Chromophobe renal cell carcinoma (chRCC) and oncocytoma (RO) are renal tumor types originating from alpha intercalated cells of the collecting ducts of the kidney. Both tumor types have similar gross histological morphology and increased mitochondria, which leads to difficulties differentiating between these tumors, especially with core biopsy samples. This study aims to apply a machine learning approach to develop a molecular classifier based on transcriptomics data. Here we generated a meta-data set containing 62 chRCC and 45 RO gene expression arrays. Arrays were subjected to quality control steps, and genes were selected based on differential expression and ROC analysis. The final gene list was evaluated with UMAP based dimension reduction followed by density-based clustering with 95.5% accuracy. Molecular profiling by KEGG pathway analysis identified enrichment of fatty acid oxidation pathway in RO. We finally identified and validated the 30-gene signature, with an accuracy of 94.4% to distinguish chRCC from RO on UMAP analysis. Our results show that chRCC and RO have a distinct gene signature that can differentiate these tumors and complement histology for routine diagnosis of these two tumors.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

Chinese-speaking parents are argued to use less cognitive mental-state-talk than their English-speaking counterparts due to their goals in socializing their children to follow an interdependence script. To extend this research, we investigated bilingual Mandarin-English Singaporean mothers who associate different functions for each language as prescribed by their government: English for school and Mandarin for in-group contexts. English and Mandarin maternal mental-state-talk from bilingual Mandarin-English mothers with their toddlers was examined. Mothers produced more cognitive terms in English than in Mandarin and more desire terms in Mandarin than in English. We show that mental-state-talk differs between bilingual parents’ languages, suggesting that mothers adjust their mental-state-talk to reflect each language’s function.

For equivalent modeling of mixed wind farms (WFs), existing clustering indicators cannot consider the complex coupling characteristics between different types of wind turbines (WTs). This paper proposes a refined equivalent modeling method for mixed WFs based on artificial intelligence technology. Firstly, the electromechanical transient performance of mixed WFs is analyzed. The WT type, wind speed and direction, and voltage dip are considered the main factors affecting the external dynamic response of mixed WFs. Secondly, the equivalent node model is established, including the selection of independent and dependent variables. Then, the multiple artificial neural networks (ANNs) are trained one by one based on sample data, to explore the nonlinear relationship between the dependent variables and the independent variables. Finally, the electromechanical transient simulations of the power systems with a mixed WF is carried out by using the MATLAB platform. Simulation results show that the proposed model can reflect the external characteristics of the mixed WF in different wind scenarios and voltage dips.

Carol Winkelmann, in her book ‘The Language of Battered Women’ describes not only the fact that domestic abuse is almost a daily occurrence in the lives of many women but that the language of religion and faith is often used by women in attempts to explain, understand and cope with such abuse . While religious belief and domestic violence may seem contradictory in terms of religious values of faith, virtue and love, research demonstrates that domestic violence in religious families and amidst religious congregations is prevalent. In fact, religious beliefs and practices are often embedded in cultural contexts and thus perpetuate patriarchal notions of dominance, power and submission. Abused Christian women, for example, are more likely to seek help from (male) ministers and others in positions of authority in their local church communities and are equally more likely to remain in or return to unsafe relationships, citing their religious beliefs to support their avoidance of ‘family break-ups’ because of abuse. What, then, is the response of ministers and church authorities to domestic abuse in their congregations? Despite recent calls for the training of pastors and other religious leaders in an understanding of domestic violence and in the recognition of appropriate, helpful responses, the language of some Christian churches can be seen to foster notions of submission so that women and pastors alike can appear confused concerning the experience of abuse. Religious congregations, while acting in love to help the poor and needy, for example, often fail to recognise domestic abuse amongst their own members and, indeed, such a topic can remain taboo in some church communities. Women, in turning to their pastors or other Christian leaders for help, can be silenced by the language of the religion itself, so that the role of wives and mothers may be seen to be submissive and the ‘keeper of the home’; to leave an abusive relationship may thus ‘break-up’ a home and imply failure of the woman to understand her role and fulfil her ‘maternal vocation’. On the other hand, religious beliefs offer victims of domestic violence both hope and comfort. Religious practices, such as prayer, liturgies and corporal (physical) works of mercy, can provide solace and practical assistance for women who suffer abuse. Domestic violence in religious congregations can be addressed within the context of the faith itself, with an emphasis on love and respect, helping women to understand their dignity with avenues of help so that the women can remove themselves and their children from abusive relationships, and the religious congregation and its leaders can call the partners to accountability. This paper seeks to outline a picture of domestic violence in religious congregations, specifically Christian church communities, by drawing on current research in the Western world. It then describes the language of some religious congregations that perpetuates domestic violence, with emphasis on contemporary studies in religious belief and domestic abuse. Finally, the paper makes some suggestions on how religious belief and practice can, in contrast to perpetuating abuse through norms, serve to assist women as victims of domestic violence, and how the connections between domestic violence and religious language or belief can be severed.

Glyphosate　(GLYP)　is a broad-spectrum, non-selective, organic phosphine post emergence herbicide registered for use on many food and non-food field. Herein, we developed a biosensor (Mbs@dsDNA) based on carboxylated modified magnetic beads incubated with NH2-polyA and then hybridized with polyT-glyphosate aptamer and complementary DNA. Afterward, a quantitative detection method based on qPCR was established.　When the glyphosate aptamer on Mbs@dsDNA specifically recognized glyphosate, a complementary DNA is released and then enters the qPCR signal amplification process. The linear range of the method was 0.1-5 μg/mL, and the detection limit was set at 0.1 μg/mL. The recoveries in tap water were ranged from 103.4 ~ 104.9%, and the relative standard deviations (RSDs) were < 1%. The aptamer proposed in this study has a good potential for recognizing glyphosate. The detection method combined with qPCR might have a good application prospect in detecting and supervising other pesticide residues.

This paper seeks to model the crack propagation in of AAs (aluminum-alloys) 2524-T3 and 7050-T7452 subjected to fatigue loading at low temperature. Fatigue crack growth tests were performed on AAs 2524-T3 and 7050-T7452 subjected to constant-amplitude and actual random-spectra loading histories at room temperature of about 25 °C and at cryogenic temperature of -70 °C, respectively, to determine their crack growth properties and residual lives. The interaction mechanisms between cryogenic temperature and the fatigue load were deduced on the basis of the results of fractographic analysis. Temperature-dependent residual lives under actual random-spectrum load history were modeled based on a modified accumulation damage rule by accounting for the load interaction. Good correlation was achieved between the predictions and actual experiments, demonstrating the practical and effective use of the proposed method.

MicroRNAs (miRNAs) play crucial roles in the regulation of the transcriptome and development of diseases including cancer and autoimmune diseases, such as rheumatoid arthritis (RA). Currently, a comprehensive map, illustrating how miRNAs regulate transcripts, pathways, immune system differentiation, and their interaction with terminal cells, such as T cells, fibroblast-like synoviocytes (FLS), osteoblasts, and osteoclasts, is still missing. In this review, we provide a thorough summary of the roles of miRNAs in the susceptibility to pathogenesis, diagnosis, therapeutic intervention, and prognosis of RA. Numerous miRNAs are abnormally expressed in cells involved in RA, and regulate target genes and pathways including the NF-κB, Fas-FasL, JAK-STAT, IRE1-RIDD, and mTOR pathways. By regulating gene expression, miRNAs affect T cell differentiation to diverse cell types, including Th17 and T-reg cells, and thus constitute promising gene therapy targets to modulate the immune system in RA. We summarize the diagnostic and prognostic potential of blood-circulating and cell-free miRNAs, highlighting the novel opportunities to combine these with rheumatoid factor (RF) and anti-cyclic citrullinated peptide (anti-CCP) to provide accurate diagnosis and prognosis, especially for seronegative patients. Furthermore, we outline how functional genetic variants of miR-499 and miR-146a partly explain the unmet susceptibility to RA. Additionally, we review the evidence implicating miRNAs as promising biomarkers of efficiency, response, and resistance to disease-modifying anti-rheumatic drugs (DMRDs) and immunotherapy. Finally, we discuss the autotherapeutic effect of miRNA intervention as a step toward the development of miRNA-based anti-RA drugs. Collectively, the current evidence supports miRNAs as interesting targets to better understand the pathogenetic mechanisms of RA and design more efficient therapeutic interventions.

In this work we study the recently developed parametrized partition function formulation and show how we can infer the thermodynamic properties of fermions based on numerical simulation of bosons and distinguishable particles at various temperatures. In particular, we show that in the three dimensional space defined by energy, temperature and the parameter characterizing parametrized partition function, we can map the energies of bosons and distinguishable particles to fermionic energies through constant-energy contours. We apply this idea to both noninteracting and interacting Fermi systems and show it is possible to infer the fermionic energies at all temperatures, thus providing a practical and efficient approach to obtain thermodynamic properties of large fermion systems with numerical simulation. As an example, we present energies for up to 50 noninteracting fermions and up to 20 interacting fermions at all temperatures and show good agreement with the analytical result for noninteracting case.

