Evaluating soil quality across various altitudinal gradients, both with and without vegetative cover, is crucial for the proper functioning of soil and optimal crop growth, thereby contributing to the sustainability of agroecosystems. Although the altitudinal gradient significantly influences soil quality, the ability to predict this quality, expressed through an index, in soils with and without vegetative cover, is still insufficiently explored. This study aimed to assess soil quality in the Jun Jun micro-watershed, located in the Tungurahua region, Ecuador. To achieve this objective, three categories of altitudinal gradients were selected: less than 2800 meters above sea level (masl), between 2800 and 2900 masl, and greater than 2900 masl. A total of 24 soil samples were collected in the mentioned gradients, considering both areas with and without vegetative cover. The indicators used included chemical and biological parameters such as soil organic carbon (OC), earthworm density (WD), earthworm biomass (WB), organic matter (OM), pH, total nitrogen (TN), and organic carbon (OC). The results revealed that in areas with altitudinal gradients below 2800 masl, soil quality index values were higher compared to other altitudes. In vegetated areas, a decrease in index values was observed as the altitudinal gradient increased, indicating a deterioration in soil quality with altitude. These findings are significant in providing a quantitative assessment of the effects of altitudinal gradient and vegetative cover influence on soil quality.

Background: Previous in vitro and in vivo studies have demonstrated that storage of cooked rice at 4 °C for 24 h and reheating to 65 °C significantly reduced starch digestibility and postprandial glycaemic responses. Moreover, the effect was greater for parboiled rice compared to other rice varieties commonly consumed in New Zealand. This study aimed to evaluate consumer preferences of related sensory attributes and consumer acceptability of several rice varieties freshly cooked or reheated. Method: Sixty-four consumers volunteered and recorded on Visual Analoge Scales their preference and acceptability of freshly prepared or cold-stored and reheated medium grain white, medium grain brown and parboiled rice. Results: All six rice samples were accepted by participants (average 54%). Reheated parboiled rice and reheated medium grain brown rice were both accepted by participants as a preferred staple meal compared to other rice samples. Among all rice samples, the sweetness and the flavour of freshly cooked warm medium-grain white rice were less preferred (scored 42.1% and 45.0% respectively) compared with other samples (P = 0.05). Participants who prepared and consumed brown rice at home regularly (more than 10 times per month), preferred the reheated brown rice (73.8% (67.4, 80.2)) and reheated parboiled rice (74.3% (67.9, 80.7)) (P < 0.001). Conclusions: It is suggested that reheated parboiled rice, with the lowest starch digestibility and glycaemic impact (both in vitro glucose release and in vivo glucose response) could be accepted as a healthier alternative for the daily staple meal.

Background: Globally, hot cooked refined rice is consumed in large quantities and is a major contributor to dietary glycaemic load. This study aimed to compare the glycaemic potency of hot and cold stored parboiled rice to widely available medium grain white rice. Method: Twenty-eight healthy volunteers participated in a three treatment experiment where postprandial blood glucose was measured over 120 minutes after consumption of 140g of rice. Three rice samples were freshly cooked medium-grain white rice, freshly cooked parboiled rice, and parboiled rice stored overnight at 4 ºC. All rice was served warm at 65 ºC. Chewing time was recorded. Results: The 24-hours cold-stored and reheated parboiled rice resulted in a 42% and 12% lower blood glucose concentration trajectory than freshly cooked medium-grain white rice and freshly cooked parboiled rice. Chewing time for 10g cold stored parboiled rice was 6 seconds (25%) longer and was considered more palatable, visually appealing and better tasting than freshly cooked medium grain (all P<0.05). Conclusions:. For regular consumers of rice reheating cooked rice after cold storage would lower the dietary glycaemic load and long term may reduce risk for type 2 and gestational diabetes. More trials are needed to identify the significance.

Liquid-liquid phase separation (LLPS) of proteins has been found ubiquitously in eukaryotic cells, critical in the controlling of many biological processes through forming a temporary condensed phase with different bimolecular components. TDP-43 is recruited to stress granules in cells and is the main component of TDP-43 granules and proteinaceous amyloid inclusions in patients with amyotrophic lateral sclerosis (ALS). TDP-43 low complexity domain (LCD) is able to demix in solution forming the protein condensed droplets. The molecular interactions regulating its LLPS were investigated at the protein fusion equilibrium stage, where the droplets stopped growing. We found the molecules in the droplet were still liquid-like but with enhanced intermolecular helix-helix interaction in the LCD. The protein would start to aggregate after about 200 minutes of lag time and aggregate slower than at the condition when the protein does not phase separate or the molecules have a reduced intermolecular helical interaction. A structural transition intermediate towards protein aggregation was also discovered involving a decrease of the intermolecular helix-helix interaction and a reduction in the helicity. Therefore, LLPS and the intermolecular helical interaction could help maintain the stability of TDP-43 LCD.

Coptisine (Cop) exerts a neuroprotective effect in central nervous system disease, particularly ischemic stroke. However, its protective mechanism is still unclear. This study aimed to investigate the protective effect of Cop on cerebral ischemia-reperfusion (IR) rats with a middle cerebral artery occlusion model by integrating a gas chromatography-mass spectrometry (GC-MS) based metabolomics approach with biochemical assessment. Our results showed that Cop could improve neurobehavioral function and decrease the ischemia size in IR rats. In addition, Cop was found to decrease inflammatory mediators (e.g., prostaglandin D2 (PGD2) and tumor necrosis factor-α (TNF-α) and attenuate oxidative stress response (e.g., increase the superoxide dismutase (SOD) expression and decrease 8-iso-PGF2α level). Furthermore, GC-MS based cerebrospinal fluid (CSF) metabolomics analysis indicated that Cop influenced the level of glycine, 2,3,4-trihydroxybutyric acid, oleic acid, glycerol, and ribose during IR injury. Cop exhibited a good neuroprotective effect against cerebral IR injury and metabolic alterations which might be mediated through its antioxidant and anti-inflammatory property.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

The safe and efficient mining of coal seams with low porosity, low permeability and high inhomogeneity under complex geological conditions is a major challenge, among which the permeability of coal seams is crucial for coal mine gas extraction. The development of coal seam permeability enhancement technology can help coal mines to produce safely and efficiently, and the extracted coal bed methane can be utilized as a green energy. In order to study the effect of freezing and thawing on the evolution of mechanical and permeability properties of coal, triaxial permeability tests were carried out on low-permeability coal under two kinds of surrounding pressures. At the same time, dry, saturated and freeze-thaw coal were set up for comparison, and the effects of water and freeze-thaw were separated from each other. The triaxial mechanics and percolation laws of dry, saturated and freeze-thaw coal rocks were obtained, and the mechanism of the influence of freeze-thaw on the permeability evolution law of coal was revealed. The research results can provide theoretical guidance for the gas extraction technology of low permeability coal seams with increased permeability.

In the pursuit of China’s dual carbon goals, identifying spatio-temporal changes in industrial carbon emission efficiency and their influencing factors in cities at different stages of development is the key to effective formulation of countermeasures to promote the low-carbon transformation of Chinese national industry and achieve high-quality economic development. In this study, we used balanced panel data of 270 Chinese cities from 2005 to 2020 as a research object: (1) to show spatio-temporal evolution patterns in urban industrial carbon emission efficiency; (2) to analyze the aggregation characteristics of industrial carbon emission efficiency in Chinese cities using Global Moran's I statistics; and (3) to use the hierarchical regression model for panel data to assess the non-linear impact of the digital economy on the industrial carbon emission efficiency of cities. The results show the following: (1) the industrial carbon emission efficiency of Chinese cities exhibited an upward trend from 2005 to 2020, with a spatial distribution pattern of high in the south and low in the north; (2) China's urban industrial carbon emission efficiency is characterized by significant spatial autocorrelation, with increasing and stabilizing correlation, and a relatively fixed pattern of spatial agglomeration; (3) there is a significant inverted-U-shaped relationship between the digital economy and the industrial carbon emission efficiency of cities. The digital economy increases carbon emissions and inhibits industrial carbon-emission efficiency in the early stages of development, but inhibits carbon emissions and promotes industrial carbon emission efficiency in mature developmental stages. Therefore, cities at all levels should reduce pollution and carbon emissions from high-energy-consuming and high-polluting enterprises, gradually reduce carbon-intensive industries, and accelerate the digital transformation and upgrading of enterprises. Western, central and eastern regions especially should seek to promote the sharing of innovation resources, strengthen exchanges and interactions relating to scientific and technological innovation, and jointly explore coordinated development routes for the digital economy.

Extraction of high-resolution surface waves is essential in surface-wave survey. Because reflections usually interfere with surface waves on X component in a multicomponent seismic exploration, it is difficult to extract dispersion curves of surface waves. The situation goes more serious when the frequencies and velocities of higher-mode surface waves are close to those of PS-waves. A method for surface-wave extraction is proposed based on the morphological differences between reflections and surface waves. Frequency-domain high-resolution linear Radon transform (LRT) and time-domain high-resolution hyperbolic Radon transform (HRT) are used to represent surface waves and reflections respectively. Then, the sparse representation problem based on the morphological component analysis (MCA) is built and optimally solved to obtain high-fidelity surface waves. An advantage of our method is its ability to extract surface waves when their frequencies and velocities are close to those of reflections. Furthermore, results of synthetic and field examples confirm that the proposed method can attenuate the distortion of surface-wave dispersive energy caused by reflections, which contributes to extracting accurate dispersion curves.

Natural montane peatlands generally are not a significant source of nitrous oxide (N₂O) due to environment limitation including phosphorus (P) scarcity and temperature lowness. Phosphorus enrichment and warming caused by global change are altering this limitation, likely to increase the source function of N₂O. However, the combined effects of P addition and warming on N₂O fluxes and biotic/abiotic factor in peatlands are still uncertain. To address this, we investigated the long-term (12 yrs) effects of P addition (5 and 10 kg ha^-1 yr^-1) and its interaction with warming on N₂O fluxes in a peatland. The results showed that although long-term P addition did not significantly affect the source/sink function of N₂O in the peatland, it stimulated enzyme activities, promoted peat decomposition. However, warming amplified the effect of P addition to increase N₂O emissions by stimulating enzyme activities and changing soil stoichiometry, even turned the peatland into a significant source of N₂O with an emission of approximate 100 g m^-2 during the growing season. Our study suggests that P enrichment under the current background of global warming will enhance the possibility of strong N₂O emissions in montane peatlands, which may increase the risk to further aggravate global warming.

