Detection of the region of interest (ROI) is a critical step in laryngeal image analysis for the delineation of glottis contour. The process can improve both computational efficiency and accuracy of the image segmentation task, which will facilitate subsequent analysis and characterization of the vocal fold vibration as it correlates with voice quality and pathology. This study aims to develop machine learning based approaches for automatic detection of ROI for glottis image sequences captured by high-speed video-endoscopy (HSV), a clinical laryngeal imaging modality. In particular, we first applied the supporting vector machine (SVM) method using histogram of oriented gradients (HOG) feature descriptor, and second, trained a convolutional neural network (CNN) model for this task. Comparisons are made for both approaches in terms of accuracy of recognition and computation time.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

Evaluating soil quality across various altitudinal gradients, both with and without vegetative cover, is crucial for the proper functioning of soil and optimal crop growth, thereby contributing to the sustainability of agroecosystems. Although the altitudinal gradient significantly influences soil quality, the ability to predict this quality, expressed through an index, in soils with and without vegetative cover, is still insufficiently explored. This study aimed to assess soil quality in the Jun Jun micro-watershed, located in the Tungurahua region, Ecuador. To achieve this objective, three categories of altitudinal gradients were selected: less than 2800 meters above sea level (masl), between 2800 and 2900 masl, and greater than 2900 masl. A total of 24 soil samples were collected in the mentioned gradients, considering both areas with and without vegetative cover. The indicators used included chemical and biological parameters such as soil organic carbon (OC), earthworm density (WD), earthworm biomass (WB), organic matter (OM), pH, total nitrogen (TN), and organic carbon (OC). The results revealed that in areas with altitudinal gradients below 2800 masl, soil quality index values were higher compared to other altitudes. In vegetated areas, a decrease in index values was observed as the altitudinal gradient increased, indicating a deterioration in soil quality with altitude. These findings are significant in providing a quantitative assessment of the effects of altitudinal gradient and vegetative cover influence on soil quality.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

Accretionary and collisional orogeny are often accompanied by the disturbance of the geothermal gradient, leading to high-temperature metamorphism. High-temperature metamorphic rocks are significant in their ability to help the reconstruction of the thermal histories of orogenic belts. The Tianshan Orogenic Belt, at the southwest margin of the Central Asian Orogenic Belt, is a record of the long-term subduction–collision–post-collision orogenic process that has taken place in the Phanerozoic Eon. Here, we report the discovery of mafic granulites in the Muzhaerte area, SW Tianshan. Petrographic observation reveals that the mafic granulites underwent two metamorphic stages. The peak mineral assemblages of the first stage are dominated by clinopyroxene + orthopyroxene + plagioclase + quartz + hornblende ± biotite, and the post-peak mineral assemblages of the second stage are dominated by clinopyroxene + plagioclase + quartz + amphibole + biotite. The calculated results obtained from the two-pyroxene thermobarometers and the Al-in-hornblende barometer for the mafic granulites indicate that the metamorphic conditions of mafic granulites are 760–860 ℃ and < 0.39–0.41 Gpa. The mafic granulites recorded a high-grade granulite facies thermal metamorphic event with the highest temperature limit currently recorded in the Central Tianshan Block.

Determining accurate PM2.5 pollution concentrations and understanding their dynamic patterns is crucial for scientifically informed air pollution control strategies. Traditional reliance on linear correlation coefficients for ascertaining PM2.5 related factors only uncovers superficial relationships. Moreover, the invariance of conventional prediction models restricts their accuracy. To enhance the precision of PM2.5 concentration prediction, this study introduces a novel integrated model that leverages feature selection and a clustering algorithm. Comprising three components - feature selection, clustering, and integrated prediction, the model first employs the non-dominated sorting Genetic Algorithm (NSGA-III) to identify the most impactful features affecting PM2.5 concentration within air pollutants and meteorological factors. This step offers more valuable feature data for subsequent modules. The model then adopts a two-layer clustering method (SOM+K-means) to analyze the multifaceted irregularity within the dataset. Finally, the model establishes the Extreme Learning Machine (ELM) weak learner for each classification, integrating multiple weak learners using the Adaboost algorithm to obtain a comprehensive prediction model. Through feature correlation enhancement, data irregularity exploration, and model adaptability improvement, the proposed model significantly enhances the overall prediction performance. Data sourced from 12 Beijing-based monitoring sites in 2016 were utilized for an empirical study, and the model's results compared with five other predictive models. The outcomes demonstrate that the proposed model significantly heightens prediction accuracy, offering useful insights and potential for broadened application to multifactor correlation concentration prediction methodologies for other pollutants.

Chalcones are a class of flavonoids possessing a variety of biological activities, including antimicrobial and antioxidant effects. Therefore, chalcones and their derivatives have potential use in the control of postharvest diseases. In this work, the effects of 2ʹ,4ʹ-dichloro-chalcone on the in vitro growth and in vivo pathogenicity of F. tricinctum and T. roseum were investigated. The results showed that 100 µM of 2ʹ,4ʹ-dichloro-chalcone strongly inhibited mycelial growth and conidial production of F. tricinctum (32.3%) and T. roseum (65.2%) in vitro. This treatment also significantly inhibited the expansion of potato dry rot from F. tricinctum (48.6%) and apple rot spot from T. roseum (36.2%). The incubation of F. tricinctum and T. roseum conidia with this agent for 2 h increased their cell membrane permeability by 25% and 22.5%, respectively and conidial membrane permeability by 41.7 and 65.4%, respectively. This treatment also significantly inhibited the total respiration rate and activated the cyanide-resistant respiratory pathway in both pathogens. Protein immunoblotting showed that the treatment increased alternative oxidase (AOX) levels after 4 h in F. tricinctum and T. roseum by 52.76% and 39.13%, respectively. Conclusion: 100 µM 2ʹ,4ʹ-dichloro-chalcone significantly inhibited mycelial growth and spore production in F. tricinctum and T. roseum in vitro and reduced their pathogenicity in postharvest potato and apple crops. Further analysis indicated that 2ʹ,4ʹ-dichloro-chalcone disrupted the integrity of cell membranes and the mitochondrial respiratory electron transport chain which leaded to ROS burst and oxidative stress, AOXs were induced directly or indirectly, and the cyanide resistant respiratory pathway was activated. The in vitro growth and pathogenicity of F. tricinctum and T. roseum were inhibited.

