial populations living in the soil can directly affect the carbon decomposed by the surface plants, and promote carbon storage and stability. In this study, 3 plots of 25.82 m×25.82 m were set up in 5 stand types, respectively. Soil samples were collected from 0~20 cm, 20~40 cm and 40~60 cm layers. Soil microbial composition, organic carbon component, pH, water content, bulk density, nitrogen, phosphorus, potassium and other physicochemical indexes and correlations were determined, and the correlations between soil carbon components and soil microbial functional modules in different mixed modes were analyzed. The results showed that: (1) The SOC of the same soil layer varied significantly, which also showed significant differences on the composition of soil bacteria and fungal microbial communities. Moreover, the bacterial community was more sensitive to the vegetation change environment, and the fungal community structure was more resistant to the influence of soil environment changes. (2) Fun_mod 1,6 and Bac_mod 7 were the microbial functional modules that played a decisive role in the process of soil carbon pool change, and the diversity and composition of bacterial community had more positive effects on soil organic carbon than that of fungal community. (3) Linear fitting and RDA results showed that POC in soil had the strongest correlation with SOC content, indicating that soil microorganisms affected the storage and stability of soil carbon mainly by regulating the conversion of surface plants (carbon sources) into POC. The soil environment of different mixed modes has different effects on soil carbon accumulation. Soil microorganisms affect soil carbon storage and stability mainly by regulating the conversion of surface plants (carbon sources) into POC forms.

Accurate prediction of the degree of airport delays under the influence of convective weather is crucial for collaborative traffic management implementation and improving the efficiency of airport operations. However, existing studies usually only consider numerical-type quantitative features of weather-affected traffic in their models, and lack the introduction of spatial information to comprehensively portray the traffic operation scenarios under the influence of weather. In order to overcome this problem, this paper firstly designs a new image representation of weather-affected air traffic, and constructs a multi-channel traffic and weather scene image (MTWSI) by populating the airspace two-dimensional grid with traffic and meteorological information to represent the overall traffic operation situation in the terminal area under the influence of convective weather; then, a deep convolutional neural network-based airport delay prediction model ( ADLCNN), which takes MTWSI images as input and uses a specific CNN model to extract the deep features that affect traffic operation in it to input into the subsequent classification algorithm to predict the flight delay level; finally, a series of comparative experiments are carried out on the operational data of Guangzhou Baiyun Airport, and the experimental validation shows that, compared with the traditional machine learning methods, the proposed CNN-based airport delay prediction The experimental validation shows that the proposed CNN-based airport delay prediction model has satisfactory prediction performance compared with the traditional machine learning methods, which also proves that the proposed MTWSI method can more comprehensively respond to the real traffic conditions.

A large number of studies have concluded that since housing pressure will affect the mobility of highly skilled young migrants (HSYM) in Chinese cities and regions, it is necessary to apply corresponding housing policies to adjust housing unaffordability for HYSM. This study uses a survey data conducted in China's Zhejiang Province of China, where specific policies have been implemented to attract talent and found that housing does crowds out the HSYM from a city, but the HSYM who have a master's degree or above or who work in government organizations or state-owned enterprises are more tolerant of housing unaffordability. The unmarried or those staying in the city for a long period are less tolerant of housing unaffordability. Meanwhile, there are the heterogeneous impacts of factors on the HSYM's tolerance for housing unaffordability across cities of different levels. Therefore, housing policies should highlight urban differences and intra-group differences.

Concrete cracks and local damage can affect the bond performance between concrete and steel bars, thereby reducing the durability of reinforced concrete structures. Compared with general concrete crack repair methods, biomineralization repair not only has effective bonding capabilities but is also particularly environmentally friendly. In view of this, this study aimed to apply biomineralization technology to repair damaged fiber-reinforced lightweight aggregate concrete (LWAC). Two groups of LWAC specimens were prepared. The control group used lightweight aggregates (LWAs) without bacterial spores and nutrient sources, and the experimental group used LWAs containing bacterial spores and nutrient sources. These specimens were first subjected to compression tests and pull-out tests, respectively, and thus were damaged. After the damaged specimen healed itself in different ways for 28 days, secondary compression and pull-out tests were conducted. The self-healing method of the control group involved placing the specimens in an incubator. The experimental group was further divided into experimental group I and experimental group II. The self-healing method of experimental group I was the same as that of the control group. The self-healing method of experimental group II involved soaking the specimen in a mixed solution of urea and calcium acetate for two days, and then taking it out and placing it in an incubator for two days, with a cycle of four days. The test results showed that, compared with the control group specimens, the relative bond strength ratio of the experimental group II specimens increased by 17.9%. Moreover, the EDS and XRD analysis results confirmed that the precipitate formed at the crack was calcium carbonate, which improved the compressive strength and bond strength after self-healing. This indicates that the biomineralization maintenance method used in experimental group II is more effective.