A single-crystal of ytterbium-doped “mixed” yttrium-lutetium aluminium garnet with a stoichiometric composition of (Y0.601Lu0.233Yb0.166)3Al5O12 was grown by the Czochralski method and its structure, vibronic, spectroscopic and laser properties were studied. The stimulated-emission cross-section for Yb3+ ions was maximized to 2.53×10-20 cm2 at 1031 nm, the emission bandwidth is ~8 nm and the reabsorption-free luminescence lifetime of the 2F5/2 state is 1.063 ms. Pumped at 941 nm, the Yb-laser generated a maximum output power of 1.04 W at 1.03 and 1.05 μm with a high slope efficiency of 76.4% and a laser threshold of 76 mW. A continuous wavelength tuning over a range of 51.6 nm (1026.4 - 1078.0 nm) was also achieved. Power scaling is achieved using a 969 nm-diode pumped microchip cavity. A maximum output power of ~9 W is obtained at 1.05 μm with a slope efficiency of 76% and with an almost circular laser beam profile.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Honeycomb-like CO₃O₄ nanosheets with high specific surface area were successfully synthesized on porous nickel foam by the facile hydrothermal method followed by an annealing treatment (300 °C), which were used as high-performance supercapacitor electrodes. The effects of mole ratio of hexamethylenetetramine (HMT) and Co(NO₃)₂ (1:1, 2:1, 3:1, 4:1, 5:1 and 6:1）as the reactants on morphological evolution and electrochemical performance of the electrodes were investigated in detail. X-ray diffractometry, transmission electron microscopy, X-ray photoelectron spectroscopy and scanning electron microscopy were applied to characterize the structure and morphology of the products. The electrochemical performance was measured by cyclic voltammetry (CV) and galvanostatic charge/discharge. The results indicated that phase constituents were almost unaffected with the change in mole ratio of HMT and Co(NO₃)₂. However, the significant morphological evolution of Co₃O₄ was observed with increasing the mole ratio, which was described as followed: the nanosheets accompanied with a large number of spherical nanoparticles→the formation of some strip-like particles due to the agglomeration of spherical nanoparticles→the formation of new nanosheets resulting from the growth of strip-like particles→the formation of coarse flower-like particles owing to the connection among the nanosheets→the nanosheets gradually covered with flower-like particles. Accompanied with the change, the specific surface area was increased firstly, and then decreased. A maximum was obtained in the HMT and Co(NO₃)₂ mole ratio of 4:1, which was further validated by CV and galvanostatic charge/discharge tests. The specific capacitance value was 743.00 F·g^-1 at 1 A·g^-1 in the galvanostatic charge/discharge test, which was apparently higher than those in the other mole ratios (139.11 F·g^-1 in 1:1, 280.46 F·g^-1 in 2:1, 503.29 F·g^-1 in 3:1, 463.75 F·g^-1 in 5:1 and 363.74 F·g^-1 in 6:1). The change was also observed in the CV test with a scanning rate of 5 mV·s^-1 (121.32 F·g^-1 in 1:1, 217.33 F·g^-1 in 2:1, 559.86 F·g^-1 in 3:1, 693.56 F·g^-1 in 4:1, 423.35 F·g^-1 in 5:1 and 321.64 F·g^-1 in 6:1). Co₃O₄ synthesized in the mole ratio of 4:1 also demonstrated an excellent cyclic performance, in which about 97% of the initial specific capacitance was remained at 1 A·g^-1 for 500 cycles in the galvanostatic charge/discharge test. This excellent electrochemical performance was ascribed to high specific surface area of Co₃O₄ nanosheets that provide enough channels and space for ions transportion.

In order to improve the adaptability of broilers to low-temperature environments and their ability to resist acute cold stress (ACS), 240 one-day-old broilers were selected and randomly divided into three groups. The control treatment (CC) was raised at the conventional feeding temperature from 1-43 days (d), the cold stimulation treatments (CS) were kept at 3 °C below the temperature of CC at 1-d intervals for 3 and 6 hours from 15 to 35 d, namely CS3 and CS6, respectively. Then all broilers were kept at 20 °C from 36 to 43 d. ACS was then carried out at 44 d, and the ambient temperature was dropped to 10 °C for 6 hours. The study investigated the production perfor-mance, as well as levels of intestinal barrier genes (including Claudin-1, E-cadherin, Occludin, ZO-1, ZO-2 and Mucin2), secretory IgA in duodenum and jejunum, and immunoglobulins (IgA and IgG) in serum. The results showed that IMCS could increase the daily weight gain and decrease the feed conversion ratio. During the IMCS, the expression levels of intestinal barrier genes were up-regulated and the content of secretory IgA was increased. When IMCS ceased for one week, the level of immunoglobulins in serum stabilized, and the expression levels of Occludin, ZO-2 and Mucin2 still maintained high levels. After ACS, broilers that received IMCS training maintained the high levels of intestinal barrier genes and secretory IgA.

Transient receptor potential melastatin-8 (TRPM8) is a cation channel that is activated by cold and “cooling agents” such as menthol and icilin, which induce a cold sensation. Stimulation of TRPM8 activates an intracellular signaling cascade that ultimately leads to a change in the gene expression pattern of the cells. Here, we investigated the TRPM8-induced signaling pathway that links TRPM8 channel activation to gene transcription. Using a pharmacological approach, we show that inhibition of phosphatidylinositol 4-phosphate 5 kinase alpha (PIP5K), an enzyme essential for the biosynthesis of phosphatidylinositol 4,5-bisphosphate, attenuated TRPM8-induced gene transcription. Analyzing the link between TRPM8 and Gq proteins, we show that pharmacological inhibition of the beta gamma subunits impairs TRPM8 signaling. In addition, genetic studies showed that TRPM8 requires an activated Galpha subunit for signaling. In the nucleus, the TRPM8-induced signaling cascade triggers an activation of the transcription factor AP-1, a complex consisting of a dimer of basic region leucine zipper (bZIP) transcription factors. Here, we identified the bZIP protein c-Jun as an essential component of AP-1 within the TRPM8-induced signling cscade. In summary, with PIP5K, Gq subunits and c-Jun we have identified key molecules in the TRPM8-induced signaling from the plasma membrane to the nucleus.

Background: The major histocompatibility complex (MHC) plays a key role in the adaptive immune response to pathogens due to its extraordinary polymorphism. However, the spatial patterns of MHC variation in the striped hamster remain unclear, particularly regarding the relative contribution of balancing selection in shaping MHC population and diversity compared to neutral forces. Methods: In this study, we investigated the immunogenic variation of the striped hamster in four wild populations in Inner Mongolia, which experience heterogeneous parasitic stress. Our goal was to identify local adaptation by comparing the genetic structure at MHC with that at seven microsatellite loci, taking into account neutral processes. Results: We observed significant variation in parasite pressure among sites, with parasite burden showing a correlation with temperature and precipitation. Molecular analysis revealed a similar co-structure between MHC and microsatellite loci. We observed lower genetic differentiation at MHC loci compared to microsatellite loci, and no correlation was found between the two. Conclusions: Overall, these results suggest a complex interplay between neutral evolutionary forces and balancing selection in shaping the spatial patterns of MHC variation. Local adaptation was not detected at a small scale but may be applicable at a larger scale.

The study of the currently known >3,000 species of snakes can provide valuable insights into the evolution of their genomes. Deinagkistrodon acutus, also known as Sharp-nosed Pit Viper, one hundred-pacer viper or five-pacer viper, is a venomous snake with significant economic, medicinal and scientific importance. Widely distributed in southeastern China and South-East Asia, D. acutus has been primarily studied for its venom. Here, we employed next-generation sequencing to assemble and annotate a highly continuous genome of D. acutus. The genome size is 1.46 Gb; its scaffold N50 length is 6.21 Mb, the repeat content is 42.81%, and 24,402 functional genes were annotated. This study helps to further understand and utilize D. acutus and its venom at the genetic level.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

The greatly diversified flowering plants (angiosperms) are the dominating and defining group in the current earth ecosystem. However, from which group by what way the flowers, especially their gynoecia (key characteristics of angiosperms), are derived have been the questions in botany unanswered over centuries. Such an embarrassing situation can be attributed to the lack of plants with partially enclosed ovules, which are supposed to be a post between gymnosperms and angi-osperms. Here we report a fossil plant that has an apparent coniferous vegetative and reproduc-tive morphologies but has a single seed partially wrapped by the subtending bract. Such a mor-phology suggests that the carpels in angiosperms may be equivalent to bracts enclosing their axil-lary seed(s). Such a non-traditional interpretation of the homology of angiosperm carpels is com-patible with various new progresses made in botany and is in line with Tomlinson’s recent hy-pothesis. Together with other fossil evidence reported recently, it appears that gynoecia in angio-sperms are derived in multiple ways.

The most recent National Research Council Nutrient Requirements for Sheep and Goats was published in 2007, one of the most consequential nutrient requirement recommendations for sheep and goats in the world. It is pertinent to continue the refinement and discussion of nutrient utilization and requirements for the purposes of enhancing the efficiency of production systems, maximizing resource economy, and minimizing the carbon footprint, among others. Progress has been made in the estimation of energy and protein requirements in sheep and goats, mainly utilizing empirical feeding experimentation, comparative slaughter technique and minimum endogenous loss method. In sheep, newer estimates of energy and protein requirements for maintenance and growth and partial efficiencies had been reported since 2007. There were suggestions that energy and protein requirements could have been affected by breed, wool growth, gender and size; with these reported values being similar or lower than the recommended values in international feeding systems such as NRC, ARC, INRA and AFRC. In goats, energy and protein requirements for growing goats were reported to be either higher or lower than the established recommendations, depending upon meat or dairy breeds. Effect of gender on energy requirement appeared to be related to the stage of growth or degree of maturity. Newer data also suggested that the guidelines of the major feeding systems for the entire growth phase may not be adequate for non-pregnant and non-lactating pubertal females. In multiparous pregnant goats, energy and protein requirements for maintenance did not appear to be affected by days of pregnancy, but efficiencies of metabolizable energy and metabolizable protein utilization for pregnancy were. There were suggestions that that metabolizable protein synthesis in the rumen can be predicted from energy intake using combined equations that encompass both sheep and goats, but more data on goats were called for to account for specific differences in nutrition. In addition to sulfur, there has been progress made on the estimation of maintenance and growth requirements of calcium, phosphorus, potassium and magnesium in goats, with suggestions on the consideration of gender and breed differences. Species, level of Intake, genotype, mature size, age, gender, body composition, use of tissue energy, activity, season, and acclimatization continue to be important considerations for the estimation of nutrient requirements in sheep and goats, with emerging factors such as climate change, heat stress, parasitism and secondary plant compounds. Model equations and partial efficiencies used by NRC to predict energy and protein requirements for maintenance, growth, lactation, and fiber have been highlighted and discussed for the purpose of a more focus discussion and refinement for the future. Potential and limitation of both traditional and emerging methodologies in determining the nutrient requirements in sheep and goats were discussed. To justify the research investment, emerging methodologies such as nutrigenomics will have to be linked more directly to the improvement of production efficiency via more precise prediction of nutrient requirement.

Calcareous sand deposits are widely distributed along the shoreline in ropical and subtropical regions. Microbially induced calcite precipitation treatment (MICP) is a relatively new method to improve the stiffness and strength of the soil. Little is known about the small-strain shear modulus and damping ratio of MICP-treated calcareous sand, which are two crucial parameters for the prediction of the dynamic behavior of soil. A series of resonant column tests are performed to investigate the dynamic performance of MICP-treated calcareous sand, with special attention paid to the influence of treatment duration and confining stress on the stiffness and damping characteristics. The relationship between the initial dynamic shear modulus and unconfined compressive strength is analyzed. Additionally, the empirical equations of the reference shear strain between treatment duration and confining stress are given. The G/G0 of MICP-cemented calcareous sand presents a higher strain sensitivity than that of untreated sand, and its attenuation pattern can be described by Hardin-Drnevich model. The σc has an apparent effect on the degradation characteristics of the dynamic shear modulus of MICP-treated calcareous sand with a low cementation level, however, its effect decreases with the increasing treatment duration. The relationship between the reference shear strain and the treatment duration and confining stress can be described by a power and a linear formula, respectively.

Supramolecular solvent (SUPRAS) has received increasing interest as an innovative, efficient, and green solvent for the effective extraction and separation of bioactive compounds from natural resources. However, studies on the use of SUPRAS for the extraction of phenolic components from plants, which are highly valued in food products due to their excellent antioxidant capacity, are still lacking. The present study developed a green ultrasound-assisted and efficient SU-PRAS method to simultaneously determine three phenolic acids in Prunella vulgaris by high-performance liquid chromatography (HPLC) and the experimental parameters were optimized in detail. The efficiency and antioxidant properties of the phenolic compounds obtained by different extraction methods were also compared. Under the optimal conditions, the extraction efficiency of SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, was substantially higher than conventional organic reagents. Moreover, this SUPRAS method also showed more significant antioxidant capacities. The confocal laser scanning microscopy (CLSM) images presented the spherical droplet structure of SUPRAS (A well-defined circle), which coincided with the position of the fluorescence position of phenolic acids. The phenolic acids were encapsulated in the vesicles by the SUPRAS droplets, which indicated the efficient extraction capacities of SUPRAS for the target compounds. Finally, combined with the CLSM method, the mechanism of the proposed method was further clarified, and the superior extraction performance of SUPRAS was theoretically demonstrated through molecular dynamics simulations. In comparison with conventional methods, the higher extraction efficiency of SUPRAS can be illustrated by the larger solvent contact surface area, more types of hydrogen bonds between extractants and supramolecular solvents, and stronger and more stable interaction forces. The results of the theoretical studies are in rational agreement with the experimental outcome.

