3D printing is a non-traditional additive manufacturing process. It is different from the traditional subtractive manufacturing process. It offers exceptional rapid prototyping capabilities and results that traditional subtractive manufacturing methods cannot attain, especially in applications involving curved or intricately shaped components. Despite its advantages, metal 3D printing will face porosity, warpage, and surface roughness issues. These issues will affect the future practical application of the parts indirectly, for example, the structural strength and the parts assembly ca-pability. Therefore, this study compares the qualities of the warpage, weight, and surface rough-ness after milling and grinding processes under the same materials (316L stainless steel) between general rolled steel and 3D additive steel. Experimental results show that 3D printing parts are approximately 13% to 14% lighter than the general rolled steel. The surface roughness performance of 3D printing steel is better than general rolled steel under the same material after milling or grinding processing. The hardness of the 3D printing steel is better than that of the gen-eral rolled steel. The research verifies that 3D additive manufacturing can use surface processing to optimize surface performance and achieve the functions of lightness and hardness.

Metasurface holography offers significant advantages, including a broad field of view, minimal noise, and high imaging quality, making it valuable across various optical domains such as 3D displays, VR, and color displays. However, the conventional pure-structured metasurface holographic devices face a limitation: once fabricated, their functionality remains fixed, restricting practical applications. In recent developments, the landscape of metasurface holography has witnessed a notable shift from passive to active elements, spurred by the introduction of multiplexed and reconfigurable metasurfaces. This paper provides a comprehensive review of the latest advancements in multiplexing and reconfigurable metasurface holography, delving into fundamental characteristics, design strategies, and diverse applications. In conclusion, we offer a brief summary of this rapidly evolving research area, suggest potential future directions, and explore applications. Finally, we briefly summarize this rapidly growing area of research, propose future directions and potential applications.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

Effective prediction of wastewater treatment is beneficial for precise control of wastewater treatment processes. The nonlinearity of pollutant indicators such as COD and TP makes the model difficult to fit and has low prediction accuracy. The classical deep learning methods have been shown to perform nonlinear modeling. However, there are enormous numerical differences between multi-dimensional data in the prediction problem of wastewater treatment, such as COD above 3000 mg/L and TP around 30 mg/L. It will make current normalization methods challenging to handle effectively, leading to the training failing to converge and the gradient disappears or exploding. This paper proposes a multi-factor prediction model based on deep learning. The model consists of a combined normalization layer and a codec. The combined normalization layer combines the advantages of three normalization calculation methods: z-score, Interval, and Max, which can realize the adaptive processing of multi-factor data, fully retain the characteristics of the data, and finally cooperate with the codec to learn the data characteristics and output the prediction results. Experiments show that the proposed model can overcome data differences and complex nonlinearity in predicting industrial wastewater pollutant indicators and achieve better prediction accuracy than classical models.

Embracing innovative digital technologies within educational systems is essential for overcoming challenges in modern learning environments, especially in the post-COVID-19 era. Teaching sustainability management in higher education institutions with innovative digital tools plays a fundamental role in the transition toward sustainable societies. Suitable game design elements play a significant role in facilitating sustainable learning. This study explored the effectiveness of incorporating business simulation games with project-based learning (PBL) in a flipped classroom setting. This approach was adopted within the context of a university cross-border e-commerce course to prepare students for acquiring 21st -century skills as higher-order thinking skills in a rapidly changing educational landscape. A quasi-experimental method was employed, involving a total of 60 university students from China's Zhejiang Province. Participants completed an online questionnaire designed to assess their learning engagement across three dimensions (cognitive, emotional, and behavioral) as well as their higher-order thinking skills (problem-solving, critical thinking, and creativity). The results show that the business simulation games combined with flipped classroom learning had a significantly positive impact on students’ learning outcomes, enhancing their problem-solving, critical thinking, and creative capabilities. Importantly, this approach also improved student engagement and promoted sustainable practices by applying real-life scenarios in an interactive environment. We conclude that business simulation games integrated with project-based learning (PBL) in flipped classroom settings represent a valuable educational approach. This approach not only enhances learning engagement but also fosters the development of higher-order thinking skills, encouraging students to adopt sustainable learning practices.

The low-temperature environment significantly inhibits the growth and metabolism of denitrifying bacteria, leading to an excessive concentration of ammonia nitrogen and total nitrogen in sewage treatment plants during the cold season. In this study, an efficient denitrifying strain of heterotrophic nitrification–aerobic denitrification(HN-AD) bacteria named HS2 was isolated and screened from industrial sewage of a chemical factory in Inner Mongolia at 8°C. The strain was confirmed to be Achromobacter spiritinus, a colorless rod-shaped bacterium. When cultured with sodium succinate as the carbon source, a carbon-to-nitrogen ratio of 20-30, a shaking rate of 150-180 r/min, and the initial pH of 6-10, the Strain HS2 exhibited excellent nitrogen removal at 8°C. Through the results of whole-genome sequencing, gene amplification, and gas product detection, the Strain HS2 was determined to possess key enzyme genes in both nitrification and denitrification pathways, suggesting a HN-AD pathway of NH4+-N→NH2OH→NO2--N→NO→N2O→N2. At 8°C, the Strain HS2 could completely remove ammonia nitrogen from industrial sewage with an initial concentration of 127.23 mg/L. Microbial species diversity analysis of the final sewage confirmed Achromobacter sp. as the dominant genus, this indicated that the low-temperature denitrifying strain HS2 plays an important role in nitrogen removal of actual low-temperature sewage.

Currently, Korea is experiencing localized extreme rainfall, which accounts for more than 80% of flood-related disasters, and is increasing in small river basins, where more than 60% of flood-related casualties occur. These events are caused by climate change and geological factors and their impact is becoming more severe. As a result, an effective measurement system is required to mitigate their impact, particularly in small stream basins that are especially vulnerable due to their steep slopes, small catchment areas, and lack of maintenance and management capacity. In addition, a Flood Early Warning Framework (FEWF) that forecasts discharge and depth during flood events is crucial for reducing casualties. Therefore, this research is focused on developing the FEWF using the nomograph and rating curve methods, which are established by the robust constrained nonlinear equation solver and are suitable for small streams. The FEWF is evaluated using real-time data observed over 7-years period from the Closed-circuit Television-based Automatic Discharge Measurement Technology (CADMT), and the results show that the FEWF is effective in forecasting discharge and depth during flood events. The use of CADMT technology for real-time data can develop an accurate and reliable FEWF, which can help mitigate the impacts of extreme rainfall events and reduce the number of flood-related casualties in small stream basins.

This study investigated whether reciprocal collaborative pedagogy significantly impacts Indonesian electrical engineering polytechnic students in reducing reading anxiety and improving self-efficacy in ESP reading comprehension skills. Fifty Polytechnic students were equally assigned to two groups. Control groups learned in the traditional reciprocal teaching method individually. Experimental group engaged in reciprocal collaborative pedagogy. Each group received a 6-week reading strategy training. E-learning platforms were used in this study as a complementary tool to distribute ESP reading materials, announcements, and the experiment details being taught. The quantitative and qualitative results demonstrated that the tasks in reciprocal collaborative pedagogy positively affects Indonesian electrical engineering polytechnic students' learning experience and outcomes. This pedagogy promotes a productive learning environment through peer interaction, active engagement, and peer group discussions of the whole learning activities, reducing feelings of anxiety and building confidence in ESP-specialized text.

The Schwarzschild metric describes a non-rotating and charge-free celestial body, and it results in things stopping at the event horizon of a black hole and spending infinite time across the event horizon by the observer far away from the black hole. The analysis of the particle’s behavior at the event horizon tells us that this solution predicts an un-expanded black hole which violates the astronomical observations and our knowledge about the black hole. Although some alternative metrics have been proposed, the singularity problem is still unsolved. In this research, the degenerate Fermi electron gas is used to reveal that the Fermi electron gas cannot shrink to a point no matter how large energy it obtains, so the singularity exists at the center very unreasonably. In order to avoid these problems, a finite-size nucleus of the black hole is proposed and reasonably explained by the behaviors of the Fermi electron gas and the Fermi neutron gas there. On the other hand, the Kerr-Newman metric is the one describing the rotating and charged black hole and the equation of the light velocity at each space point can be obtained. It tells us that there are two real and non-imaginary solutions for the radial speed of light at the position larger than the Schwarzschild radius.

Despite well-documented health benefits of probiotics Saccharomyces, its application in oral health has not been comprehensively assessed. Dental caries is a transmissible disease initiated by acid production of cariogenic bacteria and yeast, such as Streptococcus mutans and Candida albicans, on tooth enamel and followed by subsequent enamel demineralization. Here, we investigated the effect of two Saccharomyces strains (Saccharomyces boulardii, Saccharomyces cerevisiae) on S. mutans-C. albicans cross-kingdom interactions using a cariogenic planktonic model. Viable cells, pH changes and gene expression were measured. S. cerevisiae and S. boulardii inhibited the growth of C. albicans either in dual-, or multi-species conditions. Saccharomyces also inhibited C. albicans hyphal formation. Furthermore, Saccharomyces reduced the acidity of the culture medium which usually plummeted below pH 5 when S. mutans and C. albicans were present in the model. The presence of Saccharomyces maintained the culture medium above 6 even after overnight incubation, demonstrating a protective potential against dental enamel demineralization. S. boulardii significantly downregulated S. mutans atpD and eno genes expression. Overall, our results shed light on a new promising candidate, Saccharomyces, for dental caries prevention due to its potential to create a less cariogenic environment marked by a neutral pH and reduced growth of C. albicans.

