The leaves of Ligustrum robustum have been applied as Ku-Ding-Cha, a functional tea to clear heat and remove toxins; and served as a folk medicine to deal with diabetes, obesity, and hypertension. Trans-p-hydroxycinnamic acid and its esters, which were isolated from the leaves of L. robustum, might be a new resource to prevent diabetes and its complications because of their strong -glucosidase and fatty acid synthase (FAS) inhibitory activities and antioxidant effect. However, the quantitative analytical method for trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum hasn’t been reported so far. In addition, it was difficult and troublesome to analyze no less than 34 trans-p-hydroxycinnamic acid esters by usual HPLC. Therefore, a new HPLC-UV method using hydrolyzation with sodium hydroxide for quantitation of trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum was developed in the present study. The optimal hydrolyzation conditions were as follows: 1 mL sodium hydroxide aqueous solution (1 M) was added into 1 mL the extract of L. robustum and incubated at 80 °C for 2 h , and then 1 mL hydrochloride (1 M) solution was added. HPLC analysis was performed in reverse phase mode using a C-18 column, eluting with methanol-0.1% acetic acid aqueous solution (40:60, v/v) in isocratic mode at a flow rate of 1.0 mL/min, and detecting at 310 nm. The analytical method was simple and rapid, which simplified greatly the analytical process. The method was validated in terms of linearity, limit of detection (LOD), limit of quantification (LOQ), precision, and accuracy. High linearity was demonstrated with correlation coefficient of 1.000 for trans-p-hydroxycinnamic acid. The LOD and LOQ values were 1.55 and 4.69 μg/mL, respectively. The relative standard deviations (RSD) of intra-day and inter-day variabilities for trans-p-hydroxycinnamic acid were less than 2%. The percentage recovery of trans-p-hydroxycinnamic acid was 101.2% ± 0.8%. Finally, the proposed method was applied successfully to the determination and comparison of the contents of trans-p-hydroxycinnamic acid and its esters in various extracts of the leaves of L. robustum. The 60%-70% ethanol extracts of L. robustum showed the highest contents of free trans-p-hydroxycinnamic acid (3.96-3.99 mg/g), and the 50%-80% ethanol extracts of L. robustum displayed the highest contents of trans-p-hydroxycinnamic acid esters (202.6-210.6 mg/g). The method can be applied also to the quality control of the products of L. robustum.

We present three reduced integrable hierarchies of nonlocal integrable NLS type equations from a vector integrable hierarchy associated with a matrix Lie algebra, not being A type. Three similarity transformations are taken to keep the invariance of the transformed zero curvature equations. The key step is to formulate a solution to a reduced stationary zero curvature equation so that the zero curvature formulation works for a reduced case.

'Huangguan' pear has significant social and economic value, and phosphorus, as one of the three main mineral elements of plants, has an irreplaceable effect on the normal growth of 'Huangguan' pear trees. The objective of this study was to predict the content of phosphorus in the pulp and peel of ‘Huangguan’ pears nondestructively and conveniently by using near-infrared spectroscopy (900–1700 nm) technology. First, twelve algorithms are used to preprocess the original spectral data, and the partial least squares regression algorithm and the gradient boosting regression tree algorithm are used to build a full-band prediction model based on the original spectral data and the processed spectral data. The characteristic wavelengths were extracted using genetic algorithms, followed by establishing a characteristic wavelength prediction model. The prediction accuracy of the models was evaluated according to the coefficient of determination R² and the relative analysis error RPD. The study found that the best prediction model for predicting phosphorus content in the pulp of 'Huangguan' pear was MSC-GA-PLSR, which had R²=0.843 and RPD=1.857 in the modelling set and R²=0.989 and RPD=7.041 in the prediction set. The best prediction model for predicting phosphorus content in the peel of ‘Huangguan’ pear was SG+SNV+FD-GA-PLSR, which had R²=0.991 and RPD=7.470 in the modelling set and R²=0.974 and RPD=4.414 in the prediction set, and the effect was good and met expectations. The results demonstrated that near-infrared spectroscopy could successfully achieve nondestructive detection of phosphorus content in the pulp and peel of 'Huangguan' pears.

Strigolactones (SLs) are a novel emerging plant hormones, which play important roles in regulating plant organ development and environmental stress tolerance. Even though the SL related genes have been identified and well characterized in some plants. The information of SL related genes in soybean is not fully established yet, especially in response to salt stress. In this study, we identified nine SL biosynthesis genes: two D27, two CCD7, two CCD8, and three MAX1, and seven SL signaling genes: two D14, two MAX2 and three D53 in soybean genome. We found that SL biosynthesis and signaling genes are conserved during evolution in different species. Syntenic analysis of these genes revealed their location on nine chromosomes as well as existence of ten pairs of duplication genes. Moreover, plant hormone and stress-responsive elements were identified in the promoter regions of SL biosynthesis and signaling genes. By using quantitative real-time PCR (qRT-PCR), we confirmed that SL genes have different tissue expression in roots, stems and leaves. Further, we also explored the expression profiles of SL biosynthesis and signaling genes under salt stress. These results suggested that SL signaling genes may play important regulatory roles in response to salt stress. In conclusion, we identified and provided valuable information on the soybean SL biosynthesis and signaling genes, and established a foundation for further functional analysis of soybean SL related genes in response to salt stress.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

Background: Coronavirus Disease 2019 (COVID-19) has been demonstrated to be the cause of pneumonia. Nevertheless, it has not been reported as the cause of acute myocarditis or fulminant myocarditis. Case presentation: A 63-year-old male was admitted with pneumonia and cardiac symptoms. He was genetically confirmed as having COVID-19 according to sputum testing on the day of admission. He also had elevated troponin I (Trop I) level (up to 11.37 g/L) and diffuse myocardial dyskinesia along with a decreased left ventricular ejection fraction (LVEF) on echocardiography. The highest level of interleukin-6 was 272.40 pg/ml. Bedside chest radiographs showed typical ground-glass changes indicative of viral pneumonia. Laboratory test results for viruses that cause myocarditis were all negative. The patient conformed to the diagnostic criteria of the Chinese expert consensus statement for fulminant myocarditis. After receiving antiviral therapy and mechanical life support, Trop I was reduced to 0.10 g/L, and interleukin-6 was reduced to 7.63 pg/ml. Moreover, the LVEF of the patient gradually recovered to 68%. The patient died of aggravation of secondary infection on the 33^rd day of hospitalization. Conclusion: COVID-19 patients may develop severe cardiac complications such as myocarditis and heart failure. This is the first report of COVID-19 complicated with fulminant myocarditis. The mechanism of cardiac pathology caused by COVID-19 needs further study.

In this study, we had investigated the use of high-pressure homogenization (HPH) as a novel pretreatment method for the extraction of sodium alginate (SA) from Laminaria japonica. Our results demonstrated that under optimal condition of 100 MPa HPH pressure, 4 cycles, pH 6.0, and 0.5% ethylene diaminetetra acetic acid tetrasodium salt (EDTA) concentration (w/v) for 3.0 hours, the extraction yield of HPH reached 34%, which was higher than that achieved by previous methods such as complex enzyme hydrolysis (CE), ultrasonic-assisted extraction (UAE), and complex enzyme-ultrasonic combined method (CE-UC). To further characterize the extracted SA, we conducted a comprehensive analysis using SEM, FTIR, MRS, NMR, XRD, TGA, and T-AOC assay. Our findings revealed the following: 1) HPH treatment significantly disrupted the structure of L. japonica cells and reduced their crystallinity to 76.27%, the lowest among all pretreatment samples; 2) the extracted SA had a greater tendency to form elastic gels; and 3) the antioxidant activity of HPH-extracted SA reached 0.02942 mgVceq∙mg-1, which was the highest among all tested methods. Based on these results, we concluded that HPH extraction not only increased the yield of SA but also enhanced its antioxidant activity.

Chinese pepper rust is a live parasitic fungal disease caused by Coleosporium zanthoxyli, which seriously affects the cultivation and industrial development of Z. armatum. Cultivating and planting resistant cultivars is considered the most economical and environmentally friendly strategy to control this disease. Therefore, the mining of excellent genes for rust resistance and analysis of the mechanism of rust resistance are the key strategies to achieve the targeted breeding of rust resistance. However, there is no relevant report on pepper rust resistance at present. The aim of the present study was to further explore the resistance mechanism of pepper by screening the rust-resistant germplasm resources in the early stage. Combined with the analysis of plant pathology, transcriptomics, and metabolomics, we found that the genes and metabolites related to phenylpropanoid metabolism were highly enriched in resistant varieties after pathogen infection, which indicated that phenylpropanoid metabolism might mediate the resistance of Z. armatum. This finding was further confirmed by real-time quantitative polymerase chain reaction analysis, which revealed that the expression levels of core genes involved in phenylpropane metabolism in disease-resistant varieties were high. In addition, the difference in flavonoid content in the leaves between resistant and susceptible varieties further supported the conclusion that the flavonoid pathway is one of the main pathways involved in resistance formation in Chinese pepper, and MeJA is involved in the formation of resistance. Our research results not only help to better understand the resistance mechanism of Z. armatum rust but also contribute to the breeding and utilization of resistant varieties.

Fusarium species are one of the filamentous fungal taxa with the most pronounced impact on agri-cultural production and human health. The mycotoxins produced by pathogenic Fusarium not on-ly attack various plants including crops, causing various plant diseases that lead to reduced yields and even death, but also penetrate into the food chain of humans and animals to cause food poi-soning and consequent health hazards. Although sporadic studies have revealed some of the bio-synthetic pathways of Fusarium toxins, they are insufficient to satisfy the need for a comprehen-sive understanding of Fusarium toxin production. In this study, we focused on 35 serious patho-genic Fusarium species with available genomes and systematically analyzed the ubiquity of the dis-tribution of identified Fusarium and non-Fusarium derived fungal toxin biosynthesis gene clusters (BGCs) in these species through the mining of core genes and comparative analysis of correspond-ing BGCs. Additionally, novel sesterterpene synthases and PKS_NRPS clusters were discovered and analysed. This work is the first to systematically analyze the distribution of related mycotoxin biosynthesis in pathogenic Fusarium species. These findings enhance the knowledge of mycotoxin production and provide a theoretical grounding for the prevention of fungal toxin production us-ing biotechnological approaches.

This paper presents an optimized energy management strategy for Li-ion power batteries used on electric vehicles (EVs) at low temperatures. Under low-temperature environments, EVs suffer a sharp driving range loss resulted from the energy and power capability reduction of the battery. Simultaneously, because of Li plating, battery degradation becomes an increasing concern as temperature drops. All these factors could greatly increase the total vehicle operation cost. Prior to battery charging and vehicle operating, preheating battery to a battery-friendly temperature is an approach to promote energy utilization and reduce total cost. Based on the proposed LiFePO4 battery model, the total vehicle operation cost under certain driving cycles is quantified in the present paper. Then given a certain ambient temperature, a target temperature of preheating is optimized under the principle of minimizing total cost. As for the preheating method, a liquid heating system is also implemented on an electric bus. Simulation results show that the preheating process becomes increasingly necessary with a decreasing ambient temperature; however, the preheating demand declines as driving range grows. Vehicle tests verify that the preheating management strategy proposed in this paper is able to save total vehicle operation cost.

A low-cost bio-mass-derived carbon substrate has been employed to synthesize MoS₂@carbon composites through a hydrothermal method. Carbon fibers derived from natural cotton provide a three-dimensional and open framework for the uniform growth of MoS₂ nanosheets, thus constructing hierarchically coaxial architecture. The unique structure could synergistically benefit fast Li-ion and electron transport from the conductive carbon scaffold and porous MoS₂ nanostructures. As a result, the MoS₂@carbon composites, when served as anodes for Li-ion batteries, exhibit a high reversible specific capacity of 820 mAh g^-1, high-rate capability (457 mAh g^-1 at 2 A g^-1), and excellent cycling stability. The superior electrochemical performance makes the MoS₂@carbon composites to be low-cost and promising anode materials for Li-ion batteries.

This paper aims to search for lump waves in a spatial symmetric (2+1)-dimensional dispersive wave model. Through an ansatz on positive quadratic functions, we conduct symbolic computations with Maple to generate lump waves for the proposed nonlinear model. A line of critical points of the lump waves is computed, whose two spatial coordinates travel at constant speeds. The corresponding maximum and minimum values are evaluated in terms of the wave numbers, and interestingly, all those extreme values do not change with time, either. The last section is the conclusion.