Amidst the escalating demands for efficient Intelligent Transportation Systems (ITS) management, the significance of accurate Origin-Destination (OD) data prediction has emerged as a paramount concern, given its indispensable role in the ITS domain. This paper introduces a groundbreaking integrated model, creatively fusing the unique strengths of Graph Convolutional Network (GCN), Residual Neural Network (ResNet), and Long Short-Term Memory Network (LSTM) into a single architecture, which we name GraphResLSTM, to exploit road segment average speed data for OD prediction. Compared with conventional road segment traffic volume data, average speed data is more readily available, significantly reducing the data accessibility barrier for OD prediction. We underscore the critical role of selection of key road segments and employs a combination of Entropy Weight Method and Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) to identify 41 representative road segments from the experimental road network. In the experimental phase, we simulate 86400000 seconds of traffic conditions, generating a total of 1440000 data records. Utilizing these simulated data, we design and conduct comparative experiments between models as well as data types. The results demonstrate that both the GraphResLSTM model and road segment average speed data outperform other models and data types notably in OD prediction tasks.

To achieve a micro-destructive and rapid measurement of the wood density of standing trees, this study investigated the feasibility of using the micro-drilling resistance method, formulated a mathematical model, explored the potential for a unified model across multiple tree species, and analyzed the influence of moisture content on measurement accuracy. First, 231 tree cores and drill resistance data were sampled from Pinus massoniana, Cunninghamia lanceolate, and Cryptomeria fortunei. The basic density and moisture content of each core were measured, and the average value of each resistance data record was calculated. Second, the average drill resistance, the natural logarithm of average drill resistance, and absolute moisture content were used as independent variables, while the wood basic density was used as the dependent variable. Third, the total model of the three tree species and sub-model for each tree species were established through a stepwise regression method. Finally, the accuracy of each model was compared and analyzed with that of using the average basic density of each tree species as an estimated density. The results revealed that the estimation accuracy of the sub-model for each tree species was 1.670 percentage points higher than the average value of each tree species used as the density estimation value for these tree species. Additionally, except for Cryptomeria fortunei, the natural logarithm of drill resistance significantly influenced the wood density model at a significance level of 0.05. Moreover, moisture content significantly affected the total model and sub-models of Pinus massoniana at a significance level of 0.05. The estimation accuracy of the total mathematical model was 2.125 percentage points lower than that achieved using the average basic density of each tree species to predict their density. The results indicated the feasibility of using the micro-drilling resistance method to measure the wood density of standing trees. Moreover, the relationship between wood density and drill resistance did not follow a linear pattern, and moisture content slightly influenced the drill needle resistance. Furthermore, the establishment of a mathematical model for each tree species was deemed essential. This study provides valuable guidance for measuring the wood density of standing trees through the micro-drilling resistance method.

Ningxiang pig is renowned breed for its exceptional meat quality, but it possesses suboptimal carcass traits. To elucidate the genetic architecture of meat quality and carcass traits in Ningxiang pigs, we assessed heritability and executed a genome-wide association study (GWAS) concerning carcass length, backfat thickness, meat color parameters (L.LD, a.LD, b.LD), and pH at two postmortem intervals (45 minutes and 24 hours) within a Ningxiang pig population. Heritability estimates ranged from moderate to high (0.30 ~ 0.80) for carcass traits and from low to high (0.11 ~ 0.48) for meat quality traits. We identified 21 significant SNPs, the majority of which were situated within previously documented QTL regions. Furthermore, the HMGA1 gene emerged as a pleiotropic gene correlated with carcass length and backfat thickness. The ADGRF1, FKBP5, and PRIM2 genes were associated with carcass length, while the NIPBL gene was linked to backfat thickness. These genes hold potential for use in selective breeding programs targeting carcass traits in Ningxiang pigs.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

In response to the structural optimization problem of PCB stator coreless disc motors, the orthogonal response surface method was used to optimize the motor structure, determine the basic parameters of the motor preliminarily, and conduct orthogonal experiments on the motor parameters based on the optimization design objectives, The optimization factors were the quantity of magnetic pole of the motor rotor, the ratio of main/auxiliary pole size, the thicknessof the permanent magnet, and the air gap length.The motor torque，the amplitude of magnetic density of the air gap and waveform distortion rateare used as optimization objectives. The motor parameters that make the motor torque reach the maximum, the air gap magnetic density maximum, and the waveform distortion rate minimum. Due to the use of PCB plates instead of motor stator cores in PCB coreless disc motors,The service life of the PCB board during motor operation will be reduced with the temperature rise generated by the stator winding To solve this problem, the response surface analysis of the motor is carried out to reduce the temperature rise of the stator windings during the operation of the motor. PCB board and stator winding are the main factors affecting the temperature rise of the motor.Taking the thickness of the PCB board, the hole diameter on the board, and the uneven width of the stator winding as optimization factors, the motor parameters with the lowest temperature rise of the motor winding are obtained. Simulation analysis is conducted using Ansys/Maxwell software, and the results prove the feasibility of optimization.

Soarinho Alkaline Intrusion, southeastern Brazil, makes part of the Serra do Mar Igneous Province, and it is composed of alkali feldspar syenite, alkali feldspar trachyte, quartz syenite, and mon-zonite. Geochemical and geochronological analysis of the Soarinho were compared with data from its neighbors Rio Bonito and Tanguá. Zircon U-Pb Laser Ablation ages show that Soarinho is youngest than Rio Bonito and Tanguá. Ages obtained from the monzonite (60 ± 2 Ma), alkali feldspar syenite (58 ± 2 Ma), and quartz syenite (58 ± 2 Ma) are indistinguishable within error. Petrographic and geochemical data show a clear contrast among Soarinho, Rio Bonito, Tanguá, and Lu-Hf isotopic data for the three alkaline intrusions (all negative), point to some similarities in their sources. The data suggest an enriched mantle source for Soarinho; however, an older con-tinental crust contribution cannot be discarded.

The newly emerged severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected millions of people and caused tremendous morbidity and mortality worldwide. Effective treatment for coronavirus disease 2019 (COVID-19) due to SARS-CoV-2 infection is lacking and different therapeutic strategies are under testing. Host humoral and cellular immunity to SARS-CoV-2 infection is a critical determinant for patients’ outcome. SARS-CoV-2 infection results in seroconversion and production of anti-SARS-CoV-2 antibodies. The antibodies may suppress viral replication through neutralization but also might also participate in COVID-19 pathogenesis through a process termed antibody-dependent enhancement. Rapid progress has been made in the research of antibody response and therapy in COVID-19 patients including characterization of the clinical features of antibody responses in different populations infected by SARS-CoV-2, treatment of COVID-19 patients with convalescent plasma and intravenous immunoglobin products, isolation and characterization of a large panel of monoclonal neutralizing antibodies, as well as preliminary clinical results from several COVID-19 vaccine candidates. In this review, we summarize the recent progress and discuss the implications of these findings in vaccine development.

This work is devoted to physical vapor deposition synthesis, and characterisation of bismuth and lutetium-substituted ferrite-garnet thin-film materials for magneto-optic (MO) applications. The properties of garnet thin films sputtered using a target of nominal composition type Bi_0.9Lu_1.85Y_0.25Fe_4.0Ga₁O₁₂ are studied. By measuring the optical transmission spectra at room temperature, the optical constants and the accurate film thicknesses can be evaluated using Swanepoel’s envelope method. The refractive index data are found to be matching very closely to these derived from Cauchy’s dispersion formula for the entire spectral range between 300-2500 nm. The optical absorption coefficient and the extinction coefficient data are studied for both the as-deposited and annealed garnet thin-film samples. A new approach is applied for accurately deriving the optical constants data simultaneously with the physical layer thickness, using a combination approach employing custom-built spectrum-fitting software in conjunction with Swanepoel’s envelope method. MO properties, such as specific Faraday rotation, MO figure of merit and MO swing factor are also investigated for several annealed garnet-phase films.

Gas flaring is commonly used by industrial plants for processing oil and natural gases in the atmosphere, and hence is an important anthropogenic source for various pollutants including CO₂, CO, and aerosols. This study evaluates the feasibility of using satellite data to characterize gas flaring form space by focusing on the Khanty Mansiysk Autonomous Okrug in Russia, a region that is well known for its dominatingly gas flaring activities. Multiple satellite-based thermal anomaly data products at night are inter-compared and analyzed, including MODIS (Moderate Resolution Imaging Spectroradiometer) Terra level-2 Thermal Anomalies product (MOD14), MODIS Aqua level-2 Thermal Anomalies product (MYD14), VIIRS (Visible Infrared Imaging Radiometer Suite) Active Fires Applications Related Product (VAFP), and VIIRS level-2 data based Nightfire product (VNF). The analysis compares and contrasts the efficacy of these sensor products in detecting small, hot sources like flares on the ground in extremely cold environments such as Russia. We found that the VNF algorithm recently launched by NOAA has the unprecedented accuracy and efficiency in characterizing gas flares in the region owing primarily to the use of Shortwave Infrared (SWIR) bands. Reconciliation of VNF’s differences and similarities with other nighttime fire products is also conducted, indicating that MOD14/MYD14 and VAFP data are only effective in detecting those gas flaring pixels that are among the hottest in the region. Validation of VNF product of gas flaring location with Google Earth images are made. It is shown that that VNF’s estimates of gas flaring area (the area of gas flaming) agree well the counterparts from Google images with a linear correlation of 0.91, highlighting its potential use for routinely monitoring emissions of gas flaring from space.

Background and Objectives: The site types of Eucalyptus urophylla × Eucalyptus grandis clonal plantations in southern Yunnan were compared, aiming to provide basis for site selection and scientific plantations management. Materials and Methods: In this study, 80 standard plots were set up in the 6−9-year-old Eucalypts plantations in Pu'er City and Lincang City. Furthermore, the quantitative theory I model and canonical correlation analysis were used to analyze the relationship between dominant tree growth traits and site factors, and evaluate the growth potential of E. urophylla × E. grandis plantation. Results: The multiple correlation coefficient between 8 site factors (altitude, slope, slope level, soil thickness, slope direction, texture, soil bulk density, and litter thickness) and the quantitative growth of the dominant wood was 0.825 (P < 0.05). According to the correlation coefficient of the quantitative regression model, slope, altitude, and soil thickness were the main factors for the classification of E. urophylla × E. grandis plantations in southern Yunnan. In addition, E. urophylla × E. grandis plantations grew best downhill and mid uphill at relatively low altitude, where the soil layer was thick and composed of weathered red soil. Contrastingly, E. urophylla × E. grandis plantation growth was extremely poor in uphill sites at higher altitude, where the soil layer was thin and composed of semi-weathered purple soil. Furthermore, total N, and available B, Cu, and Zn content, as well as soil organic matter content in the soil had a great influence on the growth of E. urophylla × E. grandis. Conclusions: Nitrogen and phosphate fertilizer as well as trace elements such as B, Zn, and Cu can be properly applied in middle- and low-yield forests to promote the growth and development of E. urophylla × E. grandis plantations.

Small peptides (SPs), ranging from 5 to 100 amino acids, play integral roles in plants due to their diverse functions. Despite their low abundance and small molecular weight, SPs intricately regulate critical aspects of plant life, including cell division, growth, differentiation, flowering, fruiting, maturation, and stress responses. As vital mediators of intercellular signaling, SPs have garnered significant attention in plant biology research. This comprehensive review delves into SPs' structure, classification, and identification, providing a detailed understanding of their significance. Additionally, we summarize recent findings on the biological functions and signaling pathways of prominent SPs that regulate plant growth and development. The review also offers a forward-looking perspective on future research directions in peptide signaling pathways.

