Aiming at the removal of radioactive cobalt ions from water by graphene oxide (GO), the adsorption mechanism of Co2+ on graphene oxide was analyzed using the quantum chemical calculation software Gaussian 16 based on the density functional theory. The influence of material structure factors such as carboxyl group, hydroxyl group, epoxy group and graphene sheet as well as external environmental factors such as pH, temperature and interfering ions on the adsorption effect was determined, and the influence of external environment was verified through experiments. Through calculation and experiment, it was found that the existence of oxygen-containing functional groups on graphene oxide can improve the adsorption efficiency of the materialappropriately,and increasing pH under acidic conditions was also helpful to improve the adsorption effect, and the material had certain selectivity for Co2+, the adsorption capacity and selectivity could be further improved when it was modified by increasing hydroxyl group.

In this paper, we establish the generalized Qi-type inequality involving conformable fractional integrals. The results presented here would provide extensions of those given in earlier works.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

A millimeter-wave microstrip leaky-wave antenna array based on the substrate-integrated waveguide (SIW) and the complementary split-ring resonator (CSRR) is proposed in this paper. The slow wave characteristics of the SIW are enhanced by etching two rows of symmetrical CSRR-type slots on the surface of the SIW layer. The magnetic coupling between the CSRR-SIW layer and equally spaced circular patches array on the upper layer realizes the radiation of electromagnetic energy. In the 23~30 GHz (relative bandwidth 26.4%) operating frequency band, the horizontal polarization radiation beam scanning from -62° to -2° is realized, with a peak gain of 9.6~11.7 dBi, and the cross-polarization ratio is more than 43.8 dB.

The signal processing technique is one of the principal tools for diagnosing power quality (PQ) issues in electrical power systems. The Discrete Fourier Transform (DFT) is a frequency analysis technique used to process power system signals and identify PQ problems. However, the DFT algorithm may lead to spectral leakage and picket-fence effect problems for asynchronously sampled signals that contain harmonic, inter-harmonic, and flicker components. To resolve this shortcoming, a hybrid method for frequency estimation based on a second-level DFT approach and a frequency-domain interpolation algorithm to obtain the accurate fundamental frequency of a power system is proposed in this paper. This method uses a second-level DFT to compute the cosine and sine parts for the fundamental frequency components of the acquired signals. Then, a frequency-domain interpolation approach is adopted to determine the amplitude ratio for the cosine and sine parts of the system's fundamental frequency. To demonstrate the performance of the proposed frequency estimation method, the observation window used by this paper to evaluate different estimation algorithms is 200 ms. According to the IEC standards, a 200 ms acquisition window is recommended for power system quality assessment. A set of mixed signals with harmonic, inter-harmonic, and flicker components with the fundamental frequency deviation is used. The evaluation results demonstrate the superiority of the new method over other approaches for assessing asynchronously sampled signals contaminated with noise, harmonic, inter-harmonic, and flicker components.

The azimuth wheel-rail of large aperture radio telescope is the key component, it not only sup-ports the whole weight of the antenna, but also directly affects the pointing performance of the antenna with its surface accuracy. The whole weight of the radio telescope is hundreds or even thousands of tons, its azimuth frame rollers have great contact stress with the wheel-rail surface, repeated rolling can cause rolling contact fatigue on the wheel-rail surface, resulting in wear, cracks and other damage to the wheel-rail, and even lead to failure or fracture of the wheel-rail in serious cases, so it is very important to monitor the damage of the antenna wheel-rail. In order to visually detect the use of antenna wheel-rail surface, this paper proposed the method using electromagnetic ultrasonic detection to detect the damage of antenna wheel-rail surface for the first time. Based on the electromagnetic ultrasonic nondestructive testing principle, the simplified wheel-rail model containing wear, corrosion and crack damage is simulated. The results show that this method can effectively detect the surface damage of the antenna wheel-rail surface, and it can provide an important reference for the research of wheel-rail damage detection of large radio telescope.

Developing new energy is critical to China's green and low-carbon development. And the New Energy Demonstration City Policy (NEDCP) is a vital innovation policy that inspires the development of new energy. Is the NEDCP facilitating green and low-carbon development, if so, how? Employing unbalanced panel data from 2003 to 2017, the impact of NEDCP on green and low-carbon development was studied by using the "difference in difference" (DID) model. We find that this policy can take significantly role. After various robustness tests, our results are still valid. According to the heterogeneity analysis, non-resource and non-old industrial base cities have a greater positive impact from this policy. The mechanism analysis denotes that the positive policy effect works through upgrading the industrial structure and stimulating urban innovation. The substantial empirical evidence presented in this article supports the continued promotion and implementation of new energy demonstration cities.

Satellite communication is expected to play a vital role in realizing Internet of Remote Things (IoRT) applications. This article considers an intelligent reflecting surface (IRS)-assisted downlink low Earth orbit (LEO) satellite communication network, where IRS provides additional reflective links to enhance the intended signal power. We aim to maximize the sum-rate of all the terrestrial users by jointly optimizing the satellite’s precoding matrix and IRS’s phase shifts. However, it is difficult to directly acquire the instantaneous channel state information (CSI) and optimal phase shifts of IRS due to the high mobility of LEO and the passive nature of reflective elements. Moreover, most conventional solution algorithms suffer from high computational complexity and are not applicable to these dynamic scenarios. A robust beamforming design based on graph attention networks (RBF-GAT) is proposed to establish a direct mapping from the received pilots and dynamic network topology to the satellite and IRS’s beamforming, which is trained offline using the unsupervised learning approach. The simulation results corroborate that the proposed RBF-GAT can achieve approximate performance compared to the upper bound with low complexity.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

Objective: Identify factors associated with excessive day time sleepiness (EDS) in individuals with obstructive sleep apnea (OSA), and analyze the effects that obesity and gender have on excessive daytime sleepiness in such individuals. Methods: A total of 160 people were selected for this study. All the people have completed a clinical evaluation, and whose apnea-hypopnea index (AHI) > 10 events/hour of sleep on polysomnography were included in the study from the Department of otolaryngology. Results: The Mean age was 43.87±11.34 years, mean EDS score was 14.09± 4.91, and mean AHI was 43.88±20.66 events/hour of sleep. Male presented lower mean age, higher EDS scores, and more time in apnoea, whereas females presented with higher mean age, lower EDS scores, and less time in sleep apnea. The EDS score showed best correlation with duration of apnoea (r = 0.448; p < 0.01), peripheral oxygen saturation (SpO₂; r = -0.458; p < 0.01) and AHI (r = 0.484; p < 0.01). The mean body mass index (BMI) was 27.41±3.86 kg/m². Normal, Overweight, obese, and morbidly obese were observed in 20%, 61%, 18%, and 0.6% of cases, respectively. Severity of the disease best correlated with BMI (r = 0.421; p < 0.01). Conclusions: OSA is predominant in males (M/F 5:1), and obese population. Females diagnosed with OSA have higher mean age. However, EDS scores and time spent in sleep apnoea is lower in females. Higher BMI is associated with EDS, irrespective of gender.

Improper lifting measures of long-span spatial steel structures during construction process may delay the construction period and even cause safety accidents. Few studies on long-span spatial steel structures considered time-varying mechanical characteristic during construction process. In order to achieve safe and efficient installation in a long-span spatial steel structure, this research presents a time-varying mechanical analysis of the synchronous and asynchronous integral lifting and a single and interlaced point’s asynchronous integral lifting analysis method of a long-span spatial steel structure. The results showed that in the case of asynchronous lifting of single point, the displacement influence on other members is related to the distance. The closer the distance from the lifting point, the greater the influence. In asynchronous integral lifting, the lifting point with large lifting force is first installed to the specified position, and the lifting point with small lifting force is installed to the specified position.

Sensory descriptive analysis was used to evaluate the aged Feng-flavored baijiu. The results indicated that there are notable differences in the samples of different ages. The samples with shorter storage times and fresh distilled Baijiu present bran flavor, and fresh green flavor. with the increase of storage time, the fragrance of honey, sweetness, flowers, and aging gradually increases. The samples of Feng-flavored baijiu were dected by Headspace solid-phase microextraction (HS-SPME) combined with comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC–TOFMS) , in total, 496 sustances were identified in all samples, mainly containing 14 types of substances, such as esters, aldehydes etc., of which 42 substances were found in Feng-flavored baijiu for the first time. Chemometrics was used to analyze the key differential compounds. 143 differential compounds closely related to aging were preliminarily screened, and principal component analysis revealed that these samples were separated by year. 65 differential compounds were selected out by partial least squares discriminant analysis(PLS-DA). Furthermore, 43 key differential compounds were selected from the aged Feng-flavored baijiu combined with variable importance in projection and Pearson correlation coefficients. Partial least squares regression (PLSR) was used to research the correlation of sensory properties and key differential compounds, and the results indicated that most compounds were closely related to the aged Baijiu . This study afford theoretical basis and reference for flavor research of Feng-flavored baijiu.

With the advances in industry and commerce, passengers have become more accepting of environmental sustainability issues; thus, more people now choose to travel by bus. Government administration constitutes an important part of bus transportation services as the government gives the right-of-way to transportation companies allowing them to provide services. When these services are of poor quality, passengers may lodge complaints. The increase in consumer awareness and developments in wireless communication technologies have made it possible for passengers to easily and immediately submit complaints about transportation companies to government institutions, which has brought drastic changes to the supply-demand chain comprised of the public sector, transportation companies, and passengers. This study proposed the use of big data analysis technology including systematized case assignment and data visualization to improve management processes in the public sector and optimize customer complaint services. Taichung City, Taiwan was selected as the research area. There, the customer complaint management process in public sector was improved, effectively solving such issues as station-skipping, allowing the public sector to fully grasp the service level of transportation companies, improving the sustainability of bus operations, and supporting the sustainable development of the public sector-transportation company-passenger supply chain.