Traditional potential transformers have problems of large volume, difficulty in insulation, iron core saturation, ferroresonance overvoltage and poor transient response characteristics. The voltage sensor based on the principle of electric field coupling and differential input structure does not need to contact the measured object or ground, and can avoid the above problems. However, it requires a sufficiently high capacitance between the differential electrodes to obtain sufficient accuracy and a high voltage division ratio. The existing method of using mutual capacitance between the differential electrodes will cause many problems and fail to meet the practical needs. To solve the above problems, this paper innovatively uses multi-layer ceramic capacitor to replace the mutual capacitance and designs a new type of voltage sensor. In addition, by using single bypass small resistance grounding method to increase the input impedance of the differential signal processing circuit, error of the sensor is further reduced. The experimental results show that the sensor has excellent accuracy and great transient response characteristics. The ratio error under power frequency is within ±0.5% and the phase error is within 1. The ratio error in the range of 500 Hz∼30 kHz is within ±5% and the phase error is within 5. Moreover, it has the advantages of low cost, miniaturization, flexible shape and easy to adjust the voltage division ratio. These characteristics indicate that the sensor has good voltage measurement and sensor network potential.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

A series of water diversion projects to address the uneven distribution of water resources in China involve the construction of a large number of hydraulic tunnels. As the lining structure that maintains the stability and durability of the tunnels, it is prone to durability damage during the operation process, which in turn affects the water transmission safety and water supply capacity. Therefore, it is important to evaluate the durability of hydraulic tunnel lining structure. Considering the randomness and fuzziness of the factors affecting the durability of hydraulic tunnel lining structure, this paper proposes a comprehensive evaluation model based on the coupling of set-pair analysis and extension. The G1 method and the simple correlation function method are used to determine the subjective and objective weights of the evaluation indexes respectively, and the combination weight is assigned based on the principle of minimum entropy; the set-pair analysis principle is used to establish the linkage affiliation function, calculate the comprehensive linkage affiliation of the object to be evaluated, and the maximum affiliation principle is used to judge the durability level of the hydraulic tunnel lining structure. Finally, taking a section of hydraulic tunnel as an example, the model proposed in this paper is used to calculate its durability grade as Class III, with the set-pair potential SHI(H) = 7.5856, which is consistent with the actual engineering practice, and a comparative study is done in combination with the AHP-Extenics method. It is verified that the evaluation model can scientifically and reasonably evaluate the durability of hydraulic tunnel lining structure, providing a basis for subsequent maintenance and reinforcement.

Research on the development of new lightweight Al-Li alloys using selective laser melting pro-cess has great potential for industrial applications. This paper reports on the development of novel aluminum-lithium alloys using selective laser melting technology. Al-Cu-Li-Mg-Ag-Sc-Zr pre-alloyed powders with lithium contents of 1 wt.%, 2 wt.% and 3 wt.%, respectively, were prepared by inert gas atomization. After SLM process optimization, the microstructure and me-chanical properties of the as-formed specimens were investigated. The densification of the three newly developed alloys are 99.51 %, 98.96 % and 92.01 %, respectively. They all have good form-ability, with the lithium loss rate about 15 %. The as-formed alloy with 1% Li content presents good comprehensive properties with a yield strength of 412.6 ± 16.0 MPa, an ultimate tensile strength of 461.1 ± 11.7 MPa, and an elongation of 13.6 ± 1.1%. The three alloys exhibit a layered molten pool stacking morphology and have a typical heterostructure. The columnar crystals and equiaxed fine grains are alternately arranged, and most of the precipitated phases are enriched at the grain boundaries. The change of Li content mainly affects the precipitation of Cu-containing phase. When the Li content is 1 wt.%, there are θ phase, T1 phase and TB phase. When Li increased to 2 wt.%, T1 and T2 phases precipitated together. When Li reaches 3 wt.%, δ' phase precipitates with T2 phase. This study provides useful guidance for the future SLM form-ing of new crack-free and high-strength Al-Li alloys.

Achieving eco-efficiency in agriculture production at low environmental costs is key to sustainable agriculture. Using the DEA-SBM model, this study evaluated the agricultural eco-efficiency of the 77 counties and districts in China’s Jiangsu province from 1999 to 2018 and analyzed its spatio-temporal evolution pattern and influencing factors. The mains conclusions were as follows: (1) The overall agricultural eco-efficiency and its decomposition terms, pure technology efficiency and scale efficiency, exhibited a fluctuating downward trend. The regional inequality in agricultural eco-efficiency had been widening and exhibited a strong positive spatial association. (2) The agricultural eco-efficiency in Jiangsu province presented a “high south and low north” spatial pattern. High-level agricultural eco-efficiency areas were in the Taihu Plain in Sunan, while low-level agricultural eco-efficiency zones are distributed across Subei City. The High-High-type spatial association pattern is concentrated in the Suzhou-Wuxi-Changzhou region, while the Low-Low areas are mainly in the coastal regions of Subei and Suzhong. (3) The spatial pattern of PTE and SE generally exhibited a “high south and low north” distribution. Areas with positive growth in agricultural eco-efficiency, PTE, and SE, were situated in Xuzhou, Nanjing city, and the bordering regions between Yangzhou and Huai’an, and Changzhou and Wuxi. (4) The excessive redundant use and application of pesticides, chemical fertilizer, agricultural diesel, labor, land, and agricultural carbon emission have been the primary factor affecting Jiangsu's agricultural eco-efficiency. Irrigation had also signficantly impacted agricultural eco-efficiency, while mechanical power and agricultural film had minimal effect. The majority of counties and districts in Subei, Suzhong, and Ningzhen Yang Hilly region have issues regarding their excessive usage of chemical fertilizer, pesticide, chemical fertilizer, agricultural diesel, labor, and land. The findings of this study can contribute towards a better understanding of agricultural eco-efficiency and spatial association effect and can help policymakers increase agricultural eco-efficiency.

Endoscopic retrograde cholangiopancreatography (ERCP) is a routinely used therapeutic procedure for the biliary and pancreatic diseases. Population aging may increase the typical indications of ERCP and come with more complexity and difficulties, especially in cannulation. This study aimed to evaluate the incidence, causes, and management of difficult biliary cannulation during ERCP in super-aged patients and the role of difficult cannulation as a risk factor for adverse events. A total of 614 patients, underwent ERCP, were prospectively studied as a cohort and divided into two groups based on their age. There were 146 patients aged 80 years or older in group A and 468 patients aged less than 80 years in group B. The primary outcome measures were the difficulty grade of papilla cannulation, clinical outcomes, and ERCP-related complications in the two groups. The adverse events were analyzed using logistic regression for patient age, co-morbidities, indications, and cannulation difficulty grade variables. There was no difference in the incidence of difficult cannulation between the two groups (32.9% vs. 34.4%, p=0.765) though, as expected, super-aged Group A had a higher prevalence of periampullary diverticulum (29.5% vs. 16.7%, p=0.001). The technical cannulation success rate was (96.6% vs. 96.8%, p= 0.54). All used cannulation techniques in the elderly group were efficient and safe. Logistic regression showed that age ≥80 was not associated with increased adverse events; however, difficult cannulation (adjusted odds ratio [AOR]=3.478; 95% confidence interval [CI]=1.877, 6.442; p<0.001) and CCI ≥2 (AOR=1.824; 95% CI=0.993, 3.349; p=0.045) were more likely to have adverse events. Age ≤65 (AOR=3.460; 95% CI=1.511, 7.922; p=0.003), female gender (AOR=2.362; 95% CI=1.089, 5.124; p=0.030), difficult cannulation (AOR=4.527; 95% CI=2.078, 9.860; p<0.001), and patients with cholangitis (AOR=3.261; 95% CI=1.204, 8.832; p=0.020) were strongly associated with increasing Post-ERCP Pancreatitis (PEP). Advanced age has not proved to be a risk factor of difficult cannulation, and secondary cannulation techniques can be safely and efficaciously utilized for this group. CCI ≥2 and difficult cannulation are associated with increased overall adverse events rate while age ≥80 factor is not.

We fabricated high-quality MAPbBr3 single crystals (SC) by introducing moderate amount electron-rich poly(propylene glycol bis(2-aminopropyl ether) (PEA) additives with an inverse temperature crystallization (ITC) method. The intramolecular vibrations and defective states of prepared MAPbBr3 single crystals were systemically studied by the in situ variable-temperature Fourier Transform Infrared (FTIR) Spectroscopy, X-ray photoelectron spectroscopy (XPS), and the synchrotron-based X-ray absorption near edge structure (XANES), et al. We infer that the proper amount of PEA additives would prevent the formation of intermediate states and crystal boundaries, passivating the density of defective states. The X-ray detection properties of single-crystal MAPbBr3 crystals were investigated, using both high dose and low dose X-ray photons at 40keV in synchrotron beamlines. The photocurrent of optimized PEA-treated MAPbBr3 single crystals demonstrate better performance compared with the as-prepared single crystals. Meanwhile, the decay time of MAPbBr3 single crystal is decreased from 460 ns to 210 ns by Time-resolved photoluminescence (TRPL) decay measurement, owing to the defect passivation by 0.5wt% PEA additives. The PEA-treated single crystals possess much faster decay time than the commercialized Ce:YAG scintillator (>500ns). These results help elucidate the passivation of defective states and contribute paths to manufacture high-quality single crystal perovskites for next-generation optoelectronic devices.

Soy protein isolate (SPI) based materials are abundant, biocompatible, renewable, and biodegradable. In order to improve the tensile strength (TS) of SPI films, we prepared a novel composite film modified with microcrystalline cellulose (MCC) and metal nanoclusters (NCs) in this research. The effects of the modification of MCC on the properties of SPI-Cu NCs and Zn NCs films were investigated. Attenuated total reflectance-Fourier transformed infrared spectroscopy analyses and X-ray diffraction patterns characterized the strong interactions and reduction of the crystalline structure of the composite films. Scanning electron microscope showed the enhanced cross-linked and entangled structure of modified films. Compared with untreated SPI film, the tensile strength of the SPI-MCC-Cu and SPI-MCC-Zn films increased from 2.91 MPa to 13.95 and 6.52 MPa, respectively. Moreover, the results also indicated their favorable water resistance with higher water contact angle. Meanwhile, the composite films exhibited increased initial degradation temperatures, demonstrating their higher thermostability. The results suggested that MCC could effectively improve the performance of SPI-NCs films, which would provide a novel preparation method for environmentally friendly SPI-based films in the applications of packaging materials.

Lithium rich layered oxides (LRLO) are a wide class of innovative active materials for positive electrodes in lithium-ion (LIB) and lithium-metal secondary batteries (LMB). LRLOs are over-stoichiometric layered oxides rich in lithium and manganese, with general formula Li1+xTM1-xO2, where TM is a blend of transition metals comprising Mn (main constituent), Ni, Co, Fe and others. Due to the very variable composition and the extended defectivity their structural identity is still debated among researchers being likely an unresolved hybrid between a monoclinic (mC24) and a hexagonal lattice (hR12). Once casted in composite positive electrode films and assembled in LIBs or LMBs, LRLOs can delivery reversible specific capacities above 220-240 mAhg-1, thus beyond any other available intercalation cathode material for LIBs, with mean working potential above 3.3-3.4 V vs Li for hundreds of cycles in liquid aprotic commercial electrodes. In this review we critically outline the recent advancements in the fundamental understanding of the physico-chemical properties of LRLO as well as the most exciting innovations in their battery performance. We focus in particular on the elusive structural identity of these phases, on the complexity of the reaction mechanism in batteries as well as on practical strategies to minimize or remove cobalt from the lattice while preserving the outstanding performance upon cycling.

Based on the data of A-share listed companies in Shanghai and Shenzhen of China from 2011 to 2018 and the digital inclusive finance index of Peking University (2011-2018), this paper empirically tests the impact of digital finance development on corporate social responsibility in various provinces of China and its impact mechanism. The results show that: (1) the development of digital finance helps to promote the fulfillment of corporate social responsibility; (2) the influence mechanism of the development of digital finance to promote the fulfillment of corporate social responsibility lies in that it reduces the cost of debt financing and leads to the improvement of corporate social responsibility.(3) Further research shows that the positive relationship between digital finance and corporate social responsibility is more significant in private enterprises. At the same time, the impact is more significant in areas with poor market environment. The above research shows that the development of digital finance has a significant positive effect, which will improve the level of corporate social responsibility.