Numerous dynamic and complicated processes characterize development from the oocyte to the embryo. However, given the importance of functional transcriptome profiles, long non-coding RNAs, single-nucleotide polymorphisms, and alternative splicing during embryonic development, the effect that these features have on the blastomeres of 2-, 4-, 8-, 16-cell, and morula stages of development have not been studied. Here, we conducted a scRNA-seq survey of cells from sheep from the oocyte to the blastocyst developmental stages. We then carried out experiments to identify and functionally analyze the transcriptome profiles, long non-coding RNAs, single-nucleotide polymorphisms (SNPs), and alternative splicing (AS). We founded that between the oocyte and zygote groups significantly down-regulated genes and the second-largest change in gene expression occurred between the 8- and 16-cell stages. We used various methods to construct a profile to characterize cellular and molecular features and systematically analyze the related GO and KEGG profile of cells of all stages from the oocyte to the blastocyst. This large-scale, single-cell atlas provides key cellular information and will likely assist clinical studies in improving preimplantation genetic diagnosis.

Agriculture is an industry that heavily relies on the environment. The increasing frequency of ex-treme disasters attributable to climate change has adversely affected agricultural land and dis-rupted the stability of the supply of agricultural products. Therefore, we implemented a research program focused on current strategies for adapting to agricultural meteorological disasters. The primary goal was to actively promote disaster prevention information and techniques through information platforms and applications and to provide refined forecasting and an early warning system to enhance preparedness for and recovery from agricultural disasters. This initiative can transform passive mitigation into dynamic action by disseminating crucial information to farmers. We integrated meteorological data and crop characteristics to develop disaster prevention strate-gies for the predisaster, during-disaster, and postdisaster stages to empower farmers to implement autonomous disaster prevention, ensuring their profitability and minimizing the impact of disas-ters. This paper presents an agricultural disaster prevention system involving cross-disciplinary collaboration to establish an early warning system for crop disasters. However, the effectiveness of the early warning system relies on the availability of complete meteorological and crop infor-mation, necessitating high-density agricultural meteorological stations, refined weather forecast services, historical crop damage data, and ongoing research and development on disaster preven-tion technology. In the system, a diversified social media interface is used to provide local farmers with weather forecast information. When impending disasters are identified, the platform acti-vates disaster prevention measures to reduce agricultural losses. This article paper introduces Taiwan’s agricultural disaster prevention system as a complete disaster prevention strategy.

This research delves into the realm of predictive modeling within artificial intelligence (AI) and introduces an innovative ensemble approach designed to enhance prognostic precision. The proposed methodology, characterized by its ebullient nature, leverages the collective wisdom of diverse predictive models, synthesizing a comprehensive and robust framework. The pursuit of parsimony are paramount, underscoring the need for efficient model architectures that balance predictive acuracy and computational efficiency. Our study meticulously explores the amalgamation of diverse algorithms, encapsulating the intrinsic complexity of real-world phenomena. We navigate the intricate landscape of feature selection, algorithmic diversity, and model combination, fostering a holistic understanding of the prognostic process. The ebullient ensemble emerges as a dynamic solution, harnessing the synergy of constituent models while mitigating the risk of overfitting. To validate the efficacy of our approach, extensive experiments are conducted on diverse datasets, spanning domains such as healthcare, finance, and natural language processing. Comparative analyses demonstrate the superior predictive performance of our ensemble model in comparison to individual algorithms and traditional ensemble methods. Additionally, we delve into interpretability aspects, elucidating the underlying mechanisms that contribute to the model's prognostic prowess. Our research advances the frontier of predictive modeling in AI, offering a nuanced and sophisticated paradigm for prognostication. The ebullient ensemble approach stands as a testament to the synergy achievable through the amalgamation of diverse predictive models, providing a pragmatic and parsimonious avenue for enhanced prognostic acuracy in artificial intelligence applications.

This article focuses on artificial intelligence in educational technology, starting with an introduction to educational technology, an interdisciplinary field of study that covers the design, development, utilization, and evaluation of technology and digital tools in educational Settings. A detailed description of its definition in an academic context - a multidisciplinary field of computer science and cognitive science that deals with the development of computational systems that exhibit intelligent behaviour, describing its areas of coverage and scope of application. It then introduces the benefits of AI in education technology, specifically addressing personalized learning, adaptive learning systems, automated scoring and feedback, virtual tutors and chatbots, data analytics, as well as content recommendations and natural language processing, accessibility and inclusion. Then it introduces the main concepts of AI personalized learning: AI personalized learning uses the power of artificial intelligence to meet the unique needs and preferences of individual learners, as well as its key principles and main characteristics. Adaptive learning systems harness the power of artificial intelligence and data analytics to tailor the learning experience to each student's needs and abilities, as well as its core principles and strengths. It also introduces the main operating principles of automated grading and feedback: it uses artificial intelligence and computer algorithms to evaluate and evaluate student assignments, tests and exams without the direct involvement of human graders, and its associated benefits. Secondly, the main concepts of virtual tutor are introduced: Virtual tutor is a computer-based system that uses artificial intelligence and machine learning algorithms to provide students with personalized and interactive educational support and its key characteristics and main advantages, and then the nature and benefits of chatbots and help in the field of education. The final conclusion summarizes the benefits and future challenges of integrating AI into educational technology.

In this paper, the filtering method of biomedical image denoising is described comprehensively. Firstly, it introduces the biomedical image denoising, describes the relationship between biomedical image denoising and medical care, introduces the filtering methods, the filtering methods of biomedical image denoising, the challenges encountered by the current filtering methods, and other application fields of filtering methods. Firstly, the background of biomedical image denoising is introduced. Biomedical image denoising is a challenge. Different imaging modes have different noise characteristics, and noise levels can vary greatly depending on the specific application. Secondly, it describes that biomedical image denoising plays an important role in medical care, and the biomedical image directly affects the patient's diagnosis, treatment plan and the overall quality of medical care service. Then the filtering method is introduced in detail, describing the core concepts and related features of linear filtering, nonlinear filtering and frequency domain filtering, and then focusing on the adaptive filtering method, describing the characteristics, conditions of use, common algorithms and advantages of adaptive filtering method. Then the filter methods of biomedical image denoising are introduced, and the core concepts of Gaussian filter, median filter, total variation denoising and Wiener filter are introduced respectively. Then, the challenges encountered by filtering methods are described, such as the accurate selection of filters, the balance between noise reduction and image detail preservation are introduced. Finally, the application of filtering method in other fields is mentioned, such as audio processing, speech recognition and so on. In summary, this paper comprehensively expounds the denoising and filtering methods of biomedical images, the filtering methods of medical image denoising, the relationship between medical image denoising and medical care, and the challenges encountered by filtering methods.

Misinformation research has grown to become a critical topic in all disciplines. Since the expanding of online media, misinformation has been spreading rapidly across the globe through social media and other information systems. Paralleling the rise of academic interest in misinformation, is the emergence of online education scholarship. Interest in the online educational implications of misinformation and its impact attracts an increase in scholarship on misinformation. This article presents the results of a review of 1172 publications with “Misinformation” across disciplines and a subset of 174 misinformation literature in online education that were published between 2009 and 2021. This review answers three questions: (1) What is the overall distribution of publication activity with "misinformation" publications? (2) What methodologies have scholars used to investigate misinformation involving online education? (3) What have scholars reported about the results of studies involving misinformation in online education? The review reveals that various methodologies were used in literature focusing on misinformation online education with leading numbers of content analysis and quantitative studies. This systematic review is particularly relevant to those online educators in various disciplines who are interested in learning what scholars from their own academic disciplines are writing about misinformation.

Plants do need a fixed proportion of carbon (C), nitrogen (N) and phosphorus (P) elements to maintain normal metabolic activities. The P fertilizers are widely used to supplement nutrients in subtropical plantations. Stoichiometric homeostasis reflects the strategy of plants to cope with various environments (including P fertilizer supply rate). It is thus of great significance to understand C:N:P stoichiometry in the plant-litter-soil system under P addition and stoichiometric homeostasis of plant tissues for fertilization management of slash pine (Pinus elliottii Engelm) plantations. We measured the C, N and P contents in root, branch, needle, litter and soil in slash pine plantations fertilized with four treatments - P1 (25 kg P ha−1 yr−1), P2 (50 kg P ha−1 yr−1), P3 (100 kg P ha−1 yr−1), and a control (CK) in subtropical China and calculated stoichiometric homeostasis of plant tissues. Results showed that P addition increased the capacity of needle to obtain C, N and P elements and altered the C:N:P stoichiometry of plant tissues, as well promoted the accumulation of C and P elements in soil, but had no significant effect on soil stoichiometry. The nutrient contents of needle and branch were higher than those of root and litter, indicating that slash pine was more inclined to allocate nutrient to the aboveground tissues. The stoichiometric homeostasis of C, N and P among plant tissues was ranked as follows: root > branch > needle, and homeostasis of nutrient elements in the needle was C > N > P. This indicated that the C, N and P stoichiometric homeostasis was various among plant tissues and elements types under P addition. These findings suggest P addition would alleviate the P limitation of slash pine growth in subtropical regions. In the future, long-term observation experiments should be conducted and the trade-off between P addition rates and economic and ecological benefits should be considered.