The model proposed in this study was based on the assumption that the biomass attached to the anode served as biocatalysts for MFC exoelectrogenesis, and this catalytic effect was quantified by the exchange current density of anode. By modifying the Freter model and combining it with the Butler-Volmer equation, this model could adequately describe the processes of electricity generation, substrate utilization, and the suspended and attached biomass concentrations, at both batch and continuous operating modes. MFC performance is affected by the operating variables such as initial substrate concentration, external resistor, influent substrate concentration, and dilution rate, and these variables were revealed to have complex interactions by data simulation. The external power generation and energy efficiency were considered as indices for MFC performance. The simulated results explained that an intermediate initial substrate concentration (about 100 mg/L under this reactor configuration) needed to be chosen to achieve maximum overall energy efficiency from substrate in the batch mode. An external resistor with the value about that of the internal resistance boosted the power generation, and a resistor with several times of that of the internal resistance achieved better overall energy efficiency. At continuous mode, dilution rate significantly impacted the steady-state substrate concentration level (thus substrate removal efficiency and rate), and attached biomass could be fully developed when the influent substrate concentration was equal to or higher than 100 mg/L at any dilution rate of the tested range. Overall, this relatively simple model provided a convenient way for evaluating and optimizing the performance of MFC reactors by regulating operating parameters.

Potato tubers are susceptible to wounding during post-harvest processes, leading to quality decline, perishability and large economic losses. In this study, the potato cultivar, ‘Longshu No.7’, was foliar-sprayed with 3% chitosan (w/v) three times during the pre-harvest period after flowering to evaluate the effect of foliar spraying with chitosan on suberization processing at wounds of harvested potato tubers. Our results demonstrate that foliar-sprayed with chitosan significantly reduced wound-induced fresh weight loss and dry rot disease index by 37.34% and 41.60% on the 28 day after wounding, respectively. Foliar-sprayed with chitosan accelerated the deposition of suberin polyphenolics and lignin at the wound sites of potato tubers with the formation of thicker cell layers. This occurred with increased localized activities of key enzymes in the suberin polyphenolics and lignin pathways, including phenylalanine ammonia lyase, 4-coumaryl-coenzyme A ligase, cinnamyl alcohol dehydrogenase and peroxidase (33.90–64.32%), as well as the contents of cinnamic acid, sinapic acid, flavonoids, lignins and total phenolics (19.70–23.46%) at wound sites of potato tubers on the 7 day after wounding. Our results indicated that foliar application of chitosan accelerated wound-induced suberization of potato tubers and could mitigate post-harvest product damages.

Applied talent is not only a builder of human civilization but also a promoter of economic development. They not only need systematic and solid engineering theoretical knowledge but also rich engineering practical experience. Applied undergraduate colleges are the cradle for cultivating applied talent and shoulder the important mission of cultivating various types of applied talent for society. With the rapid development of higher education, the number of applied undergraduate institutions has sharply increased, but the quality of applied talent cultivated by them has shown a significant decline, which greatly restricts the pace of industrial development in the world. This article proposes a new concept of promoting the "three certificates" (graduation certificate, degree certificate, and skill certificate) education model in applied undergraduate colleges, which is of great significance for the country to cultivate composite talents with the ability of "product design, production management, and product processing" at the same time.

Li-rich layered oxide cathode materials have become one of the most promising cathode materials for high-energy-density lithium-ion batteries owning to its high theoretical specific capacity, low cost, high operating voltage and environmental friendliness. Yet they suffer from severe capacity and voltage attenuation during prolong cycling, which blocks their commercial application. To clarify these causes, we synthesize 0.5Li2MnO3·0.5LiNi0.8Co0.1Mn0.1O2 (LL-811) with high-nickel-content cathode material by a solid-sate complexation method, and it manifests a lot slower capacity and voltage attenuation during prolong cycling compared to LL-111 and LL-523 cathode materials. The capacity retention at 1C after 100 cycles reaches to 87.5% and the voltage attenuation after 100 cycles is only 0.460 V. Combining X-ray diffraction (XRD), scanning electron microscope (SEM) and transmission electron microscopy (TEM), it indicates that increasing the nickel content not only stabilizes the structure but also alleviates the attenuation of capacity and voltage. Therefore, it provides a new idea for designing of Li-rich layered oxide cathode materials that suppress voltage and capacity attenuation.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

The rapid development of 2019-2020 Wuhan seafood market pneumonia currently posed a major public health concern in China. Genome sequencing identified a novel beta-coronavirus closely related to SARS-CoV, named 2019-nCoV by WHO, as the cause of this pandemic disease. Viruses with single stranded RNA genome are prone to evolve quickly by accumulation of mutations, such as SNV, INDEL and cross viral recombination, aiding fast transmission among hosts and cross species. Here we collected related genome sequences and investigated variations shared by different strains of 2019-nCoV, identified reoccurrence of SNV mutations in clusters of patients, an indication of rapid evolution of 2019-nCoV at the transmission from animal host to human. The information collected herein would help to understand the dynamics of current pandemic.

The separation and enrichment can be targeted to enrich the rare and precious metals in fly ash and reduce the cost of leaching and recovering of fly ash. Regarding their different properties, the single-component separation was used to obtain uncompleted burned carbon, glass microbeads, minerals, and other characteristic components from the ash. Also, the mineral composition of each component was analyzed by electron microscopy. The metal minerals were mainly concentrated in the mineral components. Besides, the electron probe micro-analysis shows that the Pt content in the minerals of fly ash was significantly correlated with the metal contents of Ni and Cu. After the obtainment of the characteristics of fly ash metal enrichment, the heavy minerals with Cu, Ni, Pt, Pd, and other target metal elements were enriched by gravity separation and flotation. The enrichment coefficients of Cu, Ni, Pt, and Pd were 1.45, 1.33, 1.90 and 1.60, respectively, and the recovery rates were 77%, 81%, 97% and 88% respectively. Since the yield of heavy minerals obtained by separation was 62.24%, it indicated the physical separation method could significantly reduce the cost of leaching and recovering of fly ash metal resources.

With the deterioration of the bridge performance and ever-increasing amount of traffic, the bridge safety is becoming a concern for engineering community. A method that can assess the bridge's condition in real-time is urgently needed. The main factors that hinder the bridge condition assessment are the uncertain operational environments. A new moving principal component analysis (MPCA) based method is developed for structural damage detection of bridges in operational environments in this paper. Two main operational environmental factors: the environmental temperature and traffic loads, are studied in the assessment process to verify the robustness and practicality of the proposed method. The numerical and experimental results show that the proposed method is effective and accurate to assess the bridge condition in operational environments.

A large body of research has examined people’s attitudes toward mandatory vaccination to cope with the COVID-19 pandemic. However, studies have yet to explore how Chinese people view the COVID-19 vaccine mandates, let alone placing such views in the country’s highly politicized context. On the other hand, facing the high pressure of loosening its zero-COVID policies amidst the worldwide practices of co-existing with the COVID-19 virus, the country has to improve its vaccination coverage quickly. In this situation, it is more than necessary to systematically investigate the Chinese public’s attitude to mandatory vaccination against the virus and the underlying determinants. The current study utilizes data from a national survey adopting quota sampling to analyze the Chinese public’s medical and non-medical considerations when judging compulsory COVID-19 vaccination. The study reveals that thanks to China’s successful lockdown policies, personal risk, and benefit perceptions did not dominate their views regarding vaccination mandates. Instead, conspiracy beliefs regarding the pandemic outbreaks, conspiratorial thinking, and nationalism more strongly predicted their willingness to accept mandatory vaccination. Given the potentially massive impacts of the COVID-19 infection, if China opens its door and loosens its strict quarantine restrictions, the Chinese public needs to be educated with more medically valuable and relevant information to improve their vaccination protection against COVID-19.