In response to the issues of sensor noise and accumulated motion errors that lead to low positioning accuracy and insufficient robustness during large maneuvers or continuous flight of small unmanned aerial vehicles (UAVs) in complex environments, this paper proposes a multi-source and multimodal data fusion method. Initially, it employs a multimodal data fusion of various sensors including GPS (Global Positioning System), IMU (Inertial Measurement Unit), and visual sensors to complement the strengths and weaknesses of each hardware component, thereby eliminating motion errors to enhance accuracy. To mitigate the impact of sudden changes in sensor data, the method introduces a digital twin UAV data source. By utilizing the Extended Kalman Filter algorithm, it fuses data from both the real UAV and its digital twin, and the filtered positional information is fed back into the control system of the real UAV. This enables real-time correction of UAV positional deviations caused by sensor noise and environmental disturbances. The multi-source multimodal fusion Kalman filter method proposed in this paper significantly improves the positioning accuracy of UAVs in complex scenarios and the overall stability of the system. This method holds significant value in maintaining high-precision positioning in variable environments and has important practical implications for enhancing UAV navigation and application efficiency.

Trimeresurus albolabris, also known as the white-lipped pit viper or white-lipped tree viper, is a highly venomous snake distributed across Southeast Asia and the cause of many snakebite cases. In this study, we report the first whole genome assembly of T. albolabris obtained with next-generation sequencing from a specimen collected in Mengzi, Yunnan, China. After genome sequencing and assembly, the genome of this male T. albolabris individual was 1.51 Gb in length and included 38.42% repeat-element content. Using this genome, 21,695 genes were identified, and 99.17% of genes could be annotated using gene functional databases. Our genome assembly and annotation process was validated using a phylogenetic tree, which included six species and focused on single-copy genes of nuclear genomes. This research will contribute to future studies on Trimeresurus biology and the genetic basis of snake venom.

Multi-sensor data fusion of E-tongue and E-nose can provide a more comprehensive and more accurate analysis results. However, it also brings some redundant information, it is a hot issue to reduce the feature dimension for pattern recognition. In this paper, the taste-olfactory data fusion based on E-tongue and E-nose combined with Support Vector Machine (SVM) was used to classify five different beers. First, the taste and olfactory feature information were obtained based on E-tongue and E-nose. Second, the original feature data of single system were fused, then Principal Component Analysis (PCA) was applied to extract principal components, Genetic Algorithm-Partial Least Squares (GA-PLS) was used to select the characteristic variables, 20 subsets were generated with those variables based on the best Variable Importance of Projection (VIP) score. Finally, the classification models based on SVM were established, also c and g of SVM were calculated by Grid Search (GS), Genetic Algorithm (GA), and Particle Swarm Optimization (PSO), the classification results of all subsets were obtained. The results showed that the classification accuracy using data fusion was much higher over single E-tongue and single E-nose, and the variable selection method by VIP had the best classification performance in #12 subset coupled with GA-SVM.

A typical solid-state quantum sensor can be developed based on negatively charged nitrogen-vacancy (NV-) centers in diamond. The electron spin state of NV- can be controlled and read at room temperature. Through optical detection magnetic resonance (ODMR) technology, temperature measurement inside living cells can be achieved at the nanoscale. The key to ODMR technology is to apply microwave resonance to manipulate the electron spin state of NV-. Therefore, the microwave field characteristics formed near the NV- have a crucial impact on the sensitivity of ODMR measurement. This article mainly focuses on the temperature situation in cellular applications, and simulates the influence of structural parameters of double open loop resonant (DOLR) microwave antennas and broadband large-area (BLA) microwave antennas on the microwave field’s resonance frequency, quality factor Q, magnetic field strength, uniformity, etc. The parameters are optimized to have sufficient bandwidth, high signal-to-noise ratio, low power loss, and high magnetic field strength in the temperature range of 36 ℃ to 42.5 ℃. Finally, the ODMR spectra are used for effect comparison, and the signal-to-noise ratio and Q values of the ODMR spectra are compared when using different antennas. We have provided an optimization method for the design of microwave antennas and it is concluded that the DOLR microwave antenna is more suitable for living cell temperature measurement in our study.

Introduction: Pre-Exposure Prophylaxis (PrEP) for HIV prevention has been implemented in several countries. Previous literature has shown that its cost-effectiveness (and, under some specifications, cost-saving character) is dependent on the reduction in price due to generics, the time-horizon and its effectiveness. The intervention has never been studied in Catalonia, a territory with extensive implementation. Methods: Economic evaluation of the implementation of HIV pre-exposition prophylaxis using administrative data from Men who have Sex with Men (MSM) who receive the treatment (at the generic price). A deterministic compartmental model and a social perspective with a micro-costing approach over the time horizon 2022-2062 are used. A baseline 86% effectiveness of PrEP is assumed. Results: Daily oral PrEP is found to be cost-saving: discounted savings in costs are attained after 16 years, and after 40 years they reach 81 million euros. In terms of health indicators, 10,322 additional discounted QALYs are generated by the intervention. Results are sensitive to sexual behavioral patterns among MSM, the price of PrEP (reduced if offered on-demand), its effectiveness and the discount rate. Conclusions: The use and promotion of PrEP in Catalonia is predicted to result in substantial health and monetary benefits because of reductions in HIV infections. Short-term investments in the promotion of PrEP will result in important cost-savings in the long term.

According to the guidelines of the European Association of Urology (EAU), it is recommended to exclude PSA testing when the expected remaining lifespan is less than 10 years. In this study, we provide a comprehensive analysis of the impact of prostate-specific antigen (PSA) testing on the quality of life of elderly men who are frail. We conducted a comprehensive literature review to identify publications that examine the use of PSA as a screening and prognostic tool for prostatic illnesses in frail men. Our search included the following keywords: Prostate-specific antigen, Frailty, Prostate cancer screening, Hypogonadism, and Benign Prostatic Obstruction (BPO). Prostate-specific antigen (PSA) testing can be used to identify prostate cancer in its early and treatable stages in fragile men with a life expectancy of over 15 years. Additionally, PSA testing allows for the evaluation of the effectiveness of various prostate cancer treatments and the monitoring of testosterone replacement therapy for hypogonadism. PSA is also indicative of the clinical development of patients with benign prostatic obstruction (BPO). Nevertheless, PSA is being extensively provided without individualised patient assessment, contributing to the economic strain on healthcare systems. Conducting a frailty evaluation on men to determine the potential advantages of PSA tests on their quality of life will help minimise avoidable expenses.

Intramuscular fat content (IFC) and meat color are vital indicators affecting pork quality. A significant positive correlation between IFC and redness meat color (a* value) indicates that these two traits are likely to be regulated by shared molecular pathways. To identify candidate genes, hub genes, and signaling pathways that regulate these two traits, we measured the IFC and a* value in 147 hybrid pigs and selected individuls with extreme phenotypes for transcriptome analysis. The results revealed 485 and 394 overlapping differentially expressed genes (DEGs) using DESeq2, limma, and edgeR packages affecting IFC and a* value, respectively. Weighted gene co-expression network analysis (WGCNA) identified four modules significantly correlated with IFC and a* value. Moreover, we integrated functional enrichment analysis results based on DEGs, GSEA, and WGCNA conditions to identify candidate genes, and identified 47 and 53 candidate genes affecting IFC and a* value, respectively. The protein-protein interaction (PPI) network analysis of candidate genes showed that 6 and 14 hub genes affecting IFC and a* value, respectively. These genes mainly participated in various pathways related to lipid metabolism and redox reactions. Notably, four crucial hub genes (MYC, SOX9, CEBPB, and PPAGRC1A) were shared for these two traits. After functional annotation of these four hub genes, we hypothesized that the SOX9/CEBPB/PPARGC1A axis could co-regulate lipid metabolism and myoglobin redox response. Further research on these hub genes, especially the SOX9/CEBPB/PPARGC1A axis, will help to understand the molecular mechanism of the co-regulation of IFC and a* value, which will provide the theoretical basis for improving pork quality.

Objectives: To investigate the value of early lactate dynamic monitoring index in predicting prognosis of patients with sepsis and septic shock. Methods: We performed our test on 50 patients. Out of 50 patients, 28 are male, and 22 are female. Prospectively studied pediatric patients with septic shock were performed. Vital signs, Lactate clearance, were obtained at presentation 6 h, 12 h, 24 h over the first 48 h of hospitalization. The therapy received, outcome parameters of mortality and duration of hospitalization were recorded. Results: The statistical data and comparative analysis showed that an average of 16.88 days after admission, 5 patients have died, 17 patients are poorly prognosis leaves the hospital, and the remaining 28 are recovered and discharged. The primary outcome variable of mean 16 days hospitalization mortality rate was 10%. Poor prognosis 34% and fully recovery 56 % were observed. In this retrospective cohort study, a lactate level of more than 2.5mmol/L was the best threshold to predict 28-day mortality among severe sepsis and septic shock patients. In our research, we found mean LC 6 h 3.08mmol/L, and after 48 h mean it is 1.79mmol/L. Significant LC 6 h found, which is 8.08mmol/L in the death group patient where 48 h mmol/L shows significant high. Poor prognosis also presents a clinical increase of lactate level high in the LC 6 h analysis, which is 3.32mmol/L. Recovered patients showed a significant improvement after administering treatment depending on the patient organ involvement and good decrease of lactate reports achieved, which is 1.20mmol/L, where admission reports show it was 1.91mmol/L in LC 6 h. Mean Heart rate 94/51mmhg, pulse 119, temperature 39℃, respiratory rate 32.26, and urine output 456 ml recorded during our study. Death patient shows a remarkable detonation of those reports but has a significant clinical report with the recovered patients. Conclusion: The early lactate dynamic monitoring index has a high value in predicting sepsis and septic shock patients' prognosis, thus worth popularizing.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

A new quinazolinone alkaloid, named peniquinazolinone A (1), as well as eleven known com-pounds, 2-(2-hydroxy-3-phenylpropionamido)-N-methylbenzamide (2), viridicatin (3), viridicatol (4), (±)-cyclopeptin (5a/5b), dehydrocyclopeptin (6), cyclopenin (7), cyclopenol (8), methyl-indole-3-carboxylate (9), 2,5-dihydroxyphenyl acetate (10), methyl m-hydroxyphenylacetate (11), conidiogenone B (12), was isolated from the endophytic Penicillium sp. HJT-A-6. The chemical structures of all compounds were elucidated by comprehensive spectroscopic analysis, including 1D, 2D NMR, and HRESIMS. The absolute configuration at C-13 of peniquinazolinone A (1) was established by applying the modified Mosher’s method. Compounds 2, 3, and 7 exhibited an op-timal promoting effect on the seed germination of Rhodiola tibetica at a concentration of 0.01 mg/mL, while the optimal concentration for compounds 4 and 9 to promote Rhodiola tibetica seed germination was 0.001 mg/mL. Compound 12 showed optimal seed-germination-promoting activity at a concentration of 0.1 mg/mL. Compared with the positive drug 6-benzyladenine (6-BA), compounds 2, 3, 4, 7, 9, and 12 could extend the seed-germination period of Rhodiola tibetica up to the 11th day.