In the recent decade, Building Information Modelling (BIM) has widely been adopted in the Architecture, Engineering and Construction (AEC) industry and completely upended the way we build. While BIM continues gain momentum in the industry, it has also attracted increasing attentions from researchers. However, most of the current study focuses on reviewing BIM for management, BIM for green building, BIM for infrastructure and BIM for Facilities Management (FM). There are few studies about Global BIM review and to discuss their complex inter-connections. In this study, we adopted a scientometric analysis method to review global BIM research from 2004-2019. A total of 1455 scholarly bibliographic records obtained from Web of Science Core Collection databased were established for the analysis. This study has identified the top productive and influential researchers, research institutes, regions/countries, subject categories and journals in the BIM field. In addition, 11 clusters of Global BIM research were also identified including construction project, green BIM, construction safety planning, automated IFC-based workflow and so on. Authors distinguished 11 clusters of global BIM research into 3 stages, namely formulating stage, accelerating stage and transforming stage. Furthermore, authors reviewed the BIM policy of Singapore and observed there is a co-production relationship between evolution of BIM policy and global BIM research. These findings provide valuable information for researchers, practitioners and policy makers by visualizing the current progress in the research field of BIM and highlighting future research needs.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

We investigated the response of leaf photosynthetic capacity to climate warming and its variation among provenances of Larix gmelinii (Dahurian larch). Seedlings of 11 L. gmelinii provenances were transplanted into two common gardens with different climate conditions (control and warming climate). We measured the leaf photosynthetic capacity and explored its influencing factors. The warming treatment significantly increased the maximum net photosynthetic rate (Pmax-a), photosynthetic nitrogen use efficiency (PNUE), maximum carboxylation rate (Vcmax), maximum electron transport rate (Jmax), triose phosphate utilization rate (TPU), mesophyll conductance (gm), leaf nitrogen content (Narea), and chlorophyll content (Chlm). The Pmax-a was significantly positively associated with Vcmax, Jmax, TPU, gm, and Narea, and the slope of the correlations between Pmax-a and Vcmax, Jmax, and TPU was steeper in the warming treatment. The responses of Pmax-a, PNUE, Vcmax, Jmax, TPU, Narea, and Chlm to warming differed among provenances. The effects of warming on Pmax-a, Vcmax, Jmax, and TPU increased and then decreased as the aridity index of the original site increased. Overall, the warming treatment improved the photosynthetic capacity of L. gmelinii, but the extent of the improvement varied among provenances. These findings provide insights into the mechanisms underlying the responses of L. gmelinii to climate warming.

With the development of salt cavern gas storage construction technology, the construction of large-scale gas storage salt caverns using sediment voids is expected to solve the problem of low effective volume formation rate and poor construction economy of high-impurity salt mines. There are few studies on the long-term operation mechanical behavior of salt cavern gas storage under the influence of sediment accumulation currently. This paper studies the influence of sediment accumulation height, particle gradation, and operating pressure on the stability of salt caverns by constructing a coupling model of sediment particle discontinuous medium and surrounding rock continuous medium. The continuous-discontinuous coupling algorithm is suitable for analyzing the influence of particle accumulation height and particle gradation on the creep shrinkage of salt caverns. The increase of sediment accumulation height slows down the creep shrinkage of the bottom of the salt cavern, strengthens the restraining effect on the surrounding rock of the cavern, and moves the position of the maximum displacement of the surrounding rock to the upper part of the cavern; the sediment particle gradation has little effect on the cavern volume shrinkage rate, and the greater the coarse particle content, the smaller the cavern volume shrinkage rate; the greater the operating pressure, the more conducive to maintaining the stability of the cavern, slowing down the upward movement of the sediment body and increasing the gas storage space in the upper part of the cavern. This research results can provide a reference for evaluating the long-term operation stability of sediment-type high-impurity salt cavern gas storage.

Stabilization of a G-quadruplex (G4) in the promotor of the c-MYC proto-oncogene leads to inhibition of gene expression, and it thus represents a potentially attractive new strategy for cancer treatment. However, most G4 stabilizers show little selectivity among the many G4s present in the cellular complement of DNA and RNA. Intriguingly, a crescent-shaped cell-penetrating thiazole peptide, TH3, preferentially stabilizes the c-MYC G4 over other promotor G4s, but the mechanisms leading to this selective binding remain obscure. To investigate these mechanisms at the atomic level, we performed an in silico comparative investigation of the binding of TH3 and its analogue TH1 to the G4s from the promotors of c-MYC, c-KIT1, c-KIT2, and BCL2. Molecular docking and molecular dynamics simulations, combined with in-depth analyses of non-covalent interactions and bulk and per-nucleotide binding free energies, revealed that both TH3 and TH1 can induce the formation of a sandwich-like framework through stacking with both the top and bottom G-tetrads of the c-MYC G4 and the adjacent terminal capping nucleotides. This framework produces enhanced binding affinities for the c-MYC G4 relative to other promotor G4s, with TH3 exhibiting an outstanding binding priority. Van der Waals interactions were identified to be the key factor in complex formation in all cases. Collectively, our findings fully agree with available experimental data. Therefore, the identified mechanisms leading to specific binding of TH3 towards the c-MYC G4 provide valuable information to guide the development of new selective G4 stabilizers.

The accompanying mechanical behavior during the flow of ore-rock dispersion is an important factor leading to the instability and failure of the orepass in the ore storage section. It is of great significance to accurately understand the instability characteristics of the well wall in the ore section, during the ore drawing process by understanding the flow characteristics and internal mechanical transfer mechanism of ore-rock dispersion. Using the discrete element method to analyze the flow characteristics, contact compactness, stress distribution characteristics and contact force probability distribution of the ore-rock dispersion, it realizes the quantitative characterization of the damage degree of ore-rock flow, and reveals the damage mechanism of mine storage wall. The results show that: (1) The friction between ore-rock particles, between ore-rock and well wall is an important reason for the change of the macroscopic flow form of ore-rock from “one” to “V” type. (2) The compactness and stress concentration of ores are increasing with the increase of storage depth, which is shown that with the increase of storage depth, the greater the probability of well wall instability. (3) The probability distribution of contact force strength between particles decreases exponentially in the whole process of ore drawing, in which the strong chain plays a major role in the stability of the dispersion system. (4) The number of overpressure and the overpressure coefficient can be used to quantitatively characterize the wall damage degree under the action of ore-rock flow. The dynamic side pressure decreases periodically in the form of exponential fluctuations, and the dynamic load formed by the ore-rock flow mainly played a role in the lower area of the ore storage section.

While considering the sensitivity over the parameter optimization, it is essential to determine which parameters have the most significant implications on model performance. This study focuses on the baseflow recession constant as one of the independent basin parameters to forecast low flows, perform hydrograph analysis, and calibrate rainfall-runoff models for significant improvement. Prior studies examined that the optimization of data adjustment parameters can improve the hydrological model performance and determine the minimum acceptable data length for data scarce regions using the Xinanjaing model. However, it is essential to pay special attention to the sensitivity of the recession constant, which can also impact the model performance during the data scarcity. Therefore, this study extends the research to comprehend the recession constant sensitivity over data adjustment parameters in the shorter datasets leading to more reliable parameter estimation. In terms of that, this study explores how recession constant affects hydrological parameter estimation on annual scale while keeping data adjustment parameters constant in continuous hydrological modeling, employing the Xinanjiang (XAJ) model as a case study. This study considered two approaches of recession constant (cg); (i) assessing the relationship between cg and the data adjustment parameter (Cep), for the 28-year datasets, (ii) investigating the significant impacts of the sensitivity of cg over Cep in shorter datasets which can affect the estimation of the acceptable minimum data length in the data scarce basins. The study underscores the importance of the recession constant sensitivity for reliable continuous hydrological model predictions, especially in data-scared areas. The study’s outcomes enhance the understanding of the importance of parameter sensitivity and its relationship in conceptual hydrological modeling during the data limitations.

Ocean surface waves have been utilized as fundamental information in various fields of oceanic research. In this paper, we suggest a simulation and modelling technique for generating an ocean surface wave using an inverse Fast Fourier Transform (iFFT), and we subsequently verify the wave’s accuracy. The conventional method, linear superposition, requires recursive calculation because of the double summation and the time variable; to circumvent this issue, the new algorithm is presented. The Joint North Sea Wave Project (JONSWAP) spectrum is utilized for the ocean surface wave simulation example, and the parameters are the significant wave height (HS) and the zero-crossing wave period (TZ). A coordinate transform for the wavenumber domain was used to apply the inverse FFT algorithm. To verify the accuracy of the simulation result, the relative error between the input condition and the analysis result was calculated. The result for TZ is below 4% relative error, and the maximum relative error for HS is 7%. To avoid the Nyquist frequency for wave-field analysis and simulation, the minimum grid size was calculated by twice applying the maximum wavenumber.

With the rapid evolution of SARS-CoV-2, the emergence of new strains is an intriguing question. This paper presents an evolutionary theory to analyze the mutations of the virus and identify the conditions that lead to the generation of new strains. We represent the virus variants using a 4-letter sequence based on amino acid mutations on the spike protein and employ an n-distance algorithm to derive a variant phylogenetic tree. We show that the theoretically-derived tree aligns with experimental data on virus evolution. Additionally, we propose an A-X model, utilizing the set of existing mutation sites (A) and a set of randomly generated sites (X), to calculate the emergence of new strains. Our findings demonstrate that a sufficient number of random iterations can predict the generation of new macro-lineages when the number of sites in X is large enough. These results provide a crucial theoretical basis for understanding the evolution of SARS-CoV-2.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

Tack is one of the most important factors affecting the operability of prepregs, but it is still very difficult to obtain the change of prepreg tack with time at different temperatures. In this paper, a newly designed T-peel device is used to test the tack decay rate of prepregs at different temperatures. The obtained decay rate deviates less than 8.9% from the manufacturer's data. The maximum deviation of the ratio of tack decay speeds calculated by the Arrhenius equation from the experiments is not higher than -9.7%. It is proved that the present method can obtain the decay rate of tack of prepregs at different temperatures. This method is also applicable to the other two types of prepregs. The article proposes the handling life unit, an operational life measurement unit for prepregs, and establishes that the relationship between tack and remaining shelf life reduces prepreg management costs.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

The broad emission bump in the electromagnetic spectra observed following the detection of gravitational waves created during the kilonova event of merger of two neutron stars in August 2017, GW170817, has been linked to the heavy elements of lanthanides (Z=57-71), and a new understanding of creation of heavy elements in the r-process. The initial spectral emission bump has a wavelength range of 3000 - 7000 \AA, thus covering the region of ultraviolet (UV) to optical (O) wavelengths, and is similar to those seen for lanthanides. Most lanthanides have large number of closely lying energy levels which introduce extensive sets of radiative transitions which often form broad region of lines of significant strength. The current study explores these broad features through photoabsorption spectroscopy of 25 lanthanides ions, Ho I-III, Er I-IV, Tm I-V, Yb I-VI and Lu I-VII. With excitations only to a few orbitals up beyond the ground configurations, we find most of these ions cover large number of bound levels with open $4f$ orbital and produce tens to about hundred thousands lines that may form one or multiple broad features in X-ray to UV, O, and infrared (IR) regions. Spectrum of each of 25 ions is presented indicating presence, shape and wavelength region of the features. Accuracy of atomic data to interpret the merger spectra has been a outstanding problem. The present study aims at providing improved atomic data for energies and transition parameters obtained using relativistic Breit-Pauli approximation implemented in the atomic structure code SUPERSTRUCTURE. The present data have been benchmarked with available experimental data for energies and transition parameters. The study finds that number of ions under the present study are possible contributors of the emission bump of GW170817. All atomic data will be made available online at NORAD-Atomic-Data database.