The leaves of Ligustrum robustum have been applied as Ku-Ding-Cha, a functional tea to clear heat and remove toxins; and served as a folk medicine to deal with diabetes, obesity, and hypertension. Trans-p-hydroxycinnamic acid and its esters, which were isolated from the leaves of L. robustum, might be a new resource to prevent diabetes and its complications because of their strong -glucosidase and fatty acid synthase (FAS) inhibitory activities and antioxidant effect. However, the quantitative analytical method for trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum hasn’t been reported so far. In addition, it was difficult and troublesome to analyze no less than 34 trans-p-hydroxycinnamic acid esters by usual HPLC. Therefore, a new HPLC-UV method using hydrolyzation with sodium hydroxide for quantitation of trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum was developed in the present study. The optimal hydrolyzation conditions were as follows: 1 mL sodium hydroxide aqueous solution (1 M) was added into 1 mL the extract of L. robustum and incubated at 80 °C for 2 h , and then 1 mL hydrochloride (1 M) solution was added. HPLC analysis was performed in reverse phase mode using a C-18 column, eluting with methanol-0.1% acetic acid aqueous solution (40:60, v/v) in isocratic mode at a flow rate of 1.0 mL/min, and detecting at 310 nm. The analytical method was simple and rapid, which simplified greatly the analytical process. The method was validated in terms of linearity, limit of detection (LOD), limit of quantification (LOQ), precision, and accuracy. High linearity was demonstrated with correlation coefficient of 1.000 for trans-p-hydroxycinnamic acid. The LOD and LOQ values were 1.55 and 4.69 μg/mL, respectively. The relative standard deviations (RSD) of intra-day and inter-day variabilities for trans-p-hydroxycinnamic acid were less than 2%. The percentage recovery of trans-p-hydroxycinnamic acid was 101.2% ± 0.8%. Finally, the proposed method was applied successfully to the determination and comparison of the contents of trans-p-hydroxycinnamic acid and its esters in various extracts of the leaves of L. robustum. The 60%-70% ethanol extracts of L. robustum showed the highest contents of free trans-p-hydroxycinnamic acid (3.96-3.99 mg/g), and the 50%-80% ethanol extracts of L. robustum displayed the highest contents of trans-p-hydroxycinnamic acid esters (202.6-210.6 mg/g). The method can be applied also to the quality control of the products of L. robustum.

The transition region is a very thin but most peculiar layer in the solar atmosphere, located between the solar chromosphere and the corona. It is a key region for understanding the coronal heating, the solar eruptions triggering, and the origin of solar winds. Here, the gradients of all physical parameters are very high, including plasma density, ionization degree, temperature, and magnetic fields, etc. Therefore, the transition region should be highly dynamic, such as fast energy releasing and transporting, plasma heating, and even particle accelerating. They include two physical aspects: thermal and non-thermal processes. The thermal processes can be observed from the ultraviolet (UV) and extreme ultraviolet (EUV) emission by multi-wavelength images. The non-thermal processes, however, should be related to radio emissions especially at millimeter wavelengths, and the frequency range should span from several GHz to beyond 300 GHz, and the emission mechanism should be highly related to the magnetic fields and variations. The ultra-wide broadband spectral observations at millimeter wavelengths with high spectral resolutions may provide rich dynamic information about the transition region, such as non-thermal energy release and transmission, the flows of plasma and energetic particles, the magnetic fields and their variations, the generation and transportation of various waves, and the formation and evolution of the source regions of solar eruptions. Here, we discussed the spectral characteristics of millimeter-wave emission from the transition region and proposed a new conception of ultra-wide broadband millimeter-wave spectrometers to observe them.

Advanced high-strength steels (AHSS) have a wide range of applications in equipment safety and lightweight design, and enhancing the strength of AHSS to the ultra-high level of 2 GPa is currently a key focus. In this study, a new process of thermo-mechanical control process followed by direct quenching and partitioning (TMCP-DQP) is developed based on Fe-0.4C-1Mn-0.6Si (wt.%) low-alloy steel, and the effects of microstructure evolution on mechanical properties under TMCP-DQP process and conventional hot rolled quenched and tempered process (HR-QT) are comparatively studied. The results show that the TMCP-DQP process not only shortened the processing steps but also achieved outstanding comprehensive mechanical properties. The TMCP-DQP steel exhibits a tensile strength of 2.23 GPa, accompanied by 11.9% elongation and a Brinell hardness of 624 HBW, with an impact toughness of 28.5 J at -20 ℃. In contrast, the HR-QT steel exhibits tensile strengths ranging from 2.16 GPa to 1.7 GPa and elongations between 5.2% and 12.2%. The microstructure of TMCP-DQP steel primarily consists of lath martensite, containing thin-film retained austenite (RA), nanoscale rod-shaped carbides, and a minor number of nanoscale twins. The volume fraction of RA reaches 7.7%, with an average carbon content of 7.1 at.% measured by three-dimensional atom probe tomography (3DAP). Compared to the HR-QT process, the TMCP-DQP process results in finer microstructure, with a prior austenite grain (PAG) size of 11.91 μm, forming packets and blocks with widths of 5.12 μm and 1.63 μm. The TMCP-DQP process achieves the ultra-high strength of low-alloy steel through the synergistic effects of grain refinement, dislocation strengthening, and precipitation strengthening. The dynamic partitioning stage stabilizes the RA through carbon enrichment, while the relaxation stage reduces a small portion of the dislocations generated by thermal deformation, and the self-tempering stage eliminates internal stresses, all guaranteeing considerable ductility and toughness. The TMCP-DQP process may offer a means for industries to streamline their manufacturing processes and provide a technological reference for producing 2.2 GPa grade AHSS.

The objective of this study was to assess the effects of parity and lactation stage on the content and conversion rate of DHA in milk from dairy cows fed ruminally protected algae powder. A total of 800 cows were blocked by parity and divided into eight groups (n = 100, three groups of primiparous cows and five groups of multiparous cows) in a six-month experimental period. The lactation period was divided into three stages: 16 – 100 d, 101 – 200 d, and 201–305 d. All cows were fed 100 g of DHA-rich algae powder twice a day, with the DHA content > 13%. Milk samples were collected monthly, and daily milk yield and dry matter intake were recorded. Using infrared spectroscopy, we determined the content of protein, fat, lactose, and total solids in milk and calculated the DHA conversion rate. The results showed that parity and lactation stage had no significant effects on milk composition. However, milk yield and dry matter intake were higher in multiparous cows than in primiparous cows. The DHA content and conversion rate in milk were not significantly different between parity groups but were positively correlated with lactation stage and negatively correlated with milk fat content.