To investigate the effects of plant polysaccharides combined with boric acid on digestive function, immune function, and harmful gas and heavy metal contents in faeces of finishing pigs, for this study, 90 healthy three-way cross-bred pigs were selected and randomly divided into five groups: Con) A control, fed basic feed; BA) fed basic feed supplemented with 40 mg/kg of boric acid; BA+APS) fed basic feed supplemented with 40 mg/kg of boric acid and 400 mg/kg of Astragalus polysaccharides; BA+GLP) fed basic feed supplemented with 40 mg/kg of boric acid with 200 mg/kg of Ganoderma lucidum polysaccharides; and BA+EPS) fed basic feed supplemented with 40 mg/kg of boric acid and 500 mg/kg of Echinacea polysaccharides. Compared with the Con, the average daily gain (ADG) and trypsin activity were higher in BA, along with there being increased glutathione peroxidase (p < 0.05); furthermore, lower malondialdehyde content and harmful substance emissions from manure were observed (p < 0.05). Compared with BA, increases in ADG, gain-to-feed ratio (G/F), trypsin, and maltase activities were observed in BA+EPS (p < 0.05), as well as a lower NH3 emissions (p < 0.05). Compared with BA, BA+APS exhibited higher ADG, average daily feed intake (ADFI), G/F, trypsin, and maltase activities (p < 0.05), while H2S emissions were lower (p < 0.05). And Taken together, our findings reveal that supplementation with boric acid and plant polysaccharides in the diet of finishing pigs synergistically improved their growth performance, trypsin and maltase activities, and immune function, while also discovered the intestinal digestive enzymes, serum inflammatory factors, oxidative stress responseand emissions of harmful gases and heavy metals from feces and urine were tightly related, further reducing the impact of fecal pollution generated by modern animal husbandry on the environment.

Unpaid family caregivers might suffer losses in income as a result of care provision. Here we used data from the baseline survey of the China Health and Retirement Longitudinal Study to assess the relationship between hours of weekly caregiving provided to grandchildren/parents/parents-in-law and individual’s monthly employment income. Our study sample comprised 3,718 middle-aged Chinese adults who were of working age (45-60 years). For women and men separately, we used a likelihood-based method to determine a caregiving threshold in a two-stage Heckman selection procedure. Instrumental variables were used to rule out the endogeneity of caregiving hours. Our analysis revealed a negative association between caregiving and income for women that depended on a caregiving threshold of 63-hours per week. There was an absence of caregiving-income relationship among men. These results offer new insights into the opportunity costs of unpaid caregiving and support tailored policies to protect the financial well-being of female caregivers.

Developing clinically meaningful nanomedicines for cancer therapy requires the drugs to be effective, safe, simple, cheap, and easy to store. In the present work, we report that a simple cationic Fe(III)-rich salt of [FeIIICl(TMPPH2)][FeIIICl4]2 (Fe-TMPP) exhibits a superior anticancer performance toward a broad spectrum of cancer cell lines, including breast, colorectal cancer, liver, pancreatic, prostate, and gastric cancers, with half maximal inhibitory concentration (IC50) values in the range of 0.098−3.97 μM (0.066−2.68 μg mL−1), and comparable to the best-reported medicines. Fe-TMPP can forms stand-alone nanoparticles in water without the need for extra surface modification or organic-solvent-assisted antisolvent precipitation. Critically, Fe-TMPP is TME-responsive (TME = tumor microenvironment), and can only elicit its function in the TME with overexpressed H2O2, converting H2O2 to the cytotoxic •OH to oxidize the phospholipid of the cancer cell membrane, causing ferroptosis, a programmed cell death process of cancer cells.

The development of a method to produce coumarins unsubstituted on the pyranic nucleus catalyzed from Wells–Dawson heteropolyacid (H₆P₂W₁₈O₆₂), phenol derivatives and ethyl 3,3-diethoxypropionate using Pechmann condensation under solvent-free conditions is described. This catalytic method was also applied successfully to synthesize various substituted coumarins, including the corresponding phenols and ethyl 3,3-diethoxypropionate. This work provides a novel, cheaper and safer way to syhthesize coumarins unsubstituted on the pyranic nucleus.

Emojis are colorful ideograms resembling stylized faces commonly used for expressing emotions in instant messaging, in social network sites and in email communication. Notwithstanding their increasing and pervasive use in electronic communication, they are not much investigated in terms of their psychological properties and communicative efficacy. Here we presented 112 different human facial expressions and emojis (expressing neutrality, joy, surprise, sadness, anger, fear and disgust) to a group of 96 female and male university students engaged in the recognition of their emotional meaning. Both Analysis of Variance and Wilcoxon tests showed that men were significantly better than women at recognizing emojis (especially negative ones) while women were better than men at recognizing human facial expressions. Quite interestingly, men were better at recognizing emojis than human facial expressions per se. These findings are in line with more recent evidences suggesting how men may be more competent and inclined to use emojis to express their emotions in messaging (especially sarcasm, tease and love) than previously thought. Finally, the data indicate how emojis are less ambiguous than facial expressions (except for neutral and surprise emotions), possibly because of the limited number of fine-grained details, and the lack of morphological features conveying facial identity.

Buckling defect will appear on the outer surface of the deformed ring during constrained ring rolling (CRR) of aluminum alloy thin wall conical ring with inner high ribs (AATWCRIHR), if the geometrical dimension of the ribs doesn't match the wall thickness. To avoid the buckling defect, a quantitative method for characterizing the degree of the buckling defect is proposed using the area of buckling profile. Then an orthogonal experimental scheme was designed taking the width of the middle rib, thickness of wall, and height of the middle rib as design variables and defining the area of buckling profile as optimization objective. Subsequently, a quadratic polynomial response surface model was established by combining the optimization algorithm with the finite element method (FEM), and the geometrical dimension of the middle ribs of the deformed AATWCRIHR is optimized. Also the optimal parameter combination to minimize the area of buckling profile is obtained and verified using FE simulation. Results show that the AATWCRIHR after optimization doesn’t generate the buckling defect during constrained ring rolling, and it is proved that the quantitative buckling defect representation method and the optimization design method based on the response surface model and the finite element simulation results are feasible for the constrained ring rolling process of the AATWCRIHR.

Extracorporeal membrane oxygenation (ECMO), in conjunction with its life-saving benefits, carries a significant risk of acute brain injury (ABI). Hypoxic-ischemic brain injury (HIBI) is one of the most common types of ABI in ECMO patients. Various risk factors such as history of hypertension, high day 1 lactate level, low pH, cannulation technique, large peri-cannulation PaCO2 drop (∆PaCO2), and early low pulse pressure, have been associated with the development of HIBI in ECMO patients. The pathogenic mechanisms of HIBI in ECMO are complex and multifactorial, attributing to the underlying pathology requiring initiation of ECMO and the risk of HIBI associated with ECMO itself. HIBI is likely to occur in the peri-cannulation or peri-decannulation time secondary to underlying refractory cardiopulmonary failure before or after ECMO. Current therapeutics target pathological mechanisms, cerebral hypoxia and is-chemia, by employing targeted temperature management in the case of extracorporeal cardiopulmonary resuscitation (eCPR), and optimizing cerebral O2 saturations and cerebral perfusion. This review describes the pathophysiology, neuromonitoring, and therapeutic techniques to improve neurological outcomes in ECMO patients so as to prevent and minimize the morbidity of HIBI. Further studies aimed at stand-ardizing the most relevant neuromonitoring techniques, optimizing cerebral perfusion, and minimizing the severity of HIBI once it occurs will improve long-term neurological outcomes in ECMO patients.