High dimensional statistical analysis for the yield of large-scale circuits is quite difficult due to expensive simulations, especially for the memory circuits with high sigma requirement (e.g., SRAM). In this paper, we developed an efficient sparse additive model to substitute simulations. To fit high sigma region accurately, the modeling center is moved to near failure boundary searched by scaling the shape of sampling function. To solve the model efficiently, the process variables are grouped by standard cells so that the model can be solved by our developed blockwise greedy algorithm. The experiments on the 28nm memory circuits validate that our method achieves high accuracy and efficiency compared with other state-of-art works.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

Predators are dependent on the capture of prey to meet their energetic and nutritive requirements, imposing a regime of predation risk. Consequently, prey experience both consumptive and non-consumptive effects. Non-consumptive effects may manifest through altered growth and ontogenetic trajectories of prey species, a dynamic modulated by olfactory or other sensory cues from predators. Bactrocera dorsalis Hendel represents a great invasive threat to global horticulture. While earlier research has primarily centered on the consumptive interactions between B. dorsalis and its natural enemies, the potential consequences of non-consumptive interactions on the development of B. dorsalis have been overlooked. In this study, we investigated the impact of predation risk effects, induced by both visual exposure to the predatory mantis Hierodula patellifera Serville and its associated odor, on the life history traits of B. dorsalis. Female B. dorsalis demonstrated reduced development time in the presence of isolated H. patellifera or H. patellifera odor, yet evidenced significantly increased fecundity. Conversely, males displayed no significant change in development time. Additionally, neither female nor male body weight at death was significantly influenced by predation risk from isolated predators or predator odor. These results indicated adaptive developmental strategies of B. dorsalis when faced with risks from predators and highlight the important role of predator odor, which has the potential to lay the groundwork for improving biological control efforts and innovative approaches within pest control.

On the basis of the force and safety factor analysis of traditional retaining wall, a new analytical method of force and displacement of slope is suggested, the numerical theoretical solution of the stress distribution of the sliding body can be obtained under the conditions, which the stresses distribution are satisfied with the differential equilibrium equations, the boundary conditions, the compatibility equation and the macroscopic equilibrium equations. The interface stresses between the sliding body and the retaining wall are continuous, the theoretical solution of retaining wall stress distributions can be gotten, while the stress differential equilibrium equation, the compatibility equation, macroscopic force and moment balance equations are satisfied. The strain and displacement solutions can be obtained by using Duncan Chang and Hooke constitutive equations for the slope and the retaining wall respectively. The transfer station of landfill in the Guandukou Town of Badong County is taken as an example, the results of the sliding body and retaining wall analysis show: The stress and strain solutions of a slope and a retaining wall can be obtained by the proposed method, the forces between the retaining wall and the sliding body include shear stress and normal stress, and the stress distributions change with the deformation of the sliding body, the shape and material of retaining wall can be optimized according to the calculation results，it is feasible for the proposed analysis method of slope with retaining wall design to be run many years.

We study the Gaudin models with gl(1|1) symmetry that are twisted by a diagonal matrix and defined on tensor products of polynomial evaluation gl(1|1)[t]-modules, extending all the results of to the twisted case. Namely, we give an explicit description of the algebra of Hamiltonians (Gaudin Hamiltonians) acting on tensor products of polynomial evaluation gl(1|1)[t]-modules and show that there exists a bijection between common eigenvectors (up to proportionality) of the algebra of Hamiltonians and monic divisors of an explicit polynomial written in terms of the highest weights and evaluation parameters. In particular, our result implies that each common eigenspace of the algebra of Hamiltonians has dimension one. We also give dimensions of the generalized eigenspaces.

A robust guaranteed cost preview repetitive controller is proposed for a class of polytopic uncertain discrete-time systems. In order to improve the tracking performance, the repetitive controller combined with preview compensator is inserted in the forward channel. By using the L-order forward difference operator, an augmented dynamic system is constructed. Then, the guaranteed cost preview repetitive control problem is transformed into the guaranteed cost control problem for the augmented dynamic system. For given performance index, the sufficient condition of asymptotic stability for the closed-loop system is derived by combining parameter-dependent Lyapunov function method with linear matrix inequality (LMI) techniques. By incorporating the controller obtained into the original system, the guaranteed-cost preview repetitive controller is derived. A numerical example is also included to show the effectiveness of the proposed method.

Abstract: Bacillus subtilis fmb60, which has broad-spectrum antimicrobial activities was isolated from plant straw compost. A hybrid NRPS/PKS cluster was screened from the genome. Sixteen secondary metabolites produced by the gene cluster were isolated and identified using LC-HRMS and NMR. Three lipoamides D–F (1-3) and two amicoumacin derivatives, amicoumacins D, E (4, 5), were identified, and are reported here for the first time. Lipoamides D–F exhibited strong antibacterial activities against harmful foodborne bacteria, with the MIC ranging from 6.25 to 25 µg/mL. Amicoumacin E scavenged 38.8% of ABTS+ radicals at 1 mg/mL. Direct cloning and heterologous expression of the NRPS/PKS and ace gene cluster identified its importance for the biosynthesis of amicoumacins. This study demonstrated that there is a high potential for biocontrol utilization of B. subtilis fmb60, and genome mining for clusters of secondary metabolites of B. subtilis fmb60 has revealed a greater biosynthetic potential for the production of novel natural products than previously anticipated.

As an important organelle in eukaryotic cells, Golgi apparatus is responsible for processing and transporting proteins and lipids in cells. Precise monitoring the status of Golgi apparatus by targeting fluorescence imaging technology is of enormous importance but remains an attractive yet dramatically challenging task. In this study, we report the construction of the first Golgi apparatus targeted sensor with bright near-infrared fluorescence, termed as Golgi-Pdots. As a start point of our investigation, hydrophobic CDs with bright NIR fluorescence at 674 nm (fluorescence quantum yield : 12.18%), narrow emission band of 23 nm, and excellent stability were facilely prepared from Magnolia Denudata flowers through an ultrasonic method. Incorporating the CDs into a polymer matrix modified with Golgi-targeting molecules can produce the water-soluble Golgi-Pdots, which showed high colloidal stability and similar optical properties as compared to CDs. Further studies revealed that the Golgi-Pdots showed good biocompatibility and Golgi-targeting ability. Based on these fascinating properties, Golgi-Pdots have been successfully used for long term bioimaging of Golgi apparatus inside live cells.

Coronavirus disease 2019 (COVID-19) from severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection has resulted in tremendous morbidity and mortality worldwide. A major underlying cause of COVID-19 mortality is a hyperinflammatory cytokine storm in severe/critically ill patients. Although many clinical trials are testing the efficacy of targeting inflammatory cytokines/chemokines in COVID-19 patients, the critical inflammatory mediator initiating COVID-19 patient death is undefined. Here we suggest that the immunopathological pathway leading to COVID-19 mortality can be divided into three stages with distinct clinical features that can be used to guide therapeutic strategies. Our interpretation of the recently published clinical trials from COVID-19 patients suggests that the clinical efficacy in preventing COVID-19 mortality using IL-1 blockade is subjected to notable caveats, while that for IL-6 blockade is suboptimal. We discuss critical factors in determining appropriate inflammatory cytokine/chemokine targets, timing, and combination of treatments to prevent COVID-19 mortality.

Blood image intensity has been used to detect erythrocyte sedimentation rate (ESR). However, it does not give an information on biophysical properties of blood sample under continuous ESR. In this study, three physical properties, including, τ₀, ESR_τ, and AI_I, are suggested to quantify mechanical variations of blood under continuous ESR. To demonstrate the proposed method, blood sample is loaded into a driving syringe. The blood flow rate is set in a periodic on–off pattern. Blood sample is then supplied into a capillary chip, and microscopic blood images are captured at specific intervals. Blood shear stress is quantified from the interface of blood stream in the coflowing channel. Both τ₀ and ESR_τ are then obtained by analyzing the blood shear stress. Simultaneously, the AI_I is evaluated by analyzing the image intensity of blood flow. According to the experimental results, the τ₀ exhibits consistent trends with respect to hematocrit as well as diluent. The ESR_τ and AI_I showed a reciprocal relationship each other. Three suggested properties represented substantial differences for suspended blood samples (i.e., hardened red blood cells, different concentration of dextran solution and fibrinogen). In conclusion, the present method can detect variations of blood sample under continuous ESR effectively.

Searching over a sorted list is a classical problem in computer science. Binary Search takes at most log2n+1 tries to find an item in a sorted list of size n. Interpolation Search achieves an average time complexity of Ο(loglogn) for uniformly distributed data. Hybrids of Binary Search and Interpolation Search are also available to handle data with unknown distributions. This paper analyzes the computation cost of these methods and shows that interpolation can significantly affect their performance — accordingly, a new method, Interpolation Once Binary Search (IOBS), is proposed. The experimental results show that IOBS outperforms the hybrids of Binary Search and Interpolation Search for nonuniformly distributed data.

Innovative interventions in the planning and design of stair and escalator facilities call for understanding their effects on stair use. This study considers five planning variables for the twinned stair and escalator facilities–stair pitch and width, angle of deviation, height and separating distance. Public sites were identified in 8 commercial districts in Beijing. Facilities (n=21) presenting heterogeneously across variables were sampled for simultaneous up and down pedestrian counts in 18 5-minute video segments middays, for a total of 1464 counts. Stair width accounts for 20% of the variance in ascending rate and 10% in descending. Plan angle accounts for 2% in ascending and 5% in descending, while pitch accounts for 1% in ascending and 5% in descending. The study confirms the effects of layout and design of stairway and escalator facilities on facility choice. The results point directly to interventions in support of higher stair-climbing rates.

The surface velocity of the Amery Ice Shelf (AIS) is vital to assessing its stability and mass balance. Previous studies have shown that the AIS basin has a stable multi-year average surface velocity. However, spatiotemporal variations in the surface velocity of the AIS and the underlying physical mechanism remain poorly understood. This study combined offset tracking and DInSAR methods to extract the monthly average surface velocity of the AIS and obtained the inter-annual surface velocity from the ITS_LIVE product. An uneven spatial distribution in inter-annual variation of the surface velocity was observed between 2000–2022, although the magnitude of variation was small at less than 20.5 m/yr. The increase and decrease in surface velocity on the eastern and western-central sides of the AIS, respectively, could be attributed to the change in the thickness of the AIS. There was clear seasonal variation in monthly average surface velocity at the eastern side of the AIS between 2017–2021, which could be attributed to variations in the area and thickness of fast-ice and also to variations in ocean temperature. This study suggested that changes in fast-ice and ocean temperature are the main factors driving spatiotemporal variation in the surface velocity of the AIS.

Vibration signal analysis is regarded as a fundamental approach in diagnosing faults in rolling bearings, and recent advancements have shown notable progress in this domain. However, the presence of substantial background noise often results in the masking of these fault signals, posing a significant challenge for researchers. In response, an Adaptive Denoising Autoencoder (ADAE) approach is proposed in this paper. The data representations are learned by the encoder through convolutional layers, while the data reconstruction is performed by the decoder using deconvolutional layers. Both the encoder and decoder incorporate adaptive shrinkage units to simulate denoising functions, effectively removing interfering information while preserving sensitive fault features. Additionally, dropout regularization is applied to sparsify the network and prevent overfitting, thereby enhancing the overall expressive power of the model. To further enhance ADAE's noise resistance, shortcut connections are added. Evaluation using publicly available datasets under scenarios with known and unknown noise demonstrates that ADAE effectively enhances the signal-to-noise ratio in strongly noisy backgrounds, facilitating accurate diagnosis of faults in rolling bearings.