In order to correct attenuated millimeter-wavelength (Ka-band) radar data and address the problem of instability, an attenuation correction methodology (attenuation correction with variation trend constraint; VTC) was developed. Using synchronous observation conditions and multi-band radars, the VTC method adopts the variation trends of reflectivity in X-band radar data captured with wavelet transform as a constraint to adjust reflectivity factors of millimeter-wavelength radar. The correction was evaluated by comparing reflectivities obtained by millimeter-wavelength cloud radar and X-band weather radar. Experiments showed that attenuation was a major contributory factor in the different reflectivities of the two radars when relatively intense echoes exist, and the attenuation correction developed in this study significantly improved data quality for millimeter-wavelength radar. Reflectivity differences between the two radars were reduced and reflectivity correlations were enhanced. Errors caused by attenuation were eliminated, while variation details in the reflectivity factors were retained. The VTC method is superior to the bin-by-bin method in terms of correction amplitude and can be used for attenuation correction of shorter wavelength radar assisted by longer wavelength radar data.

There is no doubt that seagrass beds constitute one of the most productive ecosystems in shallow coastal waters. Despite this, picoplankton in seagrass ecosystems has received relatively little attention. The purpose of this study was to compare picoplankton growth and mortality rates between seagrass and unvegetated habitats using chamber incubations. We tested two main hypotheses: (i) incubation with seagrass would result in higher bacterial growth rates due to increased DOM release from seagrass photosynthesis, and (ii) Synechococcus spp. would be lower in the presence of seagrass due to competition for inorganic nutrients. Our results showed bacterial growth rates of 2.31 and 2.44 d–1 without and with seagrass, respectively. In seagrass chambers, bacterial growth was higher than that in non-seagrass chambers, suggesting that organic carbon coming from the seagrass community may support bacterial production. Furthermore, we observed a negative Synechococcus spp. growth rate (-0.9 d–1) in the seagrass treatment, likely reflecting nutrient competition with the seagrass. Small-scale chambers proved to be a useful tool for studying the factors controlling spatial and temporal patterns of picoplankton across different habitats. Furthermore, future studies should examine picoplankton growth over a wider range of spatial scales in seagrass beds and adjacent unvegetated sediment.

Glass has emerged as a highly versatile substrate for various sensor and MEMS packaging applications, including electromechanical, thermal, optical, biomedical, and RF devices, due to its exceptional properties such as high geometrical tolerances, outstanding heat and chemical resistance, excellent high-frequency electrical properties, and the ability to be hermetically sealed. In these applications, Through-Glass-Via (TGV) plays a vital role in manufacturing and packaging by creating electrical interconnections through glass substrates. This paper provides a comprehensive summary of the research progress in TGV fabrication along with their integrations, including through-via formation and metallization. The paper also reviews the significant qualification and reliability achievements obtained by the scientific community for TGV. Additionally, the paper summarizes the application of TGV technology in various sensors.

Human milk reduces risk for necrotizing enterocolitis in preterm infants. Necrotizing enterocolitis occurs in the ileocecal region where thousands of milk protein-derived peptides have been released from digestion. Digestion-released peptides may exert bioactivity, such antimicrobial and immunomodulatory activities, in the gut. In this study, we applied mass spectrometry-based peptidomics to characterize peptides present in colostrum before and after in vitro digestion. Sequence-based computational modeling was applied to predict peptides with antimicrobial activity. We identified more peptides in undigested samples, yet the abundances were much higher in the digested samples. Heatmapping demonstrated highly different peptide profiles between undigested and digested samples. Four peptides (αS1-casein [157–163], αS1-casein [157–165], β-casein [153–159] and plasminogen [591–597]) were selected, synthesized and tested against common pathogenic bacteria associated with necrotizing enterocolitis. All four exhibited bacteriostatic, though not bactericidal, activities against Klebsiella aerogenes, Citrobacter freundii and Serratia marcescens, but not Escherichia coli.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

Abstract In order to solve the problem that it is difficult to obtain the accurate trigger signal moment when using the time difference of UAV flight acoustic signals collected by acoustic sensors arranged in advance to locate the position of UAVs when they cannot be tracked by radar and are difficult to be observed by the human eye, an acoustic source localisation method with improved empirical modal decomposition (REMD) under an adaptive frequency window is proposed. Firstly, the collected UAV flight signals are smoothed and filtered, then the robust empirical modal decomposition (REMD) is used for IMF modal decomposition and spectral analysis of the collected signals, and a panning frequency window with variable bandwidth is introduced for corresponding frequency locking and extracting the IMFs; the GWO optimisation is used and the sliding metrics are set to determine the position of the panning frequency window automatically; finally, the extracted Finally, the extracted IMF components are reconstructed according to the criterion, and the trigger signal moments in the reconstructed IMF components are resolved and recorded, and the algorithm is used to calculate the difference between the reception moments of different sensors; for the traditional sound source localisation algorithms with a small detection range, which are prone to fall into the no-solution or false-solution, i.e., unable to achieve the localisation, a weighted least-squares-based Chan-Taylor algorithm is proposed for the localisation computation, and a weighted least-squares algorithm is proposed for the localisation computation, through the Inputting the sensor delay parameter and solving the linear equation system to get the target position information; finally, this paper verifies the robustness and performance of the design method with simulated and actual signals. The results show that the maximum positioning error is no more than 5% in an area with a side length of 15m in the measurement area. With the improved accuracy of time delay estimation, the positioning simulation results meet the positioning requirements even though the positioning error is further expanded when the measurement area is further expanded.

Trimeresurus albolabris, also known as the white-lipped pit viper or white-lipped tree viper, is a highly venomous snake distributed across Southeast Asia and the cause of many snakebite cases. In this study, we report the first whole genome assembly of T. albolabris obtained with next-generation sequencing from a specimen collected in Mengzi, Yunnan, China. After genome sequencing and assembly, the genome of this male T. albolabris individual was 1.51 Gb in length and included 38.42% repeat-element content. Using this genome, 21,695 genes were identified, and 99.17% of genes could be annotated using gene functional databases. Our genome assembly and annotation process was validated using a phylogenetic tree, which included six species and focused on single-copy genes of nuclear genomes. This research will contribute to future studies on Trimeresurus biology and the genetic basis of snake venom.

