Evaluating soil quality across various altitudinal gradients, both with and without vegetative cover, is crucial for the proper functioning of soil and optimal crop growth, thereby contributing to the sustainability of agroecosystems. Although the altitudinal gradient significantly influences soil quality, the ability to predict this quality, expressed through an index, in soils with and without vegetative cover, is still insufficiently explored. This study aimed to assess soil quality in the Jun Jun micro-watershed, located in the Tungurahua region, Ecuador. To achieve this objective, three categories of altitudinal gradients were selected: less than 2800 meters above sea level (masl), between 2800 and 2900 masl, and greater than 2900 masl. A total of 24 soil samples were collected in the mentioned gradients, considering both areas with and without vegetative cover. The indicators used included chemical and biological parameters such as soil organic carbon (OC), earthworm density (WD), earthworm biomass (WB), organic matter (OM), pH, total nitrogen (TN), and organic carbon (OC). The results revealed that in areas with altitudinal gradients below 2800 masl, soil quality index values were higher compared to other altitudes. In vegetated areas, a decrease in index values was observed as the altitudinal gradient increased, indicating a deterioration in soil quality with altitude. These findings are significant in providing a quantitative assessment of the effects of altitudinal gradient and vegetative cover influence on soil quality.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

Determining accurate PM2.5 pollution concentrations and understanding their dynamic patterns is crucial for scientifically informed air pollution control strategies. Traditional reliance on linear correlation coefficients for ascertaining PM2.5 related factors only uncovers superficial relationships. Moreover, the invariance of conventional prediction models restricts their accuracy. To enhance the precision of PM2.5 concentration prediction, this study introduces a novel integrated model that leverages feature selection and a clustering algorithm. Comprising three components - feature selection, clustering, and integrated prediction, the model first employs the non-dominated sorting Genetic Algorithm (NSGA-III) to identify the most impactful features affecting PM2.5 concentration within air pollutants and meteorological factors. This step offers more valuable feature data for subsequent modules. The model then adopts a two-layer clustering method (SOM+K-means) to analyze the multifaceted irregularity within the dataset. Finally, the model establishes the Extreme Learning Machine (ELM) weak learner for each classification, integrating multiple weak learners using the Adaboost algorithm to obtain a comprehensive prediction model. Through feature correlation enhancement, data irregularity exploration, and model adaptability improvement, the proposed model significantly enhances the overall prediction performance. Data sourced from 12 Beijing-based monitoring sites in 2016 were utilized for an empirical study, and the model's results compared with five other predictive models. The outcomes demonstrate that the proposed model significantly heightens prediction accuracy, offering useful insights and potential for broadened application to multifactor correlation concentration prediction methodologies for other pollutants.

The model proposed in this study was based on the assumption that the biomass attached to the anode served as biocatalysts for MFC exoelectrogenesis, and this catalytic effect was quantified by the exchange current density of anode. By modifying the Freter model and combining it with the Butler-Volmer equation, this model could adequately describe the processes of electricity generation, substrate utilization, and the suspended and attached biomass concentrations, at both batch and continuous operating modes. MFC performance is affected by the operating variables such as initial substrate concentration, external resistor, influent substrate concentration, and dilution rate, and these variables were revealed to have complex interactions by data simulation. The external power generation and energy efficiency were considered as indices for MFC performance. The simulated results explained that an intermediate initial substrate concentration (about 100 mg/L under this reactor configuration) needed to be chosen to achieve maximum overall energy efficiency from substrate in the batch mode. An external resistor with the value about that of the internal resistance boosted the power generation, and a resistor with several times of that of the internal resistance achieved better overall energy efficiency. At continuous mode, dilution rate significantly impacted the steady-state substrate concentration level (thus substrate removal efficiency and rate), and attached biomass could be fully developed when the influent substrate concentration was equal to or higher than 100 mg/L at any dilution rate of the tested range. Overall, this relatively simple model provided a convenient way for evaluating and optimizing the performance of MFC reactors by regulating operating parameters.

With the deterioration of the bridge performance and ever-increasing amount of traffic, the bridge safety is becoming a concern for engineering community. A method that can assess the bridge's condition in real-time is urgently needed. The main factors that hinder the bridge condition assessment are the uncertain operational environments. A new moving principal component analysis (MPCA) based method is developed for structural damage detection of bridges in operational environments in this paper. Two main operational environmental factors: the environmental temperature and traffic loads, are studied in the assessment process to verify the robustness and practicality of the proposed method. The numerical and experimental results show that the proposed method is effective and accurate to assess the bridge condition in operational environments.

Detection of the region of interest (ROI) is a critical step in laryngeal image analysis for the delineation of glottis contour. The process can improve both computational efficiency and accuracy of the image segmentation task, which will facilitate subsequent analysis and characterization of the vocal fold vibration as it correlates with voice quality and pathology. This study aims to develop machine learning based approaches for automatic detection of ROI for glottis image sequences captured by high-speed video-endoscopy (HSV), a clinical laryngeal imaging modality. In particular, we first applied the supporting vector machine (SVM) method using histogram of oriented gradients (HOG) feature descriptor, and second, trained a convolutional neural network (CNN) model for this task. Comparisons are made for both approaches in terms of accuracy of recognition and computation time.

With the rapid development of Internet and the widely usage of smart devices, massive multimedia data are generated, collected, stored and shared on the Internet. This trend makes cross-modal retrieval problem become a hot issue in this years. Many existing works pay attentions on correlation learning to generate a common subspace for cross-modal correlation measurement, and others uses adversarial learning technique to abate the heterogeneity of multi-modal data. However, very few works combine correlation learning and adversarial learning to bridge the inter-modal semantic gap and diminish cross-modal heterogeneity. This paper propose a novel cross-modal retrieval method, named ALSCOR, which is an end-to-end framework to integrate cross-modal representation learning, correlation learning and adversarial. CCA model, accompanied by two representation model, VisNet and TxtNet is proposed to capture non-linear correlation. Beside, intra-modal classifier and modality classifier are used to learn intra-modal discrimination and minimize the inter-modal heterogeneity. Comprehensive experiments are conducted on three benchmark datasets. The results demonstrate that the proposed ALSCOR has better performance than the state-of-the-arts.

Online social networking techniques and large-scale multimedia retrieval are developing rapidly, which not only has brought great convenience to our daily life, but generated, collected, and stored large-scale multimedia data as well. This trend has put forward higher requirements and greater challenges on massive multimedia retrieval. In this paper, we investigate the problem of image similarity measurement, which is one of the key problems of multimedia retrieval. Firstly, the definition of similarity measurement of images and the related notions are proposed. Then, an efficient similarity measurement framework is proposed. Besides, we present a novel basic method of similarity measurement named SMIN. To improve the performance of similarity measurement, we carefully design a novel indexing structure called SMI Temp Index (SMII for short). Moreover, we establish an index of potential similar visual words off-line to solve to problem that the index cannot be reused. Experimental evaluations on two real image datasets demonstrate that the proposed approach outperforms state-of-the-arts.

The current spreading novel coronavirus SARS-CoV-2 is highly infectious and pathogenic and has attracted global attention. Recent studies have found that SARS-CoV-2 and SARS-CoV share around 80% of homology and use the same cell entry receptor, ACE2. These inspired us to study other receptors of SARS-CoV, which may be used for SARS-CoV-2 binding as well. In this study, we screened the gene expression of three receptors (ACE2, DC-SIGN and L-SIGN) in four datasets of normal lung tissue from lung adenocarcinoma patients and two single-cell RNA sequencing datasets from normal lung and bronchial epithelial cells separately. No significant difference in gene expression of these three receptors were found between gender groups (male vs female). We found higher gene expression of DC-SIGN in elder with age>60 and higher gene expression of L-SIGN in Caucasian than Asian. Similar to ACE2, we observed significantly higher DC-SIGN gene expression in the lungs of smokers, especially former smokers. However, smokers upregulate ACE2 and DC-SIGN gene expression in different cell types. In the whole lung, ACE2 is actively expressed in remodeled Alveolar Type II cells of former smokers, while DC-SIGN is largely expressed in monocytes of former smokers and dendritic cells of current smokers. In bronchial epithelium, no obvious gene expression of DC-SIGN and L-SIGN was observed while ACE2 was found to be actively expressed in goblet cells of current smokers and club cells of non-smokers. In conclusion, our findings may indicate that smokers, especially former smokers, and people over 60 have higher risk and are more susceptible to SARS-CoV-2 infection. Also, this study provides hints on possible SARS-CoV-2 pathogenicity mechanisms in lung infection.

In the extra-thick coal seams and multi-layered hard roofs, the longwall hydraulic support yielding, coal face spalling, strong deformations of goaf-side entry, and severe ground pressure dynamic events typically occur at the longwall top coal caving longwall faces. Based on the Key strata theory an overburden caving model is proposed here to predict the multilayered hard strata behaviour. The proposed model together with the measured stress changes in coal seam and underground observations in Tongxin coal mine provides a new idea to analyse stress changes in coal and help to minimise rock bursts in the multi-layered hard rock ground. Using the proposed primary Key and the sub-Key strata units the model predicts the formation and instability of the overlying strata that leads to abrupt dynamic changes to the surrounding rock stress. The data obtained from the vertical stress monitoring in the 38 m wide coal pillar located adjacent to the longwall face indicates that the Key strata layers have a significant influence on ground behaviour. Sudden dynamically driven unloading of strata was caused by the first caving of the sub-Key strata while reloading of the vertical stress occurred when the goaf overhang of the sub-Key strata failed. Based on this findings several measures were recommended to minimise the undesirable dynamic occurrences including pre-split of the hard Key strata by blasting and using the energy consumption yielding reinforcement to support the damage prone gate road areas. Use of the numerical modelling simulations was suggested to improve the key theory accuracy.

The electronic structural evolution of LLM-105 crystal and the (101) plane of LLM-105 crystal under different pressures is investigated by the density functional theory (DFT) calculations and the surface properties of seven low-Miller-index planes of LLM-105 crystal were investigated in this study. The result demonstrates that the surface energy of (101) plane of LLM-105 is much smaller when compared with other low-Miller-index planes of LLM-105.In order to further investigate the stability of crystal structure and (101) plane of LLM-105 under different pressures, a series of pressures ranged from 0 GPa to 55 GPa were applied during the DFT calculation, and the result shows that the electronic structures of LLM-105 crystal and the (101) plane changed with the increase of external pressure and the evolution process of (101) plane is different from that of LLM-105 crystal structure.