This study examines the unique circumstances surrounding state-owned equity participation in non-state-controlled enterprises in China. Specifically, this study examines the impact of state-owned equity participation on the environmental, social, and governance (ESG) performance of non-state-controlled enterprises. Focusing on A-share listed firms on the Shanghai and Shenzhen Stock Exchanges and using data from 2013 to 2021, empirical testing shows that state-owned equity participation can significantly improve the ESG performance of non-state-controlled enterprises, with this conclusion remaining reliable after a series of robustness tests. Top management incentives is a mediating mechanism for state-owned equity participation in enhancing ESG performance. This study also finds that when state-owned equity participates in large enterprises or companies with a high degree of digital transformation, the effect on ESG performance is greater than that of small to medium-sized enterprises (SMEs) or enterprises with a low level of digital transformation. The findings of this study add to the current body of the existing field of research on the factors influencing corporate ESG performance and the impact of state-owned equity on corporate non-financial performance.

The cytoskeleton is a master organizer of cell cortex, organelles positioning and membrane trafficking. Therefore, playing a decisive role in establishment of apico-basal polarity. Septins are critical cytoskeleton components which function in apico-basal polarity remain weakly investigated. Here, using 3D culture system, we demonstrate that septin9 localizes at basolateral membrane (BM). Its depletion induces an inverted polarity phenotype, decreasing -catenin at BM and increasing the expression of the transforming growth factor (TGF) and the epithelial-to-mesenchymal transition (EMT) markers. Similar effects were observed upon deleting its two polybasic domains, and the mutant become cytoplasmic and apical. The cysts with an inverted polarity phenotype display an invasive phenotype, with src and cortactin accumulating at the peripheric membrane. Inhibition of TGF-receptor and RhoA rescues the polarized phenotype. Although the cysts from overexpressed-septin 9, overgrowth and present a filled lumen. Both phenotypes correspond to tumor features. This suggests that septin 9 expression and assembly through the two PB domains are essential for establishing and maintaining apico-basal polarity against tumor development through a mechanism involving TGF-dependent EMT and RhoA activity.

In this research, the other reasonable explanations for the cosmic microwave background radiation is revealed. Due to the microwave resolution, it very roughly shows the image of galaxies in the universe. Moreover, the intensity measurement on each pixel of the image is the sum of the incident microwaves from different directions, so the microwave image cannot represent the microwave sources clearly far away from the Earth. Hence, we propose a simulation after removing several strongest microwave sources, the remaining microwave radiation sources can establish a very uniform intensity distribution over a range of several ten light years. On the other hand, Sloan Digital Sky Survey reveals 200 million galaxies in the universe and, in fact, only to eliminate the contributions of all galaxies from the microwave image is impossible. The way to further obtain the fine-scale structure by only removing the few strongest microwave sources as the foreground effect will keep the other contributions from all the rest galaxies and stars. Therefore, the Cosmic Microwave Background cannot be uniquely explained the radiation which was left after the initial formation of the universe. Moreover, it is the mainly residual radiation from the un-calculated galaxies and inaccurate estimation of the microwave source strength.

Plant-microbe interactions are essential for ecosystem health and agricultural productivity. Metabolomics has revolutionized our understanding of these interactions by providing powerful methods to decipher the complex chemical signals involved. This review highlights the various metabolomics techniques used to study plant-microbe interactions, such as mass spectrometry, nuclear magnetic resonance spectroscopy, and advanced imaging technologies. We also discuss the role of contemporary bioinformatics tools, extensive databases, and the increasing influence of artificial intelligence and machine learning in the analysis of metabolomics data. Integrating metabolomics with other omics fields, including transcriptomics, proteomics, and metagenomics, allows for a comprehensive understanding of the molecular mechanisms underlying plant-microbe interactions. The review emphasizes the significance of fluxomics in elucidating the dynamic nature of metabolic networks. While there are challenges in data analysis, integration, and interpretation, metabolomics has profoundly expanded our knowledge of the role metabolites play in shaping plant-microbe interactions. As metabolomics technologies advance and integrate further with other omics approaches, we anticipate groundbreaking discoveries that will provide deeper insights into these complex interactions, ultimately leading to innovative strategies for sustainable agriculture and biotechnology.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Multi-view stereo (MVS) employs multi-point photography for image point positioning and three-dimensional reconstruction technology. Recently, this technology has been introduced into the monitoring of road slopes due to advances in photography and computing technology. In general, the various phases of post-image processing procedures are applied to various photographic data. In this study a novel, automated image-monitoring system is proposed to improve the ability of automatic processing. First, an Internet of things (IoT)-based digital photography system architecture was constructed to provide automatic control of camera photography and real-time transmission of image data. In addition, a visual SfM-MVS 3D reconstruction technique was used to develop related software and hardware interfaces based on the built-in Python computing framework of Photoscan Pro. The software integrates fully automatic photography, image transmission, monitoring of data processing and product release programs. The experimental results show that the system architecture can be applied to fully automatic three-dimensional monitoring of road slopes.

Global warming poses a threat to plant survival, impacting growth and agricultural yield. Protein turnover, a critical regulatory mechanism balancing protein synthesis and degradation, is crucial for cellular response to environmental changes. We investigated the effects of elevated temperature on proteome dynamics in Arabidopsis thaliana seedlings using 15N-stable isotope labeling and ul-tra-performance liquid chromatography-high resolution mass spectrometry, coupled with the ProteinTurnover algorithm. Analyzing different cellular fractions from plants grown under 22°C and 30°C growth conditions, we found significant changes in the turnover rates of 571 proteins, with a median 1.4-fold increase, indicating accelerated protein dynamics under thermal stress. Notably, soluble root fraction proteins exhibited smaller turnover changes, suggesting tissue-specific adap-tations. Significant turnover alterations occurred with redox signaling, stress response, protein folding, secondary metabolism, and photorespiration, indicating complex responses enhancing plant thermal resilience. Conversely, proteins involved in carbohydrate metabolism and mito-chondrial ATP synthesis showed minimal changes, highlighting their stability. This analysis high-lights the intricate balance between proteome stability and adaptability, advancing our under-standing of plant responses to heat stress and supporting the development of improved thermo-tolerant crops.

A series of Zn-modified Hβ (Zn/Hβ) catalysts were prepared by using the different zinc precursors such as ZnSO4·7H2O, ZnCl2, C4H6O4Zn·2H2O and Zn(NO3)2·6H2O, and their catalytic performance in the ethanol conversion to propylene reaction was evaluated. Results indicate the amount and strength distribution of acid sites of the Zn/Hβ catalysts were easily tuned by employing different type of zinc precursors. More importantly, when the Zn species were introduced to the Hβ, the propylene yield was significantly enhanced, whereas the yields of the byproducts such as ethylene and C2-C4 alkanes were remarkably suppressed. For the catalyst prepared by using the ZnCl2 precursor (Zn/Hβ-C), a higher propylene yield up to 43.4% was achieved as a result of the moderate amount and distribution of acid sites. The average coking rate of the used Zn/Hβ catalysts strongly depended on the amount of total acid sites, especially the strong acid sites, i.e., the higher the amount of total acid sites of the catalyst, the greater the average coking rate. For the catalyst prepared by using the ZnSO4·7H2O precursor, Zn/Hβ-S exhibited a better stability even after depositing more coke, which is due to the higher amount of strong acid sites.

Surface-enhanced Raman spectroscopy (SERS) is commonly used for super-selective analysis through nanostructured silver layers in the environment, food quality, biomedicine, and materials science. To fabricate a high-sensitivity but more accessible device of SERS, dc magnetron sputtering technology was used to realize high sensitivity, low cost, stable deposition rate, and rapid mass production. This study investigated various thicknesses of a silver film ranging from 3.0 to 12.1 nm by field-emission-scanning-electron microscope, X-ray diffraction, and X-ray photoelectron spectroscopy. In the rhodamine 6G (R6G) testing irradiated by a He-Ne laser beam, the analytical enhancement factor (AEF) of 9.35x108, the limit of detection (LOD) of 10-8 M, and the relative standard deviation (RSD) of 1.61% were better than other SERS substrates fabricated by the same dc sputtering process because the results show that the 6 nm thickness silver layer has the highest sensitivity, stability, and lifetime. The paraquat and acetylcholine analytes were further investigated and high sensitivity was also achievable. The proposed SERS samples were evaluated and stored in a low humidity environment for up to forty weeks, and no spectrum attenuation could be detected. Soon, the proposed technology to fabricate high sensitivity, repeatability, and robust SERS substrate will be an optimized process technology in multiple applications.

Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) are fast becoming the most common chronic liver disease and are often preventable with healthy dietary habits and weight management. Sugar-sweetened beverage (SSB) consumption is associated with obesity and NAFLD. However, the impact of different types of SSB, including artificially sweetened beverages (ASB), is not clear after controlling for total sugar intake and total caloric intake. In this study, we examined the association between different SSB consumption and the risk of NAFLD and NASH. A total of 3,739 US adults aged ≥20 years old who had completed 24-hour dietary recall interviews and measurements, including dietary, SSB, smoking, physical activity, and liver stiffness measurement, using the National Health and Nutrition Examination Survey 2017-2020 surveys were included in this study. Chi-square tests, t-tests, and weighted logistic regression models were utilized for analyses. The prevalence of NASH was 20.5%, and NAFLD (defined without NASH) was 32.7% of .S.U.S. adults. We observed a higher prevalence of NASH/NAFLD in men, Mexican-Americans, sugar intake from SSB, light-moderate alcohol use, individuals with lower physical activity levels, higher energy intake, obesity, and medical comorbidities. Heavy sugar consumption through SSB was significantly associated with NAFLD (aOR=1.60, 95% CI=1.05-2.45). In addition, intake of ASB only (compared to non-SSB category) was significantly associated with NAFLD (aOR=1.78, 95% CI=1.04-3.05), after adjusting for demographic, risk behaviors, and body mass index. Higher sugar intake from SSB and exclusive ASB intake are both associated with the risk of NAFLD.

Large-scale volumetric fracturing is generally used during shale gas development. The return rate of fracturing fluid is low, and a large amount of slickwater will be retained in the reservoir. The adsorption and desorption of partially hydrolyzed polyacrylamide (HPAM), an additive commonly used in slickwater, on the surface of shale was studied using Longmaxi Shale from the Sichuan Basin. The experimental results showed that the mass ratio of the HPAM solution to shale reached saturation adsorption at 20:1 when the concentration of HPAM solution was 1000 mg/L and 25:1 when the concentration of HPAM solution was 500 mg/L. The mass ratio of the HPAM solution to shale was fixed at 25:1, and the adsorption equilibrium was reached at a HPAM concentration of 1000 mg/L when the aqueous solution temperature was 30°C and 800 mg/L when the aqueous solution temperature was 60°C. The Langmuir adsorption model yielded a better fit than the Freundlich adsorption model. The adsorption equilibrium time at 30°C was at 60 min for a HPAM concentration of 500 mg/L, while for a concentration of 1000 mg/L, it was at 90 min. The adsorption equilibrium time at 60°C was 40 min for a HPAM concentration of 500 mg/L, whereas it was 60 min for a HPAM concentration at 1000 mg/L. The pseudo-second order kinetics model yielded better fits than the pseudo-first order kinetics model. The adsorption of HPAM on shale was strong, and the adsorbed HPAM resembled cobwebs adhering to the shale surface. HPAM on the surface of shale after adsorption could resist the desorption capacity of water. However, when the amount of adsorbed HPAM on shale increased significantly, the amount of residual HPAM on the surface of the shale decreased rapidly during desorption in deionized water. The desorption of HPAM on the shale surface followed a modified desorption model. The higher the concentration of HPAM adsorbed on the shale surface was, the easier it was to desorb, the easier it was to be removed from the shale.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Murine herpesvirus-68 (MHV-68) productively infects the mouse lungs, exhibiting a complex pathology characteristic of both acute viral infections and chronic respiratory diseases. We sought to discover proteins differentially expressed in bronchoalveolar lavage (BAL) from mice infected with MHV-68. Mice were infected intranasally with MHV-68. After 9 days, as the lytic phase of infection resolved, differential BAL proteins were identified by 2D electrophoresis and mass spectrometry. Of 23 unique proteins, acute phase proteins, vitamin A transport, and oxidative stress response factors Pdx6 and EC-SOD (Sod3) were enriched. Correspondingly, iNOS2 was induced in lung tissue by 7 days post infection. Oxidative stress was partly a direct result of MHV-68 infection, as reactive oxygen species (ROS) were induced in cultured murine NIH3T3 fibroblasts and human lung A549 cells infected with MHV-68. Finally, mice were infected with a recombinant MHV-68 co-expressing inflammatory cytokine murine interleukin 6 (IL6) showed exacerbated oxidative stress and soluble type I collagen characteristic of tissue recovery. Thus, oxidative stress appears to be a salient feature of MHV-68 pathogenesis, in part caused by lytic replication of virus and IL6. Proteins and small molecules in lung oxidative stress networks therefore may provide new therapeutic targets to ameliorate respiratory virus infections.

In this tutorial review, we compare and contrast the chemical mechanisms of electrophile/oxidant sensing, and the molecular mechanisms of signal propagation. We critically analyze biological systems in which these different pathways are believed to be manifest and what the data really mean. Finally, we discuss applications of this knowledge to disease treatment and drug development.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This survey of research literature is an overview of the current state of science addressing DSM-5 diagnostic criteria as it relates to identifying Autism Spectrum Disorder (ASD) in young children. Selected sources are of high quality and have been published since 2020 in peer-reviewed journals relevant to children’s health. The narrative is organized from the earliest to the most recent publications and is divided into sections around categories and themes that highlight the main arguments, findings, and controversies identified by researchers. There are indications in the literature that while ASD can be identified and differentiated from other developmental disorders in young children, doing so requires that clinicians who have relied on the DSM-5 should also use multiple measures, including other formalized screening tools as assessments that gather observational input from parents and caregivers, as well as findings from physical examinations, laboratory investigations, and magnetic resonance imagining (MRI). This high level of corroboration points to an emerging diagnosis paradigm through which transdiagnostic approaches to early diagnosis and intervention may exist.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Temper embrittlement is a major challenge encountered during the heat treatment of high-performance steels for large forgings. This study investigates the microstructural evolution and mechanical properties of Cr-Ni-Mo-V thick-walled steel, designed for new large forgings with a tensile strength of 1500 MPa, under different tempering cooling rates. Optical microscopy (OM), scanning electron microscopy (SEM), and electron backscatter diffraction (EBSD) were employed to analyze the microstructural features. The results demonstrate that the embrittlement occurring during air cooling after tempering is attributed to the concentration of impurities near Fe3C at the grain boundaries. The low-temperature impact toughness at -40°C after water quenching reaches 29 J due to the accelerated cooling rate during tempering, which slows down the diffusion of impurity elements towards the grain boundaries, resulting in reduced concentration and dislocation density, and increased stability of the grain boundaries, thereby enhancing toughness. the bainite content decreases and the interface between martensite and bainite undergoes changes after water quenching during tempering. These alterations influence the crack propagation direction within the two-phase microstructure, further modifying the toughness. These findings contribute to the understanding of temper embrittlement and provide valuable guidance for optimizing heat treatment processes to enhance the performance of high-performance steels in large forgings.

A novel indole, microindolinone A (1), was isolated from a deep-sea-derived actinomycete Microbacterium sp. MCCC 1A11207, together with 18 known compounds (2–19). By detailed analysis of the ¹H, ¹³C, HSQC, COSY, HMBC, HRESIMS, and CD data, the absolute configuration of 1 was elucidated as 5R-hydroxy-4,5,6,7-tetrahydroindole-4-one. Noteworthily, 1 is the second example of a saturated indole isolated from nature.

Proteases or peptidases are hydrolases that catalyze the breakdown of polypeptide chains into smaller peptide subunits. Proteases exist in all life forms, including archaea, bacteria, protozoa, insects, animals, and plants, due to their vital functions in cellular processing and regulation. There are several classes of proteases in the MEROPS database based on their catalytic mecha-nisms. This review focuses on the post-proline cleaving enzymes (PPCEs), especially the prolyl endoprotease/oligopeptidase (PEP/POP). To date, most PPCEs studied are of microbial and ani-mal origins. Recently, there are reports of new plant PPCEs. The most common PEP/POP are members of the S9 family that comprise two conserved domains. The substrate-limiting β-propeller domain prevents unwanted digestion, while the α/β hydrolase catalyzes reaction at the carboxyl-terminal of proline residues. PPCEs have diverse applications, are widely used in the beer brewing industry, and have potential as therapeutic agents for Alzheimer’s disease and celiac disease by targeting proline-rich substrates. Protein engineering via mutagenesis has been performed to improve heat resistance, pepsin-resistant capability, specificity, and protein turno-ver of PPCEs for pharmacological applications. This is the first comprehensive review to cover the biotechnological applications of PPCEs and discuss the unique prolyl cleaving activity of dif-ferent enzymes based on the recent structure-function studies from diverse taxa.