The threat of fine particulate matter concentration (PM2.5) is increasing globally, Tackling this issue requires an accurate understanding of its trends and drivers. The article investigates the PM2.5 characteristics of 285 prefecture-level cities in China from 2000-2018 based on multiscale geographically weighted regression(MGWR), and the results show that（1）previous studies based on classical MGWR models may be somewhat unstable, while MGWR can reflect the scale of influence of different variables on the dependent variable, and its regression results are more reliable.（2）PM2.5 is very sensitive to carbon emission(CE) factors, and there is a high degree of spatial heterogeneity, and the influence scale of location is the smallest among all variables, close to the municipal scale.（3）In 2000, the constant term all, IS, OFT, CE, and LT positively affect PM2.5, while GDP (jurisdiction) and UR negatively affect PM2.5; in 2010, the constant term all, GDP (jurisdiction), IS, OFT and LT positively affect PM2.5, while UR and CE negatively affect PM2.5; in 2018 the constant term all, IS, OFT and CE factors positively affect PM2.5, and GDP (jurisdiction), UR and LT negatively affect PM2.5.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

In recent years, food and drink marketers have become increasingly interested in the question of whether there are any meaningful sex/gender differences in the world of taste/flavour perception. However, it turns out that while there are a large number of individual differences in the experience of food/drink, few, if any, fall neatly along sex/gender lines. As such, the marketers of food and drink need to tread very carefully when it comes to marketing food or beverage products specifically at men, or more usually, women. All too often, the brands entering this space soon find their attempts branded crass and/or sexist. Adopting a stealthy or implicit gender-based product development strategy is therefore perhaps more likely to succeed than the explicit targeting of food/beverage-related products in what is undoubtedly a highly-politicized area. That said, the one area where the public appear willing to accept products that are explicitly targeted at men or women is in the case of nutritional foods/supplements.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Flavonoids are major secondary metabolites in plants, which play important roles in maintaining the cellular redox balance in cells. Chalcone synthase (CHS) is the key enzyme in the flavonoids biosynthesis pathway, and has been proved to monitor the changes to drought stress tolerance. In this work, we overexpressed a CHS gene in tobacco (Nicotiana tabacum). The transgenic tobacco plants were more tolerant than the control plants to drought stress. The transcription levels of the key genes involved in the flavonoids pathway and the contents of seven flavonoids were also significantly raised in the transgenic tobacco plants. In addition, overexpression of the CHS gene lead to a lower concentration of the oxidative stress product malondialdehyde. Overall, the NtCHS gene studied in this work was considered as a candidate gene for genetic engineering to enhance drought tolerance of plants and improve response to oxidative stress.

Foxtail millet (Setaria italica) is an important cereal crop with rich nutritional value. Distinctness, Uniformity, and Stability (DUS) are the prerequisites for the application of new variety rights for foxtail millet. In this study, we investigated 32 DUS test characteristics of 183 foxtail millet resources, studied their artificial selection trends, and identified varieties that conform to breeding trends. The results indicated significant differences in terms of means, ranges, and coefficients of variation for each characteristic. Correlation analysis was performed to determine the correlations between various DUS characteristics. Principal component analysis was conducted on 31 test characteristics to determine their primary characteristics. By plotting PC1 and PC2, all germplasm resources could be clearly distinguished. Trends in foxtail millet breeding were identified through differential analysis of DUS test characteristics between landrace varieties and cultivated varieties. Based on these breeding trends, optimal solution types for multiple evaluation indicators were determined; weight allocation was calculated, and a specific TOPSIS algorithm was designed to establish a comprehensive multi-criteria decision-making model. Using this model, the breeding potential of foxtail millet germplasm resources was ranked. These findings provided important reference for foxtail millet breeding in future.

Abstract: Plant types and soil bacterial communities had a close relationship, understanding the profound association between them contributes to better learn bacterial ecological function for plant growth. In this study, rhizosphere soil of six different chemotype Cinnamomum camphora trees were collected, including C. bodinieri var. citralifera, [C. camphora (Linn.) Presl], camphora-type, cineole-type, linalool-type and isoborneol-type. Soil properties content and bacterial communities were analyzed. Two chemotype C. camphora, including [C. camphora (Linn.) Presl] and linalool-type, shaped similar bacterial community structure, decreased Firmcutes relative abundance. richness estimators (Chao1 index and Ace index) of [C. camphora (Linn.) Presl] were decreased compared with the others. Furthermore, soil bacterial community structure was also similar among bodinieri var. citralifera, camphora-type, cineole-type and isoborneol-type. Hence, different chemotype C. camphora altered soil nutrient and shaped rhizosphere bacterial communities.

Analyzing horse behavior is crucial for assessing training quality, particularly in accurately identifying actions like standing, walking, and running. Research has been conducted both domestically and internationally in this regard; however, challenges persist, including reliance on single sensors, poor real-time performance, and low identification accuracy. In view of these challenges, this study investigated real-time identification of horse behavior based on wearable devices. The system, centered around a microcontroller and utilizing a 4G network as a carrier, employs multi-axis IMU sensors as input sources to perceive horse posture. The study proposed a behavior classification method based on analysis of acceleration thresholds. The method consists primarily of two sequential stages: first, the resultant acceleration interval counting method, which employs a nonlinear segmentation approach for initial behavior classification; and second, the statistical analysis of variance parameters between segments, which when coupled with multi-level threshold processing, achieves a refined classification. Experimental results indicated that the interval counting method alone achieved an accuracy of 87.55%, while for the variance analysis method alone the accuracy was 90.87%. The proposed method, comprising the two stages, reached a classification accuracy of 91.57%, underpinning its usefulness in supporting future equine research.

In the paper, the author introduces the notions "multi-order logarithmic numbers" and "multi-order logarithmic polynomials", establishes an explicit formula, an identity, and two recurrence relations by virtue of the Faa di Bruno formula and two identities of the Bell polynomials of the second kind in terms of the Stirling numbers of the fi rst and second kinds, and constructs some determinantal inequalities, product inequalities, logarithmic convexity for multi-order logarithmic numbers and polynomials by virtue of some properties of completely monotonic functions.

Background: The diagnosis of metabolic syndrome (MetS) is a challenge in people with spinal cord injury (SCI). We aimed at identifying clinical risk factors or early markers of MetS in SCI that would facilitate a timely diagnosis and implementation of preventive/therapeutic strategies. Methods: 168 patients with chronic (>1 year) SCI underwent clinical and biochemical evaluations. MetS was diagnosed according to modified criteria of the International Diabetes Federation validated in people with SCI. Results: MetS was diagnosed in 56 of 132 men (42.4%) and 17 of 36 women (47.2%). At univariate regression analyses, putative predictors of MetS were an older age, a higher number of comorbidities, a lower insulin-sensitivity, the presence and intensity of pain, a shorter injury duration, a poorer leisure time physical activity (LTPA) and an incomplete motor injury. At the multiple regression analysis, a significant independent association with MetS only persisted for a poorer LTPA in minutes/week (OR: 0.998, 95%CI: 0.996, 0.999) and more severe pain symptoms as assessed by numeral rating scale (OR: 1.353, 95%CI: 1.085, 1.793). Conclusions: In patients with SCI, intense pain symptoms and poor LTPA may suggest a high likelihood of MetS, regardless of age, SCI duration, motor disability degree, insu-lin-sensitivity and comorbidities.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The Mara River basin (MRB) has a world-famous ecosystem, but the vegetation has been damaged due to economic development in recent years, and there is little known about the area that will experience severe vegetation damage in the future. Based on the vegetation vulnerability system, principal component analysis, and three CMIP6 scenarios (SSP1-2.6, SSP2-4.5, SSP5-8.5), vegetation vulnerability was calculated in the base period (2010-2019), near-term period (2020-2059) and long-term period (2060-2099) in the MRB. The spatial cluster of vegetation vulnerability was revealed by spatial correlation analysis, and the transition of vegetation vulnerability of different periods was analyzed by stochastic matrix. The results showed that in all periods, the vulnerability showed a high-high cluster in the east, and a low-low cluster midstream and downstream. From the stochastic matrix, the area of high vulnerability increased the least under the SSP1-2.6, while it increased the most under the SSP5-8.5. The vegetation vulnerability upstream increased the most from the base period to the near-term period and long-term period in the MRB. By comparing the vegetation vulnerability under different scenarios, and pointing out the areas with the highest vulnerability increase, this study can better provide comprehensive decision-making for vegetation protection in the MRB.

In wireless sensor networks (WSNs), each sensor node can estimate the global parameter from the local data in distributed manner. This paper proposed a robust diffusion estimation algorithm based on minimum error entropy criterion with self-adjusting step-size, which are referred to as diffusion MEE-SAS (DMEE-SAS) algorithm. The DMEE-SAS algorithm has fast speed of convergence and is robust against non-Gaussian noise in the measurements. The detailed performance analysis of the DMEE-SAS algorithm is performed. By combining the DMEE-SAS with diffusion minimum error entropy (DMEE) algorithms, an Improving DMEE-SAS algorithm is proposed, in non-stationary environment where tracking is very important. The Improving DMEE-SAS algorithm can avoid insensitivity of the DMEE-SAS algorithm due to the small effective step-size near the optimal estimator, and obtain a fast convergence speed. Numerical simulations are given to verify the effectiveness and advantages of these proposed algorithms.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

Due to the continuing high suicide rates among young men, there is a need to understand help-seeking behaviour and engagement with tailored suicide prevention interventions. The aim of this study was to compare help-seeking among younger and older men who attended a therapeutic centre for men in a suicidal crisis. In this case series study, data were collected from 546 men who were referred into a community-based therapeutic service in North West England. Of the 546 men, 337 (52%) received therapy; 161 (48%) were aged between 18 and 30 years (mean age 24 years, SD=3.4). Analyses included baseline differences, symptom trajectories for the CORE-34 Clinical Outcome Measure (CORE-OM) and engagement with the therapy. For the CORE-OM there was a clinically significant reduction in mean scores between assessment and discharge (p<0.001) for both younger and older men. At initial assessment, younger men were less affected by entrapment (46% v 62%; p=.02), defeat (33% v 52%; p=.01), not engaging in new goals (38% v 47%; p=.02), and positive attitudes towards suicide (14% v 18%; p=.001) than older men. At discharge assessment, older men were significantly more likely to have an absence of positive future thinking (15% v 8%; p=0.03), have less social support (45% v 33%; p=.02) and feelings of entrapment (17% v 14%; p=.02) than younger men. Future research needs to assess the long-term effects of help-seeking using a brief psychological intervention for young men in order to understand whether the effects of the therapy are sustainable over a period of time following discharge from the service.