Surgical smoke is produced by energy-based surgical instruments. The airborne volatile organic compounds (VOCs) from surgical smoke may have potential health risk. This study aimed to evaluate the evidence for the harmful effects on the operating theater staff. An internationally recognized evaluation model of health risk assessment (HRA) was adapted to preliminarily assess the health risks caused by VOCs in surgical smoke. Results of HRA indicated that non-carcinogenic risk indexes of VOCs did not exceed one, indicating that these pollutants didn't cause significant non-carcinogenic harm to the health of the operating theater staff. But the cancer risk indexes exposed to formaldehyde and benzene all exceed 10-5, which was higher than the suggested value of USEPA (10-6) and might cause potential harm to the health of the operating theater staff. Long-term exposure of such surgical smoke will be harmful to the health of the operating theater staff and have a great risk of cancer.

Potato (Solanumtuberosum L.) is the world's largest non-cereal crop, occupying a position critical for global food security, the fourth largest crop food in China. Due to its location and weather conditions, Yunnan province is the fourth largest potato producer in China with twice yearly production system. However, compared to high number of consumers, potato yield is still low to satisfy the population need. In this study, we have analyzed impacts of three cultivation factors: (1) three cultivation models (T1, T2, and T3), (2) planting density (T1, T2, and T3), (3) soil covering (T1, T2, T3, T4) on plant growth, and yield production. The soil moisture content, temperature, roots growth, stems development, leaf area index, and number-weight of tubers per plant and per plot (g) have significantly increased with commercial yield average of 3tones/mu. This suggests that the combination of these three factors would be a great potato extension model in winter climate zones similar to Yunnan Province. This will contributes in satisfaction of the world population potato consumption need.

As the general acceptance of fiber-reinforced polymer (FRP) in the concrete construction industry continues to rise, it is increasingly imperative that the crack width of FRP reinforced concrete members of pavement and girder be predicted with good accuracy due to strengthening of RC pavement, slabs or beams structures using FRP is known to control crack width. However, no specific provisions are provided by most international design codes for predicting crack width in FRP reinforced concrete flexure members. In this paper, five formulas for predicting the crack width for FRP reinforced structures are derived from three common computational theories which including statistical method, comprehensive theory, and bond-slip theory. The formula of statistical method is simplest, but the parameters depend on much sample data. The comprehensive and slippage theory based on semi-empirical statistical crack spacing are obtained through the calculation of non-uniformity coefficient of strain. The comprehensive and slippage theory based on semi-empirical axial force balance are obtained through the calculation of tensile reinforcement factor. The comparative analysis of performance of five formulas is carried out. The results indicate that the formula from comprehensive theory based on semi-empirical statistical crack spacing is recommended for predicting the crack width of FRP reinforced concrete flexural structure.

Tao and Ming (name) or Tao and Yan (language or speech) is an inseparable pair of important concepts in traditional Chinese language philosophy. In LaoTze’s opinion, Tao could not be spoken out, and language or speech could not reach Tao’s essence. Yan and Tao are separated from each other, and they are paradoxical. All the confusion derives from Yan regardless of how delicate they are. Tao can be expressed in words, but it will never be expressed through common languages. In this article, Tao is regarded as a human being’s thoughts or intentions and is even considered to be the origin of the real world. Language can express people’s thought, although it has some limitations. There exist some contradictions between the real word and the world expressed in words. To enable people to better understand the existence of the real world from multiple perspectives at the language or linguistic level without being constrained by words, this article studies LaoTze’s linguistic philosophy reflected in his opinion on the relationship between Tao and Yan and makes a comparative analysis of modern Western language philosophers’ stand on language (or speech) and existence.

At present, there are still no specific therapeutic drugs and appropriate vaccines for Dengue. Therefore, it is very important to explore distinct clinical diagnostic indicators. In this study, we combined differentially expressed genes (DEGs) analysis and weighted co-expression network analysis (WGCNA) to screen a stable and robust biomarker which can be used to distinguish three clinical stages of Dengue and severity of Dengue. CD38 can distinguish excellently Early Acute, Late Acute, Convalescent stages for Dengue patients, and ZNF595 can discriminate DHF from DF in whole acute stages. We also found that three clinical stages can be discriminated based on the fractions of Plasma cells, activated memory CD4+ T cells, and Monocytes. In different clinical stages different immune cells function positively. Negative inhibition of viral replication based on Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and Gene set enrichment analysis (GSEA), up-regulated autophagy genes and impairing immune system are potential reasons resulting in dengue hemorrhagic fever (DHF).

Carbon dots have received much attention due to their unique physicochemical properties and diverse applications in bioimaging, optoelectronic devices, catalysis, and agriculture. Here in this work, we report a simple hydrothermal synthesis of nitrogen and phosphorus-doped carbon dots (N, P-CDs). The optical and physical properties of the synthesized N, P-CDs were analyzed using systematical spectroscopy and electrical characterization. The synthesized N, P-CDs show strong photoluminescence at 626 nm and demonstrate high stability under UV light and other conditions. Moreover, we incorporate the synthesized N, P-CDs into water spinach by root spraying and leaf spraying. It was found that N, P-CDs could effectively promote the growth of water spinach by increasing the photosynthetic rate, and the content of total phenols and anthocyanins in water spinach

This paper addresses a new micromechanical model to predict biaxial tensile moduli of plain weave fabric (PWF) composites by considering the interaction between the orthogonal interlacing strands. The two orthogonal yarns in micromechanical unit cell (UC) were idealized as the curved beams with a path depicted by using sinusoidal shape functions. The biaxial tensile moduli of PWF composites were derived by means of the minimum total complementary potential energy principle founded on micromechanics. The biaxial tensile tests were respectively conducted on the RTM-made EW220/5284 PWF composites at five biaxial loading ratios of 0, 1, 2, 3 and ∞ to validate the new model. The predictions from the new model were compared with experimental data and good correlation was achieved between the predictions and actual experiments, demonstrating the practical and effective use of the proposed model. Using the new model, the biaxial tensile moduli of plain weave fabric (PWF) composites could be predicted based only on the properties of basic woven fabric.

We consider the conjecture of the relationship between the entanglement entropy of spacetime, matter and the action in Einstein's general relativity. Our analysis suggests the possibility of regarding the entanglement entropy of spacetime and matter as the dimensionless action in general relativity by using Planck units. In this case, the action principle originates from the maximization of the entanglement entropy. We also show that the fundamental property of entanglement entropy leads to attractive characteristic of gravitational force for classical particles.

We consider the quantum thermodynamic origin of the gravitational force of matter by applying the spacetime entanglement entropy and the Unruh effect originating from vacuum quantum fluctuations. By analyzing both the local thermal equilibrium and quasi-static processes of a system, we may get both the magnitude and direction of Newton's gravitational force in our theoretical model. Our work shows the possibility that the elusive Unruh effect has already shown its manifestation through gravitational force.

The apple leaf-curling midge, Dasineura mali Kieffer (Diptera: Cecidomyiidae), is an invasive pest of apple. To provide crucial information for its pest risk analysis, forecast and management, we investigated the effects of temperatures (5, 10, 15, 20 and 25°C) and daylengths (10, 11, 12, 13, 14 and 15 hrs) on its development and survival. The midge could not complete its development at 10°C or lower. After transferred from 20°C to 10°C, mature larvae could survive for about two months and develop to adults. Pupation and emergence rates were significantly higher at 20°C than at 10°C and 25°C. Daylength had no effect on these parameters. The low temperature threshold and thermal requirement to complete development from eggs to adults were 3.7°C and 627 degree-days, respectively. The midge had significantly lower thermal requirement for completion of its lifecycle at 20°C (614.5 degree-days) than at 15°C (650.1 degree-days) and 25°C (634.8 degree-days). The thermal model developed in this study provided accurate predictions of the number of D. mali generations and adult emergence time in each generation in different regions of New Zealand. We suggest that the model could be used to predict population dynamics of this pest in other parts of the world.

This study investigated the fatigue properties and interfacial strengthening mechanisms of Al6061-to-Cu dissimilar welded joints via electromagnetic pulse welding (EMPW). The load-bearing capacity of the joints at discharge voltages of 14 kV and 16 kV was superior to that of 12 kV. Meanwhile, the fatigue life of 14 kV joints was one order of magnitude higher than that of 12 kV. The SEM observation on the fatigue fracture surface shows that the typical “tire-mark” fatigue striation just appeared on the 14 kV joint, indicating higher ductility for handling more extended plastic deformation. The high EBSD acquisition was achieved except for the transition zone due to the formation of ultra-fine nanocrystalline Al2Cu phase and amorphous phase, along with many dislocations. Dense low-angle grain boundaries (LAGBs) and refined grains are formed along the bonding interface. This indicates that severe plastic deformation induced dislocations to form the substructure in such an instant (40-60 μs) during the high-velocity collision. The interfacial strength is not only due to the continuous interfacial diffusion layer with a “wave-like” or “inverted hook-like” pattern but also benefits from refined grains along the interface and in the transition zone, as well as the hybrid amorphous-nanocrystalline microstructure, which strengthens the joint through increasing ductility induced by refined grains and regulating amorphous or nanocrystalline phases to affect the balance between strength and ductility of the Al/Cu joint.

This paper aims to address the exponential stability and stabilization problems for a class of delayed nonlinear Markov jump systems under randomly occurring Denial-of-Service (DoS) attack and packet loss. Firstly, the stochastic characteristics of DoS attack and packet loss are depicted by the attack success rate and packet loss rate. Secondly, a Period Observation Window (POW) method and a hybrid-input strategy are proposed to compensate for the impact of DoS attack and packet loss on the system. Thirdly, A Dynamic Event-triggered Mechanism (DETM) is introduced to save more network resources and ensure the security and reliability of systems. Then, by constructing a general common Lyapunov functional and combining with the DETM and other inequality analysis techniques, the less conservative stability and stabilization criteria for the underlying systems are derived. In the end, the effectiveness of our result is verified through a numerical example.