The connexin gene family is the most prevalent gene that contributes to hearing loss. Connexins 26 and 30, encoded by GJB2 and GJB6 respectively, are the most abundant expressed connexins in the inner ear. Connexin 43 which is encoded by GJA1 appears to be widely expressed in various organs, including the heart, skin, brain, and inner ear. The mutations that arise in GJB2, GJB6 and GJA1 can all result in comprehensive or non-comprehensive genetic deafness in newborns. As it is predicted that connexins include at least 20 isoforms in humans, the biosynthesis, structural composition, and degradation of connexins must be precisely regulated so that the gap junctions can operate properly. Certain mutations result in connexins possessing a faulty subcellular localization, failing to transport to the cell membrane and preventing gap junction formation, ultimately leading to connexin dysfunction and hearing loss. In this review, we provide a discussion of the transport models for connexin 43, connexins 30 and 26, mutations affecting trafficking pathways of connexin 26, the existing controversies in trafficking pathways of connexins, and the molecules involved in connexin trafficking and their functions. This review can contribute to a new way of understanding the etiological principles of connexin mutations and finding therapeutic strategies for hereditary deafness.

Tao and Ming (name) or Tao and Yan (language or speech) is an inseparable pair of important concepts in traditional Chinese language philosophy. In LaoTze’s opinion, Tao could not be spoken out, and language or speech could not reach Tao’s essence. Yan and Tao are separated from each other, and they are paradoxical. All the confusion derives from Yan regardless of how delicate they are. Tao can be expressed in words, but it will never be expressed through common languages. In this article, Tao is regarded as a human being’s thoughts or intentions and is even considered to be the origin of the real world. Language can express people’s thought, although it has some limitations. There exist some contradictions between the real word and the world expressed in words. To enable people to better understand the existence of the real world from multiple perspectives at the language or linguistic level without being constrained by words, this article studies LaoTze’s linguistic philosophy reflected in his opinion on the relationship between Tao and Yan and makes a comparative analysis of modern Western language philosophers’ stand on language (or speech) and existence.

Objective: Pancreatic carcinoma (PANC) is one of the important aggressive cancers, with deficiency in effective therapeutics. Studies have unveiled that miR-139-5p expression is significantly downregulated in other types of cancers. However, the functions and mechanisms of miR-139-5p in PANC remain unclear. Methods: Bioinformatic analysis was performed to analyze the differentially expressed genes in the TCGA database. PANC cell line with overexpressed miR-139-5p and Solute Carrier Family 7, Member 11 (SLC7A11) was established, and has been used to detect cell proliferation, migration, invasion and colony formation in PANC. Subsequently, bioinformatic analysis and luciferase assay were performed to confirm that SLC7A11 was a target gene of miR-139-5p. Xenograft mouse model was used to investigate the role of miR-139-5p in PANC tumorigenicity. Results: Through bioinformatic analysis, miR-139-5p was predicted to regulate phosphatidylinositol signaling pathway by targeting SLC7A11. MiR-139-5p was found to be lowly expressed in PANC tissues, while SLC7A11 was highly expressed. Low expression of miR-139-5p and high expression of SLC7A11 were positively associated with poor clinical outcomes. PANC cell proliferation, migration, and invasion could be inhibited by miR-139-5p overexpression and could be promoted by SLC7A11 overexpression. MiR-139-5p could regulate the protein expression level of PI3K and Akt associated with phosphatidylinositol signaling pathway could be by inhibiting the expression of SLC7A11. MiR-139-5p overexpression could suppress PANC tumor growth and the expression of SLC7A11, p-PI3K, p-Akt in tumor tissues. Therefore, the inhibiting effect of miR-139-5p to PANC cell proliferation, invasion and migration, at least, was partly due to its inhibiting effect on SLC7A11 expression. Conclusion: These results demonstrated a novel role of miR-139-5p/SLC7A11 in PANC and provided potential prognostic predictors for PANC patients.

Agricultural mechanization is an important factor to improve the green total factor productivity of planting industry, which is the key way to realize the sustainable development and high-quality development of agriculture. Based on the panel data of 30 provinces in China from 2001 to 2019, this paper uses the stochastic frontier analysis method of output oriented distance function to measure the green total factor productivity of China’s planting industry based on net carbon sink, and empirically studies the impact of agricultural mechanization on the green total factor productivity in China’s planting industry. The empirical analysis finds that mechanization can significantly promote the planting green total factor productivity, and this basic conclusion is still robust after using instrumental variables, sub sample regression. Further research found that the path of mechanization on planting green total factor productivity is mainly reflected in technology progress and spatial spillover. The mechanism of operation scale expansion, factor allocation optimization and technical efficiency change is not significant. Given these findings, the paper adds considerable value to the empirical literature and also provides various policy- and practical implications.

Forest-grass intercropping patterns of protected cultivation has been widely used to increase productivity and sustainability in modern agriculture. However, there have been few studies of wolfberry (L. barbarum) intercropping and it is cultivated mostly by clean tillage. This paper takes 10 kinds of wolfberry-forage intercropping patterns, compares the effects of different planting modes on the growth, yield, photosynthetic characteristics, nutritional quality, and the degree of occurrence of diseases and pests, which aims to make clear the effects of wolfberry-forage intercropping patterns on wolfberry. The results showed that different intercropping combinations had different effects on wolfberry. The overall effect of Wolfberry-forage intercropping patterns on the growth of wolfberry were promote the photosynthetic characteristics. Ryegrass could increase the branch number, Lvyuan 5 and mangel increase branch length; Mangel, clover, sweet sorghum, ryegrass and stipas could reduce the damage of powdery mildew by 69%, and alfalfa, stipa and ryegrass could reduce the occurrence of aphids by 67% (P<0.05). Intercropping could increase carotenoids, flavonoids and ascorbic acid contents to improve wolfberry quality by 21%, 53% and 127%, respectively (P<0.05). Among all the performances, wolfberry-mangel intercropping has absolute advantages in promoting wolfberry yield and quality increase. Therefore the best patterns of wolfberry-mangel, wolfberry-ryegrass, wolfberry-alfalfa and wolfberry-clover were chosen.