Thermodynamic studies consider living entities as dissipative structures. Organisms maintain and develop an orderly structure by exchanging matter, energy, and entropy with the surrounding environment; thus, maintaining life and growth. For a single cell, the temperature, volume, content concentration, and content complexity are four control variables. For warm-blooded animals, both temperature and content concentration are assumed to be constant, and only volume and content complexity, i.e., various proteins, nucleic acids, and small molecular substances in the cell and their interactions, are considered as acting variables. Thus, the potential function of a single cell should conform to the cusp catastrophe model. As the studies on the specific mathematical models of the relationship between the volume and content complexity are not available, we could not propose specific methods for the specific variants of the potential function of this cusp catastrophe model. We could only present our approximate results based on the basic characteristics of the cusp catastrophe model. We speculated that when a single cell is in a stable state, it cannot undergo differentiation, dedifferentiation, and division. These behaviors occur only when the cell enters an unstable state. Based on this speculation, we divided somatic cells of warm-blooded animals into two types, namely stable cells and non-steady cells. If we consider a warm-blooded animal as a whole dissipative structure, its control variables should have steady-state cells, non-steady-state cells, and negative entropy input. If we assume that the negative entropy input is constant, the proportion of non-steady cells and the total number of cells can be used as the control variables of the potential function. For warm-blooded animals, their potential function also conforms to the cusp catastrophe model. Because the studies on the relationship between the proportion of non-steady-state cells and the total cell number are rare, we could not propose specific methods for the variation of the potential function of this cusp catastrophe model. We could only present our approximate results according to the basic characteristics of the cusp catastrophe model. We speculated that as individuals, animals should be in a stable state during development. Once they enter an unstable state, they will fall ill or die. For humans, the proportion of non-steady cells decreases during the growth process from a fertilized egg to old age. From the fertilized egg to adulthood, the total cell number increases; however, in old age, the total cell number begins to decrease gradually. The entire developmental curve will gradually enter an unstable state. We speculated that once the developmental curve of a human enters an unstable state, it is death for the elderly.

Microplastics (MPs) are a critical environmental issue, with impacts ranging from ecosystem contamination to health risks through bioaccumulation. This review addresses the inefficacy of traditional water treatments in removing MPs and proposes photodegradation, particularly via nanomaterial-enhanced photocatalysts, as a solution. Utilizing their unique properties like large surface area and tunable bandgap, nanomaterials significantly improve degradation efficiency. Different strategies for photocatalysts modification to improve photocatalytic performance are thoroughly summarized, with the particular emphasis on element doping and heterojunction construction. Furthermore, this review thoroughly summarizes the possible fundamental mechanisms driving photodegradation of microplastics facilitated by nanomaterials, with a focus on processes like free radical formation and singlet oxygen oxidation. By clearly elucidating these strategies and mechanisms, this review aims to provide valuable insights and inspire further progress in microplastic photodegradation.

An analytical method was established by HPLC-DAD-ELSD with C18-NH2 column tandem for the simultaneous determination of hydrophobic components atractylenolide I, II, III, atractylone and hydrophilic compounds glucose, fructose and sucrose in the dried rhizome of Atractylodes macrocephala Koidz (a natural raw material for health foods, Bai-Zhu aka. in Chinese). The method combines different separation capabilities of reversed-phase liquid chromatography and hydrophilic interaction liquid chromatography, can provide a new choice for the simultaneous determination of hydrophilic and hydrophobic compounds in traditional Chinese medicines and health foods. It provided a reference method for the quality control of Bai-Zhu. The results showed that the linear correlation coefficients of the established column tandem chromatographic method were all greater than 0.9990, the relative standard deviation was 0.1%-2.8%, and the average recovery was 96.7%-103.1%. The contents of atractylenolide I, II, III, atractylone, fructose, glucose, and sucrose in 17 batches of Baizhu were 172.3-759.8 μg/g, 201.4-612.8 μg/g, 160.3-534.2 μg/g, 541.4-8723.1 μg/g, 6.9-89.7 mg/g, 0.7-7.9 mg/g, and 1.2-21.0 mg/g, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Based on a modified dice-and-fill technique, a PIN-PMN-PT single crystal 1-3 composite with the kerf of 12 μm and pitch of 50 μm was prepared. The as-made piezoelectric composite material behaved with high piezoelectric constant (d33 = 1500 pC/N), high electromechanical coefficient (kt = 0.81), and low acoustic impedance (16.2 Mrayls). Using lithography and flexible circuit method, a 48-element phased array was successfully fabricated from such a piezoelectric composite. The array element was measured to have a central frequency of 20 MHz and a fractional bandwidth of approximately 77% at −6 dB. Of particular significance was that this PIN-PMN-PT single crystal 1-3 composite-based phased array exhibits a superior insertion loss compared with PMN-PT single crystal and PZT-5H-based 20 MHz phased arrays. The focusing and steering capabilities of the obtained phased array were demonstrated theoretically and experimentally. These promising results indicate that the PIN-PMN-PT single crystal 1-3 composite-based high frequency phased array is a good candidate for ultrasound imaging applications.

To keep the global navigation satellite system functional during extreme conditions, it is a trend to employ autonomous navigation technology with inter-satellite link. As in the newly built BeiDou system (BDS-3) equipped with Ka-band inter-satellite links, every individual satellite has the ability of communicating and measuring distances among each other. The system also has less dependence on the ground stations and improved navigation performance. Because of the huge amount of measurement data, centralized data processing algorithm for orbit determination is suggested to be replaced by a distributed one in which each satellite in the constellation is required to finish a partial computation task. In current paper, the balanced extended Kalman filter algorithm for distributed orbit determination is proposed and compared with whole-constellation centralized extended Kalman filter, iterative cascade extended Kalman filter, and increasing measurement covariance extended Kalman filter. The proposed method demands a lower computation power however yields results with a relatively good accuracy.

Brain tumors are abnormal cells growth in the brain tissues that can be cancerous, or not. In any case, they could be a very aggressive disease that should be detected as early as possible. Usually, magnetic resonance imaging (MRI) is the main tool commonly adopted by neurologists and radiologists to identify and classify any possible anomalies present in the brain anatomy. In the present work, an automatic unsupervised method called Z2-$\gamma$, based on the use of adaptive finite-elements and suitable pre-processing and post-processing techniques, is introduced. In particular, the proposed methodology is able to automatically classify whether a given MR image represents a healthy or a diseased brain and in this latter case, is able to locate the tumor area.

Transient receptor potential melastatin-8 (TRPM8) is a cation channel that is activated by cold and “cooling agents” such as menthol and icilin, which induce a cold sensation. Stimulation of TRPM8 activates an intracellular signaling cascade that ultimately leads to a change in the gene expression pattern of the cells. Here, we investigated the TRPM8-induced signaling pathway that links TRPM8 channel activation to gene transcription. Using a pharmacological approach, we show that inhibition of phosphatidylinositol 4-phosphate 5 kinase alpha (PIP5K), an enzyme essential for the biosynthesis of phosphatidylinositol 4,5-bisphosphate, attenuated TRPM8-induced gene transcription. Analyzing the link between TRPM8 and Gq proteins, we show that pharmacological inhibition of the beta gamma subunits impairs TRPM8 signaling. In addition, genetic studies showed that TRPM8 requires an activated Galpha subunit for signaling. In the nucleus, the TRPM8-induced signaling cascade triggers an activation of the transcription factor AP-1, a complex consisting of a dimer of basic region leucine zipper (bZIP) transcription factors. Here, we identified the bZIP protein c-Jun as an essential component of AP-1 within the TRPM8-induced signling cscade. In summary, with PIP5K, Gq subunits and c-Jun we have identified key molecules in the TRPM8-induced signaling from the plasma membrane to the nucleus.

Wastes from social economic activities had great impact on water quality thereby limiting water usability for domestic purposes. Sewages discharge from people activities, usually consist of undesirable concentrations of soluble chemicals that infiltrate into the surrounding surface and underground water, and then constitute health risk to the populace. In order to investigate the concentration characteristics and health risk for the local residents in Nandong Underground River Watershed (NURW), eleven common heavy metals in the water body analysis were conducted. Health risk assessment (HRA) was taken to analyze eleven heavy metals of 84 water samples from surface and underground waters in NURW: 36 samples underground water and 48 samples surface water. Our results showed that the heavy metals concentration order is that of Fe > Al > Mn > Zn > As > Cd > Pb > Cr > Ni > Cu > Hg. Correlation analysis indicates that these eleven metal elements have certain similarity on material source and migration transformation. The health risks for local residents exposed to metal elements in the water of NURW mainly from carcinogenic risk (10−6～10−4 a−1) through drinking way, and the health risk of heavy metals exposed to children through drinking way was much higher than adults. The maximum exposing health risks of Cr in both underground and surface water were higher than the recommendation standard (5.0×10-5 a-1) from ICRP, and all the values over the standard (5.0×10-6 a-1) recommended by the Swedish Environmental Protection Agency and the Dutch Ministry of Construction and Environment and the British Royal Society. The results of health risk assessment shows that Cr in the water of NURW was the mainly source of carcinogenic risk for the local residents, following by Cd and As. Consequently, it is necessary to control the three carcinogenic metals when the water was used as drinking water source.

The four-way reversing valve is a key component determining whether a heat pump air conditioning system can work. Studying the four-way reversing valve is of great significance for improving the performance of the heat pump air conditioning system. In this paper, the control equation of the sliding block movement process is constructed to simulate the reversing process of the four-way reversing valve in fluid mechanics, and a detailed study is carried out from the sliding block speed, sliding block acceleration, sliding block force, refrigerant leakage, and other aspects. Research has shown that optimizing the structure of the slider can greatly improve the working performance of the four-way reversing valve. Increasing the height of the slider not only improves the pressure relief ability of the four-way reversing valve and prevents the slider from being damaged by high-pressure gas impact, but also reduces the leakage of refrigerant during the directional process; When reducing the length of the slider, although it will improve the pressure relief capacity of the four-way reversing valve, it also increases the amount of refrigerant leakage. The research results provide a theoretical basis and improvement direction for designers to improve the performance of four-way reversing valves.

Tumor invasion, metastasis, and recrudesce remain a considerable challenge in the treatment of gastric cancer (GC). Herein, we first identified that RBFOX3 (RNA binding protein fox-1 homolog 3) was significantly up-regulated in GC tissues and negatively linked to the survival rate of GC patients. RBFOX3 promoted cell division and cell cycle progression in vitro as well as in vivo. Furthermore, RBFOX3 increased cell invasion and migration ability. Interestingly, both the suppression of GC cell multiplication and invasion moderated by the silencing of RBFOX3 was rescued by HTERT up-regulation. Additionally, RBFOX3 augmented the resistance of GC cells to 5-fluorouracil (5-Fu) by repressing RBFOX3. Mechanistically, exogenous up-regulation of RBFOX3 triggered promoter activity and HTERT expression thereby enhancing the division and development of GC cells. Importantly, our findings revealed that RBFOX3 interacted with AP-2β to modulate the HTERT expression as demonstrated by co-immunoprecipitation analysis. In conclusion, our study indicates that high expression of RBFOX3 promotes GC progression and development but predicts worse prognosis by stimulating HTERT signaling. Moreover, the results suggest that the RBFOX3/AP-2β/HTERT pathway is a novel target for the development of therapeutic agents for the prevention and treatment of GC reappearance and metastasis.