The pressing threat of global warming poses significant risks to plant survival, adversely affecting their growth and agricultural productivity. It is crucial to understand how plants react to heat stress at the molecular level to develop crops that can withstand higher temperatures. In our study, we investigated the proteome dynamics of *Arabidopsis thaliana* seedlings under moderate heat stress conditions (30°C) using a combination of 15N-stable isotope labeling and the ProteinTurnover algorithm. This approach allowed us to closely examine the proteomic changes across different cellular compartments. Our findings revealed significant changes in the turnover rates of 571 proteins, with an average increase of 1.4-fold, indicating enhanced protein dynamics under heat stress. Notably, root soluble proteins showed more subtle changes, suggesting tissue-specific responses. We also detected significant turnover variations in proteins involved in redox signaling, stress response, and metabolism, highlighting the complex nature of these adaptive mechanisms. In contrast, proteins related to carbohydrate metabolism and mitochondrial ATP synthesis showed little change, underscoring their stability. This detailed analysis illuminates the proteomic adaptations of *Arabidopsis* seedlings to moderate heat stress, enhancing our understanding of plant thermal resilience and supporting efforts to develop thermotolerant crops.

Over the past few decades, phototherapy, encompassing the utilization of both natural and artificial light, has emerged as a dependable and non-invasive strategy for addressing a diverse range of illnesses, diseases, and infections. This therapeutic approach, primarily known for its efficacy in treating skin infections such as herpes and acne lesions, involves the synergistic use of specific light wavelengths and photosensitizers like methylene blue. Photodynamic therapy, as it is termed, relies on the generation of antimicrobial reactive oxygen species (ROS) through the interaction between light and externally applied photosensitizers. Recent research, however, has highlighted the intrinsic antimicrobial properties of light itself, marking a paradigm shift in focus from exogenous agents to the inherent photosensitivity of molecules found naturally within pathogens. Chemical analyses have identified specific organic molecular structures and systems, including porphyrins and conjugated C=C bonds, as pivotal components in molecular photosensitivity. Given the prevalence of these systems in organic life forms, there is an urgent need to investigate the potential impact of phototherapy on individual molecules expressed within pathogens and discern their contributions to the antimicrobial effects of light. This review delves into the recently unveiled key molecular targets of phototherapy, offering insights into their potential downstream implications and therapeutic applications. By shedding light on these fundamental molecular mechanisms, we aim to advance our understanding of phototherapy's broader therapeutic potential and contribute to the development of innovative treatments for a wide array of microbial infections and diseases.

Design guidelines and the Design Review Panel (DRP) are crucial components in ensuring consistent and high-quality design within masterplan sites. This study focuses on New Zealand, examining the challenges faced by industry partners in adapting to masterplanned design guidelines. The case study centers on Hobsonville Point, the largest Government lead masterplan community in New Zealand, which promotes sustainable and higher-density living—an uncommon concept in the country. We conducted interviews with 18 key stakeholders involved in the development of Hobsonville Point. The results show that the DRP provides flexible judgments and insightful information that better accommodates individual development characteristics than the strict numerical standards specified in design guidelines. This study underscores the importance of DRP in producing good design outcomes, especially when they are involved at the very beginning of the design process. Additionally, we took note of stakeholder concerns about DRP members' expertise and the possible effects of high turnover rates on the design process. To strive for continual improvement, future empirical studies on the DRP process are encouraged to enhance proficiency and dependability. Design guidance should be prioritised to ensure climate-related design is implemented to promote sustainable urban development.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

To determine the fracture rate of ceramic crowns and causes of ceramic crown failure, this study used keywords—namely “endocrown,” “veneered fixed dental prosthesis,” “monolithic lithium disilicate (LS2),” and “all-ceramic single crown”—to search for articles published in English from 2005 to 2023 in the PubMed electronic database. Rather than using the Boolean logic algorithm between MESH terms and keywords, we accurately calculated the numbers of final clinically tracked cases with crown fractures from the contents of articles. The titles and abstracts of many related articles focused on implant or abutment fracture, while crown fracture was investigated and mentioned only in the main texts of the articles. Our studies included those crowns as well as having more complete data collection. Our search yielded 228, 93, 404, and 358 articles for the keywords “endocrown,” “veneered fixed dental prosthesis,” “monolithic lithium disilicate (LS2),” and “all-ceramic single crown,” respectively. We used the Newcastle–Ottawa Scale (NOS) to assess article quality, and our inclusion criteria were randomized controlled trials (RCT) and cohort study articles involving more than 3 years of follow-up and more than 20 cases. After reviewing, 16 high-quality articles were selected for analysis. The 4.4% crown fracture rate recommended on the basis of most clinical results was achieved in only 6 of the 16 articles. In these 6 articles, the researchers concluded the following reasons that may cause the crown fractures: the thickness of the veneer ceramic material; the connector dimensions; pontic span of the fixed prosthesis; the type of cement; the treatment of the ceramic surface before luting. Other articles inferred that the computer-aided design libraries that were insufficient for the creation of appropriate anatomically supported frameworks for prostheses with ceramic veneers; the thermal expansion coefficient and fracture toughness of the framework material did not match those of the veneer ceramic, resulting in an insufficient area supporting the ceramic veneer then leads to premature crown failure after a long period chewing. The future prospective for material developing could focus on solving those problems and have better clinical results.

Since the 21st century, China's urbanization process has been rapid development, the concept and function of urban public space in the city has been gradually paid attention to. In order to guarantee life and water, most urban construction relies on rivers, and Bridges are the most important way to communicate between urban areas. The main functional part of the bridge is the span structure, that is, the bearing structure of the bridge, and the lower part of the "gray" space formed by the bridge structure. Considering the social level, with the economic growth and urbanization development, people have brought a better living environment and quality of life, and also improved the requirements for urban public environment. In the increasingly tense urban space, how to use and transform the space under the bridge is a problem that needs to be considered and solved. In view of this problem, in this study, we try to solve the micro-transformation of space under Bridges in cities through public art from the perspective of "regional culture" and "art for all". This paper analyzes the micro-transformation of space art under Bridges in two large cities of Shanghai and Foshan, namely, the space under Bridges under Songhong Road in Shanghai, the space under Bridges under Central Of Suzhou River and the space under Bridges under Pingsheng Bridge in Foshan. This paper discusses the cultural intervention of "regional culture" in the micro-transformation of the space under the bridge, and the influence and effect of "art for all" on the public art space under the bridge after the transformation to the community and the public.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Urban planning and transportation policies are vital to creating sustainable and liveable cities. Transit-orientated development (TOD) has emerged as a prominent approach, emphasising the establishment of neighbourhoods with convenient access to public transportation and promoting car-free lifestyles. TOD initiatives aim to improve public transit efficiency, reduce dependence on private vehicles, and encourage walkability and connectivity within communities. By prioritising TOD, cities can effectively address transportation challenges, alleviate congestion, mitigate carbon emissions, and improve residents' overall quality of life. This research paper investigates the connection between proximity to transit stations and local living habits. Specifically, it examines the human mobility of residents living within a 15-minute walk distance of transit stations in Auckland, New Zealand, a car-dependent city striving to transition into a sustainable TOD model. The objective is to determine whether people living near transit stations are more inclined to participate in local activities and exhibit a higher proportion of trips within a radius of 15 minutes. The results illustrate that approximately 54% of the residents show dominant local mobility patterns. However, only about 16 stations out of 34 show their local residents have prominent collective 'local' travel patterns. By understanding the connection between proximity to transit stations and local mobility patterns, urban planners and designers can make informed decisions to improve the built environment and optimise the land use mix. This research offers insights to support the creation of vibrant and people-centric urban environments, facilitating the development of sustainable and liveable cities.

BKW is a highly efficient Storage Function-type rainfall-runoff model that utilizes the steady-state storage (S) and outflow (Q) of a catchment at different rainfall intensities as the S-Q relation of the catchment. For the inundation nowcasting of urban areas under high-intensity, short-duration rainfall, a Storage Function-type model is a judicious choice. However, S-Q hysteresis exists in the catchment S-Q relation, and BKW is unable to exhibit hysteresis due to assuming that the S-Q relation of a catchment is a nonlinear relation. The S-Q hysteresis can influence the outflow estimation of BKW, reducing the model's accuracy. Through the evaluation of analytical solutions, we found that the change in rainfall intensity dominates the S-Q relation of a catchment. The S-Q relation during a rainfall event is a dynamic process rather than a monotonic nonlinear relation. By applying the dynamic S-Q relation in BKW, we improved BKW to become a highly efficient and accurate rainfall-runoff model for small urban catchments.

Image segmentation is the process of partitioning an image into multiple segments where the goal is to simplify the representation of the image and make the image more meaningful and easier to analyze. In particular, semantic segmentation is an approach of detecting the classes of objects, based on each pixel. In the past, most semantic segmentation models were for only one single style, such as urban street views, medical images, or even Manga. In this paper, we proposed a semantic segmentation model called Dual-Pyramid Wide Residual Network (DPWRN) to solve the segmentation for cross-style datasets, which is suitable for diverse segmentation applications. The DPWRN integrated the Pyramid of Kernel paralleled with Dilation (PKD) and Multi-Feature Fusion (MFF) to improve the accuracy of segmentation. To evaluate the generalization of the DPWRN and its superiority over most state-of-the-art models, three datasets with completely different styles are tested in the experiments. Finally, the DPWRN verified its generalization and also showed its superiority over most state-of-the-art models.