Translation is spatiotemporally regulated and ER-associated mRNAs are generally in efficient translation. It is unclear whether the ER-associated mRNAs are deadenylated or degraded on the ER surface in situ or in the cytosol. Here, we showed that ER possessed active deadenylases, particularly the poly(A)-specific ribonuclease (PARN), in common cell lines and mouse tissues. Consistently, purified recombinant PARN exhibited a strong ability to insert into the Langmuir monolayer and liposome. ER-anchored PARN was found to be able to reshape the poly(A) length profile of the ER-associated RNAs by suppressing long poly(A) tails without significantly influencing the cytosolic RNAs. The shortening of long poly(A) tails did not affect global translation efficiency, suggesting that the non-specific action of PARN towards long poly(A) tails was beyond the scope of translation regulation on the ER surface. Transcriptome sequencing analysis indicated that the ER-anchored PARN trigged the degradation of a small subset of ER-enriched transcripts. The ER-anchored PARN modulated the translation of its targets by redistributing ribosomes to heavy polysomes, suggesting that PARN may play a role in dynamic ribosome reallocation. During DNA damage response, MK2 phosphorylated PARN-Ser557 to modulate PARN translocation from the ER to cytosol. By promoting the decay of ER-associated MDM2 transcripts with low ribosome occupancy, the ER-anchored PARN modulated DNA damage response and thereby cell viability. These findings revealed that a highly regulated communication between mRNA degradation rate and translation efficiency is present on the ER surface in situ and that PARN may contribute to this communication by modulating the dynamic ribosome reallocation between transcripts with low and high ribosome occupancies.

Emerging pollutants as pharmaceuticals have been focusing international attention for few decades. Ciprofloxacin (CIP) is a common drug widely found in effluents from hospitals, industrial and different wastewater treatment plants, as well as rivers. In this work, the lab-scale 3D-BER system was established, and more than 90% of the antibiotic CIP removal from the Low C/N wastewater. Best results were obtained with current intensity, and different C/N ratio significantly improve the removal of CIP and nitrates, when the ideal conditions were; C/N = 1.5-3.5, pH =7.0-7.5, and I = 60 mA. The highest removal efficiency of CIP = 94.20 %, NO3--N= 95.53 % and total nitrogen (TN) = 84.27 %, respectively. In this novel system, the autotrophic-heterotrophic denitrifying bacteria played vital role for the removal of CIP and enhanced denitrification process. Thus, autotrophic denitrifying bacteria uses CO2 and H2 as carbon sources to reduce nitrates to N2. This system has the assortment and prosperous community revealed at the current intensity of 60 mA, and the analysis of bacterial community structure in effluent samples fluctuates under different condition of C/N ratios. According to the results of LC-MS/MS analysis, the intermediate products were proposed after efficient biodegradation of CIP. Microbial community on biodegrading was mostly found at phylum, and class level was dominantly responsible for the NO3--N and biodegradation of CIP. This work can provide some new insights towards the biodegradation of CIP and the efficient removal of nitrates from low C/N wastewater treatment by the novel 3D-BER system.

Spermatogonial stem cells (SSCs) are the only primitive spermatogonial cells in males that can naturally transmit genetic information to their offspring and replicate throughout their lives. Phospholipase D family member 6 (PLD6) has recently been found to be a surface marker for SSCs in mice and boars; however, it has not been validated in cattle. The results of RT-PCR and qRT-PCR found that the relative expression of PLD6 gene in the testicular tissues of 2-year-old Simmental calves was significantly higher than that of 6-month-old calves. Immunofluorescent staining further verified the expression of PLD6 protein in bovine spermatogenic cells like germ cell marker VASA. Based on multiple bioinformatic databases, PLD6 is a conservative protein which has high homology with mouse Q5SWZ9 protein. It is closely involved in the normal functioning of the reproductive system. Molecular dynamics simulation analyzed the binding of PLD6 as a phospholipase to cardiolipin (CL), and PLD6-CL complex showed high stability. The protein interaction network analysis showed that there is a significant relationship between PLD6 and piRNA binding protein. PLD6 acts as an endonuclease and participates in piRNA production. In addition, PLD6 in bovine and mouse testes has a similar expression pattern with the spermatogonium-related genes VASA and PIWIL2. In conclusion, these analyses imply that PLD6 has a relatively high expression in bovine testes and could be used as a biomarker for spermatogenic cells including SSCs.

With the rapid development of Internet and the widely usage of smart devices, massive multimedia data are generated, collected, stored and shared on the Internet. This trend makes cross-modal retrieval problem become a hot issue in this years. Many existing works pay attentions on correlation learning to generate a common subspace for cross-modal correlation measurement, and others uses adversarial learning technique to abate the heterogeneity of multi-modal data. However, very few works combine correlation learning and adversarial learning to bridge the inter-modal semantic gap and diminish cross-modal heterogeneity. This paper propose a novel cross-modal retrieval method, named ALSCOR, which is an end-to-end framework to integrate cross-modal representation learning, correlation learning and adversarial. CCA model, accompanied by two representation model, VisNet and TxtNet is proposed to capture non-linear correlation. Beside, intra-modal classifier and modality classifier are used to learn intra-modal discrimination and minimize the inter-modal heterogeneity. Comprehensive experiments are conducted on three benchmark datasets. The results demonstrate that the proposed ALSCOR has better performance than the state-of-the-arts.

Online social networking techniques and large-scale multimedia retrieval are developing rapidly, which not only has brought great convenience to our daily life, but generated, collected, and stored large-scale multimedia data as well. This trend has put forward higher requirements and greater challenges on massive multimedia retrieval. In this paper, we investigate the problem of image similarity measurement, which is one of the key problems of multimedia retrieval. Firstly, the definition of similarity measurement of images and the related notions are proposed. Then, an efficient similarity measurement framework is proposed. Besides, we present a novel basic method of similarity measurement named SMIN. To improve the performance of similarity measurement, we carefully design a novel indexing structure called SMI Temp Index (SMII for short). Moreover, we establish an index of potential similar visual words off-line to solve to problem that the index cannot be reused. Experimental evaluations on two real image datasets demonstrate that the proposed approach outperforms state-of-the-arts.

The current spreading novel coronavirus SARS-CoV-2 is highly infectious and pathogenic and has attracted global attention. Recent studies have found that SARS-CoV-2 and SARS-CoV share around 80% of homology and use the same cell entry receptor, ACE2. These inspired us to study other receptors of SARS-CoV, which may be used for SARS-CoV-2 binding as well. In this study, we screened the gene expression of three receptors (ACE2, DC-SIGN and L-SIGN) in four datasets of normal lung tissue from lung adenocarcinoma patients and two single-cell RNA sequencing datasets from normal lung and bronchial epithelial cells separately. No significant difference in gene expression of these three receptors were found between gender groups (male vs female). We found higher gene expression of DC-SIGN in elder with age>60 and higher gene expression of L-SIGN in Caucasian than Asian. Similar to ACE2, we observed significantly higher DC-SIGN gene expression in the lungs of smokers, especially former smokers. However, smokers upregulate ACE2 and DC-SIGN gene expression in different cell types. In the whole lung, ACE2 is actively expressed in remodeled Alveolar Type II cells of former smokers, while DC-SIGN is largely expressed in monocytes of former smokers and dendritic cells of current smokers. In bronchial epithelium, no obvious gene expression of DC-SIGN and L-SIGN was observed while ACE2 was found to be actively expressed in goblet cells of current smokers and club cells of non-smokers. In conclusion, our findings may indicate that smokers, especially former smokers, and people over 60 have higher risk and are more susceptible to SARS-CoV-2 infection. Also, this study provides hints on possible SARS-CoV-2 pathogenicity mechanisms in lung infection.