Photovoltaic(PV) power generation is highly nonlinear and stochastic. Accurate prediction of PV power generation plays a crucial role in grid connection as well as the operation and scheduling of power plants. To predict the PV power combination model, this paper suggests a method based on Empirical Mode Decomposition (EMD), Ensemble Empirical Mode Decomposition (EEMD), Complete Ensemble Empirical Mode Decomposition with Adaptive Noise (CEEMDAN), Nonlinear Auto-Regressive Neural Networks with Exogenous Input (NARXNN), Long Short Term Memory (LSTM) Neural Network, and Light Gradient Boosting Machine (LightGBM) algorithms. To attempt to reduce the non-smoothness of PV power, the weather variable features with the greatest effect on PV power are first identified by correlation analysis. Following this, the PV power modal decomposition is split and reorganized into a new feature matrix. Finally， a NARX is used to obtain preliminary PV power components and residual vector features， and the PV power is predicted by combining three models of LightGBM， LSTM, and NARX and then the final prediction results are obtained by combining the PV power prediction results using error inverse method weighted optimization. The prediction results demonstrate that the model put forth in this paper outperforms those of other models and validate the model's validity by utilizing real measurement data from Andre Agassi College in the United States.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

The study of the currently known >3,000 species of snakes can provide valuable insights into the evolution of their genomes. Deinagkistrodon acutus, also known as Sharp-nosed Pit Viper, one hundred-pacer viper or five-pacer viper, is a venomous snake with significant economic, medicinal and scientific importance. Widely distributed in southeastern China and South-East Asia, D. acutus has been primarily studied for its venom. Here, we employed next-generation sequencing to assemble and annotate a highly continuous genome of D. acutus. The genome size is 1.46 Gb; its scaffold N50 length is 6.21 Mb, the repeat content is 42.81%, and 24,402 functional genes were annotated. This study helps to further understand and utilize D. acutus and its venom at the genetic level.

Chalcones are a class of flavonoids possessing a variety of biological activities, including antimicrobial and antioxidant effects. Therefore, chalcones and their derivatives have potential use in the control of postharvest diseases. In this work, the effects of 2ʹ,4ʹ-dichloro-chalcone on the in vitro growth and in vivo pathogenicity of F. tricinctum and T. roseum were investigated. The results showed that 100 µM of 2ʹ,4ʹ-dichloro-chalcone strongly inhibited mycelial growth and conidial production of F. tricinctum (32.3%) and T. roseum (65.2%) in vitro. This treatment also significantly inhibited the expansion of potato dry rot from F. tricinctum (48.6%) and apple rot spot from T. roseum (36.2%). The incubation of F. tricinctum and T. roseum conidia with this agent for 2 h increased their cell membrane permeability by 25% and 22.5%, respectively and conidial membrane permeability by 41.7 and 65.4%, respectively. This treatment also significantly inhibited the total respiration rate and activated the cyanide-resistant respiratory pathway in both pathogens. Protein immunoblotting showed that the treatment increased alternative oxidase (AOX) levels after 4 h in F. tricinctum and T. roseum by 52.76% and 39.13%, respectively. Conclusion: 100 µM 2ʹ,4ʹ-dichloro-chalcone significantly inhibited mycelial growth and spore production in F. tricinctum and T. roseum in vitro and reduced their pathogenicity in postharvest potato and apple crops. Further analysis indicated that 2ʹ,4ʹ-dichloro-chalcone disrupted the integrity of cell membranes and the mitochondrial respiratory electron transport chain which leaded to ROS burst and oxidative stress, AOXs were induced directly or indirectly, and the cyanide resistant respiratory pathway was activated. The in vitro growth and pathogenicity of F. tricinctum and T. roseum were inhibited.

In the present work report, the MgAl₂O₄and the Ag/MgAl₂O₄ samples were successfully synthesized by the modified hydrothermal and the isovolumetric impregnation methods, respectively. The structural properties of the prepared samples were systematically characterized by XRD, SEM, TEM, DRS, XPS and et al techniques. The photocatalytic degradation of methylene blue by the Ag/MgAl₂O₄ and MgAl₂O₄ samples was comparatively studied under UV lamp irradiation. The results revealed that the prepared Ag/MgAl₂O₄ (pH=6) samples were the most active among the samples in photocatalytic of methylene blue. Under UV lamp irradiation, the Ag/MgAl₂O₄ (pH=6) photodegradation of methylene blue reached to 89.6% within 120 min. And the Ag/MgAl₂O₄ (pH=6) complex photocatalysts displayed a high photochemical stability under repeated irradiation. Repeated irradiate the Ag/MgAl₂O₄ (pH=6) compound, which indicated it had a high photochemical stability.

Concern over potential antimony mediated toxicity from mining and smelting activities has instigated novel concepts toward removing aqueous antimony ions. The iron based adsorbent Fe3O4/HCO was found to be efficient for treating antimony-containing wastewater However, ineffective methodology for preparation limited its effective adsorption capacity and thus wider application. In this study, a new type of HCO-doped-(Fe3O4)x adsorbent was prepared by co-precipitation method for doping Fe3O4 into HCO sludge (HCO), thereby improving adsorption performance for Sb(III) and Sb(V) ions, with the maximum adsorbing capacity being 44.46 mg/g and 47.91 mg/g, respectively. According to the results of BET, SEM-EDS, XRD and XPS, it were confirmed that the FeOOH and X≡Fe-OH were formed during the preparation process, bring about the increased the surface area, thus resulting in further increase of surface area, hydroxyl groups and the net negative ionic charge. Moreover, the adsorption kinetics followed the pseudo-second-order kinetic model which indicated that adsorption process of Sb(III)/Sb(V) by HCO-doped-(Fe3O4)x adsorbent was controlled by chemical reaction. The main adsorption mechanism is that antimony ion and amorphous iron oxide X≡Fe-OH undergo coordination exchange reaction and complexation reaction with CeO2 or Ce2O3. Furthermore, HCO-doped-(Fe3O4)x could adapt to wide pH and had stable adsorption ability after regeneration. The good adsorption performance of HCO-doped-(Fe3O4)x makes it a potential applications of adsorbent for removal of antimony.

The greatly diversified flowering plants (angiosperms) are the dominating and defining group in the current earth ecosystem. However, from which group by what way the flowers, especially their gynoecia (key characteristics of angiosperms), are derived have been the questions in botany unanswered over centuries. Such an embarrassing situation can be attributed to the lack of plants with partially enclosed ovules, which are supposed to be a post between gymnosperms and angi-osperms. Here we report a fossil plant that has an apparent coniferous vegetative and reproduc-tive morphologies but has a single seed partially wrapped by the subtending bract. Such a mor-phology suggests that the carpels in angiosperms may be equivalent to bracts enclosing their axil-lary seed(s). Such a non-traditional interpretation of the homology of angiosperm carpels is com-patible with various new progresses made in botany and is in line with Tomlinson’s recent hy-pothesis. Together with other fossil evidence reported recently, it appears that gynoecia in angio-sperms are derived in multiple ways.

Potato tubers are susceptible to wounding during post-harvest processes, leading to quality decline, perishability and large economic losses. In this study, the potato cultivar, ‘Longshu No.7’, was foliar-sprayed with 3% chitosan (w/v) three times during the pre-harvest period after flowering to evaluate the effect of foliar spraying with chitosan on suberization processing at wounds of harvested potato tubers. Our results demonstrate that foliar-sprayed with chitosan significantly reduced wound-induced fresh weight loss and dry rot disease index by 37.34% and 41.60% on the 28 day after wounding, respectively. Foliar-sprayed with chitosan accelerated the deposition of suberin polyphenolics and lignin at the wound sites of potato tubers with the formation of thicker cell layers. This occurred with increased localized activities of key enzymes in the suberin polyphenolics and lignin pathways, including phenylalanine ammonia lyase, 4-coumaryl-coenzyme A ligase, cinnamyl alcohol dehydrogenase and peroxidase (33.90–64.32%), as well as the contents of cinnamic acid, sinapic acid, flavonoids, lignins and total phenolics (19.70–23.46%) at wound sites of potato tubers on the 7 day after wounding. Our results indicated that foliar application of chitosan accelerated wound-induced suberization of potato tubers and could mitigate post-harvest product damages.

Compact solar-powered plasma water generator: enhanced on-site aged seed germination with the corona dielectric barrier discharger

The city administration of China planned numerous metro projects and more metros can hardly avoid undercrossing a bridge. While metro shield construction when undercrossing a bridge (MSCUB) is frequently located in complicated natural and social context, which made the construction process more susceptible to safety accidents. Therefore, it is crucial to look into safety risk of MSCUB. The paper identified the safety risk factors during SSCUR by using literature review and experts’ evaluation, proposed a novel safety risk assessment model by integrating CFA and FER, and then selected a project case to test the validity of the suggested model. Research results show that (a) a safety risk factors list of MSCUB was identified, including 4 first-level safety risks and 37 second-level safety risk factors; (b) the proposed safety risk assessment model can be used to measure the risk values of the overall worksite safety risk, the first-level safety risks and the safety risk factors of MSCUB; (c) environment-type safety risk and personnel-type safety risk have higher risk values when shield construction undercrossing a bridge; (d) when compared to worker-type safety risk, manager-type safety risk is the higher risk value. The research can enrich the theoretic knowledge of MSCUB safety risk assessment and provide references to safety managers for conducting scientific and effective safety management on the construction site when subway undercrossing a river.

The fast decoding of low-density parity-check (LDPC) is crucial for its future applications. In this paper, we propose to use Early Termination (ET) and Force Convergence (FC) techniques to accelerate the decoding of two new local/global two-phases decoding algorithms to reduce the Globally Coupled (GC) LDPC codes. Specifically, ET is applied in the local decoding phase of two- phases decoding of GC-LDPC codes to skip the local decoding which is highly likely to fail and avoid the unnecessary iterations. FC is applied in global decoding phase where converged variable nodes are identified and removed from Tanner graph and the decoding can be speed up shrinking parity check matrices. Two variants are proposed for the ET operation in local decoding phase. ET-1 merely stops iteration if it meets the stopping criterion while in ET-1, the iteration number saved in local decoding is added up in global decoding to improve the decoding performance. The simulation results show that the ET-1-FC scheme can save up to 42% decoding time complexity in the low SNR region while keeping the error rate performance nearly unchanged, the ET-2-FC can improve the error rate performance by 0.18dB at bit error rate 0.001 or 0.23dB at frame error rate 0.1. In the waterfalling region of BER/FER curves, both schemes can save about 25% decoding time complexity.