Ultrasonic feedback energy is affected by the variety, planting and growth state of crops, it is difficult to fine application in precision agriculture systems. To this end, an ultrasonic sensor was mounted in a spray boom height detection system. Winter wheat was used as the test object to obtain feedback energy values for the spray boom height from the top of the wheat in the field during six critical growth stages: the standing stage, jointing stage, booting stage, heading stage, filling stage and maturity stage. The relationship between the actual value of the height from the spray boom to the top of wheat (Habw) and the detected value of the height from the spray boom to the top of wheat (Hdbw) was analyzed. A spray boom height detection model based on the ultrasonic sensor during the full growth cycle of wheat was determined. Field validation tests showed that the applicability of the spray boom height detection distance (Dd) of the spray boom height detection model proposed in the present study was 450 mm~950 mm. Within the applicable Dd range, the detection error of the detection model was ≤5 cm during the full growth cycle. This study provides an ultrasonic detection model construction method, which improves the reliability and accuracy of ultrasonic boom height detection for different wheat growth stages.

The three-pronged sliding universal coupling is a new kind of three-pronged coupling. To study its kinematic and dynamic characteristics, directional cosine matrices are utilized as tools to analyze the coordinate systems by establishing simplified geometric models and corresponding motions. Through the analysis of the motions of the input and output shafts and employing the method of single-force element, a set of equilibrium equations for the forces acting on the output shaft and the input shaft are formulated for solution analysis. The research indicates that during the rotation process, there exists a small angular difference between the input shaft and the intermediate shaft, demonstrating the quasi-constant angular velocity characteristics of the new tripod sliding universal coupling. The curves of the forces and torques acting on each component of the coupling approximate sinusoidal curves. The optimal operating angle range for the new tripod universal coupling is at angle , during which the system exhibits good transmission and mechanical performance.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

Fifty-two kinds of N’-phenylhydrazides were successfully designed and synthesized. Their anti-fungal activity in vitro against five strains of C. alb. was evaluated. All prepared compounds owned varying degrees of activity and their MIC80, TAI, and TSI values were calculated. The in-hibitory activities of 27/52 compounds against fluconazole-resistant fungi C. alb. 4395 and C. alb. 5272 were much higher than those of fluconazole. The MIC80 values of 14/52 compounds against fluconazole-resistant fungus C. alb. 5122 were less than 4 μg/mL, so it was the most sensitive fungus (TSIB = 12.0). A11 showed the highest inhibitory activity against C. alb. SC5314, 4395, and 5272. The antifungal activities of B14 and D5 against four strains of fluconazole-resistant fungi were higher than those of fluconazole. The TAI values of A11 (2.71), B14 (2.13), and D5 (2.25) are the highest. Further exploring the antifungal mechanism revealed that the fungus treated with compound A11 produced free radicals and reactive oxygen species, and their mycelium mor-phology was damaged. In conclusion, the hydrazide scaffold showed potential in the develop-ment of antifungal lead compounds. Among them, A11, B14, and D5 demonstrated particularly promising antifungal activity and hold potential as novel antifungal agents.

Fabry-Perot air chamber was constructed at the melting point (splicing location) of two single-mode fibers by glycerin assisted self-expansion method. The morphology of the Fabry-Perot air chamber was fabricated and optimized by modulating the splicing parameters (drawing process, discharging location, time and intensity) and the fibers’ end-face (plane or arc). The in-line or reflected Fabry-Perot cavities have been applied to determine the tensile strain in the range of 0-1.2 N. The train sensing performance of the spherical shaped FP cavity has been experimentally demonstrated with the best sensitivity of 3.628 nm/N, corresponding to the resolution of ~0.005 N. The proposed FP fiber sensor has the advantages of low cost, fast fabrication and easy-integration with the common fiber system.

The Jeryak, a hybrid offspring of Gannan yak and Jersey cattle, exhibits evident hybrid advantages over the Gannan yak in terms of production performance and other various aspects. The small non-coding RNAs known as miRNAs exert a significant regulatory influence on gene expression post-transcriptionally. However, the regulatory mechanism of miRNA associated with muscle development in Jeryak remains elusive. To elucidate the regulatory role of miRNAs in orches-trating the skeletal muscle development in Jeryak, we selected dorsal longissimus muscle tissues from Gannan yak and Jeryak for transcriptome sequencing analysis. A total of 230 (DE)miRNAs and 1819 differentially expressed mRNAs (DEMs) were identified in the longest dorsal muscle of Gannan yak and Jeryak. The functional enrichment analysis revealed a significantly enrichment of target genes from differentially expressed (DE)miRNAs and DEMs in signaling pathways associ-ated with muscle growth, such as the Ras signaling pathway and the MAPK signaling pathway. The network of interactions between miRNA and mRNA suggested that some differentially ex-pressed miRNAs, including miR-2478-z, miR-339-x, novel-m0036-3p and novel-m0037-3p, played a pivotal role in facilitating muscle development. These findings help us to deepen our under-standing of the hybrid dominance of Jeryaks and provide a theoretical basis for further research on the regulatory mechanisms of miRNAs associated with Jeryak muscle growth and development.

To understand the molecular mechanism underlying yellowing in pineapples during ripening, coupled with alterations in fruit quality, comprehensive metabolome and transcriptome investigations were carried out. These investigations were conducted using the pulp samples collected at three distinct stages of maturity: young fruit (YF), mature fruit (MF), and fully mature fruit (FMF). This study revealed a noteworthy increase in the levels of total phenols and flavones, coupled with a concurrent decline in lignin and total acid content, as the fruit transitioned from YF to FMF. Furthermore, the analysis yielded 167 differentially accumulated metabolites (DAMs) and 2194 differentially expressed genes (DEGs). Kyoto Encyclopedia of Genes and Genomes enrichment analysis based on DAMs and DEGs revealed that the biosynthesis of plant secondary metabolites, particularly the flavonol, flavonoid, and phenypropanoid pathways, plays a pivotal role in fruit yellowing. Additionally, a comprehensive regulatory network encompassing genes that contribute to metabolisms of flavones, flavonols, lignin, and organic acids was proposed. This network sheds light on the intricate processes that underlies fruit yellowing and quality alterations. These findings enhance our understanding of the regulatory pathways governing pineapple ripening and offer valuable scientific insight into the molecular breeding of pineapples.

To the best of the author’s knowledge, studies of mature plasmacytoid dendritic cell proliferation associated with T lymphoblastic lymphoma were extremely rare in the literature. Here, we report a patient who underwent both mature plasmacytoid dendritic cell proliferation and T lymphoblastic lymphoma. With the findings of lymph node biopsy taken from the right cervical and inguinal regions, we identified eye-catching mature plasmacytoid dendritic cells that were considered to be responsible for this lesion at the beginning, until the immunostaining of Ki67 and TDT showed a small group of positive cells hiding in these plasmacytoid dendritic cells. Bone marrow biopsy was also performed in this patient. Microscopically, the hematopoietic tissue was almost completely replaced by lymphoblastoid cells with condensed chromatin, inconspicuous nucleoli and scanty cytoplasm, which were basically the same as those seen in the lymph nodes in morphology. However, there was no sign of plasmacytoid dendritic cells or Langerhans cells in the bone marrow biopsy. With the help of bone marrow biopsy, our final diagnosis of the lymph node was T lymphoblastic lymphoma coexisting with mature plasmacytoid dendritic cell proliferation . Although accumulations of plasmacytoid dendritic cells may occur in some infections or reactive lymphadenopathy, the presence of extensive nodules or infiltration of plasmacytoid dendritic cells strongly reminds the pathologist to carefully evaluate the bone marrow or peripheral blood status of the patient to exclude a hidden myeloid or other neoplasm.

Developing new energy is critical to China's green and low-carbon development. And the New Energy Demonstration City Policy (NEDCP) is a vital innovation policy that inspires the development of new energy. Is the NEDCP facilitating green and low-carbon development, if so, how? Employing unbalanced panel data from 2003 to 2017, the impact of NEDCP on green and low-carbon development was studied by using the "difference in difference" (DID) model. We find that this policy can take significantly role. After various robustness tests, our results are still valid. According to the heterogeneity analysis, non-resource and non-old industrial base cities have a greater positive impact from this policy. The mechanism analysis denotes that the positive policy effect works through upgrading the industrial structure and stimulating urban innovation. The substantial empirical evidence presented in this article supports the continued promotion and implementation of new energy demonstration cities.

Mangrove plant seedling cultivation is crucial for the protection, management and restoration of mangrove ecosystem. In this study, we focused on Kandelia obovata, a typical mangrove, and evaluated nursery cultivation with different combinations of three salinity levels (S1: 0 ppt, S2: 10 ppt, and S3: 20 ppt), three genealogies (EZD, JX, and YZ), and five growth media (M1: 100% loess, M2: 100% sandy, M3: 50% loess + 50% sandy, M4: 40% loess + 40% sandy + 20% peat, and M5: 40% loess + 40% sandy + 20% coir), by measuring the growth parameters such as mortality rate, seedling height, diameter, and biomass partition. These growth indexes were significantly affected by salinity and medium, and genealogies also had significant effects on mortality rate and biomass accumulation. S2 or S3 both had lower mortality and higher growth indexes than S1. M1 was the medium that increased seedlings height, diameter and biomass the most and had the lowest death rate. EZD and JX were also higher levels than YZ in these indicators, but the difference between them was not obvious. S3, M1, and EZD consistently performed well in fuzzy evaluation and quality assessment. Furthermore, combinations involving these treatments also produced highly favorable results. These results furnish both a theoretical and practical foundation for advancing nursery cultivation techniques and germplasm breeding of K. obovata in mangroves.

Celtis sinensis is an adaptable species that is widely grown in southern China. In June 2022, a leaf blotch disease of C. sinensis was observed in Nanjing, Jiangsu, China. Based on morphological characterization, three isolates were identified as Alternaria species. Phylogenetic analysis of combined ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 sequences identified the three isolates we obtained as Alternaria alternata and Alternaria koreana. Koch’s postulates were fulfilled in the greenhouse, and the pathogenicity of A. alternata and A. koreana was determined by leaf inoculation tests on C. sinensis seedlings. The symptoms of indoor inoculation were consistent with those in the field. A. alternata and A. koreana can grow at 15-35 °C, with an optimal growth temperature of 25 °C. The results of fungicide sensitivity experiments indicated that A. alternata and A. koreana were the most sensitive to prochloraz, which may be a useful strategy for the future prevention and control management of A. alternata and A. koreana. This study provides the first step for further research on A. alternata and A. koreana as pathogens of C. sinensis and provides a theoretical basis for future control strategies.

The field of fluorescence sensing, leveraging various supramolecular self-assembled architectures constructed from macrocyclic pillar[n]arenes, has seen significant advancement in recent decades. This review comprehensively discusses, for the first time, the recent innovations in the synthesis and self-assembly of pillar[n]arene-based supramolecular architectures (PSAs) containing metal coordination sites, along with their practical applications and prospects in fluorescence sensing. Integrating hydrophobic and electron-rich cavities of pillar[n]arenes into these supramolecular structures endow the entire system with self-assembly behavior and stimulus responsiveness. Employing the host–guest interaction strategy coupled with complementary coordination forces, PSAs exhibiting both intelligent and controllable properties are successfully constructed. This provides a broad horizon for advancing fluorescence sensors capable of detecting environmental pollutants. This review aims to establish a solid foundation for the future development of fluorescence sensing applications utilizing PSAs. Additionally, current challenges and future perspectives in this field are discussed.

A variable speed anti-tangling reel mechanism was designed to address the problems of tangling, hanging and rewinding of the tassel wheel and the high paddling loss in the current Chinese rape combine harvester cutting table. The kinematic equations of the reel mechanism were developed, and the analysis showed that the speed in the entry stage is low and the speed in the exit stage is high, and the attitude of the reel teeth change with the rape plant movement during the whole paddling process. A single-factor test and a multi-factor regression orthogonal combination test were carried out using the cutting table loss rate of rape harvesting as the evaluation index. The main and secondary factors affecting the cutting table loss of the variable speed reel were obtained as the reel speed, the machine travel speed and the ground angle of the frame. A mathematical model of regression of cutter loss and the main influencing factors was established, with the coefficient of determination R2 = 0.9918. The optimal combination of parameters for the variable speed reel was obtained with the lowest cutting table loss rate in rape harvesting as the optimization target: reel speed 25r/min, frame parallel to the ground and implement travel speed 0.7m/s. Field validation tests and comparative tests of cutting table loss of the two reels were carried out. The test results show that the regression mathematical model of the cutting table loss is more accurate, and the cutting table loss is reduced by 13.9% with the variable speed reel compared to the cam-action reel, and there are no problems with the paddle teeth hanging and tangling during the paddling process.