Remote sensing technology provides a new way to explore the earth for geoscience applications. In the context of continuous deepening of geological research and the vigorous development of geospatial information science, 3D geological modeling technology has become a research hotspot in the intersection of earth science and information science. The traditional 3D geological modeling technology refers to underground 3D modeling using geological data. This modeling method can only display the underground scene in 3D visualization, but cannot display the surface in detail. In this study, remote sensing technology is adopted to improve the traditional 3D geological modeling method, so that geological modeling can be integrated with remote sensing image, and a new 3D geological modeling method based on remote sensing technology is developed. This method can perform integrated 3D visualization of underground and aboveground scenes, which provides a new way for disaster prevention and reduction, geological prospecting and tectonic interpretation. The new 3D geological modeling method is mainly applied in the geological field, and has made new progress in multi-source heterogeneous geological data fusion, large-scale high-precision modeling, geological grid subdivision, attribute modeling technology, remote sensing image fusion and other aspects. Taking the Ya'an area as an example, this paper makes use of the new generation of 3D geological modeling technology to carry out 3D geological modeling and visual display. The 3D visualization in Ya'an area verifies the feasibility and effectiveness of the new 3D geological modeling method based on remote sensing technology in the current data environment.

Wetlands, which is composed of soil, vegetation and water, has sufficient water supply and is sensitive to climate change. This study analyzed the coupling degree between wetlands and atmosphere, and discussed the influence of environmental factors (solar radiation and water vapor pressure deficit) on latent heat flux by using the experimental data from the Maduo Observatory of Climate and Environment of the Northwest Institute of Eco-Environment and Resource, CAS and WRF model. The results showed, during the vegetation growthing season, the average value of Ω (decoupling factor) is 0.38 in alpine wetlands, indicating the coupling between wetlands and atmosphere is poor; Solar radiation is the main factor influencing the latent heat flux in the results of both observation data analysis and model simulation, and solar radiation and water vapor pressure deficit still have an opposite reaction to latent heat flux; when solar radiation and water vapor pressure deficit increase by 30%, the average daily amount of latent heat flux increases from 5.57 MJ·m-2 to 7.50 MJ·m-2 and decreases to 5.17 MJ·m-2, respectively. This study provides a new research approach for the study of the parameterization of latent heat flux and evapotranspiration under the context of global climate change.

This paper proposes a novel micro-grid structure, which can operate fully-autonomously with inherent seamless switching. It can operate independently in both grid-connected and islanded mode as a self-governed entity without relying on the utility grid. An AC/DC/AC converter is employed as the interface between the micro-grid and the utility grid, which enables the two entities to have different voltages in grid-connected mode. Seamless switching between operation modes can be achieved naturally. The micro-grid is regulated to exchange predefined amount of power with the utility grid in grid-connected mode. This will benefit the power dispatching algorithm of the power system. The predefined power is estimated based on power forecasting of local renewable generations and loads with consideration of the Sate of Charge (SOC) of the battery, and is updated and broadcasted every certain period. A small scale AC micro-grid with a rotating generator, battery storage and solar arrays etc. is built for investigation. Matlab/Simulink results are provided to validate the robustness and flexibility of proposed micro-grid and its operation strategy.

In the extra-thick coal seams and multi-layered hard roofs, the longwall hydraulic support yielding, coal face spalling, strong deformations of goaf-side entry, and severe ground pressure dynamic events typically occur at the longwall top coal caving longwall faces. Based on the Key strata theory an overburden caving model is proposed here to predict the multilayered hard strata behaviour. The proposed model together with the measured stress changes in coal seam and underground observations in Tongxin coal mine provides a new idea to analyse stress changes in coal and help to minimise rock bursts in the multi-layered hard rock ground. Using the proposed primary Key and the sub-Key strata units the model predicts the formation and instability of the overlying strata that leads to abrupt dynamic changes to the surrounding rock stress. The data obtained from the vertical stress monitoring in the 38 m wide coal pillar located adjacent to the longwall face indicates that the Key strata layers have a significant influence on ground behaviour. Sudden dynamically driven unloading of strata was caused by the first caving of the sub-Key strata while reloading of the vertical stress occurred when the goaf overhang of the sub-Key strata failed. Based on this findings several measures were recommended to minimise the undesirable dynamic occurrences including pre-split of the hard Key strata by blasting and using the energy consumption yielding reinforcement to support the damage prone gate road areas. Use of the numerical modelling simulations was suggested to improve the key theory accuracy.

The analysis of water inflow is a key issue in the construction of subsea tunnels. However, present research on the water inflow of subsea tunnels is predominantly focused on single-bore tunnels. Given the current practices in engineering, it is common to see a parallel configuration of three bores. In such cases, the proximity of tunnels to one another might result in alterations to the water inflow due to the interplay of seepage fields. This paper begins by conducting a numerical simulation to assess the water inflow characteristics of a three-bore parallel subsea tunnel. The study then investigates the impact of many factors, including the permeability coefficient of the surrounding rock, the depth of the seawater, the depth of the tunnel, the spacing between tunnels, and the relative size of the tunnels, on the water inflow phenomenon. Furthermore, based on the principles of the analytic hierarchy process and fuzzy mathematics, a comprehensive assessment framework is developed to evaluate the water inflow of three-bore parallel subsea tunnels. Ultimately, this grade of water inflow is used in practical engineering. The results show that there is mutual influence between the three parallel tunnels, and the predicted water inflow will be too large if the single tunnel model is adopted. The interaction between tunnels should be considered in the water inflow grade evaluation system of the three-hole parallel submarine tunnel. Engineering cases show that using a single-hole tunnel model without considering the interaction between tunnels will lead to higher water inflow grades. The research results of this paper can provide guidance for the waterproofing and drainage design of three parallel subsea tunnels and the stability analysis of surrounding rocks.

A series of novel superabsorbent composites of poly(acrylic acid)/semicoke were prepared by polymerization of acrylic acid using ammonium persulphate as initiator, N,N’-methylenebisacrylamide as crosslinker and semicoke which was the by-product of coal carbonizing as the inorganic components. FTIR and SEM analysis indicated that the superabsorbent composites had been successfully polymerized and the semicoke participated into the construction of 3D polymeric network. Meanwhile, the effects of initiator, crosslinker, semicoke, neutralization degree as well as the pH value were investigated, and the results showed that superabsorbent composites containing 10% of semicoke possessed the maximum water absorbency of 584 g/g in distilled water and 75 g/g in 0.9 % NaCl solution. The superabsorbent composites kept the high water absorbency within a wide pH range of 4-11, and still exhibited better re-swelling capability even after seven times. The superabsorbent composite with the excellent performance is a potential water-retaining agent used in the agriculture.