Laser-targeted weeding methods further enhance the sustainable development of green agriculture, with one key technology being the improvement of weed localization accuracy. Here, we propose an improved YOLOv8 instance segmentation based on bidirectional feature fusion and deformable convolution (BFFDC-YOLOv8-seg) to address the challenges of insufficient weed localization accuracy in complex environments with resource-limited laser weeding devices. Initially, by training on extensive datasets of plant images, the most appropriate model scale and training weights are determined, facilitating the development of a lightweight network. Subsequently, the introduction of the Bidirectional Feature Pyramid Network (BiFPN) during feature fusion effectively prevents the omission of weeds. Lastly, the use of Dynamic Snake Convolution (DSConv) to replace some convolutional kernels enhances flexibility, benefiting the segmentation of weeds with elongated stems and irregular edges. Experimental results indicate that the BFFDC-YOLOv8-seg model achieves a 4.9% increase in precision, an 8.1% increase in recall rate, and a 2.8% increase in mAP50 value to 98.8% on a vegetable weed dataset compared to the original model. It also shows improved mAP50 over other typical segmentation models such as Mask R-CNN, YOLOv5-seg, and YOLOv7-seg by 10.8%, 13.4%, and 1.8%, respectively. Furthermore, the model achieves a detection speed of 24.8 FPS on the Jetson Orin nano standalone device, with a model size of 6.8MB that balances between size and accuracy. The model meets the requirements for real-time precise weed segmentation, suitable for complex vegetable field environments and resource-limited laser weeding devices.

Epitaxial lithium ferrite (LiFe5O8) films with different thicknesses have been successfully fabricated on SrTiO3 (001) substrates by magnetron sputtering deposition technique. The microstructural and magnetic properties are characterized by advanced transmission electron microscope and magnetic measurement device. It was found that the formation of structural defects can be influenced by the thickness of the film. Apart from the misfit dislocations, the orientation domains form in thinner film and twin boundaries appear in thicker film, respectively, contributing to the misfit strain relaxation in the heterosystem. The magnetic measurement shows that the thinner films have enhanced magnetization and a relatively lower coercive field compared with the thicker films containing the antiferromagnetic twin boundaries. Our results provide a way for tuning the microstructure and magnetic properties of lithium ferrite films by changing the film thickness.

Hydrogen is considered as an ideal substitute to the traditional fossil fuels because of its widespread sources, high calorific value of combustion, and zero carbon emissions. The electrocatalytic water-splitting to produce hydrogen is also deemed to be the best approach, however, it is a challenge to make high-efficient and low-cost electrocatalysts. Single-atom catalysts (SACs) are considered the most promising candidate to replace the traditional noble-metal catalysts. Compared with SACs, the dual-atom catalysts (DACs) are of greater attraction including higher metal loading, more versatile active sites, and excellent catalytic activity. In the review, several general synthetic strategies and structural characterization methods of DACs are introduced, and the mechanisms of hydrogen evolution reaction (HER) and oxygen evolution reactions (OER) are discussed. The authors hope that the review has given some insights and inspiration to the researchers about DACs in electrocatalytic water-splitting.

The multidrug resistance transporter NorM is an important drug resistance pump and plays a critical role in multidrug resistance in bacteria and mammals. In this study we carried out molecular dynamics simulation to study the mechanism of Na+ binding and dynamical structures of two long loops in the substrate-releasing process in substrate binding NorM. Our simulation study identified several key residues (D41, E261 D377) along the Na+ binding pathway and a multi-state ion-binding mechanism is proposed based on the simulation study. In this proposed model, the transport of Na+ is a multi-stage process with D41 being the first station for binding to Na+, followed by Na+ binding to the second station E262 and finally to the cation-binding site of E262 and D377. During the transport of Na+, the transmembrane components TM1, TM7 and TM2 are rearranged to facilitate the ion transport as well conformational changes of NorM to a closed state. Further, substrate-bound simulation revealed that Loop3-4 and Loop9-10 control the substrate-releasing process.

The rapid urbanization in China has significantly contributed to the vast expansion of urban built-up areas. Precisely extracting and monitoring these areas is crucial for understanding and optimizing the developmental process and spatial attributes of smart, compact cities. However, most existing studies tend to focus narrowly on a single city or global scale with a single dimension, often ignoring mesoscale analysis across multiple urban agglomerations. In contrast, our study employs GIS and image processing techniques to integrate multi-source data for the identification of built-up areas. We specifically compare and analyze two representative urban agglomerations in China: the Yangtze River Delta (YRD) in the east and the Chengdu-Chongqing (CC) region in the west. We use different methods to extract built-up areas from socio-economic factors, natural surfaces, and traffic network dimensions. Additionally, we utilize a high-precision built-up area dataset of China as a reference for verification and comparison. Our findings reveal several significant insights: (1) The multi-source data fusion approach effectively enhances the extraction of built-up areas within urban agglomerations, achieving higher accuracy than previously employed methods. (2) Our research methodology performs particularly well in the CC urban agglomeration. The average precision rate in CC is 96.03%, while the average precision rate in YRD is lower at 80.33%. This study provides an objective and accurate assessment of distribution characteristics and internal spatial structure of built-up areas within urban agglomerations. This method offers a new perspective for identifying and monitoring built-up areas in Chinese urban agglomerations.

The Shule River Basin (SRB) is a typical arid area in northwest China with a fragile ecology. Un-derstanding vegetation dynamics and its response to climate change and human activities provides essential information for ecological and environmental resource management. This study extracted fractional vegetation coverage (FVC) data from 2000 to 2019 using the Google Earth Engine plat-form and Landsat satellite images, employing trend analysis and other methods to examine spati-otemporal changes in vegetation in the SRB. Additionally, partial correlation and residual analysis were utilized to explore the response of FVC to climate change and human activities. The main results were as follows: (1) The regional average FVC in the SRB showed a significant upward trend from 2000 to 2019, increasing by 1.3 × 10−3 y–1. The area within 1 km of roads experienced a higher increase of 3 × 10−3 y–1, while the roadless areas experienced a lower increase of 1.1 × 10−3 y–1. Road construction from 2004 to 2006 significantly reduced the FVC within 200 meters of the roads. FVC spatial heterogeneity in the SRB is significant. (2) Partial correlation analysis shows that FVC has a strong positive correlation with precipitation and surface water area, with correlation coefficients of 0.575 and 0.744, respectively. There is a weak negative correlation between FVC and land surface temperature (LST). FVC changes are more influenced by precipitation than by LST. (3) Compared to climate factors, human activities have a greater impact on vegetation dynamics in the SRB. The contributions of climate change to vegetation recovery are increasing. (4) The area changes of dif-ferent land types are closely related to climate factors and human activities, reflecting their impact on vegetation. These results provide valuable information for ecosystem restoration and environ-mental protection in the SRB.

Demethyleneberberine is an active component extracted from the Chinese herbal drug Cortex Phellodendri. It is also a metabolite of the berberine in animals and humans. However, the pharmacokinetics, tissue distribution and excretion of demethyleneberberine have not been reported. The present study aimed to investigate the pharmacokinetic parameters of demethyleneberberine by developing a method of high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). The detection was performed by using positive ion electrospray ionization in multiple reaction monitoring mode. The MS/MS ion transitions were monitored at m/z 324.4→308.3 for demethyleneberberine and 465.5→350.3 for IS. After oral administration of demethyleneberberine in rats and mice, the pharmacokinetics, tissue distribution, and excretion of desmethylberberine in rats and mice were comparatively studied for the first time. The plasma concentration of desmethylberberine reached its peak within 5 min after oral administration in both rats and mice. The bioavailability of rats and mice was comparable, ranging from 4.47% to 5.94%, higher than that of berberine. The total excretion of desmethylberberine in urine, feces and bile is 7.28~9.77%. These findings provide valuable insights into the pharmacological and clinical research on desmethylberberine.

In February 2004, the Food and Drug Administration (FDA) was the first to approve the combination of cisplatin (CDDP) and pemetrexed (PEM) as standard first-line chemotherapy for untreated, unresectable malignant pleural mesothelioma (MPM). However, after that approval, no progress was made in the standard first-line treatment of MPM for almost 15 years. Positive results from a phase 3 study (Mesothelioma Avastin Cisplatin Pemetrexed Study: MAPS) verifying the effect of bevacizumab, an anti-angiogenesis agent added to CDDP/PEM for unresectable MPM, were published in The Lancet in December 2015; however, this did not lead to approval by national drug regulatory agencies. Furthermore, no second-line treatment was established for cases refractory to CDDP/PEM. In August 2018, the Pharmaceuticals and Medical Devices Agency of Japan was the first in the world to approve monotherapy with nivolumab, an immune checkpoint inhibitor (ICI), for previously unresectable, advanced, or recurrent MPM. Following Japan, in October 2020, the FDA approved the combination of nivolumab and ipilimumab for the treatment of previously untreated, unresectable MPM. In this article, we review the transition of drug treatment for MPM, in light of the historical background, focusing on the benefits of ICIs.

In order to investigate the relationship between government policy, the service and design of rural crowdsourcing spaces, the self-efficacy of returning youth, and the innovation performance of businesses, this study focuses on gathering data by distributing questionnaires to returning youth in rural crowdsourcing spaces and developing a structural model. The results demonstrate how important government policies are in encouraging youth entrepreneurship in their local communities. It has the potential to enhance both the development of rural crowdsourcing spaces and the self-efficacy of young entrepreneurs, thereby enhancing the innovative capabilities of local entrepreneurial businesses. Therefore, in order to encourage economic development in rural areas, the government should improve pertinent support measures.

With the gradual improvement of coal mining efficiency, the disturbance of groundwater system caused by the high-intensity mining mode also increases, which is a more severe challenge to the prevention of mine safety and the protection of water resources in mining areas. How to accurately describe the dynamic changes of the groundwater system under mining and quantitatively predict mine water inflow is a major problem in the current research. Based on the full analysis of the response characteristics of groundwater system to the extraction disturbance, this paper forms a kind of method to establish a mine hydrogeological conceptual model that can accurately represent the water inrush process, and uses the MODFLOW non-structural division grid to accurately characterize the formation structure, and finally make accurate water inflow prediction. Taking the Caojiatan Coal Mine in Shaanxi Province, China as an example, a numerical model of unstructured mine water inrush was established for the first time, and the changes of water inflow source and water inflow intensity were quantitatively evaluated. Compared with the traditional water inflow prediction method, it is found that the prediction accuracy is improved by 12%~17% by detailing the response characteristics of complex groundwater system under high-strength coal seam mining conditions. The method is of great significance and promotion value for the comprehensive understanding of the disturbance characteristics of human underground engineering activities, such as coal mining, on the groundwater system, and for accurately predicting water inflow.

Flap surgery is a common method used to cover defects following tumor ablation, trauma, or infection. However, insufficient vascularity in the transferred flap can lead to flap necrosis and failure. Proper postoperative monitoring is essential to prevent these complications. Recently, research has explored the use of infrared thermal imaging in plastic surgery, leading to its clinical application. This study investigates the use of a forward-looking infrared (FLIR) camera to monitor blood flow in flaps. In the study, 28 rats underwent reverse McFarlane flap surgery, and their flaps were analyzed using a FLIR thermal imaging camera seven days post-surgery. Additionally, thermal images of flaps were taken on postoperative days 0, 1, 2, 3, and 7 in 22 patients. The study focused on temperature differences between normal skin and the perforator compared to the average flap temperature. Results showed that the temperature difference was higher in the necrosis group and increased over time in cases of total necrosis. A lower perforator temperature compared to the flap's average indicated vascular compromise, potentially leading to flap failure. The FLIR camera, being contact-free and convenient, shows promise for understanding and inferring the clinical progression of flaps in postoperative monitoring.