With the integrated development of the Internet, wireless sensor technology, cloud computing, and mobile Internet, there has been a lot of attention given to research about and applications of the Internet of Things. A Wireless Sensor Network (WSN) is one of the important information technologies in the Internet of Things; it integrates multi-technology to detect and gather information in a network environment by mutual cooperation, using a variety of methods to process and analyze data, implement awareness, and perform tests. This paper mainly researches the localization algorithm of sensor nodes in a wireless sensor network. Firstly, a multi-granularity region partition is proposed to divide the location region. In the range-based method, the RSSI (Received Signal Strength indicator, RSSI) is used to estimate distance. The optimal RSSI value is computed by the Gaussian fitting method. Furthermore, a Voronoi diagram is characterized by the use of dividing region. Rach anchor node is regarded as the center of each region; the whole position region is divided into several regions and the sub-region of neighboring nodes is combined into triangles while the unknown node is locked in the ultimate area. Secondly, the multi-granularity regional division and Lagrange multiplier method are used to calculate the final coordinates. Because nodes are influenced by many factors in the practical application, two kinds of positioning methods are designed: the unknown node is in the positioning unit or not. When the unknown node is on the side of the positioning unit, we use the method of vector similarity. Moreover, we use the centroid algorithm to calculate the ultimate coordinates of unknown node. When the unknown node is not on the side of the positioning unit, we establish a Lagrange equation containing the constraint condition to calculate the first coordinates. Furthermore, we use the Taylor expansion formula to correct the coordinates of the unknown node. In addition, this localization method has been validated by establishing the real environment.

Transverse momentum spectra of +, p, Λ, Ξ or ¯Ξ+, Ω or ¯Ω+ and deuteron (d) in different centrality intervals in Gold-Gold (Au-Au) and Lead-Lead (Pb-Pb) collisions at 62.4 GeV and 2.76 TeV respectively, are analyzed by the blast wave model with Boltzmann Gibbs statistics. We extracted Kinetic freeze out temperature,transverse flow velocity and kinetic freezeout volume from the transverse momentum spectra of the particles. It is observed that the non-strange and strange (multi-strange) particles freezeout separately due to different reaction cross-sections. While the freezeout volume and transverse flow velocity are mass dependent which decrease with the rest mass of the particles. The present work reveals the scenario of double kinetic freezeout in collisions at STAR and ALICE Collaborations. Furthermore, the kinetic freezeout temperature and freezeout volume are larger in central collisions than the peripheral collisions and they decrease from central to periphery. However the transverse flow velocity remains almost unchanged from central to peripheral collisions.

In this study, a new method for synthesizing Au-NaYF4:Yb3+/Er3+-DSPE-PEG2K nanocomposites was introduced. Using a hydrothermal method, the synthesized Yb3+- and Er3+-codoped NaYF4 upconversion luminescent materials and Au nanoparticles were doped into upconversion nanomaterials and modified with DSPE-PEG2k up-conversion nanomaterials. This material is known as Ag-UCNPs-DSPE-PEG2k, it improves both the luminous intensity because of the doped Au nanoparticles and has low cytotoxicity because of the DSPE-PEG2k modified. Exciting UCNPs with a wavelength of 980nm near-infrared light will emit light with a wavelength of 520nm to further excite gold nanoparticles to convert light energy into heat. Successful synthesized gold nanoparticles was confirmed using transmission electron microscopy (TEM). The morphology of UCNPs was observed using scanning electron microscopy (SEM), and the mapping confirmed the successful doping of Au nanoparticles. Fluorescence spectra were used to compare changes in luminescence intensity before and after doping Au nanoparticles. The cytotoxicity of Au-UCNPs-DSPE-PEG2K was tested via the cell counting kit-8 (CCK-8) method, and its imaging ability was characterized using the Magnetic Resonance Imaging (MRI) and Computed Tomography (CT) method.

Carboxypeptidase A4 (CPA4) has shown the potential possibility as a biomarker in the early diagnosis for certain cancers. However, no previous research has linked CPA4 to therapeutic or prognostic significance in bladder cancer. Using data from The Cancer Genome Atlas (TCGA) database, we set out to determine the full extent of the link between CPA4 and BLCA. We further analyzed the interacting proteins of CPA4 and infiltrated immune cells via TIMER2，STRING and GEPIA2 databases. The expression of CPA4 in tumor and normal tissues was compared using the TCGA+GETx database. The connection between CPA44 expression and clinicopathologic characteristics and overall survival (OS) was investigated using multivariate methods and Kaplan-Meier survival curves. The potential functions and pathways were investigated via gene set enrichment analysis. Furthermore, we analyze the associations between CPA4 expression and infiltrated immune cells with their respective gene marker sets using the ssGSEA, TIMER2, and GEPIA2 databases. Compared to matching normal tissues, human CPA4 was found to be substantially expressed. We confirmed that overexpression of CPA4 is linked with shorter OS, DSF, PFI, and increased diagnostic potential using Kaplan-Meier and ROC analysis. The expression of CPA4 is related to T-bet, IL12RB2, CTLA4, and LAG3, among which T-bet and IL12RB2 are Th1 marker genes, while CTLA4 and LAG3 are related to T cell exhaustion, which may be used to guide the application of checkpoint blockade and the adoption of T cell transfer therapy.

Due to the advantages of low latency, low power consumption and high flexibility of FPGA-based acceleration technology, it has been more and more widely studied and applied in the field of computer vision in recent years. An FPGA-based feature extraction and tracking accelerator for real-time visual odometry (VO) and visual simultaneous localization and mapping (V-SLAM) is proposed, which can realize the complete acceleration processing capability of the image front-end and directly output the feature point ID and coordinates to the backend. The accelerator consists of image preprocessing, pyramid processing, optical flow processing, and feature extraction and tracking modules. For the first time, it implements a hardware solution that combines features from accelerated segment test (FAST) corners with Gunnar Farneback (GF) dense optical flow, to achieve better feature tracking performance and provide more flexible technical route selection. In order to solve the scale invariance and rotation invariance lacking problem of FAST features, an efficient pyramid module with a five-layer thumbnail structure is designed and implemented. The accelerator is implemented on a modern Xilinx Zynq FPGA. The evaluation result shows that the accelerator can achieve stable tracking of features of violently shaking images, and is consistent with the results of MATLAB code running on PC. When operating at 100MHz, the accelerator can process 108 frames per second for 720P images and 48 frames per second for 1080P images. Compared to PC CPUs that consume seconds of time, the processing latency is greatly reduced to the order of milliseconds, making GF dense optical flow an efficient and practical technical solution on the edge side.

Solidification cracking is a major obstacle when joining dissimilar alloys using additive manufacturing. In this work, location-specific solidification cracking susceptibility has been investigated using an integrated computational materials engineering (ICME) approach for a graded alloy formed by mixing P91 steel and Inconel 740H superalloy. An alloy derived from a mixture of 26 wt.% P91 steel and 74 wt.% Inconel 740H, with high configurational and total entropy, was fabricated using wire-arc additive manufacturing. Microstructure characterization revealed intergranular solidification cracks, which increased in length along with the build height. With inputs from experiments, such as secondary dendrite arm spacing, the DICTRA (diffusion-controlled transformations) module within the Thermo-Calc software was used to model location-specific solidification cracking susceptibility. The top region, with the highest cooling rate, has the highest solidification cracking susceptibility and is in good agreement with the experimentally observed crack length. From Scheil simulations, it was deduced that pronounced segregation of Nb and Cu within the cracks increased the solidification range by suppressing the solidus temperature. The overall solidification cracking susceptibility and freezing range was highest for the 26 wt.% P91 alloy amongst the mixed compositions between P91 steel and 740H superalloy, proving that solidification characteristics play a major role in alloy design for additive manufacturing.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The current study emphasizes on optimizing a suitable ratio of enzymatically hydrolyzed potato powder (EHPP) and whole milk powder (WMP) to produce a quality yogurt by evaluating the physicochemical and rheological properties. The results showed that the addition of EHPP decreased the pH towards acidic conditions which resulted in the high acidity of yoghurt. The proximate composition showed that EHPP increased the ash, protein, water holding capacity (WHC) while fat, synersis, color parameters and total solid were decreased when compared to control yoghurt (CY) sample. Moreover, texture profile (TPA) analysis showed that the addition of EHPP decreased the hardness and cohesiveness while springiness did not show significant difference. Furthermore, rheological properties revealed that EHPP decreased the storage modulus (G’) and loss modulus (G”) when compared with control. In addition to this, sensory analysis revealed that the treatment P4M (1:3) was found as optimum ratio regarding taste, flavor, and aroma. Besides this, scanning electron microscopy (SEM) confirms that the high amount of EHPP resulted in the void holes while CY showed dense gel structure. The prepared yogurt with EHPP provides an excellent flavor, satisfying sweetness and homogeneous texture. These findings suggest the optimum formulation ratio of prepared yogurt was found to be P4M (1:3) for desirable attributes and consumer acceptance. The prepared yogurt from the EHPP presents the potential industrial applications.