In order to solve the problem of feature extraction of underwater acoustic signals in complex ocean environment, a new method for feature extraction from ship radiated noise is presented based on empirical mode decomposition theory and permutation entropy. It analyzes the separability for permutation entropies of the intrinsic mode functions of three types of ship radiated noise signals, and discusses the permutation entropy of the intrinsic mode function with the highest energy. In this study, ship radiated noise signals measured from three types of ships are decomposed into a set of intrinsic mode functions with empirical mode decomposition method. Then, the permutation entropies of all intrinsic mode functions are calculated with appropriate parameters. The permutation entropies are obviously different in the intrinsic mode functions with the highest energy, thus, the permutation entropy of the intrinsic mode function with the highest energy is regarded as a new characteristic parameter to extract the feature of ship radiated noise. After that, the characteristic parameters, namely, the energy difference between high and low frequency, permutation entropy, and multi-scale permutation entropy, are compared with the permutation entropy of the intrinsic mode function with the highest energy. It is discovered that the four characteristic parameters are at the same level for similar ships, however, there are differences in the parameters for different types of ships. The results demonstrate that the permutation entropy of the intrinsic mode function with the highest energy is better in separability as the characteristic parameter than the other three parameters by comparing their fluctuation ranges and the average values of the four characteristic parameters. Hence, the feature of ship radiated noise can be extracted efficiently with the method.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

Understanding the infiltration and solidification processes of liquid 5083Al alloy into Al2O3 three-dimensional reticulated porous ceramic (Al2O3(3D) RPC) is essential for optimizing the microstructure and properties of Al2O3(3D)/5083Al interpenetrating phase composites (IPCs) prepared by low-pressure infiltration process (LPIP). This study employs ProCAST software to simulate the infiltration and solidification processes of liquid 5083Al with pouring velocities (PV) of 0.4 m/s infiltrating into Al2O3(3D) RPC preforms with varying porosities at different pouring temperatures (PT) to prepare Al2O3(3D)/5083Al IPCs using LPIP. The results demonstrate that pore diameter of Al2O3(3D) RPC preforms and PT of liquid 5083Al significantly influence the of the infiltration. Solidification process analysis reveals that the Al2O3(3D) RPC preform with smaller pore diameters allows the lower pouring velocity of 5083Al to solidify faster compared to the preform with larger pore diameters. Al2O3(3D)/5083Al IPCs were prepared successfully from Al2O3(3D) RPC porosity of 15 PPI with liquid 5083Al at PV 0.4 m/s and PT 800 °C using LPIP, resulting in nearly fully dense composites, where both Al2O3(3D) RPCs and 5083Al interpenetrate throughout the microstructure. The infiltration and solidification defects were reduced under air pressure of 0.3 MPa (corresponding to PV of 0.4 m/s) during LPIP. Finite volume method simulations are in good agreement with experimental data, validating the suitability of the simplified model for Al2O3(3D) RPCs in the infiltration simulation.

We experimentally study the supercontinuum (SC) induced by femtosecond filament in different liquid media, and determine the relative measurement value of filamentation threshold Pth for these media by using a Mach-Zehnder interferometer (MZI). It is found that the value of Pth is higher than the critical power for self-focusing Pcr, which can be attributed to the strong dispersion effect. Changing the focal length of the focusing lens affect the measured results of the filamentation threshold: In the case of shorter focal length, linear focusing (i.e., geometrical focusing) regime dominates, and the measured values of Pth for different media are almost the same; as the focal length becomes larger, self-focusing starts to play a role, making the values of Pth for different media different from each other. This work provides an effective approach to study the femtosecond filamentation process in liquid media, and helpful to further understand the physical process of supercontinuum induced by femtosecond filament in liquid media.

In this research article we solve the problem of synchronization and anti-synchronization of chaotic systems described by discrete and time-delayed variable fractional order differential equations. To guarantee the synchronization and anti-synchronization of these systems, we use the well-known PID control theory and the Lyapunov-Krasovskii stability theory for discrete systems of variable fractional order.We illustrate the results obtained through simulation with examples, in which it can be seen that our results are satisfactory, thus achieving synchronization and anti-synchronization of chaotic systems of variable fractional order with discrete time delay.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Incident rates of neurodegenerative diseases have steadily increased globally, but there is no therapeutic access available. We newly prescribed medicinal herbal remedy including five different herbal plants called, Chen-Ma-Dan-Sam-Ga-Mi-Bang (CMST), purposed to prove for pharmacological properties and corresponded actions on hippocampus neuronal cell injury by hypoxia-induced mice model. Mice were adapted to normoxia or hypoxia with or without CMST for 5 days. We gathered pharmacological effects of CMST on cell injury by enhancement of dihydroethidium and 4-hydroxynonenal signals which were correlated with abnormal redox status in the protein or gene expression levels (abnormal elevations of nitric oxide, reactive oxygen species, lipid peroxidation and deteriorations of total glutathione, total antioxidant capacity, and activities of superoxide dismutase and catalase) due to hypoxia. CMST also notably exerted to attenuates molecules for neuronal cell injury markers such as p-tau, cleaved caspase-3 due to DNA oxidations (53bp1and phosphor-histone H2AX), inflammatory cytokines, and hemeoxigenase-1. We further figured out the underlying actions of CMST by in vitro experiment through inactivation of microglial cell which can mediate neuronal cell injury. Collectively, CMST prevented from hippocampal neuronal cells via inactivation of microglial cell with normalization of redox status on hypoxia-induced hippocampus neuronal cell injury.

Based on the cloud platform of Google Earth Engine (GEE), this study selected Landsat 5/8 and Sentinel-2 remote sensing images and used Support Vector Machine (SVM) classification method to classify the 35 years of intertidal salt marshes in China, and verified the classification results in combination with field survey. Finally, combining with various driving factors, the reasons and laws affecting the changes of salt marshes species and area were discussed and analyzed. The main results of the study are as follows:The main types of salt marshes plants in China include Phragmites australis, Spartina alterniflora, Suaeda salsa, Scirpus mariquete, Tamarix chinensis, Cyperus malaccensis and Sesuvium portulacastrum. The results salt marshes classification indicated that 166999.32 ha in 1985, 172893.87 ha in 1990, 174952.29 ha in 1995, 125567.51 ha in 2000, 93257.97 ha in 2005, 102539.04 ha in 2010, 96302.92 ha in 2015, and 115722.75 ha in 2019. The main driving factors of salt marsh change from 1985 to 2015 are reclamation, mudflat aquaculture, climate change, coastal zone erosion, invasion of alien species, and natural competition and succession among salt marshes species. The results can be used to quantitatively analyze the salt marshes carbon storage in space and time, and provide data support for the protection of salt marsh wetlands, the restoration of ecological functions and the implementation of "carbon neutral".