The mechanical engineering requires heat treatment after rough machining to reach the mechanical strength, but the heat treatment can induce workpiece deformation, so that the workpiece cannot be reworked. In this study, the plasma was integrated with a lathe, and the on line heat treatment was performed to achieve the mechanical strength and hardness, so as to reduce the machining process and handling. However, for on line heat treatment, it is important to study the machine and plasma parameters of the lathe and plasma, and the research method is used eventually to optimize the process, reduce the machining cost and machining error. The variable factors in surface on line real-time heat treatment are revolution, feed rate and current, the objective function is the hardness of mechanical properties. In the screening experiment, the interaction of factors was discussed using full factorial experiment. The Central Composite Design was combined with the Lack-of-Fit test for optimization experiment, the R2 coefficient was used to determine whether the regression model is appropriate. The optimum parameters were derived from the contour diagram and response surface diagram. The experimental results show that the significant factors include revolution, feed rate and current, the optimum parameters include revolution 168rpm, feed rate 0.068mm/rev and current 86A. The experimental results of optimum parameters show that the surface hardness is increased from 306HLD to 806HLD, the surface hardening effect is enhanced by 163%, so the on line real-time heat treatment equipment has a best hardening effect.

The study utilizes the energy-flux-vector method to analyze the heat transfer characteristics of natural convection in a wavy-wall porous square cavity with a partially-heated bottom surface. The effects of the modified Darcy number and modified Rayleigh number on the energy-flux-vector distribution and mean Nusselt number are examined. The results show that when a low modified Darcy number with any value of modified Rayleigh number is given, the recirculation regions are not formed in the energy-flux-vector distribution within the porous cavity. Therefore, a low mean Nusselt number is obtained. The recirculation regions do still not form and thus the mean Nusselt number has a low value when a low modified Darcy number with a high modified Rayleigh number is given. However, when the values of the modified Darcy number and modified Rayleigh number are high, the energy flux vectors generate recirculation regions and thus a high mean Nusselt number is obtained.

Confidence interval of is an interval corresponding to a specified confidence and including the true value. It can be used to describe the precision of a statistical quantity and quantify its uncertainty. Although the principle of maximum entropy (POME) has been used for a variety of applications in hydrology, the confidence intervals of the POME quantile estimators have not been available. In this study, the calculation formulas of asymptotic variances and confidence intervals of quantiles based on POME for Gamma, Pearson type 3 (P3) and Extreme value type 1 (EV1) distributions were derived. Monte Carlo Simulation experiments were performed to evaluate the performance of derived formulas for finite samples. Using four data sets for annual precipitation at the Weihe River basin in China, the derived formulas were applied for calculating the variances and confidence intervals of precipitation quantiles for different return periods and the results were compared with those of the methods of moments (MOM) and of maximum likelihood (ML) method. It is shown that POME yields the smallest standard errors and the narrowest confidence intervals of quantile estimators among the three methods, and can reduce the uncertainty of quantile estimators

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

Postoperative adhesive arachnoiditis is an inflammatory response of the spinal leptomeninges that occurs after surgery, resulting in scar formation in the avascular nature of the arachnoid layer. Clinical manifestations of this condition include pain, sensory deficits, motor dysfunction, reflex abnormalities, and bladder/bowel impairments. In MRI scans, the signs of postoperative adhesive arachnoiditis can vary, but some specific indicators can assist surgeons in locating the lesion and planning surgical interventions more accurately. In this report, we reported a 37-year-old man with postoperative adhesive arachnoiditis after two surgeries for Chiari I malformation, demonstrating that the gradually-forming the delta cord sign with sequential syringomyelia. During the intraoperative examination, we identified the presence of the delta cord sign, which was formed by an arachnoid scar that was tethering the dorsal spinal cord to the dura. This discovery allowed us to precisely pinpoint the location of the arachnoid scar, thereby providing valuable guidance to avoid any unnecessary exploration of innocent structures during the procedure. Other localization signs were also reviewed.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Among the plethora of financial management tools available, stock investments stand out as the most recognizable and widely accepted option. However, investors often make buying and selling decisions based on unverified information provided by stock analysts. Since the credibility of this information remains uncertain, it frequently results in investment losses. Ordinary investors relying solely on rumors often miss out on prime opportunities for buying and selling stocks. In the current volatile investment landscape, various investment strategies cater to different situations. If individuals can effectively identify opportunities within this complex environment and dynamically adapt suitable investment strategies at any given time, substantial returns can be achieved. The ability of investors to promptly detect shifts in the current stock market environment and make accurate decisions regarding stock selection, timing, and capital allocation strategies is of utmost importance. This study presents a dynamic framework for investment decision support, which utilizes evolutionary strategies to determine the optimal timing for key strategic tools such as stock selection, timing, and capital allocation. By leveraging historical data for training and testing, this approach aims to assist investors in adapting to the ever-changing stock market environment. If investors can successfully identify and implement an appropriate investment strategy to aid in making accurate decisions, it is possible to achieve significant excess returns.

A case-crossover study examined how PM_2.5 from Asian Dust Storms (ADS) affects the number of emergency room (ER) admissions for cardiovascular diseases (CVDs) and respiratory diseases (RDs). Our data indicated that PM_2.5 concentration from ADS was highly correlated with ER visits for CVDs and RDs. The odds ratios (OR) increased by 2.92 (95% CI: 1.22-5.08) and 1.86 (95% CI: 1.30-2.91) per increase 10 µg/m³ in PM_2.5 levels, for CVDs and RDs, respectively. A 10 µg/m³ increase in PM_2.5 from ADSs was significantly associated with increase in ER visits for CVDs among those 65 years of age and older (an increase of 2.77 in OR) and for females (an increase of 3.09 in OR). In contrast, PM_2.5 levels had a significant impact on RD ER visits among those under 65 years of age (OR=1.77). The risk of ER visits for CVDs increased on the day when the ADS occurred in Taiwan and the day after (lag 0 and lag 1); the corresponding risk increase for RDs only increased on the fifth day after the ADS (lag 5). In Taiwan’s late winter and spring, the severity of ER visits for CVDs and RDs increases. Environmental protection agencies should employ an early warning system for ADS to reduce high-risk groups’ exposure to PM_2.5.

The management of blunt abdominopelvic trauma with combined hemoperitoneum and pelvic fractures is challenging for trauma surgeons. Although angioembolization can achieve hemostasis in most visceral organ injuries and pelvic fractures after blunt abdominal trauma, it cannot effectively control hemorrhage in patients with blunt bowel mesenteric injury (BBMI). This study aimed to determine the risk factors associated with hemodynamically unstable patients with BBMI and to test the hypothesis that pelvic fracture is an independent risk factor for patients with unstable BBMI and concomitant pelvic fracture to guide the therapeutic sequence for difficult-to-manage patients. This retrospective study reviewed the data of hospitalized patients with trauma between 2009 and 2021 and included 158 adult patients with surgically proven BBMI. The patients were divided on the basis of the presence of a shock episode before emergency laparotomy. The shock group included 44.3% of all patients in the study (n = 70). Clinical injury severity and prognosis for patients in the shock group were poorer than those for patients in the non-shock group, and more invasive treatments and transfusions were performed for patients in the shock group than for those in the non-shock group. Pelvic fractures were more frequently associated in the shock group than in the non-shock group (21.4% vs. 5.7%; p = 0.003). In multivariate analysis, the presence of intracerebral hemorrhage (odds ratio [OR] = 10.87, 95% confidence intervals [CIs]: 1.70–69.75) and rib fracture (OR = 5.94, 95% CIs = 1.06–33.45) were identified as independent predictors of shock, whereas the effect of pelvic fracture did not achieve statistical significance (OR = 2.94, 95% CIs = 0.66–13.13) after adjusting for confounding factors. For patients with BBMI, outcomes need to be improved during early diagnosis and treatments should be expeditiously performed on the basis of the rapid identification of unstable hemodynamic status. In unstable patients with concomitant pelvic fractures, we support the current management algorithm that recommends performing laparotomy first.