Coal is an important resource that is closely related to people’s lives and has an irreplaceable role. However, coal mine safety accidents occur from time to time in the process of working underground. To this end, this paper proposes a coal mine environmental safety early warning model to detect abnormalities and ensure worker safety in a timely manner by assessing the underground climate environment. In this paper, the support vector machine (SVM) parameters are optimized using an improved artificial hummingbird algorithm (IAHA), and its safety level is classified by combining various environmental parameters. To address the problems of insufficient global exploration capability and slow convergence of the artificial hummingbird algorithm during iterations, a strategy incorporating Tent chaos mapping and backward learning is used to initialize the population, a Levy flight strategy is introduced to improve the search capability during the guided foraging phase, and then the simplex method is introduced to replace the worst value before the end of each iteration of the algorithm. The IAHA-SVM safety warning model was established using the improved algorithm to classify and predict the safety of the coal mine environment into four classes. Finally, the performance of the IAHA algorithm and the IAHA-SVM model are simulated separately. The simulation results show that the convergence speed and the search accuracy of the IAHA algorithm are improved, and the performance of the IAHA-SVM model has a significant improvement.

The massive use of electronic equipment has raised concerns about electromagnetic (EM) pollution, leading to increased attention to EM shielding in both civil and military applications. EM absorption materials play a crucial role in reducing the energy of microwaves projected onto their surface. In this work, we propose a novel OTA (over-the-air) antenna test method to evaluate and analyze the functionality of EM absorption materials. This method offers a new and practical way to assess the effectiveness of these materials. Measured results indicate that the presence of the EM absorption material led to a decrease in antenna gain of approximately 2-3 dB, a reduction in efficiency of more than 10-15%, and a smaller radiation pattern during the actual testing process. These findings highlight the impact of EM absorption materials on antenna performance. Compared to the traditional S-parameter testing method, the gain comparison testing method exhibits the advantages of higher accuracy and simpler operation in the lower frequency experiment.

In the paper, the author finds bounds of the sine and cosine along a circle on the complex plane in terms of two double inequalities for the norms of the sine and cosine along a circle on the complex plane.

In the paper, the author discusses and computes bounds of the sine and cosine along straight lines on the complex plane.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The pathogenicity of grapevine geminivirus A (GGVA), a recently identified DNA virus, to grapevine plants remains largely unclear. Here, we report a new GGVA isolate (named GGVAQN) obtained from grapevine ‘Queen Nina’ plants with severe disease symptoms; the infectious clone of GGVAQN (pXT-GGVAQN) was also constructed. Infection assays indicated that Nicotiana benthamiana plants inoculated with GGVAQN display upward leaf curling and chlorotic mottling symptoms. Direct injection of Agrobacterium tumefaciens cells carrying pXT-GGVAQN into roots of in vitro-grown ‘Red Globe’ grape plantlets by syringe led to systemic infection with GGVAQN, and the plants exhibited chlorotic mottling symptoms on their upper leaves, and downward curling, interveinal yellowing, and leaf-margin necrosis symptoms on their lower leaves. Our results provide insights into the pathogenicity of GGVA, and a simple and efficient inoculation method to deliver infectious viral clones to woody perennial plants.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Obesity is a global health concern. Recent research has suggested that the development of anti-obesity ingredients and functional foods should focus on natural products without side effects. We investigated the anti-obesity efficacy and mechanisms of action of Brassica juncea extract (BJE) using in vitro and in vivo obesity models. In in vitro experiments, BJE treatment downregulated adipogenic-related proteins CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), adipocyte protein 2 (aP2), and lipid synthesis-related protein acetyl-CoA carboxylase (ACC). It also upregulated the heat generation protein peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α) and fatty acid oxidation protein carnitine palmitoyltransferase-1 (CPT-1). Oral administration of BJE decreased body weight, alleviated liver damage, and inhibited lipid accumulation in high-fat diet (HFD)-induced obese mice. Inhibition of lipid accumulation by BJE in vivo was associated with decreased expression of adipogenic and lipid synthesis proteins and increased expression of heat generation and fatty acid oxidation proteins. BJE administration improved obesity by decreasing adipogenesis and activating heat generation and fatty acid oxidation in 3T3-L1 cells and in HFD-induced obese C57BL/6J mice. These findings indicate that BJE is a promising natural means of preventing obesity-related metabolic diseases.

In the paper, by convolution theorem for the Laplace transforms and analytic techniques, the author finds necessary and sufficient conditions for complete monotonicity, monotonicity, and inequalities of several functions involving polygamma functions. By these results, the author derives a lower bound of a function related to the sectional curvature of the manifold of the beta distributions. Finally, the author poses several guesses and open problems related to monotonicity, complete monotonicity, and inequalities of several functions involving polygamma functions.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Background: Coronavirus Disease 2019 (COVID-19) has been demonstrated to be the cause of pneumonia. Nevertheless, it has not been reported as the cause of acute myocarditis or fulminant myocarditis. Case presentation: A 63-year-old male was admitted with pneumonia and cardiac symptoms. He was genetically confirmed as having COVID-19 according to sputum testing on the day of admission. He also had elevated troponin I (Trop I) level (up to 11.37 g/L) and diffuse myocardial dyskinesia along with a decreased left ventricular ejection fraction (LVEF) on echocardiography. The highest level of interleukin-6 was 272.40 pg/ml. Bedside chest radiographs showed typical ground-glass changes indicative of viral pneumonia. Laboratory test results for viruses that cause myocarditis were all negative. The patient conformed to the diagnostic criteria of the Chinese expert consensus statement for fulminant myocarditis. After receiving antiviral therapy and mechanical life support, Trop I was reduced to 0.10 g/L, and interleukin-6 was reduced to 7.63 pg/ml. Moreover, the LVEF of the patient gradually recovered to 68%. The patient died of aggravation of secondary infection on the 33^rd day of hospitalization. Conclusion: COVID-19 patients may develop severe cardiac complications such as myocarditis and heart failure. This is the first report of COVID-19 complicated with fulminant myocarditis. The mechanism of cardiac pathology caused by COVID-19 needs further study.

The 3x+1 problem asks the following: Suppose we start with a positive integer, and if it is odd then multiply it by 3 and add 1, and if it is even, divide it by 2. Then repeat this process as long as you can. Do you eventually reach the integer 1, no matter what you started with? Collatz conjecture (or 3n+1 problem) has been explored for about 85 years. In this paper, we convert an integer number from decimal to binary number, and convert the Collatz function to binary function, which is multiplication and division of two binary numbers. Finally the iternation of the Collatz function, eventually reach the integer 1, thus we solve the 3x+1 problem completely.

This paper presents a study to accurately evaluate defects in reinforced concrete decks using ultrasonic pulse-echo signals. Two validation specimens were designed and tested where reinforced concrete deck slab specimens included planned voids and defects. A commercial Ultrasonic Pulse-Echo (UPE) device obtains 2-D images of the void/defect locations of the reinforced concrete deck. The UPE is based on the ultrasonic shear-wave test method using dry-point-contact transmitting and receiving transducers and employing a synthetic aperture focusing technique. The authors analyzed the recorded UPE A-scan data to enhance the accuracy of estimating the defects' locations using the synthetic aperture focusing technique imaging method. The analysis benefitted from an advanced denoising approach and defect echo peak extraction based on empirical modal decomposition, Hurst exponent characterization, and Hilbert envelope estimation. While output from conventional UPC devices can only provide qualitative results, the new method provides quantitative information on the anomalies inside the reinforced concrete deck. The developed approach accurately assists with assessing the location and depth of the voids/defects in the reinforced concrete deck slabs.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

This study assessed the acute effects of oral methylliberine (DynamineTM) supplementation on cognitive function and indices of well-being. This was a double-blind, randomized, within-subject crossover trial. 25 healthy men and women (33.5±10.7yr, 172.7±8.6cm, 73.3±11.0kg) underwent pretesting before ingesting methylliberine (100mg) or placebo (PLA) for 3 days. On the fourth day participants were tested before their 4th dose (baseline) and every hour post-ingestion for 3 hours. After a one-week washout period, participants repeated testing with the alternate investigational product. The testing battery consisted of vitals, Stroop test and Trail Making Test-B, and visual analog scales that assessed various indices of well-being. Mixed factorial ANOVA with repeated measures were used to assess all variables. There were significant (p≤0.050) interactions in concentration, motivation, and mood. Methylliberine improved concentration 1- and 3-hours, motivation 3 hours, and mood 1-, 2-, and 3 hours (p≤0.050). Methylliberine improved energy, sustained energy, and mood in all participants to a greater extent than PLA at 1-hour and 3-hours relative to baseline (p≤0.050). PLA improved motivation at 1- and 2-hours and mood at 2-hours (p≤0.050). Methylliberine improved concentration, well-being, and the ability to tolerate stress to a greater extent than PLA at 3-hours relative to baseline (p≤0.050). Women observed elevations in sustained energy 1- and 3-hours (p≤0.050) in methylliberine vs. PLA. Methylliberine had negligible influence on cognitive function, vitals (p>0.050), and no adverse events were reported. Methylliberine significantly improved subjective feelings of energy, concentration, motivation, and mood, but not cognitive function. PLA improved motivation and mood at hours 1 and 2, while methylliberine sustained benefits for longer. Methylliberine also improved concentration, well-being, and the ability to tolerate stress to a greater degree than PLA while having no detrimental effects on vital signs. Methylliberine also seems to have a positive impact on sustained energy in women.