Amidst the escalating demands for efficient Intelligent Transportation Systems (ITS) management, the significance of accurate Origin-Destination (OD) data prediction has emerged as a paramount concern, given its indispensable role in the ITS domain. This paper introduces a groundbreaking integrated model, creatively fusing the unique strengths of Graph Convolutional Network (GCN), Residual Neural Network (ResNet), and Long Short-Term Memory Network (LSTM) into a single architecture, which we name GraphResLSTM, to exploit road segment average speed data for OD prediction. Compared with conventional road segment traffic volume data, average speed data is more readily available, significantly reducing the data accessibility barrier for OD prediction. We underscore the critical role of selection of key road segments and employs a combination of Entropy Weight Method and Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) to identify 41 representative road segments from the experimental road network. In the experimental phase, we simulate 86400000 seconds of traffic conditions, generating a total of 1440000 data records. Utilizing these simulated data, we design and conduct comparative experiments between models as well as data types. The results demonstrate that both the GraphResLSTM model and road segment average speed data outperform other models and data types notably in OD prediction tasks.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

As a dominant mangrove species, Kandelia obovata is distributed in an intertidal marsh with an active H₂S release. Whether H₂S participates in the salt tolerance of mangrove plant is still ambiguous although increasing evidence have demonstrated that H₂S functions in plant responses to multiple abiotic stresses. In this study, as an H₂S donor, NaHS was used to investigate the regulatory mechanism of H₂S on salt tolerance of K. obovata seedlings using a combined physiological and proteomic analysis. The results showed that the reduction in photosynthesis (Pn) caused by 400 mM NaCl was recovered by the addition of NaHS (200 μM). Furthermore, the application of H₂S enhanced the quantum efficiency of PSII and the membrane lipid stability, implying that H₂S is beneficial to the survival of K. obovata seedlings under high salinity. We further identified 37 differentially expressed proteins by proteomic approaches under salinity and NaHS treatment. Among them, the proteins related to photosynthesis, primary metabolism, stress response and hormone biosynthesis were primarily enriched. The physiological and proteomic results highlighted that exogenous H₂S up-regulated photosynthesis and energy metabolism to help K. obovata to cope with high salinity. Specifically, H₂S increased photosynthetic electron transfer, chlorophyll biosynthesis and carbon fixation in K. obovata leaves under salt stress. Furthermore, the abundances of other proteins related to metabolic pathway, such as antioxidation (APX, CSD2, PDX1), protein synthesis (HSP, Cpn 20), nitrogen metabolism (GS2, GS1:1), glycolysis (PGK, TPI), AsA-GSH cycle were increased by H₂S under high salinity. These findings provide new insights into the roles of H₂S in the adaptations of mangrove plant K. obovata to high salinity environment.

The working environment of mining electric locomotives is wet and muddy coal mine 1 roadway. There may be idling or slipping between the wheels and rails of mining electric locomotives 2 due to low friction between the wheel and rail and insufficient utilization of creep rate. Therefore, it 3 is necessary to control the creep rate within a reasonable range. In this paper, the autonomous control 4 algorithm for mining electric locomotives based on improved ε-greedy is theoretically proven to be 5 convergent and effective firstly. Secondly, after analyzing the contact state between the wheel and rail 6 under wet and slippery road conditions, it was concluded that the value of creep rate is an important 7 factor affecting the autonomous driving of mining electric locomotives. Therefore, the autonomous 8 control method for mining electric locomotives based on creep control is proposed in this paper. 9 Finally, the effectiveness of the proposed method was verified through simulation. The problem of 10 wheel slipping and idling caused by insufficient friction of mining electric locomotives in coal mining 11 environments is effectively suppressed. Autonomous operation of vehicles with optimal driving 12 efficiency can be achieved through quantitative control and utilization of the creep rate between 13 wheels and rails

Gas flaring is commonly used by industrial plants for processing oil and natural gases in the atmosphere, and hence is an important anthropogenic source for various pollutants including CO₂, CO, and aerosols. This study evaluates the feasibility of using satellite data to characterize gas flaring form space by focusing on the Khanty Mansiysk Autonomous Okrug in Russia, a region that is well known for its dominatingly gas flaring activities. Multiple satellite-based thermal anomaly data products at night are inter-compared and analyzed, including MODIS (Moderate Resolution Imaging Spectroradiometer) Terra level-2 Thermal Anomalies product (MOD14), MODIS Aqua level-2 Thermal Anomalies product (MYD14), VIIRS (Visible Infrared Imaging Radiometer Suite) Active Fires Applications Related Product (VAFP), and VIIRS level-2 data based Nightfire product (VNF). The analysis compares and contrasts the efficacy of these sensor products in detecting small, hot sources like flares on the ground in extremely cold environments such as Russia. We found that the VNF algorithm recently launched by NOAA has the unprecedented accuracy and efficiency in characterizing gas flares in the region owing primarily to the use of Shortwave Infrared (SWIR) bands. Reconciliation of VNF’s differences and similarities with other nighttime fire products is also conducted, indicating that MOD14/MYD14 and VAFP data are only effective in detecting those gas flaring pixels that are among the hottest in the region. Validation of VNF product of gas flaring location with Google Earth images are made. It is shown that that VNF’s estimates of gas flaring area (the area of gas flaming) agree well the counterparts from Google images with a linear correlation of 0.91, highlighting its potential use for routinely monitoring emissions of gas flaring from space.

Lithium-rich layered oxides is one of the most perspective candidates for cathode materials of lithium ion battery, because of its high discharge capacity. However, there are some disadvantages of uneven composition, voltage decay, and poor rate capacity, which are closely related to the preparation method. Here, 0.5Li2MnO3·0.5LiMn0.8Ni0.1Co0.1O2 were successfully prepared by sol-gel and oxalate co-precipitation methods. A systematic analysis of the materials shows that the 0.5Li2MnO3·0.5LiMn0.8Ni0.1Co0.1O2 prepared by the oxalic acid co-precipitation method has the most stable layered structure and the best electrochemical performance. The initial discharge specific capacity is 261.6 mAh·g-1 at 0.05 C, and the discharge specific capacity is 138 mAh·g-1 at 5 C. The voltage decay is only 210 mV, and the capacity retention is 94.2% after 100 cycles at 1 C. The suppression of voltage decay can be attributed to the high nickel content and uniform element distribution. In addition, tightly packed porous spheres help to reduce lithium ion diffusion energy and improve the stability of the layered structure, thereby improving cycle stability and rate capacity. This conclusion provides a reference for designing high energy density lithium-ion batteries.

The escalation of mining activities in the karst regions of Guizhou Province has heightened the occurrence of water-inrush incidents in deep coal mines. This study focused on water-inrush phenomena within the Xinhua mining area of Jinsha County, Guizhou Province, aiming to investigate the sources of these incidents. The findings indicated that the overlying limestone of the Changxing Formation in the coal seam served as a vulnerable aquifer under certain conditions, leading to water inrushes. The analysis of the spatiotemporal distribution patterns of water-inrush incidents at the working face indicated that previous mining operations damaged the shallow Changxing Formation limestone, resulting in the accumulation of goaf water and the formation of numerous mining-induced fractures. These fractures served as rapid conduits for water inrushes from both atmospheric precipitation and underground sources at the deep working face. The examination of surface water and mine water quality demonstrated that both exhibited similar characteristics, predominantly featuring bicarbonate, sulfate, and sodium compositions. Investigation into the relationship between mine water inflow and atmospheric precipitation established that atmospheric precipitation influenced the mine water supply cycle, with a replenishment period of ~10 months during the operational phase of the Jinyuan Coal Mine and about one month post-closure. The fractures induced by mining activities within the Changxing Formation limestone facilitated water flow, with atmospheric precipitation serving as the primary water source for the mine. This study offered a valuable scientific foundation for addressing water-related damage resulting from atmospheric precipitation in mines susceptible to water inrushes under analogous hydrogeological conditions.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

Although the Orthotropic steel decks (OSDs) have been widely used in the construction of long-span bridges, there are frequently reported fatigue cracks after years of operation, and the bridge deck overlay also presents severe damage due to OSD crack-induced stiffness reduction. The ultra-high performance concrete (UHPC), recognized as the most innovative cementitious composites and the next generation of high-performance materials, shows high strength, ductility, toughness and well performance on durability. After its first application to the OSD bridge in early 2000s, the orthotropic Steel-UHPC composite deck has been comprehensively studied worldwide. This review will summarize some important studies and findings on behavior and fatigue performance of orthotropic steel-UHPC composite deck. The existing studies and engineering application indicate that such deck system presents good bending behavior and high fatigue performance. The failure mode of shear studs in UHPC layer is dominated by shear fractures. The cracking of UHPC layer shall consider the superposition effect of stress from both the whole bridge structure and local decks. While some reasonable structural details in the traditional OSD may not work for the orthotropic steel-UHPC composite deck. It is recommended to evaluate the stress behavior and structural parameters, as well as fatigue life by conducting the field test under in-service traffic conditions.

In this study, the impact of the addition of high-aspect-ratio nano-ettringite to photocurable epoxy acrylate resin was explored, with a specific focus on the changes observed in viscosity, shrinkage, tensile strength, and elongation at the break of composites formed. Herein, the nano-ettringite samples were modified using KH-570. The 3 wt% or 6 wt% KH-570-modified and unmodified nano-ettringite were dispersed into the resin by ultrasonic treatment in conjunction with mechanical stirring. The grafting effects of nano-ettringite onto KH-570 were analyzed through scanning electron microscopy (SEM), X-ray diffraction (XRD), thermogravimetric (TG) analysis, and Fourier transform infrared spectroscopy (FTIR). The results demonstrate that increased dosages of unmodified and modified nano-ettringite led to increased viscosity of the composite while reducing shrinkage. At the same dosage, the photocurable resin with modified nano-ettringite demonstrated a lower shrinkage and a higher tensile strength. Notably, when the amount of modified nano-ettringite was 3 wt%, the highest tensile strength of the composite was 64.61 MPa, presenting a 72.57% increase compared to the blank sample. Furthermore, the incorporation of modified nano-ettringite as a filler provides a new perspective for improving the performance of photocurable epoxy acrylate resin composites.

Li-rich layered oxide cathode materials have become one of the most promising cathode materials for high-energy-density lithium-ion batteries owning to its high theoretical specific capacity, low cost, high operating voltage and environmental friendliness. Yet they suffer from severe capacity and voltage attenuation during prolong cycling, which blocks their commercial application. To clarify these causes, we synthesize 0.5Li2MnO3·0.5LiNi0.8Co0.1Mn0.1O2 (LL-811) with high-nickel-content cathode material by a solid-sate complexation method, and it manifests a lot slower capacity and voltage attenuation during prolong cycling compared to LL-111 and LL-523 cathode materials. The capacity retention at 1C after 100 cycles reaches to 87.5% and the voltage attenuation after 100 cycles is only 0.460 V. Combining X-ray diffraction (XRD), scanning electron microscope (SEM) and transmission electron microscopy (TEM), it indicates that increasing the nickel content not only stabilizes the structure but also alleviates the attenuation of capacity and voltage. Therefore, it provides a new idea for designing of Li-rich layered oxide cathode materials that suppress voltage and capacity attenuation.