Thermal interface material (TIM) that can exist as liquid at the service temperature enables efficient heat transfer across two adjacent surfaces in electronic applications. In this work, the thermal conductivities of different phase regions in the Ga-In system at various compositions and temperatures are measured for the first time. A modified comparative cut bar technique is used for the measurement of the thermal conductivities of In_xGa_1-x (x=0, 0.1, 0.214, 0.3, and 0.9) alloys at 40, 60, 80, and 100^oC that are the temperatures commonly encountered in consumer electronics. The thermal conductivity values for the liquid and semi-liquid (liquid+β) Ga-In alloys are higher than the TIM currently used in consumer electronics. These measured quantities, along with the available experimental data from the literature, served as input for the thermal conductivity parameter optimization using the CALPHAD (CALculation of PHase Diagram) method for the pure elements, solution phase, and two-phase region. A set of self-consistent parameters for the description of the thermal conductivity of the Ga-In system is obtained. There is good agreement between the measured and calculated thermal conductivity values for all the phases. Hence, it can be envisaged that liquid/semi-liquid Ga-In alloys can be considered as a potential TIM in consumer electronics due to its high thermal conductivity.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

In order to perform multi-degree-of-freedom motion measurements of marine machinery such as ship-borne mechanical platform in an absolute environment without a reference, absolute measurement methods using acceleration sensors and tilt gyroscopes are typically employed. However, due to the influence of wave forces on ship-borne mechanical platform, the coupling between different degrees of freedom can cause mutual interference, resulting in significant sensor measurement disturbances that make efficient computation and real-time analysis challenging. Specifically, when ship-borne mechanical platform swings, the proof mass of the acceleration sensor produces an undesirable signal output in the vertical direction, which leads to imprecise acceleration integration, thereby affecting accurate motion collection and posture estimation. To address these challenges, by analyzing the influence of the inclination angle of the ship-borne mechanical platform on the sensor measurement, and using the working principle of the acceleration sensor and angle sensor, a correction method for the motion measurement of the ship-borne mechanical platform based on multi-sensor fusion is proposed. In this article, we first analyze the influence of inclination angle on the integral effect in the heave direction. Then the configuration using four groups of acceleration sensors to correct the integral effect is proposed. Finally, the optimal inclination angle is determined through Kalman filtering based on the measured value of angle sensors and estimated values from the acceleration sensor sets. Experiments have proved that the average error of the corrected heave displacement signal is 25.34 mm, which is better than the integral displacement signal of a single acceleration sensor. At the same time, the acceleration sensor is used to calculate the roll angle and pitch angle of the ship-borne mechanical platform, and combined with the angle sensor signal to perform Kalman filtering, which filters out the errors caused by the shaking and instability of the mechanical platform, and can more accurately estimate the true inclination of the platform. Therefore, this method can enhance the precision and accuracy of the ship-borne mechanical platform motion signal acquisition, providing more valuable experimental data for research in marine engineering and related fields.

Triple-negative breast cancer (TNBC), characterized by deficiency in estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor2 (HER2), is among the most lethal subtypes of breast cancer (BC). Nevertheless, the molecular determinants that contribute to its malignant phenotype such as tumor heterogeneity and therapy resistance remain elusive. In this study, we sought to identify the stemness-associated genes involved in TNBC progression. Using bioinformatics approach, we found 55-up and 9-down regulated genes in TNBC. Out of the 55 upregulated genes, a 5 gene-signature (CDK1, EZH2, CCNB1, CCNA2, and AURKA) involved in cell regeneration, was positively correlated with status of tumor hypoxia and clustered with stemness-associated genes, as recognized by Parametric Gene Set Enrichment Analysis (PGSEA). Also, enhanced infiltration of immunosuppressive cells was positively correlated with the expression of these 5 genes. Moreover, our experiments showed that depletion of the transcriptional co-factor nucleus accumbens-associated protein 1 (NAC1), which is highly expressed in TNBC, reduced the expressions of these genes. Thus, the five genes signature identified by this study warrants further exploration as a potential new biomarker of TNBC heterogeneity/stemness characterized by high hypoxia, stemness enrichment, and immune-suppressive tumor microenvironment.

Mycophenolate mofetil was reported to have broad in vitro activity against different viruses and had been tried in combination with IFN-β in treating MERS infection. We tested the pharmacological activity of mycophenolate mofetil using SARS-CoV-2 infected Vero cells. The half-maximal effective concentration (EC₅₀) of mycophenolate mofetil against SARS-CoV-2 was 0.47 μM while that of remdesivir was 0.77 μM. Molecular docking results of mycophenolate mofetil to potential target proteins of COVID-19 suggested that mycophenolate mofetil might inhibit SARS-CoV-2 mainly by interacting with DHODH and IMPDH2. Furthermore, mycophenolate mofetil as an immunosuppressant may be a good therapeutic option for the management of hyperinflammation in patients with severe COVID-19. Based on its high potency against SARS-CoV-2 in Vero E6 cells, its good pharmacokinetics and clinical safety profile, mycophenolate mofetil deserves further exploration as potential treatment for COVID-19.

Marine mortar was the goal material and its multi-scale physical-chemical-mechanical characteristics were the principal interest in this study. The on-line multi-scale damage detection experiments art was designed to quantify the characteristics mathematically and graphically. The normal cylinder specimen with 70-day age was produced and investigated by dynamically global MSHCT scan and local detection of EDS, SEM and XRD. The experiments results indicated that the marine mortar offered the appreciable strength at the early age at least, although some saline minerals were generated during the preparation. The micro-interfacial behavior and the parental foci controlled the damage development of the marine mortar the performance of which was still the adjustable one by the composition optimization.

In this study, a new method for synthesizing Ag-NaYF4:Yb3+/Er3+ @ SiO2 nanocomposites was introduced. Using a hydrothermal method, the synthesized Yb3+- and Er3+-codoped NaYF4 upconversion luminescent materials and Ag nanoparticles were doped into upconversion nanomaterials and coated with SiO2 up-conversion nanomaterials. This material is known as Ag-UCNPs-SiO2’ it improves both the luminous intensity because of the doped Ag nanoparticles and has low cytotoxicity because of the SiO2 coating. The morphology of UCNPs was observed using scanning electron microscopy (SEM), and the mapping confirmed the successful doping of Ag nanoparticles. Successful coating of SiO2 was confirmed using transmission electron microscopy (TEM). Fluorescence spectra were used to compare changes in luminescence intensity before and after doping Ag nanoparticles. The reason for the increase in luminescence intensity after doping with Ag nanoparticles was simulated using first-principles calculations. The cytotoxicity of Ag-UCNPs-SiO2 was tested via the cell counting kit-8 (CCK-8) method, and its imaging ability was characterized using the micro-CT method.

Carbon fiber insole (CFI), which is lightweight and stiff to reduce energy loss and help wearers perform better in sports, has recently been introduced. However, there are scarce reports on the effects of CFI on sports performance, muscle fatigue and wearing comfort. This study investigat-ed the short-term effects of CFI on sports performance, lower extremity muscle activity, and sub-jective comfort. Thirty young healthy males performed various sports tasks and treadmill runs with wearable sensors under two experimental insole conditions (benchmark insole as a baseline, CFI). The results showed that compared to the benchmark insole, CFI significantly improved sports performance in terms of power generation and agility. However, it activated more of the Tibialis Anterior and Gastrocnemius Medialis muscles and was perceived stiffer, and less com-fortable. These findings suggested that CFI can improve sports performance, but it could cause more lower extremity muscle fatigue and subjective discomfort.

Wenchuan earthquake that occurred in China in 2008 caused severe damage to a large number of electric substations. In this paper, Kriging interpolation method was used to calculate the impact area of the instrumental seismic intensity in Wenchuan earthquake, and to compare the intensities based on strong motion observation against the instrumental seismic intensities at locations where the observation data is available. The instrumental seismic intensities were calculated for the Wenchuan Earthquake at substations in the national power grid with voltage of 110kV or higher in areas of Mianyang, Deyang, Guangyuan and Chengdu. The cumulative Gaussian distribution function was then used to fit the relationship of the curves of the damage probabilities of high-voltage electrical equipment such as transformers, voltage mutual inductors, current mutual inductors, circuit breakers, isolating switches and lightning arrester with their instrumental seismic intensities. The damage probability density distribution curve of high-voltage electrical equipment based on the instrumental seismic intensities was obtained. The results showed that: (1) In the lower seismic intensity region, the mean instrumental seismic intensity was in good agreement with the traditional seismic intensity, but there was noticeable dispersion; in regions of intensity IX and above, the instrumental intensity was lower than the seismic intensity, but there was a lower degree of dispersion. (2) Among high-voltage electrical equipment, the transformers were most vulnerable to damage and they had some damage even under lower instrumental intensity. More damage would be produced when the instrumental intensity reached VIII or above; the second most vulnerable equipment was the circuit breaker, and the damage was most likely to occur when the instrument intensity was IX or above . (3) The damage rate curves of lightning arresters, current mutual inductors, voltage mutual inductors and isolating switches were relatively close to each other and the damage probability was the highest when the instrumental intensity was about X.