HIV diagnosis and management have often caused disruptions to the everyday life and imagined futures of people living with HIV, both at individual and social levels. This has been conceptualised, in a rather dystopian way, as ‘biographical disruption’. This paper attempts to re-cast data from interviews with 40 men living with HIV (MLHIV) in Yogyakarta and Belu, Indonesia, in a slightly more positive light. Our analysis uses the concepts of additive and subtractive resilience strategies and we show how, rather than having a purely disrupted biography, participants talked about their experiences of ‘biographical reinvention'. Study participants were recruited using the snowball sampling technique, starting from two HIV clinics in the settings. Data were collected using one-on-one in-depth interviews, and a qualitative framework analysis was used to guide step-by-step data analysis. The findings showed that despite the disruptions in their everyday life (i.e., mental health condition, work, activities, social relationships, etc.) following the HIV diagnosis and management, MLHIV in our study managed to utilise their internal assets or traits (i.e., hope, optimism, resilience) and mobilised external resources (i.e., support from families, friends and healthcare professionals) to cope with the disruptions. An interweaving of these internal assets and external resources enabled them to take on new activities and roles (additive resilience strategies) and give up health compromising behaviours (subtractive resilience strategies). These were effective for most MLHIV in our study not only to cope with the HIV repercussions and improve their physical and mental health conditions, but to think or work on a ‘reinvented’ biography which encompassed resilience, hope and optimism for better health, life and future. The findings indicate the need for HIV interventions and healthcare systems that provide appropriate support for the development and maintenance of internal assets of PLHIV to enable them to cope with the repercussions of HIV and work on a ‘reinvented’ biography.

Overweight and Obesity (Ow/Ob) is a risk factor for developing cardiometabolic disease, and metabolic dysfunction. Dietary interventions, such as caloric restriction (CR), have been explored but little is known about the acute effects of CR and often such diets are not standardized. PURPOSE: To assess the impact of a standardized 3-day CR diet (~590kcal/d) on cardiometabolic health and fat metabolism in Ow/Ob individuals. METHODS: Fifteen Ow/Ob men and women were assessed pre-post 3-day CR using standardized diet; specifically, body weight/composition (% body fat, visceral fat score (Vfs), waist-hip circumferences, blood pressure and vascular stiffness, resting energy expenditure (REE), substrate utilization (respiratory quotient, RQ), and blood glucose/lipid profile. RESULTS: CR induced changes in body weight (93.1±15.2 to 90.67±14.4 kg, p&lt;0.001, d=1.9), body mass index (32.9±4.0 to 32.0±3.7 kg/m2, p&lt;0.001, d=1.4), body fat (37.2±7.5 to 35.8±7.5%, p=0.002, d=1.1) and Vfs (13.1±4.5 to 12.2±3.9 a.u., p=0.002, d=1.1), but not body water (46.3±3.6 to 46.0±3.6%, p=0.29, d=0.3). CR had no effect on peripheral (86±5 to 89±5 mmHg, p=0.23, d=0.3) or central mean arterial pressure (86±5 to 87±6 mmHg, p=0.44, d=0.2), but lowered augmentation index (29.8±17.5 to 21.5±14.5%, p=0.05, d=0.6). Blood glucose (86±7 to 84±11 mg/dl, p=0.33, d=0.3) and blood lipids (total cholesterol (196±49 to 203±54 mg/dl, p=0.16, d=0.4) and TC/HDL (4.9±2.4 to 6.1±4.7, p=0.13, d=0.4)) were unchanged. RQ decreased with CR (0.84±0.01 to 0.76±0.00, p&lt;0.001, d=1.9), though REE was unchanged (1718±274 to 1722±317 kcal/d, p=0.83, d=0.1). CONCLUSION: The 3-day CR significantly improved body weight and composition and fat metabolism, with minimal cardiovascular effects.

Background: This study aimed to estimate the prevalence of sexualized drug use (SDU) in gay, bisexual, and other men who have sex with men living with HIV (HIV+GBMSM) in Madrid during 2019/2020 and compare it with data from 2016/2017. Methods: We analysed the frequency of SDU in a sample of HIV+GBMSM attending HIV clinics, who participated in an anonymous online survey regarding sexual behaviour and recreational drug use. The association between SDU, sexual risk behaviours, and STIs was evaluated. The methodology employed in the present study(U-SEX-2) in 2019/2020 was consistent with that of a previous study(U-SEX-1) in 2016/2017. Results: The study included 424 HIV+GBMSM, with a mean age of 40(10.43) years. Overall, 94% (396) reported being sexually active. Additionally, 33% (140) had been diagnosed with an STI within the previous year. Moreover, 54% (229) had used drugs in the last year, 25% (107) engaged in SDU, and 15% (17) reported engagement in slamsex. After adjusting for confounding factors, SDU was associated with STIs, fisting, unprotected anal intercourse, and having &gt; 24 sexual partners in the last year. According to the DUDIT test scores, 76% (81) probably had problematic drug use (≥6 points), and 5% (8) probable drug dependence (≥25 points). When comparing the U-SEX-1(2016/2017) data with the U-SEX-2(2019/2020) data, no significant differences were found in the proportion of participants practicing SDU or slamsex. Conclusion: The prevalence of SDU among HIV+GBMSM has remained high in recent years and without significant changes. We observed a clear association between SDU, high-risk sexual behaviors, STIs, and the risk of drug related problems.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

In the present study we report the efficacy of food matrices derived from olives in preventing oxidation of low-density lipoprotein cholesterol (LDL) and lipid peroxidation. To this end, 12 healthy volunteers were divided into 3 groups and cross-received a single dose of olive phenolics, mainly hydroxytyrosol (HT), provided as a liquid dietary supplement (30.6 or 61.5 mg HT), or as fortified extra virgin olive oil (12.19 mg HT + tyrosol). Blood and urine samples were collected at baseline and up to 12 hours after ingestion. Plasma oxidized LDL levels were measured by ELISA using a monoclonal antibody, while F2-isoprostanes were quantified in urine by UHPLC-MS/MS. Despite the great variability between individuals, a tendency to reduce lipoxidation reactions has been observed after olive phenolics intake in both, blood and urine. In addition, the subgroup of individuals with the highest baseline lipoxidation level showed a decrease in F2-isoprostanes (p < 0.05) after taking the food supplements, as well as a marked decrease in oxidized LDL levels (p < 0.01) after intake of the food supplement with the lowest HT dose. These promising results suggest that HT supplementation could be a useful aid in preventing lipoxidation. Additionally, people with a redox imbalance could benefit even more from supplementing with bioavailable HT.

Lack of sleep is a factor that disrupts the receptors' reception of information from the environ-ment and contributes to the emergence of problems with maintaining balance. The main pur-pose of this study was to find out whether Computer Dynamic Posturography could be a useful tool in distinguishing between people who sleep well from people with insomnia. The study participants were 76 male students who were divided into groups based on the results obtained from the Pittsburgh Sleep Quality Questionnaire. In each group, postural stability had been tested using three main tests: Strategy Organization Test SOT, Motor Control Test MCT and Ad-aptation Test ADT. The results of the analysis show that the obtained results differ in the exam-ined groups under the SOT test. Among people with insomnia, higher values of the tested pa-rameters were noted, than with people who sleep well, which translates into a worse ability to maintain balance. The greatest impact is observed when using eyesight and a vestibular system to maintain a stable posture. It was confirmed that Computer Dynamic Posturography is used to differentiate between people who sleep well from people with insomnia in the group of men. Lack of sleep significantly disturbs postural stability.

The study describes the acute and delayed time course of recovery following the CrossFit® Benchmark Workout Karen. Eight trained men (28.4±6.4 years; 1RM back squat 139.1±26.0 kg) undertook the Karen protocol. The protocol consists of 150 Wall Balls, aiming to hit a target 3 meters high. Countermovement jump height (CMJ), creatine kinase (CK), and perceived recovery status scale (PRS) (general, lower and upper limbs) were assessed pre, post-0h, 24h, 48h and 72h after the session. The CK concentration 24h after was higher than pre-exercise (338.4 U/L vs. 143.3 U/L; effect size: 0.74; p≤0.05). At 48h and 72h following exercise, CK concentration had returned to baseline levels. The PRS general and of the lower limbs were lower in the 24-hours post-exercise compared to pre-exercise (PRS general: 4.7 ±1.5 and 7.9 ±1.7 mmol/L; and PRS of the lower limbs: 4.0 ±2.5 and 7.9 ±0.8, respectively). The PRS general, lower, and upper limbs were reduced at 48-post exercise compared to 72-hours post-exercise scores. Our findings provide insights into the fatigue profile and recovery in acute CrossFit® and can be useful to coaches effectively design the daily session.

Multi-rotor drones, a kind of unmanned equipment which is widely used in military, commercial consumption and other fields, has been developed very rapidly in recent years. However, their short flight time has hindered the expansion of their application range. This can be addressed by utilizing hydrogen fuel cells, which exhibit high energy density, strong adaptability to ambient temperature, and no pollution emissions, as the power source. Accordingly, the application of hydrogen fuel cells as the power source in multi-rotor drones is a promising technology that has attracted significant research attention. This paper summarizes the development process of hydrogen fuel cell mul-ti-rotor drones and analyzes the key obstacles that need to be addressed for the further development of hydrogen fuel cell multi-rotor drones, including structural lightweight, hydrogen storage methods, energy management strategies. Additionally, prospects for the future development of hydrogen fuel cell multi-rotor drones are presented.