The electronic structural evolution of LLM-105 crystal and the (101) plane of LLM-105 crystal under different pressures is investigated by the density functional theory (DFT) calculations and the surface properties of seven low-Miller-index planes of LLM-105 crystal were investigated in this study. The result demonstrates that the surface energy of (101) plane of LLM-105 is much smaller when compared with other low-Miller-index planes of LLM-105.In order to further investigate the stability of crystal structure and (101) plane of LLM-105 under different pressures, a series of pressures ranged from 0 GPa to 55 GPa were applied during the DFT calculation, and the result shows that the electronic structures of LLM-105 crystal and the (101) plane changed with the increase of external pressure and the evolution process of (101) plane is different from that of LLM-105 crystal structure.

We report an all-optical radio-frequency (RF) spectrum analyzer with a bandwidth greater than 5 terahertz (THz), based on a 50-cm long spiral waveguide in a CMOS-compatible high-index doped silica platform. By carefully mapping out the dispersion profile of the waveguides for different thicknesses, we identify the optimal design to achieve near zero dispersion in the C-band. To demonstrate the capability of the RF spectrum analyzer, we measure the optical output of a femtosecond fiber laser with an ultrafast optical RF spectrum in the terahertz regime.

Novel 1,2,3-triazole compounds 3–4 were synthesised via the regioselective addition and cyclization reaction of 1,1-enediamines (EDAMs) 1 with p-methylbenzenesulfonyl azide (TsN₃) 2 in 1,4-dioxane at refluxing for 5 hours. As a result, 1,2,3-triazoles 3–4 can be easily and efficiently obtained via catalyst-free click chemistry. The reactions have some advantages such as metal-free catalyst, excellent yield, inexpensive raw materials, and convenient final treatment.

Previous research has shown that the effectiveness of selecting filter set from a large set of commercial broadband filters by vector analyzing method based on maximum linear independence (MLI). However, the traditional MLI is suboptimal due to predefining the first filter of the selected filter set being the maximum ℓ2 norm among all those of the filters. An exhaustive imaging simulation is conducted to investigate the features of the most competent filter set. In the simulation, every filter in a subset of all the filters is selected serving as the first filter in turn. From the results of the simulation, we found there are remarkable characteristics for the most competent filter set. Besides smaller condition number, the geometric features of the best-performed filter set comprise the distinct peak of the transmittance of the first filter, the generally uniform distributing of the peaks of the transmittance curve of the filters, the substantial overlapping of the transmittance curves with those of the adjacent filer sets. Therefore, the best-performed filter sets can be decided intuitively by simple vector analyzing and just a few experimental verifications. This work would be useful for optimizing spectral sensitivity of broadband multispectral imaging sensors or SFA sensors.

Rapeseed (Brassica napus L.) is one of the most important oil crops in China. Improving oil production of rapeseed is an important way to ensure the safety of edible oil in China. Oil production is an important index to reflect the quality of rapeseed and is determined by oil content and yield. Applying nitrogen is an important way to ensure a high yield. However, increasing nitrogen application would decrease oil content. Thus, it is critical to screen elite germplasm resources with stable or improved oil content under high nitrogen and to investigate the molecular mechanisms of nitrogen regulation of oil accumulation. In this paper, we review the effects of nitrogen levels on rapeseed yields and oil content, aiming to reveal the mechanisms of nitrogen regulation in oil accumulation and thereby provide a theoretical basis for breeding varieties with high oil content.

Thermodynamic studies consider living entities as dissipative structures. Organisms maintain and develop an orderly structure by exchanging matter, energy, and entropy with the surrounding environment; thus, maintaining life and growth. For a single cell, the temperature, volume, content concentration, and content complexity are four control variables. For warm-blooded animals, both temperature and content concentration are assumed to be constant, and only volume and content complexity, i.e., various proteins, nucleic acids, and small molecular substances in the cell and their interactions, are considered as acting variables. Thus, the potential function of a single cell should conform to the cusp catastrophe model. As the studies on the specific mathematical models of the relationship between the volume and content complexity are not available, we could not propose specific methods for the specific variants of the potential function of this cusp catastrophe model. We could only present our approximate results based on the basic characteristics of the cusp catastrophe model. We speculated that when a single cell is in a stable state, it cannot undergo differentiation, dedifferentiation, and division. These behaviors occur only when the cell enters an unstable state. Based on this speculation, we divided somatic cells of warm-blooded animals into two types, namely stable cells and non-steady cells. If we consider a warm-blooded animal as a whole dissipative structure, its control variables should have steady-state cells, non-steady-state cells, and negative entropy input. If we assume that the negative entropy input is constant, the proportion of non-steady cells and the total number of cells can be used as the control variables of the potential function. For warm-blooded animals, their potential function also conforms to the cusp catastrophe model. Because the studies on the relationship between the proportion of non-steady-state cells and the total cell number are rare, we could not propose specific methods for the variation of the potential function of this cusp catastrophe model. We could only present our approximate results according to the basic characteristics of the cusp catastrophe model. We speculated that as individuals, animals should be in a stable state during development. Once they enter an unstable state, they will fall ill or die. For humans, the proportion of non-steady cells decreases during the growth process from a fertilized egg to old age. From the fertilized egg to adulthood, the total cell number increases; however, in old age, the total cell number begins to decrease gradually. The entire developmental curve will gradually enter an unstable state. We speculated that once the developmental curve of a human enters an unstable state, it is death for the elderly.

Fifty-two kinds of N’-phenylhydrazides were successfully designed and synthesized. Their anti-fungal activity in vitro against five strains of C. alb. was evaluated. All prepared compounds owned varying degrees of activity and their MIC80, TAI, and TSI values were calculated. The in-hibitory activities of 27/52 compounds against fluconazole-resistant fungi C. alb. 4395 and C. alb. 5272 were much higher than those of fluconazole. The MIC80 values of 14/52 compounds against fluconazole-resistant fungus C. alb. 5122 were less than 4 μg/mL, so it was the most sensitive fungus (TSIB = 12.0). A11 showed the highest inhibitory activity against C. alb. SC5314, 4395, and 5272. The antifungal activities of B14 and D5 against four strains of fluconazole-resistant fungi were higher than those of fluconazole. The TAI values of A11 (2.71), B14 (2.13), and D5 (2.25) are the highest. Further exploring the antifungal mechanism revealed that the fungus treated with compound A11 produced free radicals and reactive oxygen species, and their mycelium mor-phology was damaged. In conclusion, the hydrazide scaffold showed potential in the develop-ment of antifungal lead compounds. Among them, A11, B14, and D5 demonstrated particularly promising antifungal activity and hold potential as novel antifungal agents.