Wenchuan earthquake that occurred in China in 2008 caused severe damage to a large number of electric substations. In this paper, Kriging interpolation method was used to calculate the impact area of the instrumental seismic intensity in Wenchuan earthquake, and to compare the intensities based on strong motion observation against the instrumental seismic intensities at locations where the observation data is available. The instrumental seismic intensities were calculated for the Wenchuan Earthquake at substations in the national power grid with voltage of 110kV or higher in areas of Mianyang, Deyang, Guangyuan and Chengdu. The cumulative Gaussian distribution function was then used to fit the relationship of the curves of the damage probabilities of high-voltage electrical equipment such as transformers, voltage mutual inductors, current mutual inductors, circuit breakers, isolating switches and lightning arrester with their instrumental seismic intensities. The damage probability density distribution curve of high-voltage electrical equipment based on the instrumental seismic intensities was obtained. The results showed that: (1) In the lower seismic intensity region, the mean instrumental seismic intensity was in good agreement with the traditional seismic intensity, but there was noticeable dispersion; in regions of intensity IX and above, the instrumental intensity was lower than the seismic intensity, but there was a lower degree of dispersion. (2) Among high-voltage electrical equipment, the transformers were most vulnerable to damage and they had some damage even under lower instrumental intensity. More damage would be produced when the instrumental intensity reached VIII or above; the second most vulnerable equipment was the circuit breaker, and the damage was most likely to occur when the instrument intensity was IX or above . (3) The damage rate curves of lightning arresters, current mutual inductors, voltage mutual inductors and isolating switches were relatively close to each other and the damage probability was the highest when the instrumental intensity was about X.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Material identification based on R_value (transparency natural logarithm ratio of low-energy to high-energy) of line-scan dual-energy X-ray transmission (DE-XRT) has a good prospect for industrial application. Unfortunately, the DE-XRT signals before attenuation cannot be directly measured, whereas their precision is very important to R_value. Therefore, a context-based signal synthesis method which takes the filtered signals that remove high-frequency noises and retain low-frequency actual fluctuations as the reference value, and takes into account the vertical (forward/column) direction and horizontal (scanning/row) direction anisotropy of line-scan images was proposed. The vertical is a time series with continuity of signal trend; the horizontal is a spatial characteristic with the fluctuation synchronization within the same row signals. The special synthesis evaluations of curve synthesis difference and surface synthesis difference were also proposed. Experimental results show that the tow evaluations are both only about 0.0007, and it only takes 35 ms to complete the surface synthesis of 119×119 pixels on the CPU with 3.4 GHz main frequency. The presented method can achieve high signal synthesis precision and calculation real-time, so as to facilitate DE-XRT material identification. It can be extended to improve the precision of numerical synthesis in other line-scan uncomplete signals.

Chinese Taihe Black-bone silky fowl (TBsf) is the homology of medicine and food and has high nutritional and medical value all over the world. However, the nutritional compositions and specific metabolite advantages of Taihe silky fowl muscle are still poorly understood. In this study, we investigated the differences of nutritional components between TBsf and another similar breed (Black Feathered chicken and laid green-shelled eggs, BF-gsc). Meanwhile, we also explored the divergences in muscle characteristics of Taihe silky fowl fed with two different diets, that is normal chicken feed (TBsf-ncf) and Broussonetia papyrifera-fermented feed (TBsf-bpf). Firstly, the growth performance and biochemical index of Taihe silky fowl was significantly different compared with black-feathered chicken. Secondly, we identified the metabolic alterations in Taihe silky fowl by performing an un-targeted UHPLC-Q-TOF-MS/MS analysis. Our results suggested that the whole metabonomic characteristics had obvious separation between TBsf-ncf, TBsf-bpf and BF-gsc groups both in the positive and negative ion mode by PCA analysis. Next, OPLS-DA multivariate analysis revealed that 57 metabolites (in positive mode) and 49 metabolites (in negative mode) were identified as differential metabolites between TBsf-ncf and BF-gsc group. These differential metabolites were mainly enriched to ABC transporters, biosynthesis of amino acids and aminoacyl-tRNA biosynthesis. Besides, there were 47 metabolites (in positive) and 13 metabolites (in negative) were differentially regulated between TBsf-ncf and TBsf-bpf group, which were majorly involved in histidine metabolism and linoleic metabolism. Furthermore, the integrated network analysis suggested that DL-arginine, DL-isoleucine, linoleoylcarnitine, stearoylcarnitine (positive) and ricionleic acid, D-proline, uric acid (negative) were the significantly metabolic biomarkers in Taihe silky fowl. Moreover, the metabolites of primaquine, ticlpoidine, riboflavin, acetylcarnitine (positive) and salicylic acid, acetaminophen sulfate, glutamic acid (negative) were markedly changed in the Taihe silky fowl fed with BP-fermented feed. In summary, a global survey of the nutritional components and metabolite differences were performed in muscle tissues of Taihe silky fowl between various breeds and feeds. The comprehensive expression profiles of the metabolites in Taihe silky fowl affected by genetic and environmental factors were acquired. This study provided valuable evidence fo breed and feed-induced putative biomarkers as well as improved the economic value of Taihe silky fowl through targeted metabolite regulation.

This study aimed to investigate the fatigue performance and interfacial strengthening mechanisms of Al6061-to-Cu dissimilar lap joints via electromagnetic pulse welding (EMPW). The load-bearing capacity of the joints at discharge voltages of 14 kV and 16 kV was superior to that of 12 kV. Furthermore, the fatigue life of the 14 kV joints was one order of magnitude higher compared to the 12 kV joints. SEM observation of the fatigue fracture surface revealed the presence of typical "tire-mark" fatigue striations only in the 14 kV joint, indicating higher ductility and the ability to withstand extended plastic deformation. Notably, ultra-fine nanocrystalline Al2Cu phase, amorphous phase, and numerous dislocations hindered EBSD acquisition in the transition zone. Nevertheless, dense low-angle grain boundaries (LAGBs) and refined grains were examined at the bonding interface. This suggests that the high-velocity collision caused severe plastic deformation and led to the formation of substructures. The interfacial strength was attributed not only to the "wave-like" or "inverted hook-like" diffusion layer but also to the presence of refined grains along the interface and nanocrystalline Al2Cu in the transition zone. Furthermore, the hybrid nanocrystalline-amorphous microstructure strengthened the joint by regulating the balance between strength and ductility.

The alignment of nanostructures in materials such as lyotropic liquid crystals (LLCs) templated materials has the potential to signicantly improve their performances. However, accurately characterising and quantifying the alignement of such fine structures remains very challenging. In situ small angle X-ray scattering (SAXS) and molecular dynamics were employed for the first time to understand the hexagonal LLC alignment process with magnetic nanoparticles under a magnetic field. The enhanced alignment has been illustrated from the distribution of azimuthal intensity in the samples exposed to magnetic field. Molecular dynamics simulations reveal the relationship between the imposed force of the magenetic nanoparticles under magnetic field and the force transferred to the LLC cylinders which leads to the LLC alignment. The combinational study with experimental measurement and computational simulation will enable the development and control of nanostructures in novel materials for various applications.

(1) Background: Substantial evidence that neural timing deficits are prevalent in developmental disorders, aging, and concussions resulting from a mild Traumatic Brain Injury (mTBI) is presented. We show that if timing deficits are remediated using low-level movement discrimination training, then high-level cognitive skills, including reading, attention, processing speed, and working memory improve substantially. (2) Methods: Two case studies are presented using MEG source imaging on an adult dyslexic, and a healthy older adult observed before and after training on movement discrimination two times/week for 8 weeks for adult dyslexic. (3) Results: We found improvements in reading, attention, processing speed, and working memory on neuropsychological tests. Substantial MEG signal increases in visual Motion Networks (V1, V3, MT, MST), Attention Networks (ACC, dlPFC, vlPFC and precuneous/ PCC areas) and Memory Networks (dlPFC). (4) Conclusions: Improving neural timing deficits before cognitive exercises to improve specific cognitive skills provides a rapid and effective method to improve cognitive skills. Improving the timing and sensitivity of low-level dorsal pathways, improving feedforward and feedback pathways, is essential to improve high-level cognitive skills. This adaptive training with substantial feedback shows cognitive transfer to tasks not trained on, significantly improving a person’s quality of life rapidly and effectively.

Frontal Polymerization (FP) is recognized as a polymer synthesis method capable of generating a highly localized and self-propagating exothermic front, considered a more rapid and energy-efficient manufacturing scheme for polymer-based fiber-reinforced composite materials. This study conducts a numerical investigation based on the Finite Element Method into the initiation and propagation of frontal polymerization of acrylamide. Utilizing Differential Scanning Calorimetry (DSC) experiments, the study phenomenologically tests the curing kinetics reactions of acrylamide (AM) in deep eutectic solvent (DES)-based polymerizable systems, thereby establishing a curing kinetics model for the autocatalytic reaction of polyacrylamide. By coupling the heat conduction diffusion equation of the frontal polymerization reaction, the Finite Element Method is employed to solve the reaction-diffusion model, aiming to explore the evolution of temperature and degree of curing during the manufacturing process. The results demonstrate the reliability and accuracy of the nth-order autocatalytic model in the study of curing kinetics for DES-based synthesis, indicating that the front propagation speed of the AM-based FP reaction is influenced by the activation temperature, duration of activation temperature, and initial temperature of the solution. Experimental validation of the polyacrylamide manufacturing through frontal polymerization corroborates the accuracy and reliability of the model predictions, providing a reference for the numerical model study and temperature control in the synthesis of acrylamide composite hydrogels via FP.