Post-training quantization is pivotal in deploying convolutional neural networks for mobile applications. Block-wise reconstruction with adaptive rounding, as employed in prior works like BrecQ and Qdrop, facilitates acceptable 4-bit quantization accuracy. However, adaptive rounding is time-intensive, and its constraint on weight optimization space curtails the potential for quantization performance. The optimality of block-wise reconstruction hinges on the quantization status of subsequent network blocks. In this investigation, we delve into the theoretical underpinnings of the limitations inherent in adaptive rounding and block-wise reconstruction. Our exploration leads to the development of a post-training quantization methodology, designated as AE-Qdrop. This algorithm operates in two distinct phases: block-wise reconstruction and global fine-tuning. The block-wise reconstruction phase introduces a progressive optimization strategy, superseding adaptive rounding, which not only augments quantization precision but also significantly improves quantization efficiency. To mitigate the risk of overfitting, we introduce a random weighted quantized activation mechanism. During the global fine-tuning phase, we account for interdependencies among quantized network blocks. The weight of each network block will be corrected with logit matching and feature matching. Extensive experiments validate that AE-Qdrop achieves high-precision and efficient quantization. For instance, in the case of 2-bit MobileNetV2, AE-Qdrop outperforms Qdrop by achieving a 6.26% enhancement in quantization accuracy and quintupling the quantization efficiency.

The changing of land use and land cover (LULC) are both affected by climate and human activity and affect climate, biological diversity, and human well-being. Accurate and timely information about the LULC pattern and change is crucial for land management decision-making, ecosystem monitoring, and urban planning, especially in developing economies undergoing industrialization, urbanization, and globalization. Biodiversity degradation and urban expansion in eastern China are research hot-spots. However, the influence of LULC changes on the region remains largely unexplored. Here, an object-based and multi-temporal image analysis approach was developed to detect how LULC changes during 1985-2015 in the Tiaoxi watershed (Zhejiang province, eastern China) using Landsat TM and OLI data. The main objective of this study is to improve the accuracy of unsupervised change detection from object-based and multi-temporal images. To this end, a total of seven LULC maps are generated with multi-temporal images. A random stratified sample design was used for assessing change detection accuracy. The proposed method achieved an overall accuracy of 91.86%, 92.14%, 92.00%, and 93.86% for 2000, 2005, 2010, and 2015, respectively. Nevertheless, the proposed method, in conjunction with object-oriented and multi-temporal satellite images, offers a robust and flexible approach to LULC changes mapping that helps with emergency response and government management. Urbanization and agriculture efficiency are the main reasons for LULC changes in the region. We anticipate that this freely available data will improve the modeling for surface forcing, provide evidence of changes in LULC, and inform water-management decision-making.

People with aphantasia exhibit the inability to voluntarily generate or form mental imagery in their minds. Since the term “aphantasia” was proposed by Zeman et al. in 2015 to describe this, it has gained increasing attention from psychiatrists, neuroscientists, and clinicians. Previous studies have mainly focused on definition, prevalence, and measurement, its impacts on individuals’ cognitive and emotional processing, and theoretical frameworks synthesizing existing findings, which have contributed greatly to our understanding of aphantasia. However, there are still some debates regarding the conclusions derived from existing research and the theories that were constructed from various sources of evidence. Building upon existing endeavors, the current systematic review emphasizes that future research is much needed to refine definition and diagnosis of aphantasia, strengthen empirical investigations at behavioral and neural levels, and more importantly, develop or update theories. These multiple lines of efforts could lead to a deeper understanding of aphantasia and further guide researchers in future research directions.

A typical white-light light-emitting diode (LED) can achieve a sunlight-like spectral profile in the visible spectrum by means of using an optical filter, with an inverted transmission profile to the white LED, fabricated using a deposition coating process. The unfiltered white LED generates white light by mixing light emitted by a blue LED (450 nm) with emission from the yellow phosphorescence excited by the blue light and differs significantly from the characteristics of the full-spectrum natural light. In this study, the spectral characteristics of the filtered LED light can be improved to reach a general color rendering index value (Ra) of 95.6 at the D65.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

Co-free Li-rich oxide is a promising cathode for low cost high energy density Li-ion battery but presents poor cyclic stability. To address this issue, CeO2 is coated on Co-free Li-rich oxide through a low-temperature aged process, resulting in a novel CeO2-coated Li-rich oxide compo-site. Due to the low-temperature aged process, a uniform CeO2 coating layer of 6 nm in thickness is successfully coated on Co-free Li-rich oxide. With this uniform coating, the resulting CeO2-coated Li-rich oxide composite presents improved cyclic stability as well as rate capability as the cathode of Li-ion battery. The capacity retention of the resulting CeO2-coated Li-rich oxide is enhanced from 67% to 85% after 100 cycles and its capacity retention of 5C/0.05C is enhanced from 10% to 23%, compared with the uncoated sample. Such significant improvements enable this low-temperature aged process to be helpful for the practical application of Li-rich oxide materials, not limited to Co-free Li-rich oxide.

China is striving to leverage the power of science and technology to green its agriculture while increasing grain productivity. In this context, this study presents the green growth rate of agriculture from the DEA-based Green Total Factor Productivity (GTFP) indicator, together with the growth rate of grain yields, and applies it to the case of Jiangsu, a major grain-producing province with a well-developed economy. It is found that Jiangsu's agriculture has generally performed well in the implementation of the two major national strategies of green development and grain security, especially in the northern Jiangsu, which is a major grain-producing area. In contrast, the phased fluctuations of green growth in agriculture in Southern Jiangsu are more pronounced, with even negative green growth occurring during the green agriculture movement. Much of the volatility in agricultural green growth at the provincial, subregional, municipal level comes from the effects of the movement of the green technology frontier led by best practitioners. Accordingly, the possibility of improving the weak state of the catch-up effect on green growth is explored from the perspective of the Chinese government-led agricultural science and innovation system; it also traces the green agricultural initiatives in the main grain-marketing areas that have failed to deliver the expected green growth, and recommends a review of such policies and refinement of the GTFP Index tool for assessing sustainable green growth.

Null-flux Electro-dynamic suspension (EDS) system promises to be one of the feasible high-speed maglev systems above 600 km/h. On account of its greater current-carrying capacity, superconducting magnet can provide super-magnetomotive force that is required for null-flux EDS system and cannot be provided by electromagnets and permanent magnets. There is already a relatively mature high-speed maglev technology with low temperature superconducting (LTS) magnets as the core, which works in the liquid helium temperature region (T≤4.2 K). 2-Generation high temperature superconducting (HTS) magnet winded by REBa2Cu3O7−δ (REBCO, RE=rare earth) tapes works above 20 K region and do not need to count on liquid helium which is rare on earth. This paper designed HTS no-insulation closed-loop coils applied for EDS system and energized with persistent current switch. The coils can work at persistent current model and has premier thermal quench self-protection. Besides, a full size double-pancake module was designed and manufactured in this paper, and it was tested in liquid nitrogen. The double-pancake module’s critical current is about 54 A and it is capable of working at persistent current model, whose average decay rate measured in 12 hours is 0.58%/day.

Objective: To study the factors affecting the time of umbilical cord shedding in premature infants.Methods: A total of 151 premature infants who were born in the obstetrics department of a Class III hospital in Hefei from November 2020 to June 2021 were selected as subjects. All premature infants and their families met the complete inclusion criteria. A total of 33 related factors from 3 aspects, including the birth situation of premature infants, the condition of premature infants in hospital and the condition of pregnant mothers, were collected for univariate analysis and multiple Logistic regression analysis. The relevant factors affecting the umbilical cord shedding time of premature infants were screened through the univariate analysis results, and the main factors affecting the umbilical cord shedding time of premature infants were screened through the multiple Logistic regression analysis results.it was found that the weight, gestural age, admission age, whether the premature infants were combined with NRDS, the use of antibiotics, the duration in the warm box, the initial temperature in the warm box, the duration of light therapy, the degree of Apgar for 1 minute, the maternal education level had an effect on the time of umbilical cord shedding of premature infants (P < 0.05). Through Logistic multiple regression analysis, it was screened that the duration of premature infants in the incubator was the main factor affecting the umbilical cord shedding time of premature infants (P < 0.05).Conclusion: Factors such as premature infants' weight, gestural age, admission age, whether they are combined with NRDS, antibiotic use, duration in the incubator, initial temperature in the incubator, duration of phototherapy, Apgar level of 1 minute, and maternal education level will affect the umbilical cord shedding time of premature infants. Among them, duration in the incubator is the main factor affecting the umbilical cord shedding time of premature infants.

Longitudinal cutting is a most common process in steel structure manufacturing, and the man-hours of the process provide an important basis for enterprises to generate production schedules.However, currently the man-hours in factories are mainly estimated by experts, and the accuracy of this method is relatively low.In this study,we propose a system that predicts man-hours with history data in the manufacturing process and that can be applied in practical structural steel fabrication.The system addresses the data inconsistency problem by one-hot encoding and data normalization techniques,Pearson correlation coefficient for feature selection,and the Random Forest Regression(RFR) for prediction.Compared with the other three Machine Learning(ML) algorithms, the Random Forest algorithm has the best performance.The results demonstrate that the proposed system outperforms the conventional approach and has better forecast accuracy, so that it is suitable for man-hours prediction.

This study presents an innovative analytical method for the detection and quantification of 14 β-agonists in pork using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The method involves the use of a solid phase microextraction (SPME) probe, consisting of a wooden tip coated with polyacrylonitrile (PAN) and molecularly imprinted polymer (MIP). This probe has been integrated into an automated extraction device, designed in our laboratory to extract the target analytes prior to LC-MS/MS analysis. Compared to the traditional solid-phase extraction (SPE) procedure, the proposed approach significantly reduces the costs related to adsorbent ma-terial and solvent consumption, and shortens purification time, thereby reducing both the tech-nical workload and associated expenses. The methodology has been carefully validated in ac-cordance with the National Standard of the People's Republic of China (GB/T 22286-2008), evalu-ating key parameters including the limit of detection (LOD), limit of quantification (LOQ), matrix effects, linearity, and both intra-day and inter-day precision. The average recovery rates for all β-agonists were observed to lie between 71.6% and 82.2%, with relative standard deviations (RSDs) consistently below 15% for both types of precision. The LOD and LOQ values were found to range from 0.09 to 0.39 μg/kg and 0.27 to 0.99 μg/kg, respectively. In terms of accurate detection of positive samples, the developed method demonstrated a closer approximation to the true value of the sample compared to the National Standard method GB/T 31658.22-2022. Overall, the proposed method exhibits substantial promise for the routine assessment of β-agonists in pork and presents a practical alternative for compliance monitoring in regulatory settings.

Recently, generative adversarial networks (GANs) can be used to generate the photo-realistic image from a low-dimension random noise. It is very dangerous that the synthesized or generated image is used on inappropriate contents in social media network. In order to successfully detect such fake image, an effective and efficient image forgery detector is desired. However, conventional image forgery detectors are failed to recognize the synthesized or generated images by using GAN-based generator since they are all generated but manipulation from the source. Therefore, we propose a deep learning-based approach to detect the fake image by combining the contrastive loss. First, several state-of-the-art GANs will be collected to generate the fake-real image pairs. Then, the contrastive will be used on the proposed common fake feature network (CFFN)to learn the discriminative feature between the fake image and real image (i.e., paired information). Finally, a smaller network will be concatenated to the CFFN to determine whether the feature of the input image is fake or real. Experimental results demonstrated that the proposed method significantly outperforms other state-of-the-art fake image detectors.