Flexible implementations of Monte Carlo Tree Search (MCTS), combined with domain specific knowledge and hybridization with other search algorithms, can be a very powerful for the solution of problems in complex planning. We introduce mctreesearch4j, a standard MCTS implementation written as a standard JVM library following key design principles of object oriented programming. We define key class abstractions allowing the MCTS library to flexibly adapt to any well defined Markov Decision Process or turn-based adversarial game. Furthermore, our library is designed to be modular and extensible, utilizing class inheritance and generic typing to standardize custom algorithm definitions. We demon- strate that the design of the MCTS implementation provides ease of adaptation for unique heuristics and customization across varying Markov Decision Process (MDP) domains. In addition, the implementation is reasonably performant and accurate for standard MDP’s. In addition, via the implementation of mctreesearch4j, the nuances of different types of MCTS algorithms are discussed.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

To estimate the degree of quantum entanglement, it is important to understand the statistical behavior of functions of spectrum of density matrices such as von Neumann entropy, quantum purity, and entanglement capacity. These entangle- ment metrics over different generic state ensembles have been studied intensively in the literature. As an alternative metric, in this work we study sum of square root spectrum of density matrices, which is relevant to negativity and fidelity in quantum information processing. In particular, we derive the exact mean and vari- ance of sum of square root spectrum over the Bures-Hall generic state ensemble extending known results obtained recently over the Hilbert-Schmidt ensemble.

Global warming may increase the potential evapotranspiration (Etp), thereby affecting the amount of clean water resources available in a region. In this study, the systematic biases in temperature outputs of 24 global climate models (GCMs) under 3 emission scenarios are corrected by using 8 bias correction methods. The trend of Etp in Yangzi River Delta in the 21st century is projected by using 4 Etp calculation formulas. The uncertainty of the projections is estimated and decomposed by using multi-way analysis of variance. The influence of uncertainty on the projected change signal is quantified by using the signal-to-noise ratio. The results show that, relative to the reference period (1971~2000), the annual mean daily Etp in Yangzi River Delta will increase by 0.14~0.17mm/d during the period 2021~2050 and by 0.21~0.41mm/d during the period 2061~2090, respectively. During 2021~2050, the uncertainty of Etp increase projections is dominantly contributed by the main effects of GCM (63%) and Etp calculation formula (24%). During 2061~2090, it is mainly contributed by the main effect of GCM (36%), followed by the main effects of emission scenario (34%) and Etp calculation formula (18%). The increase projections of Etp are generally reliable and robust during the two projection periods.

Mass hauling operations play central roles in construction projects. They typically use many haulers that consume large amounts of energy and emit significant quantities of CO₂. However, practical methods for estimating the energy consumption and CO₂ emissions of such operations during project planning are lacking. This paper presents a detailed model for estimating the energy consumption and CO₂ emissions of mass haulers that integrates the mass hauling plan with a set of predictive equations. The mass hauling plan is generated using a planning program such as DynaRoad in conjunction with data on the productivity of selected haulers and the amount of material to be hauled during cutting, filling, borrowing, and disposal operations. This plan is then used as input for estimating the energy consumption and CO₂ emissions of the selected hauling fleet. The proposed model will help planners to assess the energy and environmental performance of mass hauling plans, and to select hauler and fleet configurations that will minimize these quantities. The model was applied in a case study, demonstrating that it can reliably predict energy consumption, CO₂ emissions, and hauler productivity as functions of the hauling distance for individual haulers and entire hauling fleets.

The intense motion of a ship can greatly impacts the comfort of crew members and the safety of the vessel. Therefore, accurately estimating and predicting ship attitudes has become an important issue. This paper introduces the latest development in functional deep learning model called DeepOnet. It takes wave height as input and ship motion as output, using a cause-to-result prediction approach. The modeling data used in this study is sourced from publicly available experimental data from the Iowa Institute of Hydraulic Research. Firstly, parameters system tuning was conducted for the neural network's hyperparameters to determine the appropriate combination of parameters. Secondly, the DeepOnet model for wave height and multi-degree-of-freedom motion was established, and the influence of increasing time steps on prediction accuracy was examined. Finally, a comparison was made between the DeepOnet model and the classical time series model LSTM. It was found that the DeepOnet model had a 10-fold improvement in accuracy for roll and heave attitudes. Moreover, as the forecast duration increased, the advantage of DeepOnet showed a trend of strengthening. As a functional prediction model, DeepOnet provides a new promising tool for very short-term prediction of ship motion.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

Wound healing is a complex, dynamic process involving the coordinated interaction of diverse cell types, growth factors, cytokines, and extracellular matrix components. Despite emerging evidence highlighting their importance, dermal sheath cells remain a largely overlooked aspect of wound healing research. This review explores the multifunctional roles of dermal sheath cells in various phases of wound healing, including modulating inflammation, aiding in proliferation, and contributing to extracellular matrix remodeling. Special attention is devoted to the paracrine effects of dermal sheath cells and their role in fibrosis, highlighting their potential in improving healing outcomes, especially in differentiating between hairy and non-hairy skin sites. By drawing connections between dermal sheath cells activity and wound healing outcomes, this work proposes new insights into the mechanisms of tissue regeneration and repair, marking a step forward in our understanding of wound healing processes.

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

The research on the excavation mechanical properties of underpass tunnels has already had certain results, but fewer of them consider the effects of dynamic and static loads on the excavation mechanical properties of underground tunnels at the same time, especially the lack of research cases of double-line highway tunnels with angled underpasses of existing railway tunnels. In this paper, based on the tunnel project of the new double-line Shiqian Highway Tunnel passing under the Hurong Railway at an oblique angle, the mechanical parameters of the rock body in the cross-tunneling area under the influence of static and dynamic load coupling are obtained by using the disturbance quantification coefficients and the Hoek-Brown criterion based on the method of over-advanced geological prediction and the investigation of the surrounding rock on the palisade face, and the engineering-scale finite element model is constructed and the mechanical characteristics of the excavation in the tunnel of the double-lane highway tunnel passing under the existing railroad under the influence of the static and dynamic loads are analyzed. The results show that: the new tunnel rock movement law for the top of the arch sinking, bottom plate bulging, side wall to move outward, the height and width of the arch and bottom plate arch with the tunnel excavation and increase, the side wall rock displacement effect is smaller; left and right lines of the tunnel disturbed area of the rule of change is similar; the existing tunnel bottom plate displacement is more than the top plate and the left and right side walls by the excavation of the time step influence is larger. Typical profile displacement is mainly determined by the distance from the excavation surface; the new tunnel in the four types of calculation conditions of the rock disturbance angle is the same; the existing tunnel roof and side wall Von Mises stress extreme occurs in the tunnel structure, the bottom plate there are pressure relief and pressure-bearing areas; based on the displacement control criteria, the recommended upper and lower step blasting method.

Despite UAV multi-target detection exhibits considerable developmental potential worldwide, it suffers distinct challenges compared with traditional tasks in this field. These challenges include insufficient feature extraction capabilities for small targets, limited capabilities for multi-dimensional feature fusion, as well as constraints on hardware computation parameters. Especially in mission scenarios such as disaster detection, these challenges will be further amplified. Consequently, this paper introduces SSE-YOLO, an innovative YOLO framework algorithm specially designed to address these challenges. To enhance the model's feature extraction capability, we employ the SPDConv module to replace the original Conv in the backbone section, utilizing depth-separable convolution instead of traditional convolution pooling. Concurrently, we eliminate the SPPF module at the bottom and address a new Separate Kernel Attention Pyramid Pooling (SKAPP) module, substantially enhancing the feature fusion capability at the model's core. Moreover, to address the challenge of multi-dimensional feature fusion, we replace the Concat module of the neck and head with E-BiFPN, transmitting feature information from the backbone to the lower network through four CBS blocks, which effectively resolves the issue of lost contextual information in the model. Meanwhile, SSE-YOLO undergoes ablation experiments on the VisDrone2019 dataset to evaluate its effectiveness against alternative methods, and experimental results illustrate the model's exceptional precision in detecting UAV targets. In comparison to models with comparable experimental accuracy, SSE-YOLO requires remarkably fewer parameters. On the VisDrone2019-DET-test-dev dataset, SSE-YOLO enhances mAP by 17.3%, with a 42.5% reduction in the parameter amounts. Therefore, the proposed method effectively tackles the challenge of reconciling low parameters and high accuracy, presenting a novel pathway for deep learning-based UAV multi-target detection.

Incremental stability analysis for time-delay systems has attracted more and more attentions for its contemporary applications in transportation processes, population dynamics, economics, satellite positions, etc. This paper researches criteria on v(t)-incremental stability, which is defined to demonstrate the convergence rate for incremental stability, for time-delay systems. Firstly, the sufficient conditions for v(t)-incremental stability for time-delay systems with continuous right-hands are studied, and several corollaries for specific cases are provided. As for time-delay systems with discontinuous right-hands, after expounding the relevant conditions for the existence and uniqueness of the Filippov solution, by using approximation methods, sufficient conditions for v(t)-incremental stability are obtained. The conclusions are applied to linear switched time-delay systems and Hopfield neural network system with composite right-hand afterwards.

In order to better realize rural revitalization, this paper analyzes the spatial and temporal char-acteristics and influencing factors of agricultural surface source pollution in the Yangtze River Economic Belt from the three perspectives of government, enterprise and agriculture by using the spatial Durbin model and the dynamic GMM method in the period of 2006-2021, and further re-searches the threshold characteristics of the distortion of the factor market on the agricultural surface source pollution under the different strengths of environmental regulation. The results show that there is a positive spatial correlation between agricultural surface pollution in the Yangtze River Economic Belt, and government environmental regulation, input factor market distortion and labor force transfer all have a significant impact on agricultural surface pollution. Among them, factor market distortion has a significant spatial spillover effect on agricultural surface pollution in the Yangtze River Economic Zone, and has a significant single-threshold ef-fect on environmental regulation. Accordingly, the government should strengthen environmental regulation, continuously improve the agricultural factor market mechanism, and pay attention to the construction of talents to provide support for rural revitalization.

The high prevalence of human papillomavirus (HPV) infection in oropharyngeal squamous cell carcinoma (OPSCC) is well-established, with p16 expression being a strong predictor. HPV-related tumors exhibit unique mechanisms targeting p16 and p53 proteins. However, re-search on HPV prevalence and the combined predictive value of p16 and p53 expression in head and neck cutaneous squamous cell carcinomas (HNCSCC), especially in Asian populations, is limited. This retrospective study surveyed 62 HNCSCC patients (2011–2020), excluding those with facial warts or other skin cancers. All patients underwent wide excision and biopsy. Immuno-histochemical staining for HPV, p16, and p53 yielded both positive and negative results. The relevance of each marker was investigated by categorizing the tumor locations into high-risk (Area H) and mid-risk (Area M) zones based on recurrence frequency. Of the 62 patients, 20 (32.26%) were male, with an average age of 82.27 years (26–103). Area H included 19 cases (30.65%), with the eyelid and lip being the most common sites (five cases, 8.06%). Area M in-cluded 43 cases (69.35%), with the cheek being the most common site (29 cases, 46.77%). p16 ex-pression was positive in 24 patients (38.71%), p53 expression in 42 patients (72.58%), and HPV in five patients (8.06%). No significant association was found between p16 expression and HPV presence (p > 0.99), with a positive predictive value of 8.33%. This indicates that p16, a surrogate marker of HPV in OPSCC, is not a reliable marker for HPV in HNCSCC. This study enhances our understanding of the relationship between HPV, p53, and p16 in HNCSCC in Asian populations and offers valuable insights for further research.

The rapid development of multicopters has led to many security problems. In order to prevent multicopters from invading restricted areas or famous buildings, an Anti-UAV Defense System (AUDS) has been developed and become a research topic of interest. Topics under research in relation to this include electromagnetic interference guns for unmanned aerial vehicles (UAVs), high-energy laser guns, US military net warheads, and AUDSs with net guns. However, these AUDSs use either manual aiming or expensive radar to track UAVs. This paper proposes a dual-axis rotary platform with UAV automatic tracking. The tracking platform uses visual image processing technology to track and lock the dynamic displacement of a UAV. When a target UAV is locked, the system uses a nine-axis attitude meter and laser rangefinders to measure its flight altitude and calculates its longitude and latitude coordinates through sphere coordinates to provide UAV monitoring for further defense or attack missions. Tracking tests of UAV flights in the air were carried out using a DJI MAVIC UAV at a height of 30 meters to 100 meters. It was set up for UAV image capture and visual recognition for tracking under various weather conditions by a thermal imager and a full-color camera respectively. When there was no cloud during the daytime, the images captured by the thermal imager and full-color camera provide a high-quality image recognition result. However, under dark weather, black clouds will emit radiant energy and seriously affect the capture of images by a thermal imager. When there is no cloud at night, the thermal imager performs well in UAV image capture. When the UAV is tracked and locked, the system can effectively obtain the flight altitude and longitude and latitude coordinate values.