Suitable soil structure and nutrient security are important for plant growth and development, characteristics of soil fractal dimension and distribution of physical and chemical properties and their interactions play an important role in studying the stability of soil structure and water and fertilizer cycles. As a sustainable management model, intercropping has positive benefits for erosion control, spatial optimization of resources, as well as improving system productivity. The effects of four intercropping methods on soil fractal dimension and physicochemical properties were investigated by intercropping Salvia miltiorrhiza with forage and S. miltiorrhiza with forest under typical karst rock desertification habitats in Guizhou. The results showed that soil nutrient content of intercropping was significantly higher than that of monoculture, the organic carbon content of soil grown under forest is higher than other treatments, and there was a non-significant change in soil water content of intercropping compared with monoculture. The soil fine-grained matter of intercropping was significantly higher than that of monoculture, while the soil fractal dimension showed a tendency to become larger with the increase of fine-grained matter. The intercropping planting, due to its component types and spatial and temporal configurations, leads to differences in soil water and fertilizer interactions, which can be combined with other ecological restoration measures to optimize the composite model and jointly promote the restoration and development of ecologically fragile areas.

Brain-stimulation reward, also known as intracranial self-stimulation (ICSS), is a commonly used procedure for studying brain reward function and drug reward. In electrical ICSS, an electrode is surgically implanted into the medial forebrain bundle in the lateral hypothalamus or the ventral tegmental area in the midbrain. Operant lever responding leads to the delivery of electrical pulse stimulation. The alteration in the stimulation frequency-lever response curve is used to evaluate the impact of pharmacological agents on brain reward function. If a test drug induces a leftward or upward shift in the ICSS response curve, it implies a reward-enhancing or abuse-like effect. Conversely, if a drug causes a rightward or downward shift in the functional response curve, it suggests a reward-attenuating or aversive effect. A significant drawback of electrical ICSS is the lack of cellular selectivity in understanding the neural substrates underlying drug reward versus aversion. Excitingly, recent advancements in optical ICSS (oICSS) have facilitated the development of at least three cell type-specific oICSS models – dopamine-, glutamate-, and GABA-dependent oICSS. In these new models, a comparable frequency-rate response curve has been established and employed to study the substrate-specific mechanisms underlying brain reward function and a drug's rewarding versus aversive effects. In this review article, we summarize recent progress in this exciting research area. The findings in these new behavioral models have not only increased our understanding of the neural mechanisms underlying drug reward and addiction but have also introduced a novel experimental approach in preclinical medication development for treating substance use disorders.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Convolutional neural networks (CNNs) face challenges in capturing long-distance text correlations, and Bidirectional Long Short-Term Memory (BiLSTM) networks exhibit limited feature extraction capabilities for text classification of work order. To address the abovementioned problems, this work utilizes an ensemble learning approach to integrate model elements efficiently. This study presents a method for classifying work order texts using a hybrid neural network model called BERT-BiLSTM-CNN. First, use Bert for preprocessing to obtain text vector representations. Then, capture context and process sequence information through BiLSTM. Next, capture local features in the text through CNN. Finally, obtain classification results through Softmax. Through comparative analysis, the method of fusing these three models is superior to other hybrid neural network model architectures in multiple classification tasks. It has a significant effect on work order classification.

Nanling Mountain region is a typical southern hilly region, which plays an important ecological and environmental protection role in China's overall land protection pattern. Based on the remote sensing image data of Longnan City in Nanling Mountain in 2013, 2018 and 2023, this paper interpreted the land use type and analyzed the land use transfer situation by using Land use transfer flow, and Land use transfer matrix. At the same time, based on the remote sensing Ecological index (RSEI) model, the ecological environment quality of Longnan City from 2013 to 2023 was retrieved. The temporal and spatial response model of ecological environment quality to land use transfer in Longnan City from 2013 to 2023 was discussed based on Spatial autocorrelation and Geographic detector. The results show that from 2013 to 2023, the decrease of forest land (16.23km²) and the increase of construction land (13.25km²) were the main land use transfer in Longnan City. The ecological environment index of Longnan City in 2013, 2018 and 2023 was 0.789, 0.917 and 0.872, respectively, showing a trend of "first rising and then decreasing". The ecological environment quality in the north of Longnan City was significantly lower than that in the south, and the poor ecological quality area appeared in and around the northern main urban area, showing a trend of "inward contraction". Forest land, garden land, grassland, cultivated land and water area have a positive impact on ecological environment quality, while traffic land, construction land and other land have a negative impact on ecological environment quality. The response of ecological environment quality to different land use transfer modes is related to the change of the overall ecological environment quality. The interaction between LUCC and other factors had a great impact on the evolution of ecological environment quality in Longnan City.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

The volatile fatty acids (VFAs) productions, as well as particulate organics decomposition, soluble chemical oxygen demand (SCOD) yield, and the VFAs production pathways, of mesophilic and thermophilic anaerobic fermentation were investigated. Batch experiments showed that the decomposition rate of volatile suspended solids (VSS), particulate carbohydrate (P-C) and particulate protein (P-P) followed the first-order kinetic model at different temperature. However, the intermediates， accumulated in the process of protein or carbohydrate digestion had a more significant inhibitory effect on the production of VFAs during the mesophilic anaerobic acidification process. Thermophilic fermentation led to more accumulation of VFAs compared to mesophilic fermentation. Then 13C stable isotope labeling experiment demonstrated that, acetic (HAc), propionic (HPr) and butyric (HBu) could be produced from carbohydrate and protein digestion, but valeric (HVa) was only generated from the degradation of protein. Finally, the possible pathway of HVa synthesis was proposed.

The aim of this study as to determine the relationship between the factors of demography, comor-bidity, medication, lifestyle, and access to health services related to the QoL of people with hy-pertension and its complications in Sleman Regency, Yogyakarta. The study was conducted in a cross-sectional manner using data from Sleman HDSS (Health and Demographic Surveillance System) from 2015 to 2018 in cycles 3 and 2 with the inclusion criteria of hypertensive patients and their complications aged 25 years or older obtained by using a total sampling of 532 people. Measurement of QoL using Short Form 12v2 2a and 2b questionnaires presented in the Physical Component Summary (PCS) and Mental Component Summary (MCS). Data analysis using Mann-Whitney test and Kruskal Wallis test. The results showed factors related to the QoL in PCS were variables of gender, age, diagnosis of hypertension and its complications, the presence of comorbidities, fatty foods, drug consumption in the last two weeks, while factors related to the mental component (MCS) were education and occupation seen from the p-value <0.05. QoL with hypertension and its complications influence and decrease the physical than the patient's mental condition.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Purpose: Pancreatic cancer (PAAD) is one of the most lethal malignancies. Immunotherapy is largely ineffective in PAAD. T-cell exhaustion contributes to the resistance for immunotherapies. We investigated the prognostic potential of T cell exhaustion-related genes (TEXGs). Methods: Single-cell RNA (scRNA) sequencing dataset from TISCH, and bulk sequencing datasets from TCGA and GTEx were applied to screen differently expressed TEXGs. Kaplan-Meier survival, LASSO regression, and Univariate/Multivariate Cox regression analysis were performed to construct TEXGs risk model. This model was used to predict the prognosis, tumor immune microenvironment, and immunotherapy response. PAAD cohorts from ICGC and GSE71729 datasets were used to validate this risk model. Pan-cancer expression of SPOCK2 was performed in TISCH database. Results: A six-gene (SPOCK2, MT1X, LIPH, RARRES3, EMP1, and MEG3) risk model was constructed. Low-risk PAAD patients had longer survival time in both training dataset (TCGA-PAAD, n=178) and validation datasets (ICGC-PACA-CA, ICGC-PAAD-US, and GSE71729, n=412). Multivariate Cox regression analysis demonstrated that the risk score was an independent prognostic variable for PAAD. High-risk patients correlated with cancer-related KEGG pathway enrichment, higher mutation frequency of KRAS and TP53 genes, and immunosuppressive status. Immunohistochemistry staining confirmed the changes of TEXGs in clinical samples. Moreover, pan-cancer scRNA sequencing datasets from TISCH analysis indicated that SPOCK2 might be a novel marker of exhausted CD8+ T cells. Conclusion: In conclusion, we established and validated a T cell exhaustion-related prognostic signature for PAAD patients. Moreover, our study suggests that SPOCK2 may be a novel marker of exhausted CD8+ T cells.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Technological advances in tea production are critical to meet global demands for tea consumption. To illuminate differences in the scientific and commercial relevance of research programs between major tea-related research organizations around the world, we conducted a bibliometric analysis comparing the scientific outputs, including peer-reviewed publications and patents, of six major research organizations published between January 01, 2008 and July 11, 2020. For this competitive ranking analysis, we examined a number of papers, research topics, academic influence, capacity for development, capacity for collaboration, and capacity for technological innovation. Among the six research organizations, Anhui Agricultural University (in China) had the most publications, while the Chinese Academy of Agricultural Sciences, Tea Research Institute showed a higher capacity for development. The Council for Scientific and Industrial Research (in India) and the University of Shizuoka (Japan) both showed high academic influence, while the University of Shizuoka, Tea Research Association Tocklai and National Agriculture and Food Research Organization (Japan) showed a high capacity for collaboration. The Chinese Academy of Agricultural Sciences, Tea Research Institute applied for the most patents, while the Council for Scientific and Industrial Research applied for the most international patents.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