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Classifying network flow subsequences in an Industrial IoT gateway is an effective method for identifying Industrial IoT faults. This paper proposes a subsequence classification algorithm SSGBUL-IKNN based on unsupervised learning encoding to address the problem of low classification accuracy. Firstly, we built a network module based on unsupervised learning to encode the flow sequence of the Industrial IoT gateway. In the encoding module, a subsequence calibration algorithm controls the increasing error during the coding process. Then, the specific fault type is obtained through an improved KNN classification algorithm based on the indication distance source from the integrated coding sequences converted by multi-dimensional network flow sequences. The test result on three Industrial IoT datasets of a sewage treatment plant shows that the accuracy of SSGBUL-IKNN in this paper exceeds 92%, significantly higher than the algorithm DTW and TSF. It reaches the classification requirements of Industrial IoT fault diagnosis.

In this paper, we study the global existence and exponential decay for a dynamic contact problem between a Timoshenko beam with second sound and two rigid obstacles, of which the heat flux is given by Cattaneo's law instead of the usual Fourier's law. The main difficulties arise from the irregular boundary terms, from the low regularity of the weak solution and from the weaker dissipative effects of heat conduction induced by Cattaneo's law. By considering related penalized problems, proving some a priori estimates and passing to the limit, we prove the global existence of the solutions. By considering the approximate framework, constructing some new functionals and applying the perturbed energy method, we obtain the exponential decay result for the approximate solution, and then prove the exponential decay rate to the original problem by utilizing the weak lower semicontinuity arguments.

Supplementary lighting is commonly used in high-quality seedling production. In this study, grafted tomato seedlings were grown for 10 days in a glasshouse with a 16-hour daily supplementary lighting at 100 μmol·m⁻²·s⁻¹ PPFD from either high pressure sodium (HPS), metal halide (MH), far-red (FR), white LEDs (W), or mixed LEDs (W₁R₂B₁) to determine which light sources improve the seedling quality. The control did not have any supplementary light. The physiological parameters and the expression of genes related to photosynthesis were analyzed. The results show that the root length, biomass, number of leaves, chlorophyll (SPAD), dry weight to height ratio (WHR) of the scion, and specific leaf weight (SLW) were the greatest for grafted seedlings grown in W₁R₂B₁. The level of root ball formation was the greatest for seedlings grown in W₁R₂B₁, followed by those grown in W, HPS, and MH. Seedlings grown in FR did not fare very well, as they were very thin and weak. Moreover, the expression of two photosynthetic genes (PsaA and PsbA) was significantly increased by W₁R₂B₁ and W, which suggests that the plastid or nuclear genes might be regulated. The overall results suggest that W₁R₂B₁ was the most suitable light source to enhance the quality of grafted tomato seedlings. The results of this study could be used as a reference for seedling production in glasshouses, and provide new insights in the research of lights affecting the development of plants.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Infectious keratitis (IK) represents a major cause of corneal blindness. This study aims to investigate the demographics, risk factors, microbiological characteristics and antibiotic susceptibility patterns of IK in Taiwan over the past 15 years. A retrospective population-based study was conducted using the Chang Gung Research Database. Patients with IK were identified by diagnostic codes for corneal ulcer from 2004 to 2019. Of 7807 included subjects, 45.2% of patients had positive corneal cultures. The proportion of contact lens-related IK declined, while that of IK related to systemic diseases grew. The percentage of isolated gram-positive bacteria surpassed that of gram-negative bacteria in the 15-year period. The prevalence of Pseudomonas aeruginosa showed a decreasing trend (p = 0.004), whereas coagulase-negative Staphylococcus (CNS) and Propionibacterium species were increasingly detected (p < 0.001). Overall, the trend of antibiotic susceptibility of both gram-positive and gram-negative bacteria did not change throughout the study period. The susceptibility to the test antibiotics maintained over 90% in gram-negative isolates during 15 years. Vancomycin preserved 100% susceptibility to all gram-positive isolates. Since most tested antibiotics exhibited stable susceptibility over decades, this study reinforced that fluoroquinolones and fortified vancomycin continue to be good empiric therapies for treating bacterial keratitis in Taiwan.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

To address the requirements of sonar imaging, such as high receiving sensitivity, wide bandwidth, wide receiving angle, an AlN PMUT with an optimized ratio of 0.6 for the piezoelectric layer diameter to backside cavity diameter is proposed in this paper. A sample AlN PMUT is designed and fabricated with SOI substrate-based bulk MEMS process. The characterization test result of the sample demonstrates a -6 dB bandwidth of approximately 500 kHz and a measured receiving sensitivity per unit area of at 1.37 V/μPa/mm2, which significantly surpasses the performance of previously reported PMUTs. The -6 dB horizontal angles of the AlN PMUT at 300 kHz and 500 kHz are measured 68.30° and 54.24°, respectively. To achieve an accurate prediction of its characteristics when being packaged and assembled in a receive array, numerical simulations with the consideration of film stress are conducted. The numerical result shows a maximum deviation of ±7% in the underwater receiving sensitivity across the frequency range of 200 kHz to 1000 kHz and a deviation of about 0.33% in the peak of underwater receiving sensitivity comparing to the experimental data. By such good agreement, the simulation method reveals its capability of providing theoretical foundation for enhancing the uniformity of the AlN PMUTs in future studies.