Focal cerebral ischemia can lead to blood-brain barrier (BBB) breakdown, which is implicated in neuroinflammation and elevation of matrix metalloproteinases (MMPs). The role of the anti-inflammatory protein, monocyte chemotactic protein–induced protein 1 (MCPIP1) plays in the injury of BBB in stroke has not yet been reported. This study was conducted to identify and characterize the role MCPIP1 plays in BBB breakdown. Transient middle cerebral artery occlusion (MCAO) is induced in both wild-type and Mcpip1^-/- mice for 2 hours of occlusion periods followed by reperfusion for 24 or 48 hours. BBB permeability was measured by FITC-dextran extravasation, MMP-9/3 expression was analyzed by western blot, and claudin-5 and zonula occludens-1 (ZO-1) were analyzed by immunohistochemistry and western blot. After MCAO in wild type mouse is induced, there is significantly increase in MCPIP1 mRNA and protein levels. Absence of MCPIP1 leaded to significant increase in FITC-dextran leakage in peri-infarct brain, significant upregulation of MMP-9, MMP-3 and reduced levels of tight junction components, claudin-5 and ZO-1 in the brain after MCAO. Our data demonstrate that absence of MCPIP1 exacerbates ischemia-induced blood-brain barrier disruption by enhancing the expression of matrix metalloproteinases and degradation of tight junction proteins. Overall data indicate that MCPIP1 is important protective role against BBB disruption in cerebral ischemia.

As a typical visual positioning system, monocular ranging is widely used in various fields. However, when the distance increases, there is a greater error. YOLOv8 network has the advantages of fast recognition speed and high accuracy. This paper proposes a method by combining YOLOv8 network recognition with a monocular ranging method to achieve target localization and grasping for the NAO robots. By establishing a visual distance error compensation model and applying it to correct the estimation results of the monocular distance measurement model, the accuracy of the NAO robot's long-distance monocular visual positioning is improved. Additionally, a grasping control strategy based on pose interpolation is proposed. Throughout, the proposed method's advantage in measurement accuracy was confirmed via experiments, and the grasping strategy has been implemented to accurately grasp the target object.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

Natural products are an important source of antibacterial agents. Canthin-6-one alkaloids have displayed potential antibacterial activity based on our previous work. In order to improve the activity, twenty-two new 3-N-benzylated 10-methoxy canthin-6-ones were designed and synthesized through quaternization reaction. The in vitro antibacterial activity against three bacteria was evaluated by double dilution method. Four compounds (6f, 6i, 6p and 6t) displayed 2-fold superiority (minimum inhibitory concentration (MIC) = 3.91 µg/mL) against agricultural pathogenic bacteria R. solanacearum and P. syringae than agrochemical propineb. Moreover, the structure–activity relationships (SARs) were also carefully summarized in order to guide the development of antibacterial canthin-6-one agents.

A millimeter-wave microstrip leaky-wave antenna array based on the substrate-integrated waveguide (SIW) and the complementary split-ring resonator (CSRR) is proposed in this paper. The slow wave characteristics of the SIW are enhanced by etching two rows of symmetrical CSRR-type slots on the surface of the SIW layer. The magnetic coupling between the CSRR-SIW layer and equally spaced circular patches array on the upper layer realizes the radiation of electromagnetic energy. In the 23~30 GHz (relative bandwidth 26.4%) operating frequency band, the horizontal polarization radiation beam scanning from -62° to -2° is realized, with a peak gain of 9.6~11.7 dBi, and the cross-polarization ratio is more than 43.8 dB.

The chemically synthesized polymer polyacrylamide (HPAM) in conventional reservoirs has achieved excellent oil displacement, but its oil displacement is poor in extreme reservoir environments. To develop biopolymer oil flooding agent under extreme reservoir conditions, the viscosity increasing and rheological properties of three biopolymers, diutan gum, xanthan gum, and scleroglucan, were studied under extreme reservoir conditions (high salt, high temperature, strong acid, and alkali), and the effects of temperature, mineralization, pH, and other factors on their viscosities and long-term stability properties were analyzed and compared. The results showed that under the temperature of 90℃ and below, the three kinds of biopolymers had the best viscosity-increasing ability. The viscosity of the three kinds of biopolymers was 80.94, 11.57, and 59.83mPa·s, respectively, when the concentration was 1500mg/L and the salinity was 220g/L. At the shear rate of 250s-1,100℃~140℃, scleroglucan has the best viscosification. At 140℃, the solution viscosity is 19.74mPa·s, and the retention rate can reach 118.27%. The results of the long-term stability study showed that the solution viscosity of scleroglucan with mineralization level of 220 mg/L was 89.54% viscosity retention in 40 days, and the diutan gum could be stabilized for 10 days, and the viscosity was maintained at 90 mPa·s. All three biopolymers are highly acid and alkali-resistant, with viscosity variations of less than 15% in the pH3~10 range. Rheological tests have shown that both of them have better viscoelastic properties than xanthan gum due to the peculiar double-helix structure of xanthan gum and the rigid triple-helix structure of scleroglucan. Therefore, the two biopolymers, diutan gum, and scleroglucan have the potential for extreme reservoir oil displacement applications, and it is recommended to use diutan gum for oil displacement in reservoirs up to 90℃ and scleroglucan for oil displacement in reservoirs between 100℃ and 140℃.

Most existing data synthesis methods are designed to tackle problems such as dataset imbalance, data anonymization and insufficient sample size. There is a lack of effective synthesis methods for the limited number of datasets which contain a large of features and unknown noise to expand the size of the dataset. We propose a data synthesis method, named Adaptive Subspace Interpolation for Sample Optimization (ASISO). The idea is to divide the original feature space into several subspaces with an equal number of samples, and then perform interpolation for the samples in the adjacent subspaces. This method can adaptively adjust the size of the dataset containing unknown noise, and the expanded data typically contain minimal error with actual. Moreover, it adjusts the structure of the samples, which can significantly reduce the proportion of samples with large errors. In addition, the hyperparameters of this method have an intuitive explanation and usually require little calibration. Experimental results on artificial data and benchmark data sets demonstrate that ASISO is a robust and stable method to optimize samples.

Purpose: To elucidate the mechanism of CXCR4/EAAT1/GS pathway in CXCL12 regulating invasion and migration in malignant pleural mesothelioma (MPM). Methods: Immunohistochemistry for CXCL12, CXCR4, EAAT1 and GS stainings and correlation analysis between them were conducted in MPM and normal tissues. Western blot and real-time PCR were performed to examine the CXCR4, EAAT1 and GS expression in H2052 cells. Wound healing and transwell assay were applied to determine the cell migration and invasion. MTT was utilized to assess cell viability. Results: CXCL12, CXCR4, EAAT1 and GS were highly expressed in MPM tissues and correlated with each other. CXCL12 upregulated both in protein and mRNA levels of CXCR4, EAAT1 and GS in H2052 cells. The EAAT1 and GS expression upregulated or not by CXCL12 were decreased by CXCR4 and EAAT1 knockdown. CXCR4 antagonist AMD3100 and EAAT1 antagonist TFB-TBOA also resulted in the same effects as CXCR4 and EAAT1 knockdown, respectively. CXCL12 promoted cell invasion and migration and increased the Matrix metalloproteinase 9 (MMP9) mRNA level. CXCR4 and EAAT1 knockdown suppressed all these functions. Furthermore, CXCL12 promoted H2052 cells growth in nude mice, both AMD3100 and TFB-TBOA inhibited this promotion. Conclusions: CXCL12 regulated the invasion and migration through CXCR4/EAAT1/GS pathway in H2052 cells.

Objective: To explore the hot spots and development trends of community public health research. Methods: The literature related to this topic was searched in CNKI and PubMed databases, and the trend map of the number of articles was drawn according to the obtained data. The included literature were analyzed with Vosviewer software for keyword and author co-occurrence, and CiteSpace 6.3.R1 Basic software was used for mechanism co-occurrence, key emergence and clustering analysis, and timeline distribution map drawing. Results: 189 Chinese literature and 77 English literature were selected. The Chinese literature focused on “community public health service, emergency management, and community governance”, and the research trend was “community public health emergency management and community governance”; English literature focuses on “nursing education, health education, human qualitative research”. Conclusion: Although the Chinese and English literature shows that scholars in this field have different emphases, the primary community health is the key and difficult point to realize the national public health service project, and improving the basic public health service in the primary community is related to the health of all the people, so it is very important.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

As the largest carbon pool on Earth, forest ecosystems are essential to maintaining carbon sink balance. However, accurately estimating the carbon sequestration and carbon storage of forest resources remains an urgent issue to address. Plot investigation, model estimation, and machine learning are examples of current approaches. Nevertheless, because of variables such as regional characteristics and plot size, large-scale and extensive region estimates are comparatively scarce. This study, which focuses on Tianzhu County, aims to comprehensively analyze and estimate the Net Primary Productivity (NPP), carbon storage, and carbon density of the forest ecosystem in this area by integrating data from forest resource inventory and the CASA model. The main conclusions are as follows: (1) The main vegetation types in Tianzhu County include coniferous forests, broad-leaved forests, mixed forests, and shrub forests; (2) Accordin g to the CASA model calculations, the annual cumulative NPP in Tianzhu County in 2020 ranges from a maximum of 249.63 gC/m² to a minimum of 3.40 gC/m², with the forest NPP amounting to 134,674.65 tons of carbon. Based on MODIS observation data, the forest’s NPP is 171,728.32 tons of carbon, with a maximum of 325.36 gC/m² and a minimum of 0.02 gC/m²; (3) At the pixel scale, the carbon storage of forests in Tianzhu County is 361,700 tons. Specifically, 46,500 tons of carbon are stored in coniferous forests, 1,100 tons in broad-leaved forests, 500 tons in mixed forests, and 313,600 tons in shrub forests.

Despite empirical findings that prosociality can prevent children and adolescents from developing psychological maladjustment, little is known about the underlying mechanisms. The goal of the present study was to examine the mediating effects of peer preference and self-perceived social competence on the associations between prosociality and psychological maladjustment (i.e., depressive symptoms and loneliness). Participants were 951 students (Mage = 11 years, 442 girls) in Grades 3~7 from Shanghai, China. They completed peer nominations of prosociality and peer preference, and self-report measures of self-perceived social competence, depressive symptoms, and loneliness. Multiple mediation analyses revealed that: (a) both peer preference and self-perceived social competence mediated the relations between prosociality and psychological maladjustment; and (b) a serial indirect pathway (i.e., prosociality  →  peer preference  →  self-perceived social competence →  psychological maladjustment) emerged when controlling for grade and gender. These findings point to potential targets in the prevention and intervention of adolescent internalizing problems.

In this study, the effects of various beryllium (Be) addition (Be-free, 0.1, 0.25, 0.50 wt.%) on the microstructure, mechanical properties, and corrosion corrosion of the Al-Mg-Li alloys were systematically investigated. The best performance was obtained in alloy with 0.1 wt.% Be addition. Trace Be addition promotes the grain refinement of the as-cast alloy ingot and contributes positive effects to the recrystallization, bringing improvement of tensile property. Meanwhile, the best anti-corrosion behavior is also presented at 0.1 wt.% Be addition, due to its potential to reduce the width of precipitates free zone (PFZ). As the Be content increase to an excessive level, the comprehensive performance decreases. Therefore, it is strongly recommended that adding trace Be element into Al-Mg-Li alloys has a positive effect on the comprehensive service performance.

Accurate lithium battery diagnosis and prognosis is critical to increase penetration of electric vehicles and grid-tied storage systems. They are both complex due to the intricate, nonlinear, and path-dependent nature of battery degradation. Data-driven models are anticipated to play a significant role in the behavioral prediction of dynamical systems such as batteries. However, they are often limited by the amount of training data available. In this work, we generated the first big data comprehensive synthetic datasets to train diagnosis and prognosis algorithms. The proof-of-concept datasets are over three orders of magnitude larger than what is currently available in the literature. With benchmark datasets, results from different studies could be easily equated, and the performance of different algorithms can be compared, enhanced, and analyzed extensively. This will expend critical capabilities of current AI algorithms, tools, and techniques to predict scientific data.