At different heat treatment temperatures, the hardness and flexural strength of M2 high-speed steel selective laser melting (SLM) parts show mixed trends. When the heat treatment temperature is 260°C, the hardness and flexural strength of the M2 high-speed steel SLM part are decreased, but the hardness difference between the upper and lower surfaces of the M2 high-speed steel SLM part is also reduced. When the heat treatment temperature is 560°C, the hardness and flexural strength of the M2 high-speed steel SLM part are almost close to that of the original M2 high-speed steel SLM part, and the performance gradient in the sample is improved, and the overall structure is uniform. When the subsequent heat treatment temperature is 860 °C, the hardness of the SLM parts reaches a minimum, with an average value of 24 HRC. However, the flexural strength exceeds that of the original SLM parts. Moreover, the microstructure of the sample is uniform, which significantly improves the anisotropy of performance.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Pathogens, especially invasive species, have caused significant global ecological, economic, and social losses in forests. Plant disease research has traditionally focused on direct interactions between plants and pathogens in an appropriate environment. However, recent research indicates that the microbiome can interact with the plant host and pathogens to modulate plant resistance or pathogen pathogenicity, thereby altering the outcome of plant–pathogen interactions. Thus, this presents new opportunities for studying the microbial management of forest diseases. Compared to parallel studies on human and crop microbiomes, research into the forest tree microbiome and its critical role in forest disease progression has lagged. The rapid development of microbiome sequencing and analysis technologies has resulted in the rapid accumulation of a large body of evidence regarding the association between forest microbiomes and diseases. These data will aid the development of innovative, effective, and environmentally sustainable methods for the microbial management of forest diseases. Herein, we summarize the most recent findings on the dynamic structure and composition of forest tree microbiomes in belowground and aboveground plant tissues (i.e., rhizosphere, endosphere, and phyllosphere), as well as their pleiotropic impact on plant immunity and pathogen pathogenicity, highlighting representative examples of biological control agents used to modulate relevant tree microbiomes. Lastly, we discuss the potential application of forest tree microbiomes in disease control as well as their future prospects and challenges.

Target recognition mainly includes three approaches: optical image-based, echo detection-based, and passive signal analysis-based methods. Among them, the passive signal-based method is closely integrated with practical applications due to its strong environmental adaptability. Based on passive radar signal analysis, we design an "end-to-end" model that cascades a noise estimation network with a recognition network to identify working modes in noise environment. The noise estimation network is implemented based on U-Net, which adopts a method of feature extraction and reconstruction to adaptively estimate the noise mapping level of the sample, which can help the recognition network to reduce noise interference. Focusing on the characteristics of radar signal, the recognition network is realized based on Multi-Scale Convolutional Attention Network (MSCANet). Firstly, the deep group convolution is used to isolate the channel interaction in the shallow network. Then, through the multi-scale convolution module, finer-grained features of the signal are extracted without increasing the complexity of the model. Finally, the self-attention mechanism is used to suppress the influence of low-correlation and negative-correlation channels and spaces. This method overcomes the problem that the conventional method is seriously disturbed by noise. We validated the proposed method in 81 kinds of noise environments, achieving an average accuracy of 94.65%. Additionally, we discussed the performance of six machine learning algorithms and four deep learning algorithms. Compared to these methods, proposed MSCANet achieved an accuracy improvement of approximately 17%. Our method demonstrates better generalization and robustness.

The portal website of a university or a college usually represents the cultural characteristics and teaching advantages and plays a vital role in higher education, showing the style of the university or college to society and improving the admission rate. Mississippi State (MS) is bounded by the Mississippi River in the west and the Gulf of Mexico in the south, with a population of 3.1 million. It has a rich cultural heritage, and many universities, especially historically black colleges and universities (HBCUS), have strong scientific research strength in agriculture, medicine, petrochemicals and papermaking. Therefore, this article will analyze the design of the portal websites of four HBCUs in Mississippi from two aspects: user experience (UE) and functional architecture (FA), determine their advantages, disadvantages, similarities and differences, and propose some optimization suggestions.

Large language model (LLM) is a representation of a major advancement in AI, and has been used in multiple natural language processing tasks. Nevertheless, in different business scenarios, LLM requires fine-tuning by engineers to achieve satisfactory performance, and the cost of achieving target performance and fine-tuning may not match. Based on the Baidu STI dataset, we study the upper bound of the performance that classical information retrieval methods can achieve under a specific business, and compare it with the cost and performance of the participating team based on LLM. This paper gives an insight into the potential of classical computational linguistics algorithms, and which can help decision-makers make reasonable choices for LLM and low-cost methods in business R&D.

While the language model using the stop sign as an independent token has been widely used to decide when the model should stop, it may lead to the growth of vocabulary dimensions and further problems. Similarly, present research on game algorithms usually estimate stopping point related problems based on the evaluation of the winning rate. However, information redundancy may also exist in such models, thus increasing the training difficulty. Above two types of tasks (and similar autoregressive tasks) show a common problem of stopping point prediction. In this paper, we describe a design of separated model, trying to separate the complexity of stopping point prediction from the main task model, so that the information used for estimating stopping point can be reduced. On this basis, in order to verify the rationality of using separated model, we propose a model-free test method. It judges the separability of transformed data based on point difference and sequence difference metrics. In this way, it can predict the credibility of the separated model inference.

Directed energy deposition (DED) is an efficient method to fabricate functionally graded materials (FGMs) with gradient composition and complex structures, allowing for local tailoring of properties instead of the costly need for extraneous welds and joints. In this study, a FGM from stainless steel to Inconel alloy was successfully fabricated using the powder-based laser DED. A very refined grain structure has been observed in at the composition with 75 wt.% Inconel alloy content, which also exhibits the highest (entropy). For the first time, the post heat treatments, microstructure and aging precipitation behaviors of FGMs were systematically studied via experimental characterization and computation, to elucidate their effects on the gradient smoothing and mechanical properties. The diffusion and segregation of Ni, Nb and Ti elements underly the transformation mechanism between Laves, δ, γ’ and γ’’ phases during precipitation. Homogenization on FGMs not only eliminates the heterogeneity inherited from the AM process, but also provides a practical way to smoothen the gradient on composition and microstructure for the eventual good gradient properties. It has a direct influence on the following precipitation behaviors in the FGM, which highly relies on the diffusion degree of the elements in the matrix and grain boundaries. The high-throughput thermodynamic modeling and kinetic modeling were exploited to evaluate the experimental microstructure and address computational uncertainty using different thermodynamic conditions and databases, which enables an accelerated design through local tailoring of process-structure-property relationships to develop new functional materials.

Abstract: Dispersal strategies of a species can affect its invasion success. Investigation into the dispersal strategies of invasive species in relation to different factors helps our understanding of the invasion mechanisms and provides knowledge for population management and invasion evaluation. Tetranychus ludeni Zacher (Acari: Tetranychidae) is an invasive species, which is native to Europe but now cosmopolitan. Here, we examined the effects of age and density on dispersal in mated females. Our results show that older females with more eggs were more likely to disperse and moved longer distances than younger ones with fewer eggs. Older females spread most of their eggs out of the natal habitats and over longer distances, which reduced competition and increased offspring fitness. Females significantly increased dispersal probability and distance with the increase of population density to avoid crowding. The synchronization of dispersal and reproduction, along with the positive density-dependent dispersal strategy, may facilitate habitat colonization and invasion speed of T. ludeni.

We previously showed that feeding mice a diet containing 1% mantle tissue decreased food consumption, leading to death. We also isolated and identified toxic substances in the mantle tissue. In the present study, we investigated the characteristics and stability of mantle tissue toxicity. Treatment of mantle tissue with 1 mM HCl, 1 mM NaOH, 1 mM dithiothreitol, and 1 mM H2O2 and heating did not reduce the toxicity of mantle tissue in mice. These results suggest that mantle toxins are stable in tissues, particularly when exposed to acidic and digestive enzymes. We examined whether mantle tissue exhibited acute toxicity. Diets containing 1% and 20% mantle extract showed similar levels of toxicity, demonstrating that feeding of mantle tissue does not lead to acute toxicity. Finally, we examined the toxicity of the mantle tissue against small intestinal tissue. Chronic feeding of mantle tissue to mice changed the color of the small intestine. Real-time PCR analysis showed that mantle tissue feeding caused changes of inflammation and endoplasmic reticulum stress markers in the small intestine. These results suggest that feeding of mantle tissue causes toxicity after causing initial damage to the small intestinal tissue.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

In this work, cobalt doped ZnO nanorod arrays with anticorrosion function were successfully prepared on FTO substrate by a simple aqueous solution method. XRD and EDS results indicate the doped Co2+ has successfully incorporated into the ZnO crystal lattice. Photocurrent density and open circuit potential (OCP) results indicate the photocathodic protection performance for 316 stainless steel (316 SS) and Q235 carbon steel in 3.5 wt.% NaCl solution under 300 W Xe lamp enhanced with the increase of cobalt concentration, and the photoanode with 15% Co/Zn ratio has the optimal photocathodic protection effect. The mechanism of enhancement may be result from the narrowed band gap, the lower recombination rate of photogenerated electron-holes, the intermediate impurity level and the split of the hypo-outer shell of cobalt ions.