This paper investigates the cooperative anti-jamming distributed channel selection problem in UAV communication networks. Considering the existence of malicious jamming and co-channel interference, a location-aware cooperative anti-jamming scheme is designed for the purpose of maximizing the users' utilities. Users in the UAV group cooperate with each other via location information sharing. When the received interference energy is lower than mutual interference threshold, users conduct channel selection strategies independently. Otherwise, users take joint actions with a cooperative anti-jamming pattern under the impact of mutual interference. Aimed at the independent anti-jamming channel selection problem under no mutual interference, a Markov Decision Process framework is introduced, whereas for the cooperative anti-jamming channel selection case under the influence of co-channel mutual interference, a Markov game framework is employed. Furthermore, motivated by reinforcement learning with a ``Cooperation-Decision-Feedback-Adjustment" idea, we design a location-aware cooperative anti-jamming distributed channel selection algorithm (LCADCSA) to obtain the optimal anti-jamming channel strategies for the users with a distributed way. In addition, the channel switching cost and cooperation cost, which have great impact on the users' utilities, are introduced. Finally, simulation results show that the proposed algorithm converges to a stable solution with which the UAV group can avoid the malicious jamming as well as co-channel interference effectively.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Strigolactones (SLs) are a novel emerging plant hormones, which play important roles in regulating plant organ development and environmental stress tolerance. Even though the SL related genes have been identified and well characterized in some plants. The information of SL related genes in soybean is not fully established yet, especially in response to salt stress. In this study, we identified nine SL biosynthesis genes: two D27, two CCD7, two CCD8, and three MAX1, and seven SL signaling genes: two D14, two MAX2 and three D53 in soybean genome. We found that SL biosynthesis and signaling genes are conserved during evolution in different species. Syntenic analysis of these genes revealed their location on nine chromosomes as well as existence of ten pairs of duplication genes. Moreover, plant hormone and stress-responsive elements were identified in the promoter regions of SL biosynthesis and signaling genes. By using quantitative real-time PCR (qRT-PCR), we confirmed that SL genes have different tissue expression in roots, stems and leaves. Further, we also explored the expression profiles of SL biosynthesis and signaling genes under salt stress. These results suggested that SL signaling genes may play important regulatory roles in response to salt stress. In conclusion, we identified and provided valuable information on the soybean SL biosynthesis and signaling genes, and established a foundation for further functional analysis of soybean SL related genes in response to salt stress.

Dissolved organic matter (DOM) derived from organic fertilizers may increase soil phosphorus (P) availability. However, the frequently observed correlation between soil P availability and dissolved organic carbon (DOC) content has led to an excessive focus on DOC content at the expense of DOM properties. The present study investigated the influence of DOM characteristics on soil P availability by using a 6-year field experiment and microcosms of P sorption in paddy soil. Our results showed that partial replacement of chemical P fertilizer with manure or crop straw increased P fertilizer-use efficiency, even when decreasing chemical P input by 34 %, compared to normal chemical fertilization. The microcosm experiment demonstrated that DOM properties, rather than total DOC content, determine soil P sorption capacity, despite the significant correlation between DOC content and P availability observed in the field experiment. Manure-DOM exerted stronger inhibitory effects on P sorption than straw-DOM, and high molecular weight (HMW)-fractionated DOM exerted stronger inhibitory effects on P sorption than low-molecular-weight-fractionated DOM by 16-20%. The mechanism was rooted in the HMW DOM with unique characteristics (e.g., strong aromaticity, hydrophobicity, abundant humic-like components, carboxyl groups, and benzene ring structures) competing for soil P sorption sites (e.g., reduction in specific surface area and micropore volume), decreasing the soil surface charge (e.g., zeta potential), and thereby suppressing P sorption in paddy soil. Our study points out a promising avenue for regulating organic matter properties with organic fertilization to improve P use efficiency in agricultural soils.

Anti-interferon (IFN)-γ autoantibodies are linked to varicella-zoster virus (VZV) infection. Given the elevated risks of herpes zoster (HZ) in rheumatoid arthritis (RA) patients treated with Janus kinase inhibitors (JAKi), we aimed to examine the relationship between anti-IFN-γ autoantibodies with HZ development in JAKi-treated patients. In twenty-four RA patients with new-onset HZ and forty-two without HZ, serum titers of anti-IFN-γ autoantibodies, plasma levels of IFN-γ, monocyte chemoattractant protein-1 (MCP-1), and IFN-γ inducible protein-10 (IP-10) were measured by ELISA. Significantly lower MCP-1 levels were observed in patients with HZ compared to those without (median, 98.21pg/ml, interquartile range (IQR) 77.63-150.30pg/ml versus 142.3pg/ml, IQR 106.7-175.6pg/ml, p<0.05). There was no significant difference in anti-IFN-γ titers, IFN-γ levels, or IP-10 levels between patients with and without HZ. Three of 24 patients with HZ had severe HZ with multi-dermatomal involvement. Anti-IFN-γ titers were significantly higher in patients with severe HZ than in those with non-severe HZ (median 24.8ng/ml, IQR 21.0-38.2ng/ml versus 10.5ng/ml, IQR 9.9-15.0ng/ml, p<0.005). In conclusion, patients with HZ had significantly lower MCP-1 levels than those without HZ, and patients with severe HZ had significantly higher titers of anti-IFN-γ than those with non-severe HZ. Given small sample size, our results need further validation in future studies.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

In scenarios such as natural disasters and military strike, it is common for unmanned aerial vehicles (UAVs) to form groups to execute reconnaissance and surveillance. To ensure the effectiveness of UAV communications, repeated resource acquisition issues and transmission mechanism design need to be addressed urgently. In this paper, we build an information interaction scenario in a Flying Ad-hoc network (FANET). The data transmission problem with the goal of throughput maximization is modeled as a coalition game framework. Then, a novel mechanism of coalition selection and data transmission based on group-buying is investigated. Since large-scale UAVs will generate high transmission overhead due to the overlapping resource requirements, we propose a resource allocation optimization method based on distributed data content. Comparing existing works, a data transmission and coalition formation mechanism is designed. Then the system model is classified into graph game and coalition formation game. Through the design of the utility function, we prove that both games have stable solutions. We also prove the convergence of the proposed approach with coalition order and Pareto order. Binary log-linear learning based coalition selection algorithm (BLL-CSA) is proposed to explore the stable coalition partition of system model. Simulation results show that the proposed data transmission and coalition formation mechanism can achieve higher data throughput than the other contrast algorithms.