Genome-wide association studies (GWAS) have successfully revealed many disease-associated genetic variants. For a case-control study, the adequate power of an association test can be achieved with a large sample size, although genotyping large samples is expensive. A cost‐effective strategy to boost power is to integrate external control samples with publicly available genotyped data. However, the naïve integration of external controls may inflate the type I error rates if ignoring the systematic differences (batch effect) between studies, such as the differences in sequencing platforms, genotype calling procedures, population stratification, and so forth. To account for the batch effect, we propose an approach by integrating External Controls into the Association Test by Regression Calibration (iECAT-RC) in case-control association studies. Extensive simulation studies show that iECAT-RC not only can control type I error rates but also can boost statistical power in all models. We also apply iECAT-RC to the UK Biobank data for M72 Fibroblastic disorders by considering genotype calling as the batch effect. Four SNPs associated with Fibroblastic disorders have been detected by iECAT-RC and the other two comparison methods. However, our method has a higher probability of identifying these significant SNPs in the scenario of an unbalanced case-control association study.

Microplastics (MPs) are a critical environmental issue, with impacts ranging from ecosystem contamination to health risks through bioaccumulation. This review addresses the inefficacy of traditional water treatments in removing MPs and proposes photodegradation, particularly via nanomaterial-enhanced photocatalysts, as a solution. Utilizing their unique properties like large surface area and tunable bandgap, nanomaterials significantly improve degradation efficiency. Different strategies for photocatalysts modification to improve photocatalytic performance are thoroughly summarized, with the particular emphasis on element doping and heterojunction construction. Furthermore, this review thoroughly summarizes the possible fundamental mechanisms driving photodegradation of microplastics facilitated by nanomaterials, with a focus on processes like free radical formation and singlet oxygen oxidation. By clearly elucidating these strategies and mechanisms, this review aims to provide valuable insights and inspire further progress in microplastic photodegradation.

An analytical method was established by HPLC-DAD-ELSD with C18-NH2 column tandem for the simultaneous determination of hydrophobic components atractylenolide I, II, III, atractylone and hydrophilic compounds glucose, fructose and sucrose in the dried rhizome of Atractylodes macrocephala Koidz (a natural raw material for health foods, Bai-Zhu aka. in Chinese). The method combines different separation capabilities of reversed-phase liquid chromatography and hydrophilic interaction liquid chromatography, can provide a new choice for the simultaneous determination of hydrophilic and hydrophobic compounds in traditional Chinese medicines and health foods. It provided a reference method for the quality control of Bai-Zhu. The results showed that the linear correlation coefficients of the established column tandem chromatographic method were all greater than 0.9990, the relative standard deviation was 0.1%-2.8%, and the average recovery was 96.7%-103.1%. The contents of atractylenolide I, II, III, atractylone, fructose, glucose, and sucrose in 17 batches of Baizhu were 172.3-759.8 μg/g, 201.4-612.8 μg/g, 160.3-534.2 μg/g, 541.4-8723.1 μg/g, 6.9-89.7 mg/g, 0.7-7.9 mg/g, and 1.2-21.0 mg/g, respectively.

Pandemics caused by viruses have threatened lives of thousands of people. Viral infection is a complex and diverse process, and substantial studies have been complemented in understanding the biochemical and molecular interactions between viruses and hosts. However, the physical microenvironment where infections implement is often less carefully considered, and the role of mechanobiology in viral infection remains elusive. Mechanobiology focuses on sensation, transduction and response to intracellular and extracellular physical factors by tissues, cells and extracellular matrix. The intracellular cytoskeleton and mechanosensors have been proved to be extensively involved in virus life cycle. Furthermore, innovative methods in vivo and in vitro are being utilized to elucidate how extracellular factors including stiffness, forces and topography in regulating viral infection. Our current review covers how physical factors from different sources coordinate virus infection. We further discuss how this knowledge can be harnessed in future research on cross-fields of mechanobiology and virology.

The epidemic of Coronavirus Disease 2019 (Covid-19) has brought many changes to people's life. This study aims to analysis Chinese people's psychological change and life after quarantining Wuhan and explore the influencing factors. Based on data from a web-survey after quarantining Wuhan (N=3268), the principal-component-analysis (PCA), multiple-linear-regression (MLR), propensity-score-matching (PSM) were used to explore the psychological change of people in China and the influencing factors. 83.3% of the respondents said that the impact of the epidemic on their life had increased after quarantining Wuhan. A considerable proportion of people's anxiety increased, being reflected in negative emotion, behavioral response and physiological response. The proportion of people who said their anxiety had increased in Wuhan was higher than that in other regions (p <0.05). The anxiety of people who were in medical isolation increased less than those who were not (p <0.05). All three aspects of people’s anxiety were positively related with time of medical isolation and degree of the attention on the epidemic (p＜0.05) except the effect of attention degree on the physiological response (p＝0.06). The measure of medical isolation at home should be advocated. Yet people should reduce the concern for the epidemic while paying attention to self-protection.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The effects of rare earth Y content on the microstructure and high-temperature oxidation properties of 47Fe-36Ni-15Cr-1.5Mn alloy at 1000°C were investigated. The results show that 47Fe-36Ni-15Cr-1.5Mn alloy oxidizes at 1000°C under laboratory atmospheric pressure to form an oxide film layer dominated by Cr2O3 and (Fe, Ni, Mn) Cr2O4 spinel, and the oxidation curve of the alloy follows the parabolic law. After the addition of rare earth Y, rare earth phases precipitated along the grain boundaries in the alloy, and the more Y content, the more precipitated phases in the grain boundaries. The alloy with added rare earths was oxidized at a high temperature of 1000 °C for 2160 min, the oxidation law still followed the parabolic law, while the rare earth phase at the grain boundary reacted with the oxygen atoms infiltrated from the outside to generate a rare earth Y-rich oxide residing at the boundary between the grain boundary and the precipitated phase of the alloy. Add 0.5 wt.% rare earth Y 47Fe-36Ni-15Cr-1.5Mn-0.5Y alloy 1000 ° C high temperature oxidation of the formation of spinel oxide crystalline particles, dense and complete oxide film layer, the surface of the addition of a small amount of (0.5 wt.%) rare earth Y after the refinement of the oxide particles, and in the alloy grain boundaries in the form of oxides reside in the alloy to inhibit the cations in the matrix and the oxygen negative ions. and oxygen-negative ions in the alloy matrix, improving the antioxidant performance of the alloy. With the further increase of rare earth Y, during the oxidation of the alloy at high temperature, the precipitation phase at the grain boundary promotes the inward diffusion of oxygen, resulting in the deterioration of the antioxidant property of the alloy.

A 'little brother' of pain, itch is an unpleasant sensation that creates a specific urge to scratch. To date, various machine-learning based image classifiers (MBICs) have been proposed for quantitative analysis of itch-induced scratch behaviour of laboratory animals in an automated, non-invasive, inexpensive and real-time manner. In spite of MBICs' advantages, the overall performances (accuracy, sensitivity and specificity) of current MBIC approaches remains inconsistent, with their values varying from ~50% to ~99%, for which the reasons underlying have yet to be investigated further, both computationally and experimentally. To look into the variation of the performance of MBICs in automated detection of itch-induced scratch, this article focuses on the experimental data recording step, and reports here for the first time that MBICs' overall performance is inextricably linked to the sharpness of experimentally recorded video of laboratory animal scratch behaviour. This article furthermore demonstrates for the first time that a linearly correlated relationship exists between video sharpness and overall performance (accuracy and specificity, but not sensitivity) of MBICs, and highlight the primary role of experimental data recording in rapid, accurate and consistent quantitative assessment of laboratory animal itch.