Objective: The aim of this study was to optimize the fermentation process of Radix Ranunculi ternate via microbial fermentation and analyze the changes in the contents of the main components, the antioxidant and hypoglycemic capacities of the extract before and after fermentation. Methods: The solid-state fermentation process was optimized using single-factor tests and the response surface method, with the yield of the alcohol extract of R. ternate as an evaluation index. Results: The best fermentation process was optimized using solid-state endophytic fungus fermentation technology as follows: strain addition ratio of Chaetomium globosum/Fusarium equiseti =1:1, fermentation for 5 d, sieve size of 40 mesh, liquid/material ratio of 0.8:1 mL·g−1, fermentation temperature of 31 °C, and inoculation amount of 7.5%. Under the optimized conditions, the contents of the water-soluble extract and total polysaccharides decreased by 12.71% and 12.95%, respectively, in the fermentation, The contents of ethanol-soluble-extract, flavonoids, saponins, polyphenols, organic acids, and total amino acids of fermented R. ternate increased by 19.77%, 57.14%, 79.67%, 14.29%, 17.63% and 3.82%, respectively, and the scavenging rate for DPPH, ABTS+, ·OH free radicals and inhibitory rate for α-amylase also increased by 19.02%, 14.17%, 7.53% and 34.54%, respectively, compared with unfermented R. ternate. Conclusions: Solid-state fermentation opens new avenues for the development and application of R. ternate as natural antioxidant and hypoglycemic food.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Outbreaks of coronavirus disease 2019 (COVID-19) have been recorded in different countries across the globe. The virus is highly contagious, hence early detection, isolation, and quarantine of infected patients will play an important role in containing the viral spread. Diagnosis in a mobile lab can aid to find infected patients in time. Here, we develop a field-deployable diagnostic workflow that can reliably detect COVID-19. Instruments used in this workflow could easily fit in a mobile cabin hospital and also be installed in the community. Different steps from sample inactivation to detection were optimized to find the fastest steps and portable instruments in detection of COVID-19. Each step was compared to that of the normal laboratory diagnosis set-up. From the results, our proposed workflow (80 min) was two times faster compared to that of the normal laboratory workflow (183 min) and a maximum of 32 samples could be detected at each run. Additionally, we showed that using 1% Rewocid WK-30 could inactivate the novel coronavirus directly without affecting the overall detection results. Comparison of our workflow using an in-house assay to that of a commercially acquired assay produced highly reliable results. From the 250 hospital samples tested, there was a high concordance 247/250 (98.8%) between the two assays. The in-house assay sensitivity and specificity were 116/116 (100%) and 131/134 (97.8%) compared to that of the commercial assay. Based on these results, we believe that our workflow is fast, reliable, adaptable and most importantly, field deployable.

The minimum dominating tree (MDT) problem consists of finding a minimum weight sub-graph from an undirected graph, such that each vertex not in this sub-graph is adjacent to at least one of the vertices in it, and the sub-graph is connected without any ring structures. This paper presents a Dual Neighborhoods Search (DNS) algorithm for solving the MDT problem, which integrates several distinguishing features, such as two neighborhoods collaboratively working for optimizing the objective function, a fast neighborhood evaluation method to boost the searching effectiveness, and several diversification techniques to help the searching process jump out of the local optimum trap thus obtaining better solutions. DNS improves the previous best-known results for 4 public benchmark instances while providing competitive results for the remaining ones. Several ingredients of DNS are investigated to demonstrate the importance of the proposed ideas and techniques.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Three-phase AC electric arc furnace (EAF) is a typical non-linear load, causing many power quality problems. Most of the researches on the voltage problems of EAF mainly focus on the voltage fluctuation, and less on the transient voltage problems caused by EAF short circuit and open circuit. In this paper, the relationship between voltage and current of EAF is obtained by combining hyperbolic function and exponential function, then the white noise and chaotic circuit are added to establish the EAF model which is suitable for the study of voltage fluctuation and transient voltage. This paper analyzes the causes of the transient voltage problem of the EAF, calculates the short-circuit current, reactive impact and the influence on voltage at the point of common coupling (PCC) in the three-phase short-circuit of the EAF, and compares the calculation results with the simulation results to prove the accuracy of this model. The results show that the reactive impact of three-phase short circuit is about twice as much as that of normal operation of EAF, resulting in about 30% voltage sag at the PCC, which is very unfavorable to the power grid. This paper provides reference for transient power quality evaluation and dynamic reactive power compensation of EAF.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Introduction: Cervical cancer is the fourth most common cancer in women globally and the most common cancer in Tanzania, resulting in about 9772 new cases and 6695 deaths each year. Research has shown an association between low levels of risk perception and knowledge of the prevention, risks, signs, etiology, and treatment of cervical cancer and low screening uptake, as contributing to high rates of cervical cancer-related mortality. However, there is scant literature on the perspectives of a wider group of stakeholders (e.g., policymakers, healthcare providers (HCPs), and women at risk), especially those living in rural and semi-rural settings. Methods: We adapted Risso-Gill and colleagues’ framework for a Health Systems Appraisal (HSA), to identify HCPs' perspective of the extent to which health system requirements for effective cervical cancer screening, prevention, and control are in place in Tanzania. We adapted interview topic guides for cervical cancer screening using the HSA framework approach. Study participants (69 in total) were interviewed between 2014-2018 –participants included key stakeholders, HCPs, and women at risk for cervical cancer. The data was analyzed using reflexive thematic analysis methodology. Results: Seven themes emerged from our analysis of semi-structured interviews and focus groups: 1) knowledge of cervical cancer risk and the role of screening and preventive care/services (e.g., prevention, risks, signs, etiology, and treatment), 2) training and knowledge of HCPs, 3) knowledge of cervical cancer screening among women at risk, 4) beliefs about cervical cancer screening, 5) role of traditional medicine, 6) risk factors, and 7) symptoms and signs. Conclusion: It is evident that there is a low level of knowledge of cervical cancer risk and the role of screening and preventive services among stakeholders, HCPs, and women living in rural and semi-rural locations in Tanzania. There is a critical need to implement more initiatives and programs to increase the uptake of screening and related services and allow women to make more informed decisions on their health.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Visualization of the seabed terrain is one of the key functions of marine geographic information system. The major challenge here is that the obtained data for seabed terrain usually consists of elevation and sediment only but does not include remote sensing images, which is important for ground terrain visualization, as they can be used as textures to reveal detailed information and achieve realistic visual results. Existing seabed terrain visualizing methods (including annotations, color-mapping, and texture-mapping) have limitations in reality and intuition, as they are inadequate to express the physical characteristics of sediment accurately. This paper presents a novel and advanced 3D visualization method of seabed terrain, which introduces the Physically Based Rendering (PBR) theory into the field of geographic visualization. We analyze the main categories of seabed sediments and their optical features respectively, then develop a procedural method to generate physically based rendering materials for different sediments. Then an enhanced bidirectional reflectance distribution function is employed to achieve accurate and intuitive terrain rendering. We also refine the texture sampling method and propose a procedural seabed objects generation method to construct a more natural and realistic undersea environment. Experimental results reveal our method can make good use of the limited seabed terrain data and get significant improvements in visual effect, which can help users to cognize and analyze the seabed geographic environment more accurately and intuitively.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Surface finishing is challenging for additively manufactured components with complex geometries. Magnetic abrasive finishing (MAF) is a promising surface finishing technology that can refine the surface quality of components with complex shapes produced by additive manufacturing. However, there is insufficient study regarding the impact of MAF on microstructure-property relationships for additively manufactured builds, which is critical for evaluating the mechanical performance. Furthermore, although MAF is usually used as the final step of post-processing, it remains unclear whether adjusting the sequence between MAF and other processes, e.g., heat treatment, can potentially improve the mechanical performance. In this work, the effects of MAF on the microstructure and mechanical property evolution of Inconel 718 superalloys made by laser powder bed fusion (LPBF) were studied. The application of MAF was found to significantly reduce the surface roughness of alloys and refine the grain size of aged samples. Moreover, MAF is able to increase the elongation of materials, which can be further influenced by the sequence of MAF and different heat treatments. The highest elongation can be achieved when MAF is performed between homogenization and aging processes. This work demonstrated a promising solution to improving the performance of LPBF Inconel 718 by combining MAF and heat treatment, which provides new perspectives on the post-processing development of additively manufactured alloys for advanced mechanical properties.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

A comprehensive review on symmetry and conditional symmetry is made from the core conception of symmetry and conditional symmetry. For a dynamical system, the structure of symmetry means its robustness against the polarity change of some of the system variables. Symmetric systems typically show symmetrical dynamics and even when the symmetry is broken, symmetric pairs of coexisting attractors are born annotating the symmetry in another way. The polarity balance can be recovered by the combinations of the polarity reverse of system variables, and furthermore, it can also be restored by the offset boosting of some of the system variables if the variables lead to the polarity reverse from their functions. In this case, conditional symmetry is constructed giving a chance for a dynamical system outputting coexisting attractors. Symmetric strange attractors typically represent the flexible polarity reverse of some of the system variables, which brings more alternatives of chaotic signal and more convenience for chaos application. Symmetric and conditionally symmetric coexisting attractors can also be found in memristive systems and circuits. Therefore, symmetric chaotic system and those of conditional symmetry provide sufficient system options for chao-based applications.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.