UAV cooperative control has been an important issue in UAV-assisted sensor network, thanks to the considerable benefit obtained from cooperative mechanism of UAVs being applied as a flying base station. In coverage scenario, the tradeoff between coverage performance and transmission performance often makes deployment of UAVs fall into a dilemma, since both indexes are related to the distance between UAVs. To address this issue, UAV coverage and data transmission mechanism is analyzed in this paper, then an efficient multi-UAV cooperative deployment model is proposed. The problem is also modeled as a coalition formation game (CFG). The CFG with Pareto order is proved to have a stable partition. Then, an effective approach consisting of coverage deployment and coalition selection is designed, wherein UAVs can decide strategies cooperatively to achieve better coverage performance. Combining analysis of game approach, a coalition selection and position deployment algorithm based on Pareto order (CSPDA-PO) is designed to execute coverage deployment and coalition selection. Finally, simulation results are shown to validate the proposed approach based on efficient multi-UAV cooperative deployment model.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

The mammalian STE 20-like protein kinase 4 (MST4) gene is highly expressed in several cancer types, but little is known on the role of MST4 in breast cancer and the function of MST4 during epithelial-mesenchymal transition (EMT) has not been fully elucidated. Here, we report that overexpression of MST4 in breast cancer results in enhanced cell growth, migration, and invasion, whereas inhibition of MST4 expression significantly attenuates these properties. Further study shows that MST4 promotes EMT by activating Akt and its downstream signaling molecules such as E-cadherin/N-cadherin, Snail, and Slug. MST4 also activates AKT and its downstream pro-survival pathway. Furthermore, by analyzing breast cancer patient tissue microarray and silicon datasets, we found that MST4 expression is much higher in breast tumor tissue compared to normal tissue, and significantly correlates with cancer stage, lymph node metastasis and a poor overall survival rate (p<0.05). Taken together, our findings demonstrate the oncogenic potential of MST4 in breast cancer, highlighting its role in cancer cell proliferation, migration/invasion, survival, and EMT, suggesting a possibility that MST4 may serve as a novel therapeutic target for breast cancer.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

To estimate the progressive collapse resistance capacity of a multi-column frame tube structure with the assembled truss beam composite floor (ATBCF), the pushdown analysis, and the nonlinear dynamic analysis as well, are conducted for such a structure by using the alternate load path (ALP) method. The bearing capacities of the remaining structures at three different work conditions, which are the side middle column failure, the edge middle column failure, and the corner column failure, are individually studied, and the collapse mechanism for the remaining structures is analyzed from the aspects of the internal force redistribution and the failure mode of the second defense line. Simultaneously, the influence of the column failure time on the dynamic response of the remaining structure and the dynamic amplification coefficient are discussed. The results show that the residual bearing capacity of the remaining structure with the bottom corner column failure is higher than that of the one with the side or edge middle column failure, while the latter has a stronger plastic deformation capacity. When the ALP method is adopted to operate the progressive collapse analysis, it is reasonable to take the column failure time as 0.1 times of the first-order vertical vibration period of the remaining structure, and it is suitable to set the dynamic amplification coefficient as of 2.0, which is the ratio of the maximum dynamic displacement to the static displacement of the remaining structure under the transient loading condition.

Acanthamoeba keratitis (AK) is a blinding corneal infection caused by the protozoan Acanthamoeba. The long-term course of AK suggests the host immunity could not kill Acanthamoeba rapidly. The immune status is still unclear in the late stage of AK. The comparative transcriptome analysis was made based on the bulk RNA sequencing of cornea tissues from AK patients and donors. Differentially expressed genes and enriched signaling pathways were calculated. CIBERSORT algorithm was used for Immune infiltration analysis of cornea tissue between AK and normal controls. A total of 2668 differentially expressed genes, including 1477 upregulated genes and 1191 downregulated genes, were detected. Gene Ontology analysis revealed that the pathways were significantly enriched in leukocyte migration, regulation of T cell activation, the external side of plasma membrane, collagen-containing extracellular matrix, immune receptor activity and cytokine binding. KEGG pathway analysis showed that the pathways were significantly enriched in the cytokine-cytokine receptor interaction, hematopoietic cell lineage and Staphylococcus aureus infection pathway. The immune infiltration profiles varied little between AK and normal controls. Compared with normal tissue, cornea tissue of AK contained a higher proportion of M0 macrophages and CD8 T cells, while resting memory CD4 T cells contributed to a relatively lower portion (P &lt; 0.05). Finally, the expression levels of cell markers and SLAMF7/STAT6 pathway were confirmed by histopathology examinations, RT-qPCR and western blot.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

With the development of organizational biology and forced from the EU Cosmetic Regulation (EU/1223/2009) with the complete ban of animal testing for cosmetic purposes, 3D skin models have been widely developed due to their similar physiological structure and metabolic function to native human tissue. 3D skin models for in vitro cosmetic evaluation are still promising alternative methods for evaluating phototoxicity, corrosivity and irritation. These models have been used for early screening and later validation of toxicity and efficacy evaluation by many well-known cosmetic companies. 3D skin models have become an important tool in cosmetic evaluation research. This article reviews the development of 3D skin models and their application in cosmetic evaluation. An outlook on the current application and future technological development directions in the cosmetic field is also presented.