Precision and accuracy estimation is an important index used to reflect the measurement performance and quality of a measurement system. To reveal the significance and connotations of the precision and accuracy estimation index of a close-range photogrammetry system, several common precision and accuracy estimation methods used in close-range photogrammetry are explained from a theoretical perspective, and the mechanism of the internal coincidence precision estimation and the external coincidence accuracy estimation are deduced, respectively. Through detailed experimental design and testing, the validity and reliability of the proposed precision and accuracy estimation methods are verified, which provides strong evidence for the quality control, optimisation, and evaluation of the measurement results from a close-range photogrammetry system. At the same time, it has significance for the further development of precision and accuracy estimation analysis of close-range photogrammetry systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

This study describes a novel method for grading pathological sections of gliomas. Our own integrated hyperspectral imaging system was employed to characterize 270 bands of cancerous tissue samples from microarray slides of gliomas. These samples were then classified according to the guidelines developed by the World Health Organization, which define the subtypes and grades of diffuse gliomas. We explored a hyperspectral feature extraction model called SMLME-Resnet using microscopic hyperspectral images of brain gliomas of different malignancy grades. The model combines the channel attention mechanism and multi-scale image features to automatically learn the pathological organization of gliomas and obtain hierarchical feature representations, effectively removing the interference of redundant information. It also completes multi-modal, multi-scale spatial and spectral feature extraction to improve the automatic classification of glioma subtypes. The proposed classification method demonstrated high average classification accuracy (>97.3\%) and Kappa coefficient (0.954), indicating its effectiveness in improving the automatic classification of hyperspectral gliomas. The method is readily applicable in a wide range of clinical settings, offering valuable assistance in alleviating the workload of clinical pathologists. Furthermore, the study contributes to the development of more personalized and refined treatment plans, as well as subsequent follow-up and adjustment of treatment, by providing physicians with insights into the underlying pathological organization of gliomas.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Infrared dim and small target detection is a key technology of various detection tasks. However, due to the lack of shape, texture, and other information, it is a challenging task to detect dim and small targets. Recently, since many traditional algorithms ingore global information of infrared images, they generate some false alarms in complicated environments. To address this problem, in this paper, a coarse-to-fine deep learning-based method is proposed to detect dim and small targets. Firstly, a coarse-to-fine detection framework integrating deep learning and background prediction is applied for detecting targets. The framework contains of coarse detection module and fine detection module. In coarse detection stage, Region Proposal Network (RPN) is employed to generate masks in target candidate regions. Then, for further optimize the result, inpainting is utilized to predict the background by the global semnantic of images. In this paper, inpainting algorithm with a mask aware dynamic filtering module is incorporated into the fine detection stage to estimate background in candidate target areas. Finally, compared with existing algorithms, the experimental results indicate that the proposed framework have effective detection capability and robustness for complex surroundings.

Androgen deprivation therapy (ADT) for prostate cancer treatment is associated with adverse physiological changes, however exercise can improve outcomes. This systematic review and meta-analysis aimed to determine exercise intervention adherence, and its effects on physiological outcomes in men diagnosed with prostate cancer undergoing ADT. Uniquely, this review incorporates a meta-aggregation of qualitative data, providing perspectives from the men’s experiences. A systematic review and meta-analysis were completed following PRISMA Guidelines. Databases (CINAHL, Cochrane, PubMed) were searched for studies using “prostate cancer”, “exercise intervention”, and “androgen deprivation therapy”. Quantitative randomised controlled trials describing adherence to exercise interventions were selected, with qualitative articles selected based on descriptions of experiences around participation. Subgroup meta-analyses of adherence, exercise mode, and intervention duration were completed for quality of life, aerobic fitness, fatigue, and strength. Articles (n=64) articles were identified, with 29 (n=23 quantitative; n=6 qualitative) articles from 25 studies included. Exercise had no effects (p&lt;0.05) on quality of life and fatigue. Significant effects (all p&lt;0.05) were observed for aerobic fitness, and upper- and lower-body strength. Adherence to exercise-based interventions was 80.38%, with improvements observed in aerobic fitness and strength. Subgroup analysis revealed exercise adherence impacted fatigue and strength, with greater improvements observed in programs &gt;12-weeks.

This paper proposes a novel single-stage buck-boost three-Level neutral-point-clamped (NPC) inverter with two independent dc sources coupled for the grid-tied photovoltaic (PV) application, which can effectively solve the unbalanced operational conditions generally appeared between two coupled independent PV sources induced by the unequal irradiation and temperature distribution. The proposed control scheme can simultaneously guarantee the maximum power point (MPP) operation of both PV sources and maintain the output waveform quality. Compared to the traditional two-stage PV inverter, the proposed NPC inverter could reduce the PV array voltage requirement and dc-link capacitors’ voltage rating, meanwhile show the advantage in operational efficiency. MATLAB simulations and the captured experimental results are presented to show the performance of the proposed three-level inverter.

Multi-cameras system is widely applied in 3D computer vision especially when multiple cameras are distributed on both sides of the measured object. The calibration methods of multi-cameras system are critical to the accuracy of vision measurement and the key is to find an appropriate calibration target. In this paper, a high-precision camera calibration method for multi-cameras system based on transparent glass checkerboard and ray tracing is described, which is used to calibrate multiple cameras distributed on both sides of the glass checkerboard. Firstly, the intrinsic parameters of each camera is obtained by Zhang’s calibration method. Then, multiple cameras capture several images from the front and back of the glass checkerboard with different orientations, and all images contain distinct grid corners. As the cameras on one side are not affected by the refraction of glass checkerboard, extrinsic parameters can be directly calculated. However, the cameras on another side are influenced by the refraction of glass checkerboard, and the direct use of projection model will produce calibration error. A multi-cameras calibration method using refractive projection model and ray tracing is developed to eliminate this error. Furthermore, both synthetic and real data are employed to validate the proposed approach. The experimental results of refractive calibration show that the error of the 3D reconstruction is smaller than 0.2 mm, the relative errors of both rotation and translation are less than 0.014%, and the mean and standard deviation of reprojection error of 4-cameras system are 0.00007 and 0.4543 pixel. The proposed method is flexible, high accurate, and simple to carry out.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Europium (Eu)-doped fluorapatite (FA) nanorods has a similar biocompatibility with hydroxyapatite (HA) in terms, attracted much attention as cell imaging biomaterials due to their luminescent property. Here, we will discuss the new feature of europium doped fluorapatite (Eu-FA) nanorods as anticancer drug carrier. Eu-FA nanorods was prepared using a hydrothermal method. The morphology, crystal structure, fluorescence and composition are investigated. The specific crystal structure, enabling an effective loading of drug molecules. Doxorubicin (DOX), used as an anticancer model drug, was shown to be effectively loaded onto the surface of the nanorods. The DOX release was fairly pH-dependent, occurring more rapidly at pH 5.5 than pH 7.4 was observed. The intracellular penetration of the DOX-loaded Eu-FA nanorods (Eu-FA/DOX) can be imaged in situ due to the self-fluorescence property. Treatment of melanoma A375 cells with Eu-FA/DOX elicited a more effective apoptosis rate than direct DOX treatment. Overall, Eu-FA show great promise for tracking and treating tumor, may potentially useful as a multifunctional carrier system to effectively load and sustainably deliver drugs.

Macadamia nut plantings in China are expanding year by year. In order to further promote the superior varieties, this study analyzed the effects of different varieties of rootstock and scion on the survival rate as well as the effects of 18 different ratios of substrate composition on seedling growth were analyzed. The results showed that: The survival rate of HAES788 varieties as rootstock and Guire No.1 as scion was the highest, reaching 96%. The optimal grafting time in December was better than that in March. Substrate formulations 12, 13, 15 and 16 had agglomerated soil and well-developed root systems compared to the controls. Plant height, stem diameter, leaf length, leaf width, and dry weight of aboveground and underground parts were significantly higher than those of the control. In addition, the substrate formulations 12, 13, 15 and 16 significantly improved the organic matter, total nitrogen, and total potassium content of the substrate soils, but little on total phosphorus content. All in all, macadamia grafting times are best in December, with HAES788 and Guire No.1 being the best rootstock and scion. Substrate formulations 12, 13, 15 and 16 are the optimal formula. This study provides a solid foundation to produce high-quality macadamia seedlings.

The CuCrSn alloy is promising as high-strength and high-conductivity Cu alloy due to its relative low smelting requirement, while thus far reports on the CuCrSn alloy is still quite lacked. In this study, the microstructure and properties of Cu-0.20Cr-0.25Sn (wt%) specimens prepared under different rolling and aging combinations were comprehensively characterized, in order to reveal the effects of cold rolling and aging on the CuCrSn alloy. The results show that increasing the aging temperature from 400 ºC to 450 ºC can obviously accelerates the precipitation, and the cold rolling before aging significantly increases the initial microhardness and promotes the precipitation. Whereas, the deformation hardening will be eliminated during the aging process, making the microhardness even decrease monotonically when the aging temperature and the rolling ratio before aging are high. Performing the cold rolling after the aging can maximize the effects of precipitation strengthening and deformation strengthening, and its adverse impact on the conductivity is not serious. A tensile strength of 506.5 MPa and a conductivity of 70.33% IACS were obtained with such a treatment, only the elongation decreases. Different strength-conductivity combinations of the CuCrSn alloy can be achieved through appropriate combinations of the aging and post aging cold rolling conditions.

The purpose of the present study was to compare heart rate (HR), blood lactate and training load between different CrossFit® workouts, with equalized total volume in men and women. The study included 23 individuals (13 men and 10 women) experienced in CrossFit® training, who performed two workouts with different training types (as many reps as possible - AMRAP and for time) but equalized volume. Measurements of lactate, HR and rating of perceived exertion (RPE) were performed. The results showed that there was no HR interaction between workout time and sex (p = 0.822; η2 = 0.006] and between workout type and sex (p = 0.064, η2 = 0.803). HR significantly differed during each workout type (p <0.001, η2 = 0.621), but not between the two workout types (p = 0.552, η2 = 0.017). Lactate showed no difference between the workout types (p = 0.474, η2 = 0.768), although the training load was higher (p = 0.033, η2 = 0.199) in women when they performed AMRAP. Altogether, HR was not significantly different between training types or sex, while RPE, lactate and training load showed small differences depending on the group (women or men) or workout type (AMRAP or 'for time').