In response to the fairness issue arising from the unequal delay of vehicles in different phases at intersections, considering the actual situation of small and variable delays for vehicles in low-saturation intersection phases, this paper proposes the concept of "sacrificing efficiency for fairness." Firstly, the universality of unfair delay phenomena at intersection phases is explained, especially at low-saturation intersections where the fluctuation in phase delays is 1.87 times higher than at other intersections. Then, a fairness evaluation index is constructed using information entropy, and the feasibility of the proposed approach is demonstrated. Subsequently, a signal optimization model that balances efficiency and fairness is proposed. Finally, the proposed model is validated through case studies, showing that it not only simultaneously considers efficiency and fairness but also has minimal impact on efficiency. Moreover, the changes to timing schemes in the efficiency model are much smaller compared to the model that only considers fairness. Sensitivity analysis reveals that the model performs better under low-saturation intersection conditions.

Applied talent is not only a builder of human civilization but also a promoter of economic development. They not only need systematic and solid engineering theoretical knowledge but also rich engineering practical experience. Applied undergraduate colleges are the cradle for cultivating applied talent and shoulder the important mission of cultivating various types of applied talent for society. With the rapid development of higher education, the number of applied undergraduate institutions has sharply increased, but the quality of applied talent cultivated by them has shown a significant decline, which greatly restricts the pace of industrial development in the world. This article proposes a new concept of promoting the "three certificates" (graduation certificate, degree certificate, and skill certificate) education model in applied undergraduate colleges, which is of great significance for the country to cultivate composite talents with the ability of "product design, production management, and product processing" at the same time.

Ocean surface waves have been utilized as fundamental information in various fields of oceanic research. In this paper, we suggest a simulation and modelling technique for generating an ocean surface wave using an inverse Fast Fourier Transform (iFFT), and we subsequently verify the wave’s accuracy. The conventional method, linear superposition, requires recursive calculation because of the double summation and the time variable; to circumvent this issue, the new algorithm is presented. The Joint North Sea Wave Project (JONSWAP) spectrum is utilized for the ocean surface wave simulation example, and the parameters are the significant wave height (HS) and the zero-crossing wave period (TZ). A coordinate transform for the wavenumber domain was used to apply the inverse FFT algorithm. To verify the accuracy of the simulation result, the relative error between the input condition and the analysis result was calculated. The result for TZ is below 4% relative error, and the maximum relative error for HS is 7%. To avoid the Nyquist frequency for wave-field analysis and simulation, the minimum grid size was calculated by twice applying the maximum wavenumber.

Current sampling methods for detecting the presence of the invasive freshwater hydrozoan Craspedacusta sowerbii rely mainly on visual confirmation of the medusa stage. Confirming the presence of the polyp stage is equally important to observing medusae since typical late summer/early fall occurrences or observations of medusae are sporadic though becoming more frequent. The polyp stage is important as it is the organism’s primary stage and is present throughout the year depending on water temperatures. Therefore, sampling methods for the polyp stage are commonly the collection of substrates such as rocks, plants or pieces of wood in a given body of water and can be cumbersome to examine. Based on preliminary culturing of the polyp stage on glass and plastic microscope slides in the lab, we designed a novel sampling methodology based on submerging 4 substrate types (small glass petri dishes, Hester-Dendy plates, plastic and glass microscope slides) to confirm the presence of C. sowerbii polyps in the field. We tested this method in various lakes in the Illinois-Indiana region (USA). The sampling method we designed was effective in that C. sowerbii polyps (and sometimes colonies) were found on both plastic and glass slides. While this method can be sufficient for detection of the polyp stage, it also shows significant potential for improvement; we highlight water flow and competition and predation from other organisms as significant factors influencing the collection of C. sowerbii polyps for future methodologies.

With the rapid evolution of SARS-CoV-2, the emergence of new strains is an intriguing question. This paper presents an evolutionary theory to analyze the mutations of the virus and identify the conditions that lead to the generation of new strains. We represent the virus variants using a 4-letter sequence based on amino acid mutations on the spike protein and employ an n-distance algorithm to derive a variant phylogenetic tree. We show that the theoretically-derived tree aligns with experimental data on virus evolution. Additionally, we propose an A-X model, utilizing the set of existing mutation sites (A) and a set of randomly generated sites (X), to calculate the emergence of new strains. Our findings demonstrate that a sufficient number of random iterations can predict the generation of new macro-lineages when the number of sites in X is large enough. These results provide a crucial theoretical basis for understanding the evolution of SARS-CoV-2.

Radio-dynamic therapy (RDT), as an emerging cancer treatment method, has attracted attention due to its remarkable therapeutic efficacy using low-dose, high-energy radiation (such as X-rays), and has shown significant potential in cancer treatment. The RDT system typically consists of scintillators and photosensitizers. Scintillators absorb X-rays and convert them to visible light, activating nearby photosensitizers to generate cytotoxic reactive oxygen species (ROS). Challenges faced by the two-component strategy, including low loading capacity and inefficient energy transfer, hinder its final effectiveness. In addition, the tumor microenvironment (TME) with hypoxia and immunosuppression limits the efficacy of RDTs. Recent advances introduce one-component RDT systems based on nanomaterials with high-Z metal elements, which effectively inhibit deep-seated tumors. These novel RDT systems exhibit immune enhancement and immune memory, potentially eliminating both primary and metastatic tumors. This review comprehensively analyzes recent advances in the rational construction of RDTs, exploring their mechanisms and its application in the treatment of deep-seated tumors. Aimed at providing a practical resource for oncology researchers and practitioners, the review offers new perspectives for potential future directions in RDT research.

It is extremely fascinating and astonishing that the gravitational field on the surface of a neutron star is with a relativistic mass density of 2.65*10¹⁶~5.87*10¹⁸kgm^-3 which can be larger than the mass density of the neutron star (~10¹⁷kgm^-3).Therefore, it is the author’s first intuitional imagining that this field could directly convert into mass. In so strong a gravitational field, electron and proton could be produced directly from graviton–photon collision. The gravitational field exists in everywhere in our universe. No vacuum that the region of a space is “empty” does exist. A particle is clearly always being acted on by the gravitational field. The quantum vacuum fluctuation and vacuum polarization need be re-understood with the interaction between photon and gravitational field. Therefore, the gravitational field is naturally one of the foundations of modern physics.

Background: The Corona Virus Disease 2019 (COVID-19) is spreading globally now. However, the clinical presentation that predict prognosis of the patients are still largely unknow. Methods: We enrolled 393 patients infected with COVID-19 and 30 patients with common pulmonary bulla and reviewed their clinical features to evaluate the potential prognostic value of pulmonary vesicles, especially in the patients with severe symptoms. One COVID-19 patient with vesicles was treated by bullectomy for last resort, and its characteristics of the patient’s perioperative laboratory tests was analyzed. The pathological findings of bullectomy were described and compared with those of common bulla cases. Results: Patients infected with COVID-19 showed more dependence on ventilator, occurrence of super resistant bacteria, and prone to vesicle formation than common bulla (p<0.05). Disease severity is associated with age, sex, and usage of ventilator, ECMO and antibiotics, super resistance bacteria and vesicle formation (p<0.05). The average mortality rate of COVID-19 patients was 4.10% (25.4% in severe patients, 0.00% in mild patients). Interestingly, the mortality rate further increased in severe patients with pulmonary vesicles than those without pulmonary vesicles (35.7% vs 22.4%, p=0.0442). One COVID-19 patient with vesicles underwent bullectomy and had a poor prognosis, who showed diffuse alveolar damage and extensive necrosis in bullectomy specimen. Conclusions: Patients infected with COVID-19 are more prone to form pulmonary vesicles showed on chest CT scans, as an important poor prognosis factor, especially in the severe patients.

Tack is one of the most important factors affecting the operability of prepregs, but it is still very difficult to obtain the change of prepreg tack with time at different temperatures. In this paper, a newly designed T-peel device is used to test the tack decay rate of prepregs at different temperatures. The obtained decay rate deviates less than 8.9% from the manufacturer's data. The maximum deviation of the ratio of tack decay speeds calculated by the Arrhenius equation from the experiments is not higher than -9.7%. It is proved that the present method can obtain the decay rate of tack of prepregs at different temperatures. This method is also applicable to the other two types of prepregs. The article proposes the handling life unit, an operational life measurement unit for prepregs, and establishes that the relationship between tack and remaining shelf life reduces prepreg management costs.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

Gamma-aminobutyric acid (GABA), a non-protein-producing amino acid, is extensively found in microorganisms, plants and vertebrates, and is abundantly expressed in the spinal cord and brain. To date, GABA is considered to be the major inhibitory neurotransmitter in the central nervous system. Its physiological effects are related to the regulation of synaptic transmission, the promotion of neuronal development and relaxation, and the prevention of insomnia and depres-sion. Mediated through its specific receptors, it plays a pivotal role in the control of neuronal ex-citability, which can serve as anovel target for developing analgesics for pain management. This review provides an update on the accumulating evidence of specific GABA receptors and their subtypes in the involvement of pain analgesia.

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

In contemporary society, an increasing number of individuals are identified as the "Indoor Generation". Prolonged periods spent indoors can have detrimental effects on our overall well-being. Consequently, the examination of biophilic indoor environments and their impact on occupant well-being and comfort has emerged as a significant area of study. Besides the construction of new biophilic buildings, numerous existing building stocks retain substantial social, economic, and environmental value. The need for stock renovation is considerable, revitalizing existing structures rather than embarking on new constructions. Swift feedback is crucial during the initial stages of renovation design, fostering consensus among all stakeholders. A comprehensive understanding of proposed renovation plans contributes to improved indoor environment design. Initially, generative adversarial networks (GANs) produce interior renovation drawings based on user preferences and designer styles. Subsequently, the implementation of Mixed Reality (MR) and Diminished Reality (DR) provides users with an immersive perspective, transforming 2D drawings into interactive MR experiences, and facilitating the presentation of interior renovation proposals. This paper outlines the development of a real-time system for architectural designers that seamlessly integrates MR, DR, and GANs results, with the aim of enhancing feedback efficiency during the renovation design process, enabling stakeholders to evaluate and understand renovation proposals more comprehensively. Furthermore, we incorporate several full-reference image quality assessment (FR-IQA) methods to evaluate the quality of the GANs-generated images. The evaluation results indicate that the majority of images fall within the moderate range of quality.