Li₂MnO₃ is critical component in the well-studied Li-excess cathode materials xLi₂MnO₃•(1- x)LiMO₂ for achieving high lithium storage capacity. In this article, the diffusion of Li ions in Li₂MnO₃ is studied using molecular dynamics (MD) simulation with well-behaved empirical force fields obtained by fitting against the crystal structure from experiment and phonons calculated using Density Function Theory (DFT). We have found two possible tetrahedral hopping channels, 0-TM and 1-TM(Mn⁴⁺) channel, which are differentiated by the face sharing octahedral cations. Simulation results show that the 0-TM channel is active for Li hopping, while 1-TM(Mn4+) channel is inactive. During the delithiation process, the Li ions in the TM layered are firstly removed, then those in the Li layer. However, the Li ions will be trapped in the tetrahedral 0-TM channels as long as the four face sharing octahedral sites are cleared. Up to x=1.0 for Li₂-xMnO₃, almost all the Li ions are located at the tetrahedral sites, forming a regular array along a axis. The de-intercalation of tetrahedral Li ions requires a high voltage (>5.2 V vs. Li/Li+), limiting the practical capacities measured in lab. The diffusion of Mn ions into the Li layers is observed in a deeper delithiated structure (x=1.2 for Li₂-xMnO₃), indicating an initial phase transformation to a spinel-like structure. However, the Mn ions are mainly trapped in the tetrahedral sites in the Li layer, instead of the octahedral sites fin spinel-like structure. A few of Mn ions diffusing into the octahedral sites in Li layers have no face sharing tetrahedral Li ions, revealing a further Li de-intercalation is imperative for the complete phase transformation. Our model is not stable for x≥1.4 in Li₂-xMnO₃. Other charge compensation mechanism should be considered in this high delithiation stage, eg. oxygen release.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

A phenomenological constitutive model is developed to describe the uniaxial transformation ratcheting behaviors of super–elastic shape memory alloy (SMA) by employing a cosine–type phase transformation equation with the initial martensite evolution coefficient that can capture the feature of the predictive residual martensite accumulation evolution and the nonlinear hysteresis loop on a finite element (FE) analysis framework. The effect of the applied loading level on transformation ratcheting are considered in the proposed model. The evolutions of transformation ratcheting and transformation stresses are constructed as the function of the accumulated residual martensite volume fraction. The FE implementation of the proposed model is carried out for the numerical analysis of transformation ratcheting of the SMA bar element. The integration algorithm and the expression of consistent tangent modulus are deduced in a new form for the forward and reverse transformation. The numerical results are compared with those of existing model and the experimental results to show the validity of the proposed model and its FE implementation in transformation ratcheting. Finally, a FE modeling is established for a repeated preload analysis of SMA bolted joint

A single fracture is the basic unit of fracture medium, and the roughness of fracture wall surface is an important factor influencing hydraulic characteristics of the flow in bedrock fracture. However, effects of the shape and density of roughness elements (various bulges/pits on rough fracture wall surfaces) on water flow in a single rough fracture have not been thoroughly discovered. Thus the water flow in single fracture with different shapes and densities of roughness elements was simulated by using Fluent software in this study. The results show that in wider fractures the flow rate mainly depends on fracture aperture, while in narrow and close fracture medium the surface roughness of fracture wall is the main factor of head loss of seepage; there is a negative power exponential relation between the hydraulic gradient index and the average fracture aperture, i.e. with the increase of fracture aperture, the relative roughness of fracture and the influence weight of hydraulic gradient both decrease; and in symmetrical-uncoupled fractures there is a super-cubic relation between the discharge per unit width and average aperture. Above results would help to deepen the understanding of rough fracture seepage.

Formaldehyde (HCHO) is one of the most important carcinogenic air contaminants. However, the lack of global surface concentration of HCHO monitoring is currently hindering research on outdoor HCHO pollution. Traditional methods are either restricted to small areas or data- demanding for a global scale of research. To alleviate this issue, we adopted neural networks to estimate surface HCHO concentration with confidence intervals in 2019, where HCHO vertical column density data from TROPOMI, in-situ data from HAPs (harmful air pollutants) monitoring network and ATom mission are utilized. Our result shows that the global surface HCHO average concentration is 2.30 μg/m3. Furthermore, in terms of regions, the concentration in Amazon Basin, Northern China, South-east Asia, Bay of Bengal, Central and Western Africa are among the highest. The results from our study provides a first dataset of the global surface HCHO concentration. In addition, the derived confidence interval of surface HCHO concentration adds an extra layer for the confidence to our results. As a pioneer work in adopting confidence interval estimation into AI-driven atmospheric pollutant research and the first global HCHO surface distribution dataset, our paper will pave the way for the rigorous study on global ambient HCHO health risk and economic loss, thus providing a basis for pollutant controlling policies worldwide.

Analyzing horse behavior is crucial for assessing training quality, particularly in accurately identifying actions like standing, walking, and running. Research has been conducted both domestically and internationally in this regard; however, challenges persist, including reliance on single sensors, poor real-time performance, and low identification accuracy. In view of these challenges, this study investigated real-time identification of horse behavior based on wearable devices. The system, centered around a microcontroller and utilizing a 4G network as a carrier, employs multi-axis IMU sensors as input sources to perceive horse posture. The study proposed a behavior classification method based on analysis of acceleration thresholds. The method consists primarily of two sequential stages: first, the resultant acceleration interval counting method, which employs a nonlinear segmentation approach for initial behavior classification; and second, the statistical analysis of variance parameters between segments, which when coupled with multi-level threshold processing, achieves a refined classification. Experimental results indicated that the interval counting method alone achieved an accuracy of 87.55%, while for the variance analysis method alone the accuracy was 90.87%. The proposed method, comprising the two stages, reached a classification accuracy of 91.57%, underpinning its usefulness in supporting future equine research.

Lower extremity joint kinetic factors are thought to modulate walk–to–run transition (WRT) and run–to–walk transition (RWT). This study aimed to investigate joint stiffness and energetic patterns during the WRT and RWT processes and identify whether gait transitions occurred within a single step or not. Ten healthy subjects participated in treadmill WRT (1.8 m/s – 2.4 m/s) and RWT (2.4 m/s – 1.8 m/s) tests. We investigated two steps before transition (S–2, S–1), two steps after transition (S1, S2) and the transition step (S0). We found significant differences between S2 and S–2 for ankle joint stiffness during WRT and RWT (p &lt; 0.001); and for hip joint stiffness, we found significant differences between S1 and S–1 during WRT and RWT (p ≤ 0.001). Additionally, stance phase mechanical energy generation was observed to transfer from proximal to distal joints at S0 during WRT, and from distal to proximal at S0 during RWT. Transition step ankle kinematic and kinetic patterns were similar to the target locomotion task gait format in both WRT and RWT. Moreover, RWT required longer adaptation time compared with WRT. These findings indicate that WRT and RWT were modulated before and after the actual transitions, not within a single step. Redistribution of joint mechanical work generation was related to gait transition triggers, which modulate the WRT and RWT process.

The effect of H2S with high concentrations on catalytic dry reforming of methane (DRM) process has seldom been focused on previously. Herein, a thermodynamic analysis of the DRM reactions in the presence of H2S with the concentration varying in 0-20 vol% was conducted firstly. Several typical types of catalysts including MgO, NiO/MgO and LaNiO3 in different states were prepared for executing DRM at 800 C, 0.1 MPa in the feed of 20 vol% CO2 and 20 vol% CH4 balanced with N2. The catalytic performance of each catalyst for DRM process under conditions of absence and presence of H2S was compared. A promotion effect of increasing H2S concentration on both the conversions of CO2 and CH4 and the molar yields of CO and H2 was observed on all the catalysts especially the MgO and the pristine NiO/MgO. While a significant decline in catalytic activity of either the reduced NiO/MgO or the reduced LaNiO3 catalyst after adding H2S, moderate reactant conversions still sustained. The results of process analysis and catalyst structure characterization suggest that H2S participation can contribute to the increment in CO2 and CH4 conversion, and active S-adsorbed species may play the key role of catalysis in the reactions involving H2S.

Thin twin-roll cast strips from a model Al-Cu-Mg-Li-Zr alloy with a small addition of Sc were prepared. A combination of a fast solidification rate and a favorable effect of Sc microalloying impacts the size and distribution of primary phase particles and the dimension of eutectic cells. Small interdendritic spacing in the range of 10-15 um enables substitution of the initial long-term homogenization annealing by a two-step annealing at 300 and 450 °C and a short solution treatment at 530 °C before quenching and the final age-hardening procedure. A dense dispersion of small Al3(Sc,Zr) precipitates intensively inhibiting recrystallization forms during this treatment. Further refining and fragmentation of the structure were performed using constrained groove pressing before the solution treatment. Small pre-straining of quenched specimens and subsequent age-hardening simulating T8 temper were used to promote the formation of a homogeneous distribution of strengthening particles and to suppress preferential heterogeneous precipitation on subgrain and grain boundaries. Microstructural features and microhardness evolution during annealing were critically examined and confronted with microstructural characteristics observed on reference mold cast alloy or alloys without Sc alloying. The proposed treatment represents a model near net shape procedure for manufacturing thicker sheets for the aerospace industry.

Molecular dynamics (MD) simulations present a sophisticated nano-scale computational approach that can play a critical role in material design for next generation batteries. One critical piece of information needed for MD simulations is the non-bonded potential parameters, which can be obtained through quantum mechanics (QM) calculations or experimental methods. However, experimental data is not available for exploratory and novel materials to derive the potential parameters. Also, the QM approach needs significant computational power and is too time consuming for large systems. On the other hand, current Artificial Intelligence techniques are faster, but they cannot be generalized across molecules and properties. As a result, there is a significant barrier to discovering and exploring new materials. Overcoming this barrier, in this work, we propose a Machine Learning (ML) based technique that can learn inter-atomic potential parameters for various particle-particle interactions employing QM calculations. This ML model can be used as an alternative for QM calculations for predicting non-bonded interactions in a computationally efficient manner. Using these parameters as input to MD simulations, we can predict a diverse range of properties, enabling researchers to design new and novel materials suitable for various applications in the absence of experimental data. We employ our ML-based technique to learn the Buckingham potential, a non-bonded interatomic potential. Subsequently, we utilize these predicted values to compute the densities of four distinct molecules, achieving an accuracy exceeding 93%. This serves as a strong demonstration of the efficacy of our proposed approach.

The working environment of mining electric locomotives is wet and muddy coal mine 1 roadway. There may be idling or slipping between the wheels and rails of mining electric locomotives 2 due to low friction between the wheel and rail and insufficient utilization of creep rate. Therefore, it 3 is necessary to control the creep rate within a reasonable range. In this paper, the autonomous control 4 algorithm for mining electric locomotives based on improved ε-greedy is theoretically proven to be 5 convergent and effective firstly. Secondly, after analyzing the contact state between the wheel and rail 6 under wet and slippery road conditions, it was concluded that the value of creep rate is an important 7 factor affecting the autonomous driving of mining electric locomotives. Therefore, the autonomous 8 control method for mining electric locomotives based on creep control is proposed in this paper. 9 Finally, the effectiveness of the proposed method was verified through simulation. The problem of 10 wheel slipping and idling caused by insufficient friction of mining electric locomotives in coal mining 11 environments is effectively suppressed. Autonomous operation of vehicles with optimal driving 12 efficiency can be achieved through quantitative control and utilization of the creep rate between 13 wheels and rails

Background: Cigarette smoking (CS) is a global public health problem and a high-risk factor for various diseases. In December 2019, a novel coronavirus (HCoV-19) was identified in Wuhan, China. Because ACE2 has been identified as a receptor for HCoV-19, we hypothesize that CS affects the expression pattern of ACE2 in respiratory tract, causing differences in susceptibility to the virus. Methods: Three datasets (GSE994, GSE17913, and GSE18344), were downloaded from the Gene Expression Omnibus (GEO) database. Correlation and enrichment analysis were used to evaluate the function of ACE2. Also, the different expression of ACE2 in different groups of three datasets were analyzed. Results: Genes associated with ACE2 were enriched in important biological processes such as viral processes and immune response. Elevated ACE2 were found in intrapulmonary airways (GSE994) and oral epithelial cells (GSE17913) of smokers but not those of non-smokers or former smokers. Significant dose- and time-dependent relationships between CS and ACE2 expression were observed in mouse lung tissues, and long periods without smoking were found to significantly reduce ACE2 expression. Conclusions: Both human and rat data confirmed that CS could induce increased ACE2 in the respiratory tract, indicating that smokers have a higher susceptibility to HCoV-19.

Background: Gastric cancer (GC) is one of the leading malignancy diseases worldwide, especially in Asian. CAST is a potential oncogene in GC carcinogenesis process. The character of macrophage infiltration in GC microenvironment was also unaddressed. Methods: We first applied machine searching in gene candidate evaluation of GC. CAST expression was analyzed via the Human Protein Atlas (HPA) and Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. Protein-protein interaction (PPI) network was downloaded from STRING. We investigated the impact of CAST on clinical prognosis using Kaplan-Meier plotter. The correlations between CAST and Lgr5 and macrophage infiltration in GC was surveyed via TIMER 2.0. Finally, GeneMANIA was also used to evaluate the possible functional linkage between genes. Results: After machine-assisted searching, CAST expression was found signicant difference in the overall survival of GC patients. STRING revealed CAST related proteomics and transcriptomics associations, mainly about CAPN family. Moreover, CAST significantly impacts the prognosis of GC from other datasets validation. Notably, high CAST expression was correlated with worse overall survival in GC patients (hazard ratio = 1.59; logrank P = 9.4 x 10-8). CAST and Lgr5 expressions were both positively correlated with WNT 2 and WNT 2B. Among GC patients in several datasets, CAST and macrophage infiltration evaluated together showed no obvious trend toward poor clinical overall survival. Conclusion: CAST plays an important role in GC clinical prognosis and is associated with WNT 2/WNT 2B/Lgr5. Our study denmostrated that CAST in GC overall survival is regulated by macrophage infiltration.