Although promoting healthy eating is a policy objective, the controllability of dietary habits remains uncertain. The personal dietary patterns reflect many factors, of which some are relatively controllable for individual, and others are not. In this article, assuming that some sort of information about controllability of dietary habits is contained in the observed pattern of food consumptions, we focused on dietary pattern on its own. We introduced a statistical descriptive model for data on food frequency questionnaire, estimated strength of pairwise linkage between foodstuffs, and grouped foodstuffs by applying community detection to the networks of the estimated inter-food linkages. Those linkages represent co-movement of pairs of foods consumption. Furthermore, we demonstrated an analysis on the relationship between health of mind and dietary habits considering the aspect of controllability of dietary habits. Using an observational study in Japan, we obtained the following results: 115 foodstuffs were divided into 3 groups for both of genders, but the compositions were different by gender; in the analysis of mental health, some stress response items were associated with the dependence on some of those food groupings. As the grouping of foodstuffs based on our estimation depicted the internal structure of dietary habit that a healthy eating policy should regard as constraint, it follows that we should design the policy along the line with that grouping.

Evans' Syndrome (ES) is a rare autoimmune disorder characterized by the simultaneous occurrence of immune thrombocytopenia (ITP) and autoimmune hemolytic anemia (AIHA). Thrombotic complications in ES patients are uncommon, particularly involving Buerger's Disease (BD). We report a case of a 49-year-old male with ES and a history of diabetes and heavy smoking, presenting with a necrotic wound on his right great toe. Diagnostic evaluations revealed severe stenosis and thrombosis in the lower limb arteries, diagnosed as BD. The patient underwent successful popliteal-tibioperoneal artery bypass surgery and subsequent disarticulation and revision of the distal phalanx, followed by the application of an acellular dermal matrix (ADM) to promote healing. Post-surgery, the patient showed significant improvement in blood flow and complete epithelialization without complications. This case highlights the importance of a multidisciplinary approach in managing complex wounds in ES patients, suggesting potential treatment pathways for future cases involving BD

Oleuropein, glycosylated secoiridoid present in the olive leaves, is known as an important antioxidant phenolic compound. We studied the antioxidant effect of low dose of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggest that growth arrest and cell dead of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects myogenesis of C2C12 cells; because the MyoD mRNA levels and the differentiation process are restored after treatment with 3,4-DHPEA-EA(P). Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process by functioning as an efficient antioxidant.

Wendan (a type of pomelo), as a popular fruit in China, is less known in other countries. Its peel is widely used in food and traditional medicine. Four different origins of Wendan pomelo were selected, and crude extracts were obtained by the Soxhlet extraction method. The composition of Wendan peel was analyzed by high-performance liquid chromatography-mass spectrometry (HPLC-MS) in positive ion mode. The compounds were identified by searching the Metabolite Link (METLIN), Spectral Database for Organic Compounds (SDBS) and referring to literature reports. A total of 20 compounds were identified among the samples from the four origins, of which 8 compounds were common. The majority of the compounds belonged to the flavonoid and coumarin classes, Meranzin hydrate was identified for the first time in pomelo peel. In vitro antioxidant activity experiments showed that samples from Taizhou, Zhejiang exhibited the highest antioxidant activity in the DPPH, ABTS, and FRAP assays, with values of 0.59 mg/mL, 97.06 μmol TE/g, and 60.62 μmol Fe2+/g, respectively. Samples from Zhangzhou, Fujian showed antioxidant activity second only to the samples from Taizhou, Zhejiang. The sample from Zhangzhou, Fujian Province, showed excellent inhibitory activity in the α-glucosidase inhibition assay (IC50=7.99 mg/mL).

The purpose of this study is to examine the relationship between the institutional investors which can affect financial performance for corporate sustainability on the income smoothing. Therefore, this study focus on the connection between the nature of stock rights and income smoothing in China. For this study, hypotheses were established on the relationship each state-controlled companies, income smoothing, and information equilibrium of individual investors, and empirical analysis was conducted through related variables. The analysis results are summarized in three categories as follows. First, this research finds that state-controlled firms (CONTs) prefer income smoothing activities compared to non-state-controlled firms for the long-term sustainable development of firms using data from 2011 to 2019. Second, this study found out that Institutional investors support the behavior of CONTs to smooth their earnings because this behavior is seen as an attempt by CONTs to convey valuable private information to other investors. Third, we was able to discover that institutional investors' monitoring effect is predominantly driven by pressure-resistant institutional investors. This research complements the lack of empirical research on income smoothing and enable to give a guideline that the type of stock rights is a critical key determinant of participation in income smoothing activities for stable growth and sustainability in the future.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

Management of chronic inflammation and wounds has always been a key issue in the pharmaceutical and healthcare sector. Curcumin (CCM) is an active ingredient extracted from turmeric rhizomes that has antioxidant, anti-inflammatory, and antibacterial activities, thus showing significant effectiveness toward wound healing. However, its shortcomings such as poor water solubility, poor chemical stability and fast metabolic rate limit its bioavailability and long-term use. In this context, hydrogels appear to be a versatile matrix for carrying and stabilizing drugs due to the biomimetic structure, soft porous microarchitecture, and pleasant biomechanical properties. The drug loading/releasing efficiencies can also be controlled by use of highly crystalline and porous metal organic frameworks (MOFs). Here, a flexible hydrogel composed of sodium alginate (SA) matrix and CCM-loaded MOFs was constructed for long-term drug release and antibacterial activity. The morphology and physicochemical properties of composite hydrogels were analyzed by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), ultraviolet visible spectroscopy (UV-Vis), Raman spectroscopy and mechanical property tests. The results showed that the composite hydrogel was highly twistable and bendable to mechanically comply with human skin. The as-prepared hydrogel could capture efficient CCM for slow drug release as well as effective killing of bacteria. Therefore, such composite hydrogel is expected to provide a new management system for chronic wound dressings.

The water resources carrying capacity (WRCC) system comprises multiple complex and nonlinear interactions related to society, economy, water resources and the water environment. A full understanding of its internal mechanism is conducive to the further improvement of the regional WRCC. This article focuses on the temporal and spatial variability of WRCC to explore a method of dynamic successive assessment. Firstly, the Pressure-State-Response (PSR)framework is used to develop a systematic and causal indicator system. Then, The Variable Fuzzy Pattern Recognition (VFPR) model and an analytic hierarchy process-entropy (AHP-E) model are combined to successively and dynamically assess WRCC. The proposed method is applied to the dynamic successive assessment of WRCC in Hebei Province, and it is obtained that the poor water resources carrying capacity in Hebei Province is mainly due to the basic attribute of the decision of the water resources shortage, but Hebei Province actively adopts a variety of measures to save water and pressurize mining, which makes the province's water resources carrying capacity have a tendency to become better gradually. At the same time, the system dynamics model (SD) of water resources carrying capacity based on the analysis of the model structure was established. Moreover, three scenarios were designed, including existing continuation, high-efficiency water-saving, cross-regional water transfer and coordinated development, each scenario divided into high and low-speed economic development and population growth schemes, then total 6 schemes between 2023 and 2030 were simulated and predicted respectively. The results indicate that if the current development model is adopted, the water resource carrying capacity will continue to maintain low levels. It was concluded that the high-speed development of economy and population, the efficient water conservation and inter-basin transfer scenario (scenario 2 with high-speed) is the best choice for sustainable development of water resources and social economy in Hebei.

The dilatometer curves of continuous cooling transformation of 12Mn steel were measured with Formastor-FⅡthermal mechanical simulator．The steel's undercooled austenite phase continuous cooling transformation curves ( CCT curves) were established by means of the dilatometer method and the metallographic-hardness measurement method． The effect of cooling rate on microstructure and hardness of the steel was studied． CCT curve of test steel was simulated by JMatPro. The results show that the Ac1 and Ac3 of the experimental steel are 692 ℃ and 855 ℃ ; the microstructure obtained is made of ferrite，pearlite and bainite．The ferrite transformation and pearlite transformation occur at a slower cooling rate，in which the ferrite is dominant. When the cooling rate is greater than 4.25 ℃ / s bainite transformation happens．As the cooling rate increases，microstructure or grains become finer．The hardness of the tested steel with increasing cooling rate shows a trend of first fast increase and soon decrease．The simulation results are consistent with the measured CCT law. The high temperature mechanical properties of 12mn steel round billet were tested by gleeble-1500d thermal / mechanical simulator. The tensile strength, reduction of area and stress-strain curves of the billet were obtained in the range of 600-1300 ℃.

Our understanding of pull-apart basins and their fault systems has been enhanced by analog experiments and simulations. However, there has been no opportunity to compare the faults that constitute pull-apart basins with surface ruptures during earthquakes. In this study, we investigated the effects of a 2018 earthquake (Mw 7.5) on a pull-apart basin in the Palu-Koro fault system, Sulawesi Island, Indonesia, using geomorphic observations in digital elevation models, optical correlation with pre- and post-earthquake satellite images. A comparison of active fault traces determined by geomorphology with the locations of surface ruptures from the 2018 earthquake shows that some of the boundary faults of the basin are inactive and that active faulting has shifted to basin-shortcut faults and relay ramps. We also report evidence of lateral spreading, in which alluvial fan materials moved around the end of the alluvial fan. These phenomena may provide insights for anticipating the location of future surface ruptures in pull-apart basins.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

LC-SPIK is a liver cancer-specific isoform of Serine Protease Inhibitor Kazal and has been proposed as a new biomarker for the detection of HCC given its unique 3-D structure which differs from normal pancreatic SPIK. An ELISA technology based on its unique structure was developed to use LC-SPIK as an effective biomarker for the clinical diagnosis of HCC. AFP, the most widely used biomarker for HCC surveillance currently, suffers from poor clinical performance, especially in the detection of early-stage HCC. In one case-control study, which included 164 HCC patients and 324 controls, LC-SPIK had an AUC of 0.87 compared to only 0.70 for AFP in distinguishing HCC from liver disease controls (cirrhosis, HBV/HCV). LC-SPIK also performed significantly better than AFP for the 81 patients with early-stage HCC (BCLC stage 0 and A), with an AUC of 0.85 compared to only 0.61 for AFP. Cirrhosis is the major risk factor for HCC, about 80% of patients with newly diagnosed HCC have preexisting cirrhosis. LC-SPIK’s clinical performance was also studied in HCC patients with viral and non-viral cirrhosis including cirrhosis caused by nonalcoholic fatty liver disease (NAFLD) and alcoholic liver disease (ALD). In a total of 163 viral cirrhosis patients with 93 HCC patients (50 early-stage), LC-SPIK had an AUC of 0.85, while AFP had an AUC of 0.70. For patients with early-stage HCC, LC-SPIK had a similar AUC of 0.83, while AFP had an AUC of only 0.60. For 120 patients with nonviral cirrhosis, including 62 HCC (23 early-stage) patients, LC-SPIK had an AUC of 0.84 while AFP had an AUC of only 0.72. For the 23 patients with early-stage HCC, LC-SPIK had a similar AUC of 0.83, while the AUC for AFP decreased to 0.65. All these results suggest that LC-SPIK has significantly better performance in the detection of HCC than AFP in all etiologies of liver diseases. In addition, LC-SPIK accurately detected the presence of HCC in 71%-91% of HCC patients with false-negative AFP test results in viral associated HCC and non-viral associated HCC.