In this paper, we study the global existence and exponential decay for a dynamic contact problem between a Timoshenko beam with second sound and two rigid obstacles, of which the heat flux is given by Cattaneo's law instead of the usual Fourier's law. The main difficulties arise from the irregular boundary terms, from the low regularity of the weak solution and from the weaker dissipative effects of heat conduction induced by Cattaneo's law. By considering related penalized problems, proving some a priori estimates and passing to the limit, we prove the global existence of the solutions. By considering the approximate framework, constructing some new functionals and applying the perturbed energy method, we obtain the exponential decay result for the approximate solution, and then prove the exponential decay rate to the original problem by utilizing the weak lower semicontinuity arguments.

A robust guaranteed cost preview repetitive controller is proposed for a class of polytopic uncertain discrete-time systems. In order to improve the tracking performance, the repetitive controller combined with preview compensator is inserted in the forward channel. By using the L-order forward difference operator, an augmented dynamic system is constructed. Then, the guaranteed cost preview repetitive control problem is transformed into the guaranteed cost control problem for the augmented dynamic system. For given performance index, the sufficient condition of asymptotic stability for the closed-loop system is derived by combining parameter-dependent Lyapunov function method with linear matrix inequality (LMI) techniques. By incorporating the controller obtained into the original system, the guaranteed-cost preview repetitive controller is derived. A numerical example is also included to show the effectiveness of the proposed method.

To solve two key problems in the identification of people who are infected with COVID-19: the first problem is that the identification accuracy is not high enough. The second problem is that present identification method such as nucleic acid testing is expensive in many countries. Methods: So, I decided to design a fast identification method for COVID-19 patients which is based on deep learning. After the model (CoughNet) learns more than 6,000 cough spectrograms of both COVID-19 patients and normal people, the accuracy rate of identification of COVID-19 patients and normal people is higher than 99% in the test set. Structure: This paper is mainly divided into three parts: the first part introduces the main background and research status of the research; The second part introduces the research methods; The third part introduces the specific process of the experiment.

There are gravitational field and baryonic matter (star, planet, gases etc.) in our world; gravitational field is much more fundamental for that the relativistic mass of the gravitational field of a neutron star is almost 10²¹ times the mass of the neutron star. And, it is astonishing that the relativistic mass density of the gravitational field on the surface of a neutron star can be larger than the mass density of the neutron star. It is well known that, in the weak gravitational field a light line appears a straight line while in the strong field it is a curved line. It is stressed that the result measured in the strong field is more fundamental for that in a galaxy the measurable object is generally with strong field. It results in that the way that the result measured on the Earth with weak field is used as the universal standard need be revised as gravity is studied in the scale of a galaxy. It seems that a new theory of gravity need be developed for the new observations.

Linear mixed models are frequently used for analysing heterogeneous data in a broad range of applications. The restricted maximum likelihood method is often preferred to estimate co-variance parameters in such models due to its unbiased estimation of the underlying variance parameters. The restricted log-likelihood function involves log determinants of a complicated co-variance matrix. An efficient statistical estimate of the underlying model parameters and quantifying the accuracy of the estimation requires the first derivatives and the second derivatives of the restricted log-likelihood function, i.e., the observed information. Standard approaches to compute the observed information and its expectation, the Fisher information, is computationally prohibitive for linear mixed models with thousands random and fixed effects. Customized algorithms are of highly demand to keep mixed models analysis scalable for increasing high-throughput heterogeneous data sets. In this paper, we explore how to leverage an averaged information splitting technique and dedicate matrix transform to significantly reduce computations and to accelerate computing. Together with a fill-in reducing multi-frontal sparse direct solver, the averaged information splitting approach improves the performance of the computation process.

Appling the controlling relative permittivity and permeability in the equations for the gravitational-magnetic-electric field interaction, a very large variation of the gravitational acceleration of the Earth by electric/magnetic field could be arrived at. This conclusion may be supported by some of the experiments for the gravitational effect of superconductivity.

Studying the two famous old problems that why the moon can move around the Sun and why the orbit of the Moon around the Earth cannot be broken off by the Sun under the condition that calculating with F=GMm/R^2, the attractive force of the Sun on the Moon is almost 2.2 times that of the Earth. We found that the planet and moon are unified as one single gravitational unit which results in that the Sun cannot have the force of F=GMm/R^2 on the moon. The moon is moved by the gravitational unit orbiting around the Sun. It could indicate that the gravitational field of the moon is limited inside the unit and the gravitational fields of both the planet and moon is unified as one single field interacting with the Sun. The findings are further clarified by reestablishing Newton’s repulsive gravity.

The characteristics of gap plasmon formed by nanoparticle-on-mirror (NPOM) structure composed of metal nanoparticles (MNP) and metal thin films have aroused the interest of various optoelectronic devices. The resonant spectrum obtained by the internal coupling effect of gap can be flexibly controlled by the polarization of incident light and the thickness of the dielectric layer between MNP and metal thin films. We have theoretically studied the resonance spectra of polarization-dependent gold ellipsoidal nanoparticles (GENP) and gold thin films in the gap region of NPOM structures. GENP and gold thin films are separated by a dielectric layer with a refractive index of 1.36. We observe that the intensity of the local electric field resonance peak in the gap region is inversely proportional to the polarization angle. Similarly, the intensity of the local electric field resonance peak in the gap region is inversely proportional to the thickness of the dielectric layer. We have obtained more than 2200 V/m local electric field intensity (dielectric layer thickness 0.3nm). Finally, the resonant peak wavelength of the electric field in the gap region of the NPOM structure is also controlled by the polarization angle of the incident light and the thickness of the dielectric layer.

Blood image intensity has been used to detect erythrocyte sedimentation rate (ESR). However, it does not give an information on biophysical properties of blood sample under continuous ESR. In this study, three physical properties, including, τ₀, ESR_τ, and AI_I, are suggested to quantify mechanical variations of blood under continuous ESR. To demonstrate the proposed method, blood sample is loaded into a driving syringe. The blood flow rate is set in a periodic on–off pattern. Blood sample is then supplied into a capillary chip, and microscopic blood images are captured at specific intervals. Blood shear stress is quantified from the interface of blood stream in the coflowing channel. Both τ₀ and ESR_τ are then obtained by analyzing the blood shear stress. Simultaneously, the AI_I is evaluated by analyzing the image intensity of blood flow. According to the experimental results, the τ₀ exhibits consistent trends with respect to hematocrit as well as diluent. The ESR_τ and AI_I showed a reciprocal relationship each other. Three suggested properties represented substantial differences for suspended blood samples (i.e., hardened red blood cells, different concentration of dextran solution and fibrinogen). In conclusion, the present method can detect variations of blood sample under continuous ESR effectively.

In this paper, we tackle air quality forecasting by using machine learning approaches to predict the hourly concentration of air pollutants (e.g., Ozone, PM_2.5 and Sulfur Dioxide). Machine learning, as one of the most popular techniques, is able to efficiently train a model on big data by using large-scale optimization algorithms. Although there exists some works applying machine learning to air quality prediction, most of the prior studies are restricted to small scale data and simply train standard regression models (linear or non-linear) to predict the hourly air pollution concentration. In this work, we propose refined models to predict the hourly air pollution concentration based on meteorological data of previous days by formulating the prediction of 24 hours as a multi-task learning problem. It enables us to select a good model with different regularization techniques. We propose a useful regularization by enforcing the prediction models of consecutive hours to be close to each other, and compare with several typical regularizations for multi-task learning including standard Frobenius norm regularization, nuclear norm regularization, ℓ_2,1 norm regularization. Our experiments show the proposed formulations and regularization achieve better performance than existing standard regression models and existing regularizations.

Searching over a sorted list is a classical problem in computer science. Binary Search takes at most log2n+1 tries to find an item in a sorted list of size n. Interpolation Search achieves an average time complexity of Ο(loglogn) for uniformly distributed data. Hybrids of Binary Search and Interpolation Search are also available to handle data with unknown distributions. This paper analyzes the computation cost of these methods and shows that interpolation can significantly affect their performance — accordingly, a new method, Interpolation Once Binary Search (IOBS), is proposed. The experimental results show that IOBS outperforms the hybrids of Binary Search and Interpolation Search for nonuniformly distributed data.

Mathematics first is a logical system. But, the Mathematics Crisis showed that we cannot have a logical self-consistent mathematics system. Physics is a kind of applied science. It first need be valid to invent new production and understand new observation. In one theory of physics, the studied object is usually defined as an abstract concept. For example, the Sun is defined as a point particle in the Newtonian theory of gravity. In different theories of physics, the abstract concept for a same object is different. It determines that logical self-consistent is not needed for different theories of physics. Physics only can be developed from observation and experiment. But, in the past a century, physicists’ main attempt is to have a standard model, such as the Grand Unification or the Theory for Everything, from mathematics derivation. Therefore, the current attempt to develop new physics is questioned. In recent, the strong gravitational field was studied. It is found that the fundamental physical constants which are measured in the weak field shall be varied in a super strong field. For the two reasons, modern physics need be advanced greatly.

Smart City has emerged as the mainstream paradigm for urban governance innovation, sustainable development, and strategy upgrades, which is drawing attention from scholars worldwide. However, current frameworks for Smart City assessment remain incomplete and simplistic. In is paper, 30 national or provincial capitals in China were selected and we designed a tri-dimensional SPI model—Social, Physical, and Information Space—for smart city spatial development assessment. Utilizing methods such as entropy weighting, coupled coordination degree models, and the Dagum Gini coefficient, this study assesses the spatial development and coupled coordination of 30 cities from 2011 to 2019. Finally, by means of BP neural networks, the study examines the contribution of each indicator to the spatial coupled coordination. The results indicated that with a narrowing disparity in development speeds among different regions, the spatial coupled coordination development level of smart capitals in China has steadily increased, presenting a pattern of staggered distribution. Moreover, the IS subsystem plays the most significant role in coupled coordination. The significance of this research lies in its tri-dimensional spatial perspective of the spatial development and coupled coordination differences of the Smart City, providing evidence-based support for the regional layout and optimization in China.

The surface velocity of the Amery Ice Shelf (AIS) is vital to assessing its stability and mass balance. Previous studies have shown that the AIS basin has a stable multi-year average surface velocity. However, spatiotemporal variations in the surface velocity of the AIS and the underlying physical mechanism remain poorly understood. This study combined offset tracking and DInSAR methods to extract the monthly average surface velocity of the AIS and obtained the inter-annual surface velocity from the ITS_LIVE product. An uneven spatial distribution in inter-annual variation of the surface velocity was observed between 2000–2022, although the magnitude of variation was small at less than 20.5 m/yr. The increase and decrease in surface velocity on the eastern and western-central sides of the AIS, respectively, could be attributed to the change in the thickness of the AIS. There was clear seasonal variation in monthly average surface velocity at the eastern side of the AIS between 2017–2021, which could be attributed to variations in the area and thickness of fast-ice and also to variations in ocean temperature. This study suggested that changes in fast-ice and ocean temperature are the main factors driving spatiotemporal variation in the surface velocity of the AIS.