Polluted rivers are a primary problem in Changhua County, Taiwan, due to rapid and massive developments in agriculture and industry. In this study, samples consisted of water influent from the Yangzi-Cuo River, Ci-Tong Jiao, Changhua County. Ecology technology, a combination of gravel contact oxidation and surface flow constructed wetlands, was employed to enhance the water quality. Ecology technology is a useful and ordinary process that focuses on original treatment of pollution through chemical, physical, and biological procedures based on the mediums of soil, plant, water, and microorganisms from pure environments. Moreover, this study aimed to minimize the river pollution index (RPI) of the Yangzi-Cuo River by using combinations of gravel contact oxidation and surface flow constructed wetlands. The inflow volume of the water samples in situ was found to be 1534–2261 cubic meters per day (CMD). The pollution in the water sample mostly involved suspended solid (SS), ammoniacal nitrogen (NH₃–N), total phosphorus (TP), total nitrogen (TN), and biochemical oxygen demand (BOD), and the values of the above indexes were found to be 10.0–26.7 mg/L, 0.9–14.0 mg/L, 1.2–14.1 mg/L, 11.1–18.2 mg/L, and 0.5–3.6 mg/L, respectively. Efficiencies of pollution elimination in SS, NH₃–N, TP, TN, and BOD were found to be 24.2–93.1%, 58.3–86.2%, 5.2–85.0%, 59.4–77.2%, and 46.3–76.4%, correspondingly, after purification treatment via ecology technology. Thus, ecology technology is a valid means of purification treatment for polluted rivers.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Porous tantalum (Ta) is a promising biomaterial and has been applied in orthopedics and dentistry for nearly two decades. The high porosity and interconnected pore structure of porous Ta promise fine bone ingrowth and new bone formation within the inner space, which further guarantee rapid osteointegration and bone-implant stability in long term. Porous Ta has high wettability and surface energy that can facilitate adherence, proliferation and mineralization of osteoblasts. Meanwhile, low elastic modulus and high friction coefficient of porous Ta can effectively avoid stress shield effect, minimize marginal bone loss and ensure primary stability. Accordingly, the satisfactory clinical application of porous Ta based implants or prostheses are mainly derived from its excellent biological and mechanical properties. With the advent of additive manufacturing, personalized porous Ta based implants or prostheses have shown their clinical value in the treatment of individual patient who need specially designed implant or prosthesis. In addition, many modification methods have been introduced to enhance the bioactivity and antibacterial property of porous Ta with promising in vitro and in vivo research results. In any case, choosing suitable patients is of great importance to guarantee surgical success after porous Ta insertion.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

A spinning gyroscope precesses about the vertical due to a torque acting upon the wheel. The torque is generated by the shift of moment of force by gravity and it points to the vertical instead of the tangential direction of precession. This intuition offers an alternative and straightforward view of precession dynamics in comparison with the literature. It also presumes a dynamic balance of momentum between circular motions of the wheel spin and precession. Accordingly, the gyroscopic dynamics is then applied to the study of galactic motion of the solar system in space and the Galactic mass is calculated with the inclusion of gyroscopic effect of the solar planets. Results indicate that the gyroscopic effect of Mercury orbiting around the Sun can increase the calculated Galactic mass by 23% in comparison with the result obtained by the classic approach.

This study proposes a new algorithm termed rain cell identification and tracking (RCIT) to identify and track rain cells from high resolution weather radar data. Previous algorithms have limitations when tracking non-consequent rain cells owing to their use of maximum correlation coefficient methods and their lack of an alternative way to handle the variation stages of rain cells during their life cycles. To address these deficiencies, various methods are implemented in the new algorithm. These include the particle image velocimetry (PIV) method for motion estimation and the rain cell matching rule to obtain the stage changes of rain cells. High resolution (5-min and 1-km) radar reflectivity data from three rainy days over the German federal state North Rhine Westphalia (NRW) are used to evaluate the proposed algorithm. The performance of the new algorithm is compared with a radar reflectivity map and verified by two object-oriented methods: structure–amplitude–location (SAL) and geometric index. The verification results suggest that the performance of the new algorithm is good. Application of the RCIT algorithm to the selected cases shows that the inner structure of rainfall events in the experimental region present extreme value distributions, with most rainfall events having a short duration with less intensity. The new algorithm can effectively capture the stage changes of rain cells during their life cycles. The proposed algorithm can serve as the basis for further hydro-meteorological applications such as spatial and temporal analysis of rainfall events and short-term flood forecasting.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

This paper reassesses the detrimental effect on fatigue performance due to thicker sections based on extensive fatigue strength test database, taken from research program worldwide over the past half of a century in offshore oil & gas and renewable industry. The data entries in the database have been evaluated to ensure its data integrity. Statistical analyses on these S-N data are performed with or without the thickness correction at different exposure level to corrosive environment, in order to re-evaluate the suitability of current standards in regard to the thickness effect. The study has concentrated on T-joint, transverse butt welded joint and tubular joint as these are the most commonly used joint types in the offshore wind industry. The analysis indicates general agreement of fatigue strength with the thickness effects in current standard for in air conditions but great conservatism for corrosive environment.

The concept of Design Fatigue Factors (DFFs) was introduced for providing desired level of safety in structural fatigue design, often associated with damage calculated from S-N curves. Calculation of fatigue damage from S-N curves can be affected by multiple factors, e.g. types of weld class, corrosion condition, loading conditions, stress concentration on different geometries etc. Each of them can be subject to different level of uncertainties. This study intends to recalibrate the DFFs from a detailed reliability analysis by investigating the probabilistic models derived from the database of S-N curves that has been most frequently used in offshore wind industry. The results of such study indicate that the DFFs can be reduced substantially for the corrosive environmental fatigue models from current standards to the same level of target reliability.

Trace amine-associated receptor 5 (TAAR5) is a G protein-coupled receptor that belongs to the TAARs family (TAAR1-TAAR9). TAAR5 is expressed in the olfactory epithelium and is responsible for sensing 3-methylamine (TMA). However, recent studies showed that TAAR5 is also expressed in the limbic brain regions and is involved in the regulation of emotional behaviour and adult neurogenesis, suggesting that TAAR5 antagonism may represent a novel therapeutic strategy for anxiety and depression. We used the AtomNet® model, the first deep learning neural network for structure-based drug discovery, to identify putative TAAR5 ligands and tested them in an in vitro BRET assay. We found two mTAAR5 antagonists with low to submicromolar activity that are able to inhibit the cAMP production induced by TMA. Moreover, these two compounds also inhibited the mTAAR5 downstream signalling, such as the phosphorylation of CREB and ERK. These two hits exhibit drug-like properties and could be used to develop further more potent TAAR5 ligands with putative anxiolytic and antidepressant activity.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

The COVID-19 pandemic has brought marked changes worldwide to the management of airborne infectious diseases. It sparked the development of the SARS-CoV-2 vaccine and pharmacotherapeutics to prevent infection and increase the survival rate during the acute viral phase and the comorbidities associated with COVID-19. Periodontal disease may increase the morbidity and perhaps the mortality of a COVID-19 infection. However, the molecular interaction between periodontitis and COVID-19 infection remains undetermined. A potential pathogenic co-morbidity may involve periodontal pathogenic release of destructive cytokines in the highly inflamed connective tissue and risk for COVID-19. Additional biomarkers such as C-reactive proteins appear to play a role for risk and pathogenesis of COVID-19. The potential of herpesviruses, especially as it is related to aggressive periodontitis may also be a comorbidity for COVID-19. This paper reviews available evidence on the bidirectional association between periodontitis and COVID-19.

Hepatocellular carcinoma (HCC) is the fifth most common type of cancer, and is the third leading cause of cancer-related deaths each year. It involves a multi-step progression and is strongly associated with chronic inflammation induced by the intake of environmental toxins and/or viral infections (i.e., hepatitis B and C viruses). Although several genetic dysregulations are considered to be involved in disease progression, the detailed regulatory mechanisms are not well defined. Homeobox (Hox) genes that encode transcription factors with homeodomains control cell growth, differentiation, and morphogenesis in embryonic development. Recently, more aberrant expressions of Hox genes were found in a wide variety of human cancer, including HCC. In this review, we summarize the currently available evidence related to the role of Hox genes in the development of HCC. The objective is to determine the roles of this conserved transcription factor family and its potential use as a therapeutic target in future investigations.

Red djulis (Chenopodium formosanum) is a native cereal plant in Taiwan; it contains abundant polyphenols, betalian and dietary fiber. The appearance of red djulis is bright red. Therefore, it is also called the “ruby of cereals”. The antioxidative activity of red djulis extract is well-understood. However, the antiaging function still remains unclear. This study examined the potential of red djulis extract for enhancing collagen secretion and preventing cutaneous aging using red djulis extracts. The red djulis extracts are comprised of an abundant active component that can effectively enhance the ability of collagen secretion of dermal fibroblasts, prevent the glycation of collagen and resist the damage of ultraviolet light exposure. After fibroblast treatment with red djulis extracts, TGM1, KRT1, KRT10 and SOD2 genes were up-regulated significantly by 2.3, 4.3, 4.4 and 27.3 times, respectively, compared to those of the control group. Additionally, it can increase COL1A2 gene expression by 43% and decrease MMP9 gene expression 33%. Therefore, it was demonstrated that red djulis extracts affect gene expressions related to the skin barrier, antioxidation and collagen. Moreover, we found positive effects on skin barrier integrity, endogenous antioxidant activity and skin collagen-preservation. The preparation of the red djulis extracts is environmental friendly and can promote the economic value of Chenopodium formosanum; thus, the proposed extract is suitable for applications in the development of food products, especially beverages, skin care and cosmetic products.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Gelidium jelly was traditionally made by boiling processed Gelidium seaweed and allowing the filtrate to congeal into jelly. The processing of Gelidium seaweed was very complicate involved the repeated procedures of water washing and sun drying for 7 times, and the seaweed was originally purple-red in color turned into yellow after the repeated wash and sun drying. This study aimed to evaluate the effects of halogen lamp drying methods in replace of sun drying on the physical-chemical qualities of Gelidium jellies. Properties included the agar yield, gelling temperature, hardness, springiness, rheological parameters, sensory attributes, color, and volatile compounds were investigated. The results demonstrated halogen lamp drying method required 12 times of washing and drying processes to achieve the similar jelly properties compared to sun drying for 7 times in the experimental conditions. Volatiles including heptanal, β-ionone, and (E)-2-decenal could be used as indicators to monitor the washing and drying processing. Halogen lamp was found could be an alternative processing method for seaweed drying, especially at rainy days.