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Nowadays, brain signal processing is performed rapidly in various brain-computer interface (BCI) applications. Most researchers focus on developing new methods for the future or improving the basic implemented models to identify the optimum standalone feature set. Our research focuses on four ideas. One of them introduces future communication models, and the others are for improving old models or methods. These are: 1) new communication imagery model instead of speech imager using the mental task: Due to speech imagery is very difficult, and it is impossible to imagine sound for all of the characters in all of the languages. Our research introduces a new mental task model for all languages that call Lip-sync imagery. This model can use for all characters in all languages. This paper implemented two lip-sync for two sounds, characters or letters. 2) New combination Signals: Selecting an inopportune frequency domain can lead to inefficient feature extraction. Therefore, domain selection is so important for processing. This combination of limited frequency ranges proposes a preliminary for creating Fragmentary Continuous frequency. For the first model, two s intervals of 4 Hz as filter banks were examined and tested. The primary purpose is to identify the combination of filter banks with 4Hz (scale of each filter bank) from the 4Hz to 40Hz frequency domain as new combination signals (8Hz) to obtain well and efficient features using increasing distinctive patterns and decreasing similar patterns of brain activities.3) new supplement bond graph classifier for SVM classifier: When SVM linear uses in very noisy, the performance is decreased. But we introduce a new bond graph linear classifier to supplement SVM linear in noisy data. 4) a deep formula recognition model: it converts the data of the first layer into a formula model (formula extraction model). The main goal is to reduce the noise in the subsequent layers for the coefficients of the formulas. The output of the last layer is the coefficients selected by different functions in different layers. Finally, the classifier extracts the root interval of the formulas, and the diagnosis does based on the root interval. For all of the ideas achieved the results of implementing methods. The results are between 55% to 98%. Less result is 55% for the deep detection formula, and the highest result is 98% for new combination signals.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The Doppler band compensated by the keystone transform (KT) is limited. Therefore, it needs to be used in conjunction with the Doppler ambiguity compensation function to correct the range migration (RM) caused by maneuvering targets with Doppler ambiguity. However, the KT implemented by sinc interpolation suffers from significant performance loss at boundaries of compensation Doppler bands. Additionally, in a multi-target scenario, KT implementation methods occupy high complexity when the Doppler range of targets spans over two compensation Doppler bands. To address aforementioned issues, this study presents a variable Doppler starting point keystone transform (VDSPKT) method, where a new form of ambiguity compensation function is constructed, turning the Doppler starting point of the compensation band in KT variable. Firstly, the position of the compensation Doppler band is changed from fixed to adjustable as needed, enhancing the flexibility of KT. Crucially, the connection points of the compensation Doppler bands in sinc interpolation are reset, avoiding the performance loss at their boundaries. Also, the compensation band is adjusted to cover the narrow Doppler frequency range caused by targets, significantly improving the computational efficiency. Finally, the simulation results demonstrate that the proposed approach effectively addresses the performance degradation and high computational complexity of KT in the aforementioned scenarios, resulting in a computational load reduced by approximately 50% compared to traditional methods.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

This study examines the prospective association of egg consumption with multiple domains of cognitive function in older, community-dwelling men and women followed 16.3 years. Participants were 617 men and 898 women from the Rancho Bernardo Cohort aged 60 and older who were surveyed about egg intake/week in 1972-74, and attended a 1988-91 research visit when cognitive function was assessed with 12 tests. Analyses showed that egg intake ranged from 0-24/week (means: men=4.23.2, women=3.52.7, p<0.0001). In men, covariate-adjusted regressions showed egg intake was associated with better performance on Buschke total (p=0.04), long-term (p=0.02) and short-term (p=0.05) recall. No significant associations were observed in women (p’s>0.05). Analyses in those <60y at in 1972-74 showed egg intake was positively associated with scores on Heaton copying(p<.04) and the Mini-Mental Status Exam(MMSE;p<.02) in men, and category fluency(p<0.05) in women. Egg intake was not significantly associated with odds of poor performance on MMSE, Trails B, or category fluency in either sex. These reassuring findings suggest there are no long-term detrimental effects of egg consumption on multiple cognitive function domains, and for men, there may be beneficial effects for verbal episodic memory. Egg consumption in middle-age may also be related to better cognitive performance later in life.

Background: Dynapenia and non-alcoholic fatty liver disease (NAFLD) are common, especially in the middle and advanced-age diabetic male population. We aimed to examine the clinical features, NAFLD severity, and parameters associated with the presence of dynapenia in type 2 diabetes mellitus (T2DM) cases. Material and Methods: One hundred thirty-five male patients diagnosed with T2DM between 45 and 65 years of age were included. Patients were staged by ultrasonography according to NAFLD status. Results: There were significant differences in muscle strength, upper arm circumference, calf circumference, and up-and-go test scores between the NAFLD groups (p<0.001 for all). The frequency of dynapenia was lower, and arm and calf circumferences were higher in patients without NAFLD. The muscle strength, upper arm circumference, calf circumference, and up-and-go test scores were significantly lower in the dynapenic group compared to the non-dynapenic group (p<0.005 for all). The prevalence of dynapenia increased along with the increase in NAFLD stages (p<0.001). Conclusions: We detected a significant association between NAFLD and dynapenia in middle-aged men with T2DM. As muscle strength decreases, the amount of fat in the liver increases, and as the fat in the liver increases, muscle strength decreases.

The tourism sector in general and the hotelier in particular face the challenge of managing appropriate measures to deal with the covid-19 pandemic. In this sense it is useful to know what the measures are most demanded by the clientele. This research, by analyzing the variance (ANOVA) of a factor concluded that women are more demanding than men in terms of the level of demand in relation to the measures to be taken in hotels. This, as a practical application, allows to know more accurately the expectations, demands and demands of the client segmented by sex, in order to satisfy and improve the tourist experiences.

Androgen receptor signaling is crucial for prostate cancer growth and is positively regulated in part by intratumoral CYP3A5. As African American (AA) men often carry the wild type CYP3A5 and express high level of CYP3A5 protein, we blocked the wild type CYP3A5 in AA origin prostate cancer cells and tested its effect on androgen receptor signaling. q-PCR based profiler assay identified several AR regulated genes known to regulate AR nuclear translocation, cell cycle progression and cell growth. CYP3A5 processes several commonly prescribed drugs and many of these are CYP3A5 inducers or inhibitors. In this study, we test the effect of these commonly prescribed CYP3A5 inducers/inhibitors on AR signaling. The results show that the CYP3A5 inducers promoted AR nuclear translocation, downstream signaling and cell growth whereas CYP3A5 inhibitors abrogated them. The observed changes in AR activity is specific to alterations in CYP3A5 activity. Both the inducers tested demonstrated increased cell growth of prostate cancer cells, whereas the inhibitors showed reduced cell growth. Further, characterization and utilization of the observation that CYP3A5 inducers and inhibitors alter AR signaling may provide guidance to physicians prescribing CYP3A5 modulating drugs to treat comorbidities in elderly patients undergoing ADT, particularly AA.

Ferrocenium (Fc+) inherits a number of molecular/electronic properties from the neutral counterparts’ ferrocene (Fc) including the high symmetry. Both Fc+ and Fc prefer the eclipsed structure (D5h) over the staggered structure (D5d) by an energy of 0.36 kcal·mol-1. The present study using the recently developed excess orbital energy spectrum (EOES) shows that the open shell Fc+ cation exhibits similar conformer dependent configurational changes to the neutral Fc conformer pair. A further energy decomposition analysis (EDA) discloses that the reasons for the preferred structures are different between Fc+ and Fc. The dominant differentiating energy between the Fc+ conformers is the electrostatic energy (EEstat), whereas in neutral Fc, it is the quantum mechanical Pauli repulsive energy (EPauli). Within the D5h conformer of Fc+, the EOES reveals that the -electrons of Fc+ experience more substantial conformer dependent energy changes than the -electrons (assumed the hole is in a β orbital).

In the paper, the authors survey integral representations (including the Lévy--Khintchine representations) and applications of some bivariate means (including the logarithmic mean, the identric mean, Stolarsky's mean, the harmonic mean, the (weighted) geometric means and their reciprocals, and the Toader--Qi mean) and the multivariate (weighted) geometric means and their reciprocals, derive integral representations of bivariate complex geometric mean and its reciprocal, and apply these newly-derived integral representations to establish integral representations of Heronian mean of power 2 and its reciprocal.

Based on PVDF (piezoelectric sensing techniques), this paper attempts to study the propagation law of shock waves in brittle materials during the process of three-wavelength laser irradiation of polysilicon, and discusses the formation mechanism of thermal shock failure. The experimental results show that the vapor pressure effect and the plasma pressure effect in the process of pulsed laser irradiation lead to the splashing of high temperature and high density melt. With the decrease of the laser wavelength, the laser breakdown threshold decreases and the shock wave is weakened. Because of pressure effect of the laser shock, the brittle fracture zone is at the edge of the irradiated area. The surface tension gradient and surface shear wave caused by the surface wave are the result of coherent coupling between optical and thermodynamics. The average propagation velocity of laser shock wave in polysilicon is 8.47×103m/s, and the experiment has reached the conclusion that the laser shock wave pressure peak exponentially distributes attenuation in the polysilicon.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

In this perspective article, we ponder topographical enhancements of artificial neural networks. In our recent paper in JMLR, we proved a quasi-equivalence between the network width and depth and also discussed the power of intra-links, which can be viewed as network height. In 1982, Hopfield published a network to model human associative memory, which contains many loops for dynamic evolution toward fixed points. Based on noising-denoising loops, diffusion models are recently developed to enable Bayesian modeling and inference with big data. Furthermore, we envision development of multi-AI-agent systems through “netware” engineering as a quantum leap of software engineering for emergent behaviors and autonomous AI at individual and population levels. We believe that the novel use of links and loops in space and time via multi-scale coupling would catalyze the next-generation neural networks.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.