Abstract：Objective: To compare the effects of fermentation on the chemical composition of Gastrodia Tuder Halimasch Powder, and to provide a basis for the processing, processing and clinical application of this medicinal material. Methods: UHPLC-Q-Orbitrap HRMS was used to identify compound structure by comparing excimer ions, characteristic fragment ions and reference substances, and referring to relevant literature and database search. The main differential components were screened by orthogonal partial least squares-discriminant analysis (OPLS-DA), and the differential components were quantitatively studied by high performance liquid chromatography, and the differences in the types and contents of chemical components before and after fermentation were compared. Results: A total of 77 compounds were identified or preliminarily derived after fermentation, including 21 terpenes, 18 organic acids, 9 flavonoids, 7 nucleosides, 6 amides, 4 amino acids, 2 pyrrolidone derivatives, 2 sterols, 2 alkaloids and 6 others.Through high performance liquid chromatography, it was found that the content of daidzein genistein and ergosterol was significantly increased after fermentation, and a new component ergosterol was produced. Compared with Gastrodia Tuder Halimasch Powder before fermentation, the content of genistin and other components was significantly reduced, and there may be a process of genistin conversion to genistein.Conclusion: The fermentation process will have a certain influence on the types and contents of the chemical components of Gastrodia Tuder Halimasch Powder, and ergosterol, genistein and .daidzein may be the main pharmacodynamic components, which can provide a useful reference for the clinical rational application, quality control and mechanism of action of Gastrodia Tuder Halimasch Powder.

Estimating the ocean’s subsurface thermohaline information from satellite measurements is essential for understanding ocean dynamics and El Niño phenomenon. This paper proposes an improved double-output Residual Neural Network (DO-ResNet) model to concurrently estimate the ocean subsurface temperature (OST) and ocean subsurface salinity (OSS) in the tropical Western Pacific using multi-source remote sensing data, including sea surface temperature (SST), sea surface salinity (SSS), sea surface height anomaly(SSHA), sea surface wind (SSW), and geographical information (including longitude (LON) and latitude (LAT)). In the model experiment, Argo data were used to train and validate the model, and the root mean square error (RMSE), normalized root mean square error (NRMSE) and coefficient of determination (R²) were employed to evaluate the model's performance. The results showed that the sea surface parameters selected in this study have a positive effect on the estimation process, and the average RMSE and R² values for estimating OST (OSS) by the proposed model are 0.34 °C (0.05 psu) and 0.91 (0.95), respectively. Under the data conditions considered in this study, DO-ResNet demonstrates superior performance relative to the extreme gradient boosting model, random forest model, and artificial neural network model. Additionally, this study evaluates the model’s accuracy by comparing its estimations of OST and OSS across different depths with Argo-derived data, demonstrating the model's ability to effectively capture the most spatial features, and by comparing NRMSE across different depths and seasons, the model displays strong seasonal adaptability. In conclusion, this research introduces a novel artificial intelligence technique for estimating OST and OSS in the tropical Western Pacific Ocean.

Chemical flooding methods are used to recover the remaining oil after water flooding, and surfactant-polymer (SP) flooding is an important chemical flooding technology. It is of great significance to design and screen high-performance oil displacement agents in order to overcome the increasingly challenging high temperature (&gt;70 ℃) and high salinity (>10,000 mg/L) reservoirs. Based on the characteristics of high temperature (70 ℃) and high salinity (151,000 mg/L) in the Qinghai Gasi reservoir, the performance of the SP flooding system was studied. This study considered interfacial tension, emulsification, viscosity, compatibility, and oil displacement efficiency. The selected formula demonstrated high resistance to both salinity (151,000 mg/L) and temperature (70 ℃), characterized by a low oil-water interfacial tension (10-2 mN/m) and high viscosity (18.13 mPa.s). After water flooding achieved an oil recovery rate of 64.64%, the subsequent replacement rate of crude oil increased by 26.95%, confirming that SP flooding can be used as a technology for enhancing oil recovery in high-temperature, high-salinity reservoirs represented by Qinghai Gasi reservoirs.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

The multidrug resistance transporter NorM is an important drug resistance pump and plays a critical role in multidrug resistance in bacteria and mammals. In this study we carried out molecular dynamics simulation to study the mechanism of Na+ binding and dynamical structures of two long loops in the substrate-releasing process in substrate binding NorM. Our simulation study identified several key residues (D41, E261 D377) along the Na+ binding pathway and a multi-state ion-binding mechanism is proposed based on the simulation study. In this proposed model, the transport of Na+ is a multi-stage process with D41 being the first station for binding to Na+, followed by Na+ binding to the second station E262 and finally to the cation-binding site of E262 and D377. During the transport of Na+, the transmembrane components TM1, TM7 and TM2 are rearranged to facilitate the ion transport as well conformational changes of NorM to a closed state. Further, substrate-bound simulation revealed that Loop3-4 and Loop9-10 control the substrate-releasing process.

In February 2004, the Food and Drug Administration (FDA) was the first to approve the combination of cisplatin (CDDP) and pemetrexed (PEM) as standard first-line chemotherapy for untreated, unresectable malignant pleural mesothelioma (MPM). However, after that approval, no progress was made in the standard first-line treatment of MPM for almost 15 years. Positive results from a phase 3 study (Mesothelioma Avastin Cisplatin Pemetrexed Study: MAPS) verifying the effect of bevacizumab, an anti-angiogenesis agent added to CDDP/PEM for unresectable MPM, were published in The Lancet in December 2015; however, this did not lead to approval by national drug regulatory agencies. Furthermore, no second-line treatment was established for cases refractory to CDDP/PEM. In August 2018, the Pharmaceuticals and Medical Devices Agency of Japan was the first in the world to approve monotherapy with nivolumab, an immune checkpoint inhibitor (ICI), for previously unresectable, advanced, or recurrent MPM. Following Japan, in October 2020, the FDA approved the combination of nivolumab and ipilimumab for the treatment of previously untreated, unresectable MPM. In this article, we review the transition of drug treatment for MPM, in light of the historical background, focusing on the benefits of ICIs.

Flap surgery is a common method used to cover defects following tumor ablation, trauma, or infection. However, insufficient vascularity in the transferred flap can lead to flap necrosis and failure. Proper postoperative monitoring is essential to prevent these complications. Recently, research has explored the use of infrared thermal imaging in plastic surgery, leading to its clinical application. This study investigates the use of a forward-looking infrared (FLIR) camera to monitor blood flow in flaps. In the study, 28 rats underwent reverse McFarlane flap surgery, and their flaps were analyzed using a FLIR thermal imaging camera seven days post-surgery. Additionally, thermal images of flaps were taken on postoperative days 0, 1, 2, 3, and 7 in 22 patients. The study focused on temperature differences between normal skin and the perforator compared to the average flap temperature. Results showed that the temperature difference was higher in the necrosis group and increased over time in cases of total necrosis. A lower perforator temperature compared to the flap's average indicated vascular compromise, potentially leading to flap failure. The FLIR camera, being contact-free and convenient, shows promise for understanding and inferring the clinical progression of flaps in postoperative monitoring.

In this study, a three-dimensional bioelectrochemical reactor system (3D-BERs) with granular activated carbon (GAC) epitomizes a novel treatment technology for treating nitrate-polluted water. The conventional denitrification process faces many challenges, including the huge demand for organic carbon, long-term accumulation of intermediate products, and the adaptation period. Results shown that under the optimal conditions of the COD/NO3--N ratio was 1.5, the denitrification efficiency reached 98.62%, when compared to 81.12% at COD/ NO3--N ratio of 3.5, and the initial pH of 7.5 ± 0.5, NO3--N was entirely removed at 2.2 h without accumulation of nitrite. The high initial ratio of NO2--N/NO3--N is mainly to accelerate the denitrification rate by accelerating the reduction of nitrite. Denitrification process followed by zero-order kinetics linear model for at different concentrations of inlet NO3--N, and achieved higher denitrification rate at greater inlet NO3--N concentration. High-throughput sequencing shows that the community structure and relative abundance of bacteria changed significantly, especially at the genes and the phyla level in immobilized GAC particles. Microbial composition enhanced the removal of nitrogen at the inner surface (IS) and bottom surface (BS) of immobilized GAC carriers. Therefore, this system is expected to be a more efficient and useful supplement or a cost-effective alternative compared to the traditional low carbon to nitrogen wastewater treatment system.

Currently, the number of lightning casualties and casualty rates have significantly reduced in developed countries, but there has been no significant reduction in developing countries. On the one hand, this is due to the high frequency of lightning; on the other hand, the vulnerability of people in developing countries is also an influencing factor. Through case analysis and summary, this paper expounds on lightning injury’s mechanism and clinical manifestations. It points out that lightning injury is mainly related to heart problems and the impact on the nervous system, rather than burns, which usually cause fewer consequences. Medical treatment needs to pay attention to the order and principles of treatment. Implementing CPR and auxiliary AED is the most effective way to save lives. Attention should be paid to the practical and effective treatment and nursing of lightning stroke sequelae. Finally, combined with the situation of lightning casualties in china, the existing problems are put forward during the process of early treatment, post-hospital treatment, and nursing observation, which provides an objective basis for the cognition of the scientific nature of the lightning injury.

Flexible implementations of Monte Carlo Tree Search (MCTS), combined with domain specific knowledge and hybridization with other search algorithms, can be a very powerful for the solution of problems in complex planning. We introduce mctreesearch4j, a standard MCTS implementation written as a standard JVM library following key design principles of object oriented programming. We define key class abstractions allowing the MCTS library to flexibly adapt to any well defined Markov Decision Process or turn-based adversarial game. Furthermore, our library is designed to be modular and extensible, utilizing class inheritance and generic typing to standardize custom algorithm definitions. We demon- strate that the design of the MCTS implementation provides ease of adaptation for unique heuristics and customization across varying Markov Decision Process (MDP) domains. In addition, the implementation is reasonably performant and accurate for standard MDP’s. In addition, via the implementation of mctreesearch4j, the nuances of different types of MCTS algorithms are discussed.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

One new cassane diterpene possessing an unusual N bridge between C-19 and C-20 named caesalsappanin R (1), as well as another new diterpene caesalsappanin S (2), were isolated from the seeds of Caesalpinia sappan with methanol extract. Their structures were determined by spectroscopic analysis and examined alongside existing data from prior studies. Their biological activities were profiled by their antiplasmodial activity.