Research in various fields of evolutionary biology has shown that divergence in gene expression is a key driver for phenotypic variation. An exceptional contribution of cis-regulatory evolution has for instance been found to contribute to morphological diversification. In the light of these findings, the analysis of genome-wide expression data has become one of the central tools to link genotype and phenotype information on a more mechanistic level. However, in many studies, especially if general conclusions are drawn from such data, a key feature of gene regulation is often neglected. With our article, we want to raise awareness that gene regulation and thus gene expression is highly context dependent. Genes show tissue- and developmental stage-specific expression. We argue that the regulatory context must be considered when studying evolution of gene expression.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

(1) In recent ten years, with the fast development of digital and engineering manufacturing technology, additive manufacturing has already been more and more widely used in the field of dentistry, from the first personalized surgical guides to the latest personalized restoration crowns and root implants. (2) Especially, the bioprinting of teeth and tissue is of great potential to realize organ regeneration and finally improve the life quality. (3) In this review paper, we firstly presented the workflow of additive manufacturing technology. Then we summarized main applications and recent research progresses of additive manufacturing in dentistry. (4) Lastly, we sketched out some challenges and future directions of additive manufacturing technology in dentistry.

Certain studies have reported various insulin resistance responses to ambient heavy metal pollution, but few have reported such responses to occupational heavy metal pollution. Even fewer have demonstrated a relationship between mixture effects of heavy metals and insulin resistance in welding workers. Overall, we recruited 53 welders and 48 administrative staff from a shipyard located in northern Taiwan. Personal exposure to heavy metals was monitored for PM2.5 and urine. Blood samples from each participant were collected from the antecubital vein after fasting. Urine samples from each participant were collected in the same period as blood samples. The geometric mean levels for chromium (Cr), manganese (Mn), iron (Fe), cobalt (Co), nickel (Ni), copper (Cu), zinc (Zn), and cadmium (Cd) in the PM2.5 of the personal breathing zone and urinary Mn of welders were significantly higher than those in administrative staffs. Ambient Cr, Co, Ni, and Cu levels in the PM2.5 and urinary Cd were positively related to HOMA2-IR after adjusting for personal covariates (PM2.5-Cr: β=0.036, 95%C.I.: 0.002 to 0.070; PM2.5-Co: β=0.040, 95%C.I.: 0.002 to 0.077; PM2.5-Ni: β=0.054, 95%C.I.: 0.013 to 0.094; PM2.5-Cu: β=0.049, 95%C.I.: 0.010 to 0.088; U-Cd: β=0.209, 95%C.I.: 0.052 to 0.366, respectively). Our findings indicated the PM2.5 metal components and urinary metals were associated with increased insulin resistance in shipyard welders.

In most countries, the incidence of nasopharyngeal carcinoma (NPC) is no more than 1 per 100,000 for both men and women; however, it is much higher for men and women in Taiwan. The use of traditional Chinese medicine (TCM) as complementary and alternative medicine for the treatment of NPC and its treatment-related side effects has been increasing. The National Health Insurance (NHI) covers 99.6% of Taiwan’s residents. In the present population-based cohort study, we aimed to investigate the pattern of utilization of Chinese herbal products (CHPs) for NPC from 2001 through 2011 in Taiwan. We identified a total of 30294 patients with newly diagnosed NPC from the Registry for Catastrophic Illnesses Patient Database (RCIPD). Descriptive statistics and multiple logistic regression analysis were employed to estimate the adjusted odds ratios (aORs) for CHP utilization. From 2001 through 2011, 17816 patients aged ≥20 years were newly diagnosed with NPC. Of these, 4749 patients used TCM outpatient services for NPC treatment. TCM users were more likely to be women, young, residents of Central Taiwan, and white-collar workers. The most commonly prescribed formula CHP was Gan-Lu-Yin, followed by Xin-Yi-Qing Fei-Tang and Shan-Shen-Mai-Men-Dong-Tang. The most commonly prescribed single CHP was Hedyotis diffusa, followed by Radix Scrophulariae and Radix Ophiopogonis. These findings provide information regarding personalized therapies for NPC and can promote further clinical experiments and pharmacological research on CHPs for NPC treatment in Taiwan. Further well-designed randomized controlled studies and basic mechanistic studies should assess the safety and effectiveness of CHPs for NPC treatment.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Our study explores the role of cancer-derived extracellular exosomes (EXs), particularly focusing on collagen alpha-3 (VI; COL6A3), in facilitating tumor dissemination and metastasis in epithelial ovarian cancer (EOC). We found that COL6A3 is expressed in aggressive ES2 derivatives, SKOV3 overexpressing COL6A3 (SKOV3/COL6A3), and mesenchymal-type ovarian carcinoma stromal progenitor cells (MSC-OCSPCs), as well as their EXs, but not in less aggressive SKOV3 cells or ES2 cells with COL6A3 knockdown (ES2/shCOL6A3). High COL6A3 expression correlates with worse overall survival in EOC patients, as evidenced by TCGA and GEO data analysis. In vitro experiments showed that EXs from MSC-OCSPCs or SKOV3/COL6A3 cells significantly enhance invasion ability in ES2 or SKOV3/COL6A3 cells, respectively (both, P <0.001). In contrast, ES2 cells with ES2/shCOL6A3 EXs exhibit reduced invasion ability (p<0.001). In vivo, the average disseminated tumor numbers in the peritoneal cavity were significantly greater in mice receiving intraperitoneally injected SKOV3/COL6A3 cells than in SKOV3 cells (p<0.001). Furthermore, mice intravenously (IV) injected with SKOV3/COL6A3 cells and SKOV3/COL6A3-EXs showed increased lung colonization compared to mice injected with SKOV3 cells and PBS (p=0.007) or SKOV3/COL6A3 cells and PBS (p=0.039). Knockdown of COL6A3 or treatment with EXs inhibitor GW4869 or rapamycin-abolished COL6A3-EXs may suppress the aggressiveness in EOC.

Concrete-filled steel tube (CFST) members have been widely used in the field of civil engineering due to their advanced superior mechanical properties. However, internal defects such as concrete core voids and interface debonding are likely to weaken the load-carrying capacity and stiffness of these members, which affects safety and serviceability of CFST structures. Visualizing the inner defects of concrete core in CFST members have been a critical need in civil engineering construction, a travel time tomography (TTT) is introduced to quantitatively identify and visualize the sizes and positions of CFST members in this paper. Moreover, a parameter analysis is performed to investigate the relationship between TTT imaging qualities and influence factors, e.g. inversion parameters, defect sizes and positions. The effectiveness and accuracy of the TTT algorithm are verified by several numerical examples and the results demonstrate that TTT can identify the sizes and positions of concrete core void defects in CFST members efficiently and several inversion parameters including model weighting matrix and inversion grid size really pose a significant impact on the imaging results of CFST members. In addition, several optimum parameters are recommended to benefit the future study of the promising TTT approach for CFST members.

In recent years, the emergence of spatiotemporal big data has made the transition of functional identification from the physical dimension to socioeconomic or human activities becoming more common. In the identification of urban functional areas, most studies considered only a single data source and a single division scale, the research results have problems such as low update frequency or incomplete information in a single data set, and overfitting or underfitting in a single spatial resolution. Using taxi trajectory data and point of interest (POI) data as the main data source, this study proposes a multi-scale recursive identification method for urban functional areas based on cross-validation. First, used the dynamic time warping (DTW) algorithm generates a time series similarity matrix, the CA-RFM model combines the clustering algorithm and random forest model is constructed, the model uses a clustering algorithm (K-MEDOIDS) to extract sig-nificant feature regions as input, which are imported into the random forest model for UFZ identification. Then, to overcome the shortcomings of single scale in expressing urban structural characteristics, a recursive model of different levels of urban road networks is established to classify multi-scale functional areas. Finally, cross-validation using the CA-RFM model and POI quantitative identification method, obtains the final identification results of urban functional areas. This paper selects Shenzhen as the study area for the case study, the results show that the com-bination of clustering algorithm and random forest model greatly reduces the error of manual selection of training samples. In addition, the research shows the superiority of the multi-scale recursive identification method that fuses multi-source data and performs cross-validation from two aspects, that is, the division speed of urban functional area identification results is accelerated and the accuracy is improved.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Two new dimacrolide sesquiterpene pyridine alkaloids (DMSPAs), dimacroregelines A (1) and B (2), were isolated from the stems of Tripterygium regelii. The structures of both compounds were characterized by extensive 1D and 2D NMR spectroscopic analyses, as well as HRESIMS data. Compounds 1 and 2 are two rare DMSPAs possessing unique 2-(3′-carboxybutyl)-3-furanoic acid units forming the second macrocyclic ring, representing the first example of DMSPAs bearing an extra furan ring in their second macrocyclic ring system. Compound 2 showed inhibitory effects on the proliferation of human rheumatoid arthritis synovial fibroblast cell (MH7A) at a concentration of 20 μM.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.