The rock joint fissure slope in cold regions is prone to deformation and failure problems such as relaxation, tension and collapse under freeze-thaw (F-T) cycles. Based on the ideology of clean production and promoting the structural integrity of geotechnical projects in cold areas, this study designed and prepared aeolian-sand (AS) to replace part of river sand as a filling mortar material by taking advantage of the low cost and easy availability of AS. Investigations were carried out to determine the impact of varying proportions of AS in mortar on the microstructure and shear properties of the mortar-rock interface under F-T cycles. Therefore, F-T cycle testing, nuclear magnetic resonance (NMR) testing and shear testing were carried out on grout with different proportions of AS. The results show that the right proportion of AS replacement could enhance the shear deformation resistance and F-T resistance of the mortar-rock interface, and 30% proportion is the optimal proportion. By increasing of F-T cycles, the three types of specimens showed different degrees of particle spalling, shedding and cracking. The slurry-rock interface layer in the A (0%) group exhibited the most severe F-T deterioration, while the B (15%) group showed a lesser degree, and the C (30%) group performed the best. T2 spectrum curve and total spectrum area change law from the microscopic point of view to verify the 30% AS proportion mortar-rock interface F-T resistance is the strongest, followed by 15% AS proportion mortar, the weakest is ordinary mortar. The degradation of the mortar-rock bond is primarily due to the conversion of solid to liquid phases and the movement of internal water caused by fluctuating temperatures. The extent of F-T deterioration in the slurry-rock interface layer is greatly affected by the varying proportions of AS. The shear strength and shear stiffness of specific proportion of AS decreased with the increase of F-T cycles. For same F-T cycles, the shear strength and shear stiffness of group C (30%) were the highest, followed by group B (15%) and group A (0%). The grout material not only reinforces the F-T joint fissure slope, but also reduces the cost of grout reinforcement and promotes the clean production of geotechnical structures.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

In wireless sensor networks (WSNs), each sensor node can estimate the global parameter from the local data in distributed manner. This paper proposed a robust diffusion estimation algorithm based on minimum error entropy criterion with self-adjusting step-size, which are referred to as diffusion MEE-SAS (DMEE-SAS) algorithm. The DMEE-SAS algorithm has fast speed of convergence and is robust against non-Gaussian noise in the measurements. The detailed performance analysis of the DMEE-SAS algorithm is performed. By combining the DMEE-SAS with diffusion minimum error entropy (DMEE) algorithms, an Improving DMEE-SAS algorithm is proposed, in non-stationary environment where tracking is very important. The Improving DMEE-SAS algorithm can avoid insensitivity of the DMEE-SAS algorithm due to the small effective step-size near the optimal estimator, and obtain a fast convergence speed. Numerical simulations are given to verify the effectiveness and advantages of these proposed algorithms.

Analyzing horse behavior is crucial for assessing training quality, particularly in accurately identifying actions like standing, walking, and running. Research has been conducted both domestically and internationally in this regard; however, challenges persist, including reliance on single sensors, poor real-time performance, and low identification accuracy. In view of these challenges, this study investigated real-time identification of horse behavior based on wearable devices. The system, centered around a microcontroller and utilizing a 4G network as a carrier, employs multi-axis IMU sensors as input sources to perceive horse posture. The study proposed a behavior classification method based on analysis of acceleration thresholds. The method consists primarily of two sequential stages: first, the resultant acceleration interval counting method, which employs a nonlinear segmentation approach for initial behavior classification; and second, the statistical analysis of variance parameters between segments, which when coupled with multi-level threshold processing, achieves a refined classification. Experimental results indicated that the interval counting method alone achieved an accuracy of 87.55%, while for the variance analysis method alone the accuracy was 90.87%. The proposed method, comprising the two stages, reached a classification accuracy of 91.57%, underpinning its usefulness in supporting future equine research.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Abstract: (1) Background: Cancer immune escape is associated with the metabolic reprogramming of TME, and combining metabolic targets with immunotherapy has great potential to improve clinical outcomes. Among all metabolic processes, lipid metabolism, especially fatty acid (FA) metabolism, has a huge role in cancer cell survival, migration, and proliferation, but its mechanism and role in the tumor immune microenvironment remain to be investigated. (2) Methods: We comprehensively analyzed 309 fatty acid-related genes, screened 121 different genes, and used one-way COX regression to select 15 genes with prognostic impact. Systematically evaluated the correlation between FMGs modification patterns and Tumor Microenvironment Infiltration, prognosis, and Immunotherapy. The FMGs-Score was constructed to quantify the FMGs modification patterns using principal component analysis. (3) Results: Three clusters based on FMGs-related genes were demonstrated in breast cancer, with three patterns of distinct immune cell infiltration and biological behavior. An FMGsScore signature was constructed to reveal that patients with a low FMGsScore had higher immune checkpoint expression, higher immune checkpoint inhibitor (ICI) scores, increased immune microenvironment infiltration, better survival advantage, and were more sensitive to immunotherapy than those with a high FMGsScore. Finally, the expression and function of the signature key gene NDUFAB1 were examined by in vitro experiments. (4) Conclusions: This study significantly demonstrates the non-negligible role of FMGs in the immune microenvironment of breast cancer, and that FMGsScores can be used to guide the prediction of immunotherapy in breast cancer patients. In in vitro experiments, knockdown of the NDUFAB1 gene resulted in reduced proliferation and migration of MCF-7 cell lines.

Pedestrian Dead Reckoning (PDR) is a promising algorithm for indoor positioning. However, the accuracy of PDR degrades due to the accumulated error, especially in multi-floor buildings. This paper introduces a three-dimensional (3D) positioning method based on terrain feature matching to reduce the influence of accumulated error in multi-floor scene. The proposed method involves two steps: motion pattern recognition and position matching calibration. The motion pattern recognition aims to detect different motion states, i.e., taking the stairs or horizontal walking, from the streaming data. Then, stair entrances and corridor corners are matched with transition points of motion states and pedestrian turning points, respectively. After matching, calibration is performed to eliminate the accumulated errors. By carrying out experiments on a two-floor closed-loop path with a walking distance about 145 m, it is shown that this method can effectively reduce the accumulated error of PDR , achieving accurate 3D positioning . The average error is reduced from 6.60 m to 1.83 m.