YOLOv8, as an efficient object detection method, can swiftly and precisely identify objects within images. However, traditional algorithms encounter difficulties when detecting small targets in remote sensing images, such as missing information, background noise, and interactions among multiple objects in complex scenes, which may affect performance. To tackle these challenges, we propose an enhanced algorithm optimized for detecting small objects in remote sensing images, named HP-YOLOv8. Firstly, we design the C2f-D-Mixer (C2f-DM) module as a replacement for the original C2f module. This module integrates both local and global information, significantly improving the ability to detect features of small objects. Secondly, we introduce a feature fusion technique based on attention mechanisms, named Bi-Level Routing Attention in Gated Feature Pyramid Network (BGFPN). This technique utilizes an efficient feature aggregation network and reparameterization technology to optimize information interaction between different scale feature maps, and through the Bi-level Routing Attention (BRA) mechanism, it effectively captures critical feature information of small target objects. Finally, we propose the Smooth Mean Perpendicular Distance Intersection over Union (SMPDIoU) loss function. The method comprehensively considers the shape and size of detection boxes, enhances the model's focus on the attributes of detection boxes and provides a more accurate bounding box regression loss calculation method. To demonstrate our approach's efficacy, we conduct comprehensive experiments across the RSOD, NWPU VHR-10, and VisDrone2019 datasets. The experimental results show that the HP-YOLOv8 achieves 95.11%, 93.05%, and 53.49% in the [email protected] metric, and 72.03%, 65.37%, and 38.91% in the more stringent [email protected]:0.95 metric, respectively.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

In order to better realize rural revitalization, this paper analyzes the spatial and temporal char-acteristics and influencing factors of agricultural surface source pollution in the Yangtze River Economic Belt from the three perspectives of government, enterprise and agriculture by using the spatial Durbin model and the dynamic GMM method in the period of 2006-2021, and further re-searches the threshold characteristics of the distortion of the factor market on the agricultural surface source pollution under the different strengths of environmental regulation. The results show that there is a positive spatial correlation between agricultural surface pollution in the Yangtze River Economic Belt, and government environmental regulation, input factor market distortion and labor force transfer all have a significant impact on agricultural surface pollution. Among them, factor market distortion has a significant spatial spillover effect on agricultural surface pollution in the Yangtze River Economic Zone, and has a significant single-threshold ef-fect on environmental regulation. Accordingly, the government should strengthen environmental regulation, continuously improve the agricultural factor market mechanism, and pay attention to the construction of talents to provide support for rural revitalization.

The high prevalence of human papillomavirus (HPV) infection in oropharyngeal squamous cell carcinoma (OPSCC) is well-established, with p16 expression being a strong predictor. HPV-related tumors exhibit unique mechanisms targeting p16 and p53 proteins. However, re-search on HPV prevalence and the combined predictive value of p16 and p53 expression in head and neck cutaneous squamous cell carcinomas (HNCSCC), especially in Asian populations, is limited. This retrospective study surveyed 62 HNCSCC patients (2011–2020), excluding those with facial warts or other skin cancers. All patients underwent wide excision and biopsy. Immuno-histochemical staining for HPV, p16, and p53 yielded both positive and negative results. The relevance of each marker was investigated by categorizing the tumor locations into high-risk (Area H) and mid-risk (Area M) zones based on recurrence frequency. Of the 62 patients, 20 (32.26%) were male, with an average age of 82.27 years (26–103). Area H included 19 cases (30.65%), with the eyelid and lip being the most common sites (five cases, 8.06%). Area M in-cluded 43 cases (69.35%), with the cheek being the most common site (29 cases, 46.77%). p16 ex-pression was positive in 24 patients (38.71%), p53 expression in 42 patients (72.58%), and HPV in five patients (8.06%). No significant association was found between p16 expression and HPV presence (p > 0.99), with a positive predictive value of 8.33%. This indicates that p16, a surrogate marker of HPV in OPSCC, is not a reliable marker for HPV in HNCSCC. This study enhances our understanding of the relationship between HPV, p53, and p16 in HNCSCC in Asian populations and offers valuable insights for further research.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

Although promoting healthy eating is a policy objective, the controllability of dietary habits remains uncertain. The personal dietary patterns reflect many factors, of which some are relatively controllable for individual, and others are not. In this article, assuming that some sort of information about controllability of dietary habits is contained in the observed pattern of food consumptions, we focused on dietary pattern on its own. We introduced a statistical descriptive model for data on food frequency questionnaire, estimated strength of pairwise linkage between foodstuffs, and grouped foodstuffs by applying community detection to the networks of the estimated inter-food linkages. Those linkages represent co-movement of pairs of foods consumption. Furthermore, we demonstrated an analysis on the relationship between health of mind and dietary habits considering the aspect of controllability of dietary habits. Using an observational study in Japan, we obtained the following results: 115 foodstuffs were divided into 3 groups for both of genders, but the compositions were different by gender; in the analysis of mental health, some stress response items were associated with the dependence on some of those food groupings. As the grouping of foodstuffs based on our estimation depicted the internal structure of dietary habit that a healthy eating policy should regard as constraint, it follows that we should design the policy along the line with that grouping.

The Mara River basin (MRB) has a world-famous ecosystem, but the vegetation has been damaged due to economic development in recent years, and there is little known about the area that will experience severe vegetation damage in the future. Based on the vegetation vulnerability system, principal component analysis, and three CMIP6 scenarios (SSP1-2.6, SSP2-4.5, SSP5-8.5), vegetation vulnerability was calculated in the base period (2010-2019), near-term period (2020-2059) and long-term period (2060-2099) in the MRB. The spatial cluster of vegetation vulnerability was revealed by spatial correlation analysis, and the transition of vegetation vulnerability of different periods was analyzed by stochastic matrix. The results showed that in all periods, the vulnerability showed a high-high cluster in the east, and a low-low cluster midstream and downstream. From the stochastic matrix, the area of high vulnerability increased the least under the SSP1-2.6, while it increased the most under the SSP5-8.5. The vegetation vulnerability upstream increased the most from the base period to the near-term period and long-term period in the MRB. By comparing the vegetation vulnerability under different scenarios, and pointing out the areas with the highest vulnerability increase, this study can better provide comprehensive decision-making for vegetation protection in the MRB.

Evans' Syndrome (ES) is a rare autoimmune disorder characterized by the simultaneous occurrence of immune thrombocytopenia (ITP) and autoimmune hemolytic anemia (AIHA). Thrombotic complications in ES patients are uncommon, particularly involving Buerger's Disease (BD). We report a case of a 49-year-old male with ES and a history of diabetes and heavy smoking, presenting with a necrotic wound on his right great toe. Diagnostic evaluations revealed severe stenosis and thrombosis in the lower limb arteries, diagnosed as BD. The patient underwent successful popliteal-tibioperoneal artery bypass surgery and subsequent disarticulation and revision of the distal phalanx, followed by the application of an acellular dermal matrix (ADM) to promote healing. Post-surgery, the patient showed significant improvement in blood flow and complete epithelialization without complications. This case highlights the importance of a multidisciplinary approach in managing complex wounds in ES patients, suggesting potential treatment pathways for future cases involving BD

Oleuropein, glycosylated secoiridoid present in the olive leaves, is known as an important antioxidant phenolic compound. We studied the antioxidant effect of low dose of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggest that growth arrest and cell dead of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects myogenesis of C2C12 cells; because the MyoD mRNA levels and the differentiation process are restored after treatment with 3,4-DHPEA-EA(P). Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process by functioning as an efficient antioxidant.

The new observations, including the fastest star, the circular velocity curve of the Milky Way and the fast galaxy bar, should imply that the mass of the center of the Milky Way is almost 10¹¹ times the mass of the Sun.

The purpose of this study is to examine the relationship between the institutional investors which can affect financial performance for corporate sustainability on the income smoothing. Therefore, this study focus on the connection between the nature of stock rights and income smoothing in China. For this study, hypotheses were established on the relationship each state-controlled companies, income smoothing, and information equilibrium of individual investors, and empirical analysis was conducted through related variables. The analysis results are summarized in three categories as follows. First, this research finds that state-controlled firms (CONTs) prefer income smoothing activities compared to non-state-controlled firms for the long-term sustainable development of firms using data from 2011 to 2019. Second, this study found out that Institutional investors support the behavior of CONTs to smooth their earnings because this behavior is seen as an attempt by CONTs to convey valuable private information to other investors. Third, we was able to discover that institutional investors' monitoring effect is predominantly driven by pressure-resistant institutional investors. This research complements the lack of empirical research on income smoothing and enable to give a guideline that the type of stock rights is a critical key determinant of participation in income smoothing activities for stable growth and sustainability in the future.

The Double U-pipe ground heat exchanger, recognized for its straightforward process, cost-effectiveness, high heat exchange efficiency, and low thermal resistance, stands as the predominant ground heat exchanger type in today's shallow geothermal energy development and utilization. Recent years have seen significant research into the heat transfer influencing factors and heat exchange performance of Double U-pipe ground heat ex-changers via experimental testing methods. Yet, studies integrating numerical simulation with in-situ testing have been less frequent. Drawing on the cylindrical heat source model theory and the outcomes of regional in-situ thermal response tests, this paper develops a Double U-pipe ground heat transfer model by establishing physical, mathematical, and heat transfer geometric models. It assesses the impact of varying inlet temperatures, flow rates, and initial ground temperatures on heat exchange efficiency under heating conditions. The results validate the precision of the double U-pipe ground heat exchanger model based on in-situ testing. They show that enhancing the temperature differential between the inlet and initial temperatures, elevating the initial ground temperature, and moderately increasing the flow rate can boost the system's heat exchange efficiency.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

This paper mainly used database technology, machine learning, thermodynamic calculation, experimental verification, etc., on integrated computational materials engineering. The interaction between different alloying elements and the strengthening effect of precipitated phases are investigated mainly for martensitic ageing steels. Modelling and parameter optimization were performed by machine learning, and the highest prediction accuracy was 98.58%. Investigated the influence of composition fluctuation on performance and correlation tests to analyze the influence of elements from multiple perspectives. Furthermore, screen out the three-component composition process parameters with composition and performance with high contrast. Thermodynamic calculations studied the effect of alloying element content on the nano-precipitation phase, Laves phase, and austenite in the material. The heat treatment process parameters of the new steel grade were also developed based on the phase diagram. A new type of martensitic ageing steel was prepared by selected vacuum arc melting. The sample with the highest overall mechanical properties had a yield strength of 1887 MPa, a tensile strength of 1907 MPa, and a hardness of 58 HRC. The sample with the highest plasticity had an elongation of 7.8%. The machine learning process for the accelerated design of new ultra-high tensile steels was found to be generalizable and reliable.

In this paper, we define the cohomology of a modified $\lambda$-differential left-symmetric algebra with coefficients in a suitable representation. We also introduce the notion of modified $\lambda$-differential left-symmetric 2-algebra. We classify linear deformations and abelian extensions of modified $\lambda$-differential left-symmetric algebras using the second cohomology group and classify skeletal modified $\lambda$-differential left-symmetric 2-algebra using the third cohomology group as our propose cohomology applications. Moreover, we prove that strict modified $\lambda$-differential left-symmetric 2-algebras are equivalent to crossed modules of modified $\lambda$-differential left-symmetric algebras.