Porins are crucial proteins located in the outer membrane that directly influence antimicrobial resistance mechanisms and virulence in bacteria. In this study, a porin gene (Vp-porin) was cloned in V. parahaemolyticus, and the function of Vp-porin on biological characteristics and virulence was investigated. The results of sequence analysis showed that Vp-porin is highly conserved in Vibrio spp. and the predicted 3D structure showed it could form a transmembrane channel with 20 β barrel. Membrane permeabilization provides evidence that membrane integrity of ∆Vp-porin was damaged and the sensitivity to tetracycline, polymyxin B, rifampicin and cephalothin of ∆Vp-porin obvious increased. In addition, loss of Vp-porin damaged motility due to down-regulated flagellar synthesis. Besides, ∆Vp-porin exhibited attenuated cytotoxicity to Tetra-hymena. The relative survival rate of Tetrahymena infection with ∆Vp-porin was 86%, which is much high than that with WT (49%). Take together, Vp-porin in V. parahaemolyticus plays various roles in biological characteristics in membrane integrity, antimicrobial resistance and motility, and contributes to virulence.

Acting as the most abundant and widely distributed volatile secondary metabolites in plants, terpenoids play crucial roles in diverse physiological regulations and metabolic processes. Terpene synthases occupy a decisive proportion in determining the composition and diversity of terpenoids; though their regulatory effects have been extensively investigated across various plant species, limited studies have focused on the upstream transcriptional regulation of terpene synthases. In this study, we unveil linalool as the predominant volatile compound in Freesia hybrida flowers, demonstrating a gradual release pattern during flower blooming. In the context of the transcriptome, a typical MYB transcription factor, FhMYB108, was screened based on digital expression profile correlation analysis and homologous gene comparison. FhMYB108 is capable of regulating the expression of terpene synthase FhTPS1, and both their expression levels exhibit a gradual increase concomitant with flower opening. Moreover, transcriptional regulation and transient expression assays revealed that FhMYB108 exerts a stimulatory effect on the transcription of A. thaliana AtTPS14, while no significant increase in AtTPS14 expression was observed upon stabilization of FhMYB108 in Arabidopsis. Investigate its reason, the highly expressed AtMYC2 in A. thaliana can interact with FhMYB108 to suppress the activation of AtTPS14 by FhMYB108. The present study not only elucidated the regulatory mechanism underlying linalool synthesis, but also discovered the synergistic effect of MYB and bHLH transcription factors in governing the biosynthesis of volatile terpenoids.

Understanding the infiltration and solidification processes of liquid 5083Al alloy into Al2O3 three-dimensional reticulated porous ceramic (Al2O3(3D) RPC) is essential for optimizing the microstructure and properties of Al2O3(3D)/5083Al interpenetrating phase composites (IPCs) prepared by low-pressure infiltration process (LPIP). This study employs ProCAST software to simulate the infiltration and solidification processes of liquid 5083Al with pouring velocities (PV) of 0.4 m/s infiltrating into Al2O3(3D) RPC preforms with varying porosities at different pouring temperatures (PT) to prepare Al2O3(3D)/5083Al IPCs using LPIP. The results demonstrate that pore diameter of Al2O3(3D) RPC preforms and PT of liquid 5083Al significantly influence the of the infiltration. Solidification process analysis reveals that the Al2O3(3D) RPC preform with smaller pore diameters allows the lower pouring velocity of 5083Al to solidify faster compared to the preform with larger pore diameters. Al2O3(3D)/5083Al IPCs were prepared successfully from Al2O3(3D) RPC porosity of 15 PPI with liquid 5083Al at PV 0.4 m/s and PT 800 °C using LPIP, resulting in nearly fully dense composites, where both Al2O3(3D) RPCs and 5083Al interpenetrate throughout the microstructure. The infiltration and solidification defects were reduced under air pressure of 0.3 MPa (corresponding to PV of 0.4 m/s) during LPIP. Finite volume method simulations are in good agreement with experimental data, validating the suitability of the simplified model for Al2O3(3D) RPCs in the infiltration simulation.

Satellite-based monitoring can retrieve ground-level PM_2.5 concentrations with higher-resolution and continuous spatial coverage to assist in making management strategies and estimating health exposures. The Sichuan Basin has a complex terrain and several city clusters that differ from other regions in China: it has an enclosed air basin with a unique planetary boundary layer dynamic which accumulates air pollution. The spatiotemporal distribution of 1-km resolution Aerosol Optical Depth (AOD) in the Sichuan Basin was retrieved using the improved dark pixel method and Moderate Resolution Imaging Spectroradiometer (MODIS) data in this study. The retrieved seasonal AOD reached its highest values in spring and had the lowest values in autumn. The higher correlation (r = 0.84, N = 171) between the ground-based Lidar AOD and 1-km resolution MODIS AOD indicated that the high-resolution MODIS AOD could be used to retrieve the ground-level PM_2.5 concentration. The Lidar-measured annual average extinction coefficient increased linearly with the Planetary Boundary Layer Height (PBLH) in the range of 100 ~ 670 m, but exponentially decreased between the heights of 670 ~ 1800 m. Both the correlation and the variation tendency of simulated PBLH from WRF_SHIN/CALMET were closer to the Lidar observation than that of three other Planetary Boundary Layer (PBL) schemes (the Grenier-Bretherton-McCaa (GBM) scheme, the he Total Energy-Mass Flux (TEMF) scheme and the University of Washington (UW) scheme), which suggested that the simulated PBLH could be used in the vertical correction of retrieval PM_2.5. Four seasonal fitting functions were also obtained for further humidity correction. The correlation coefficient between the aerosol extinction coefficient and the fitted surface-level PM_2.5 concentration at the benchmark station of Southwest Jiao-tong University was enhanced significantly from 0.62 to 0.76 after vertical and humidity corrections during a whole year. During the evaluation of the retrieved ground-level PM_2.5 with observed values from three cities, Yibin (YB), Dazhou (DZ), and Deyang (DY), our algorithm performed well, resulting in higher correlation coefficients of 0.78 (N = 177), 0.77 (N = 178), and 0.81 (N = 181), respectively.

Background Dietary guidelines typically recommend limiting the intake of fresh red meat, yet evidence linking red meat consumption with adverse health outcomes is inconsistent. Objective To assess the level of evidence from existing systematic reviews and meta-analyses and analyze the association between high consumption of red meat and cancer risk and adverse health outcomes. Methods Eight databases were searched to collect systematic reviews and meta-analyses from database inception to December 2022. Two independent reviewers screened and extracted data and used the AMSTAR 2 tool to evaluate methodological quality of the included studies. Meta-analysis was conducted using STATA 17.0. Results A total of 18 studies were included, of which 5 were rated as high quality, 4 as medium quality, 6 as low quality, and 3 as extremely low quality. Of the 9 SRs/MAs included, primary studies with overlap were identified, and 14 studies were eventually included. The meta-analysis results showed that compared with the lowest intake of red meat, the highest intake of red meat was associated with an increased risk of colorectal cancer (OR 1.21, 95% CI 1.07-1.37), gastric cancer (OR 1.37, 95% CI 1.18-1.59), non-Hodgkin's lymphoma (OR 1.10.95% CI 1.02-1.19), stroke (RR 1.11, 95% CI 1.03-1.20), type 2 diabetes (RR 1.19 95% CI 1.04-1.37), and ischemic heart disease (RR 1.09, 95% CI 1.06-1.12), as well as a negative effect on total cholesterol (WMD 0.264, 95% CI 0.144-0.383), triglycerides (WMD -0.181, 95% CI -0.349 to -0.013), low-density lipoprotein (WMD 0.198, 95% CI 0.065-0.330), and high-density lipoprotein (WMD -0.065, 95% CI -0.109 to -0.020). However, the associations with breast cancer (RR 1.05 95% CI 1.00-1.11), glycemic control (WMD 0.040, 95% CI 0.049-0.129), and changes in body weight status [overweight (β 0.89, 95% CI 0.48-1.64); obesity (β 1.06, 95% CI 0.30-3.71)] were not significant. Conclusions This comprehensive umbrella review suggests that high consumption of red meat may increase the risk of colorectal cancer, gastric cancer, non-Hodgkin lymphoma, stroke, type 2 diabetes, and cardiovascular disease, and that reducing red meat intake is a key modifiable dietary factor for reducing risk. However, there was no significant correlation with breast cancer, kidney stones, age-related eye disease or changes in body weight.

In recent times, there has been significant enthusiasm for the development of all solid state batteries. This interest stems from a dual focus on safety—addressing concerns related to toxic and flammable organic liquid electrolytes—and the pursuit of high energy density. \cite{SCHNELL2018160,Zheng2018}. While liquid electrolyte batteries constitute for now the vast majority of commercial cells, solid electrolyte batteries show great promise. In parallel with experimental research, computational models \cite{GrazioliEtAlCM2016} clarify the several fundamental physics \cite{LiMonroeARCBM2020} that take place throughout battery operations. We review some classical models, emphasizing the conceptual advancements documented in the most recent works.

The possibility of using graphane monolayer crystals as the electrode material is becoming popular. Graphane is stable at room temperature and has large surface area, but its chemical inertness hinders its direct interactions with Li ions. In this study, we performed density functional theory calculations to study the energetic stability, structural and electronic properties of Li on graphane with various CH divacancy configurations (v12, v13 and v14 ). The results show that adsorption of Li atom reduces the formation energy of the CH divacancy configurations. The Li-v12 is most stable with the highest binding energy of 3.25 eV/Li and relaxes to in-plane with other C atoms. Altering the Li charge state to have Li−1-v12 or Li+1 -v12 affects the energetic stability and electronic characters of Li-v12 . The Li−1-v12 (Li +1-v 12 ) enhances (reduces) the binding force between Li and v 12 configuration, and furthermore it improves (deteriorates) the conductivity of the structure. Further investigation of graphane with vacancies is encouraged due to these intriguing observations, as it holds promise for potential utilization as an electrode material.

Li-rich manganese-based cathode materials (LRMs) are considered one of the most promising cathode materials for the next generation lithium-ion batteries (LIBs) because of their high energy density. However, there are problems such as capacity decay, poor rate performance, and continuous voltage drop, which seriously limit their large-scale commercial applications. In this work, Li1.2Mn0.54Co0.13Ni0.13O2 coated with Li2MoO4 with unique spinel structure was prepared by wet chemistry method and the subsequent calcination process. The Li2MoO4 coating layer with spinel structure can provide a 3D Li+ transport channel, which is beneficial for improving rate performance, while protecting LRMs from electrolyte corrosion, suppressing interface side reactions, and improving cycling stability. The capacity retention rate of LRMs coated with 3wt% Li2MoO4 increased from 69.25% to 81.85% after 100 cycles at 1C, and the voltage attenuation decreased from 7.06 to 4.98 mV per cycle. The lower Rct also exhibits improved magnification performance. The results indicate that the Li2MoO4 coating effectively improves the cyclic stability and electrochemical performance of LRMs.

The low-temperature environment significantly inhibits the growth and metabolism of denitrifying bacteria, leading to an excessive concentration of ammonia nitrogen and total nitrogen in sewage treatment plants during the cold season. In this study, an efficient denitrifying strain of heterotrophic nitrification–aerobic denitrification(HN-AD) bacteria named HS2 was isolated and screened from industrial sewage of a chemical factory in Inner Mongolia at 8°C. The strain was confirmed to be Achromobacter spiritinus, a colorless rod-shaped bacterium. When cultured with sodium succinate as the carbon source, a carbon-to-nitrogen ratio of 20-30, a shaking rate of 150-180 r/min, and the initial pH of 6-10, the Strain HS2 exhibited excellent nitrogen removal at 8°C. Through the results of whole-genome sequencing, gene amplification, and gas product detection, the Strain HS2 was determined to possess key enzyme genes in both nitrification and denitrification pathways, suggesting a HN-AD pathway of NH4+-N→NH2OH→NO2--N→NO→N2O→N2. At 8°C, the Strain HS2 could completely remove ammonia nitrogen from industrial sewage with an initial concentration of 127.23 mg/L. Microbial species diversity analysis of the final sewage confirmed Achromobacter sp. as the dominant genus, this indicated that the low-temperature denitrifying strain HS2 plays an important role in nitrogen removal of actual low-temperature sewage.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

A typical solid-state quantum sensor can be developed based on negatively charged nitrogen-vacancy (NV-) centers in diamond. The electron spin state of NV- can be controlled and read at room temperature. Through optical detection magnetic resonance (ODMR) technology, temperature measurement inside living cells can be achieved at the nanoscale. The key to ODMR technology is to apply microwave resonance to manipulate the electron spin state of NV-. Therefore, the microwave field characteristics formed near the NV- have a crucial impact on the sensitivity of ODMR measurement. This article mainly focuses on the temperature situation in cellular applications, and simulates the influence of structural parameters of double open loop resonant (DOLR) microwave antennas and broadband large-area (BLA) microwave antennas on the microwave field’s resonance frequency, quality factor Q, magnetic field strength, uniformity, etc. The parameters are optimized to have sufficient bandwidth, high signal-to-noise ratio, low power loss, and high magnetic field strength in the temperature range of 36 ℃ to 42.5 ℃. Finally, the ODMR spectra are used for effect comparison, and the signal-to-noise ratio and Q values of the ODMR spectra are compared when using different antennas. We have provided an optimization method for the design of microwave antennas and it is concluded that the DOLR microwave antenna is more suitable for living cell temperature measurement in our study.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

We experimentally study the supercontinuum (SC) induced by femtosecond filament in different liquid media, and determine the relative measurement value of filamentation threshold Pth for these media by using a Mach-Zehnder interferometer (MZI). It is found that the value of Pth is higher than the critical power for self-focusing Pcr, which can be attributed to the strong dispersion effect. Changing the focal length of the focusing lens affect the measured results of the filamentation threshold: In the case of shorter focal length, linear focusing (i.e., geometrical focusing) regime dominates, and the measured values of Pth for different media are almost the same; as the focal length becomes larger, self-focusing starts to play a role, making the values of Pth for different media different from each other. This work provides an effective approach to study the femtosecond filamentation process in liquid media, and helpful to further understand the physical process of supercontinuum induced by femtosecond filament in liquid media.

The decreasing width, increasing aspect ratio RDL presents significant challenges to design for reliability (DFR) of advanced package. Therefore, this paper proposes a ML based RDL modeling and simulation method. In the method, RDL is divided into blocks and subdivided into pixels of metal percentage, and the RDL is digitalized as tensors. Then, an ANN-based surrogate model is built and trained by a subset of tensors to predict the equivalent material properties of each block. Lastly, all blocks are transformed into elements for simulations. For validation, line bending simulations were conducted on an RDL, with the reaction force as accuracy indicator. The results show that neglecting layout impact causes critical errors as substrate thins. By the method, the reaction force error is 2.81% and the layout impact can accurately be considered with 200×200 elements. For application, the TCT maximum temperature state simulation was conducted on a CPU chip. The simulation indicates that for advanced package the maximum stress more likely occurs in RDL rather than bumps, both RDL and bumps are critical impacted by layouts, and RDL stress is also impacted by vias/bumps. The proposed method precisely concerns layout impacts with little resources, presents an opportunity of efficiency improvement.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Osteoporosis is an abnormal bone remodeling condition characterized by decreased bone density, which leads to high risks of broken bones. Previous studies have demonstrated that Lycii Radicis Cortex (LRC) extract inhibits bone loss in ovariectomized (OVX) mice by enhancing the osteoblast differentiation. A bioactive compound, Kukoamine B (KB), was identified from a fractionation of LRC extract as a candidate component responsible for an anti-osteoporotic effect. This study investigated the anti-osteoporotic effects of KB using in vitro and in vivo osteoporosis models. KB treatment significantly increased the osteoblastic differentiation and mineralized nodule formation of osteoblastic MC3T3-E1 cells, while it significantly decreased the osteoclast differentiation of primary-cultured monocytes derived from mouse bone marrow. The effects of KB on osteoblastic and osteoclastic differentiations under more physiological conditions were also examined. In the co-culture of MC3T3-E1 cells and monocytes, KB promoted osteoblast differentiation but did not affect osteoclast differentiation. For the in vivo experiments, KB significantly inhibited OVX-induced bone mineral density loss and restored the impaired bone structural properties in osteoporosis model mice. These results suggest that KB may be a potential therapeutic candidate for the treatment of osteoporosis.

This study was first time designed to investigate the effect of oxidation on protein digestion and transport properties in boiled sea cucumber body wall (BSCBW) via simulated digestion combine with everted-rat-gut-sac models. Boiling heat treatments led to protein oxidation in SCBW, manifested by increases in free radical intensity, thiobarbituric acid reactive substances, carbonyl groups, disulfide bonds, dityrosine bonds, advanced glycation end products, protein hydrophobicity and aggregation, declines in free sulfhydryl group, and secondary structure transition from α-helix to β-sheet. Boiling for 2 h caused the anti-digestion collagen unfolding, provided the action site for protease, and improved the protein digestion and transport levels. On the contrary, excessive oxidative modification of 4 h-BSCBW resulted in decreased protein digestion and transport levels. From the perspective of texture, digestion and transport properties, boiling for 2 h can obtain sea cucumber products with better edible and digestible properties, which is considered to be a better processing condition.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

The effects of simulated acid rain (SAR) on the photosynthetic performance of subtropical coniferous species have not been thoroughly investigated. In this study, we treated two coniferous species, Pinus massoniana (PM) and Cunninghamia lanceolata (CL), with SAR and then analyzed photosynthetic activities via the simultaneous measurement of prompt fluorescence(PF), delayed fluorescence(DF), and modulated reflection at 820 nm(MR820). Following the low-pH SAR treatment, the I–P phase of the OJIP curves of PM and CL decreased significantly and then the K-band and L-band were detectable. The delayed fluorescence for both PM and CL decreased as the pH of the SAR solution decreased, with a more significant decrease in the I1 peak than in the I2 peak. According to the MR820 curve, the exposure to SAR stress inhibited the rapid decrease and slow increase in the MR820 transients of PM and CL. The gradients of the decreasing and increasing phases were lower for CL than for PM at pH 2.5. In addition, SAR decreased the light energy captured per unit area (ABS/CSm) and the quantum yield of electron transfer per unit area (ETO/CSm), but it increased the accumulation of QA−, thereby decreasing primary photochemical efficiency (TRO/CSm, φPO). These changes in photosystem II (PSII) resulted in a decrease in the maximum quantum yield of PSII (Fv/Fm) and the performance index (PIABS). Moreover, PSII was protected from thylakoid membrane photodamages through the increase in heat dissipation per unit area (DIO/CSm) in response to SAR. The increase in δRO as the pH of the SAR solution decreased was observed for PM, but not for CL. Considered together, the study findings suggest that SAR treatments can decrease chlorophyll contents and damage the OEC in PM and CL, which obstructs the transfer of electrons on the donor and acceptor sides of PSII. However, PM is better able to withstand SAR stress than CL, likely because of the activation of a protective mechanism (reflected by the change in δRO). Therefore, in coniferous forest areas severely affected by acid rain, CL may need to be protected more than PM.

An adaptive operation strategy for on-demand control of DMFC system is proposed as an alternative method to enhance the voltage stability. Based on a single-cell DMFC stack, a newly simplified semi-empirical model is developed from the uniform-designed experimental results to describe the I-V relationship. Integrated with this model, the multi-objective optimization method is utilized to develop an adaptive operation strategy. Although the voltage instability is frequently encountered in unoptimized operations, the voltage deviation is successfully decreased to a required level by adaptive operations with operational adjustments. Moreover, the adaptive operations are also found to be able to extend the range of operating current density or to decrease the voltage deviation according to ones requirements. Numerical simulations are implemented to investigate the underlying mechanisms of the proposed adaptive operation strategy, and experimental adaptive operations are also performed on another DMFC system to validate the adaptive operation strategy. Preliminary experimental study shows a rapid response of DMFC system to the operational adjustment, which further validates the effectiveness and feasibility of the adaptive operation strategy in practical applications. The proposed strategy contributes to a guideline for the better control of output voltage from operating DMFC systems.

Malignancy is a fatal disease with an increasing incidence with each passing year, and the early diagnosis of malignancy can significantly improve the cure rate of patients, which has profound implications for saving patients' lives. The changes of miRNA are closely related to the occurrence of malignant tumors. The expression of miRNA in many malignant tumors is obviously different and unique from that in normal tissues. In this study, a strategy for amplifying microRNA (miRNA) signal was designed using duplex specific nuclease (DSN), which was then combined with Peptide nucleic acid (PNA) probe hybridization technology to prepare a sensitive and efficient paper-based lateral flow biosensor (LFB) for the detection of pancreatic cancer (PC) associated microRNA-10b. The performance evaluation results of the LFB showed that the detection limit of miR-NA-10b is 5 nM/mL, and carries demonstrated well specificity, stability, reproducibility. The biosensor prepared in this paper can provide accurate and rapid detection of miRNA-10b. The detection results play a guiding role in the early diagnosis of PC. Meeting the clinical need for largescale screening of individuals at high risk of PC. Providing new avenues to achieve early mass screening in individuals at high risk of PC.

As one of the critical state parameters of the battery management system, lithium battery state of charge (SOC) can provide an essential reference for battery safety management, charge/discharge control, and energy management of electric vehicles. To analyze the application of deep learning in electric vehicle power battery SOC estimation, this study reviewed the technical process, common public datasets, and the neural networks used, structural characteristics, advantages and disadvantages of lithium battery SOC estimation in deep learning method. First, the specific technical processes of the deep learning method for SOC estimation were analyzed, including data collection, data preprocessing, feature engineering, model training, and model evaluation. Secondly, the current commonly and publicly used lithium battery dataset was summarized. Then, the input variables, data sets, errors, and advantages and disadvantages of four types of deep learning methods, were concluded using the structure of neural network used for training as the classification criterion. Finally, the challenges and future development directions of lithium battery SOC estimation in deep learning method were explained.

We have proposed a data-driven approach for designing mesoscale porous structures of Li-ion battery electrode with three-dimensional virtual structures and machine learning techniques. Over 2,000 artificial 3D structures assuming positive electrode composed of random packed spheres as active material particles are generated, and charge/discharge resistance has been evaluated using simplified Physico-chemical model. In this model, resistance from Li diffusion in active material particles (diffusion resistance), transfer resistance of Li+ in electrolyte (electrolyte resistance) and reaction resistance on the interface between active material and electrolyte are simulated based on mass balance of Li, Ohm’s law in and linearized Butler-Volmer equation, respectively. Using these simulation results, regression models via Artificial Neural Network (ANN) have been created in order to predict charge/discharge resistance from porous structure features. In this study, porosity, active material particle size and volume fraction, pressure in the compaction process, electrolyte conductivity, and binder volume fraction are adopted as features, associated with controllable process parameters for manufacturing battery electrode. As results, the predicted electrode resistance by ANN regression model is good agreement with the simulated values. Furthermore, sensitivity analysis and optimization of the process parameters have been carried out. The proposed data-driven approach could be a solution as a guiding principle for manufacturing battery electrode.

In this paper the application of recycled Li-ion batteries spent cathode (LIB-SC) combined with NaHCO₃/H₂O₂ system is presented for the first time in the literature as an alternative for degradation of potentially toxic organic molecules. The model pollutant choice was methylene blue molecule. The spent cathode composition corresponds to LiCoO₂, which was proved by the XRD and EDX. Regarding the decolorization of methylene blue solution, the addition of NaHCO₃ in comparison with only H₂O₂ reduces the complete decolorization time in 96%. This reduction occurs because the radical CO₃ is more stable than OH. In this way, the application the system proposed in this article is aimed at solving two major global problems: the disposal of cell phone batteries and the pollution of liquid effluents.

This paper concentrates on the general birth-death processes with two different types of catastrophes. The Laplace transform of transition probability function for birth-death processes with two-type catastrophes are is successfully expressed with the Laplace transform of transition probability function of the birth-death processes without catastrophe. The first effective catastrophe occurrence time is considered. The Laplace transform of its probability density function, expectation and variance are obtained.