The Yangtze River is cross-linked with numerous lakes within its floodplain and is a worldwide biodiversity hotspot. There is no evidence indicating when this unique river-lake system developed. The endemic East Asian cyprinid clade has evolved diverse spawning adaptations to different flow conditions. Our ancestral egg-type reconstruction showed an ancestral state of adhesive eggs and later demersal eggs origination (both stream adaptations). Semi-buoyant eggs emerged ~18 Mya as a fast-flowing river adaptation, with increased hydration via three yolk protein degradation pathways, ion transport pathways and egg envelope permeability transition pores. Adhesive eggs evolved secondarily ~14 Mya with the egg envelope increasing to four layers and an adhesive layer, along with an increase in adhesiveness via microfilament/adhesive-related protein crosslinking and enhanced glycosaminoglycan biosynthesis, improving adherence to submerged lake plants, indicating that the cross-linked river-lake system formed in the mid-Miocene. This study provides a unique biological evidence for large-scale water system evolution.

To explore the forage quality of wild oat populations under different growth environments, the basic nutrient composition and forage quality of five wild oat populations in Israel were compared. Ash, crude protein, and soluble sugar content of oats were significantly (P<0.05) related to some forage quality and possible environment of population origin. Among them, the environmental factors of origin had significant effects on the indicators of ash, crude protein, and soluble sugars of oat straw, but less on the contents of crude fat, total phosphorus, and total potassium. Meanwhile, the annual rainfall and the number of days of rainfall in the country of origin greatly influenced the cellulose content. Finally, we investigated the similarity of feeding values of different populations using PCA analysis. The results showed that, in conclusion, the higher variability of wild oat populations may be a new possibility brought by feeding oats.

Based on a modified dice-and-fill technique, a PIN-PMN-PT single crystal 1-3 composite with the kerf of 12 μm and pitch of 50 μm was prepared. The as-made piezoelectric composite material behaved with high piezoelectric constant (d33 = 1500 pC/N), high electromechanical coefficient (kt = 0.81), and low acoustic impedance (16.2 Mrayls). Using lithography and flexible circuit method, a 48-element phased array was successfully fabricated from such a piezoelectric composite. The array element was measured to have a central frequency of 20 MHz and a fractional bandwidth of approximately 77% at −6 dB. Of particular significance was that this PIN-PMN-PT single crystal 1-3 composite-based phased array exhibits a superior insertion loss compared with PMN-PT single crystal and PZT-5H-based 20 MHz phased arrays. The focusing and steering capabilities of the obtained phased array were demonstrated theoretically and experimentally. These promising results indicate that the PIN-PMN-PT single crystal 1-3 composite-based high frequency phased array is a good candidate for ultrasound imaging applications.

To keep the global navigation satellite system functional during extreme conditions, it is a trend to employ autonomous navigation technology with inter-satellite link. As in the newly built BeiDou system (BDS-3) equipped with Ka-band inter-satellite links, every individual satellite has the ability of communicating and measuring distances among each other. The system also has less dependence on the ground stations and improved navigation performance. Because of the huge amount of measurement data, centralized data processing algorithm for orbit determination is suggested to be replaced by a distributed one in which each satellite in the constellation is required to finish a partial computation task. In current paper, the balanced extended Kalman filter algorithm for distributed orbit determination is proposed and compared with whole-constellation centralized extended Kalman filter, iterative cascade extended Kalman filter, and increasing measurement covariance extended Kalman filter. The proposed method demands a lower computation power however yields results with a relatively good accuracy.

Effective detection of isopropyl methylfluorophosphonate (GB, sarin), a type of organophosphine poisoning agent, is an urgent issue to be addressed in maintaining public safety. In this research, a gas-sensitive film material defined as poly (4-hydroxy-4,4-bis trifluoromethyl) - butyl-1-enyl) - si-loxane (SXFA) with the structure of hexafluoroisopropyl (HFIP) functional group was synthesized by using methyl vinylpropyl dichlorosilane and hexafluoroacetone trihydrate as initial materials. Synthesis process products were characterized by FTIR. SXFA was prepared on a 200 MHz shear surface wave delay line with spin coating method for GB detected. Detection limit of ＜ 0.1 mg/m3 was obtained through conditional experiments. Meanwhile, we also obtained the maximum re-sponse of 2.168 mV at 0.1 mg/m3 concentration, which indicting a much lower detection limit of SAW-SXFA sensor. Additionally, the maximum response standard deviation of 0.11 mV with a co-efficient of variation of 0.01, as well as the maximum recovery standard deviation of 0.22 mV with a coefficient of variation of 0.02 were also obtained through 5 repeated experiments. Results showed that the SAW-SXFA sensor has strong selectivity and reproducibility, good selectivity, positive detection ability, high sensitivity, and fast alarm performance for sarin detection.

Wastes from social economic activities had great impact on water quality thereby limiting water usability for domestic purposes. Sewages discharge from people activities, usually consist of undesirable concentrations of soluble chemicals that infiltrate into the surrounding surface and underground water, and then constitute health risk to the populace. In order to investigate the concentration characteristics and health risk for the local residents in Nandong Underground River Watershed (NURW), eleven common heavy metals in the water body analysis were conducted. Health risk assessment (HRA) was taken to analyze eleven heavy metals of 84 water samples from surface and underground waters in NURW: 36 samples underground water and 48 samples surface water. Our results showed that the heavy metals concentration order is that of Fe > Al > Mn > Zn > As > Cd > Pb > Cr > Ni > Cu > Hg. Correlation analysis indicates that these eleven metal elements have certain similarity on material source and migration transformation. The health risks for local residents exposed to metal elements in the water of NURW mainly from carcinogenic risk (10−6～10−4 a−1) through drinking way, and the health risk of heavy metals exposed to children through drinking way was much higher than adults. The maximum exposing health risks of Cr in both underground and surface water were higher than the recommendation standard (5.0×10-5 a-1) from ICRP, and all the values over the standard (5.0×10-6 a-1) recommended by the Swedish Environmental Protection Agency and the Dutch Ministry of Construction and Environment and the British Royal Society. The results of health risk assessment shows that Cr in the water of NURW was the mainly source of carcinogenic risk for the local residents, following by Cd and As. Consequently, it is necessary to control the three carcinogenic metals when the water was used as drinking water source.

The study aims to explore gender differences in smoking and drinking in three Asian cities—Hanoi, Shanghai and Taipei, and assesses the magnitude of these gender differences across cities. A total of 17,016 adolescents and young adults, aged 15 to 24 years, residing in both urban and rural area of Hanoi, Shanghai and Taipei were selected by multistage sampling methods and surveyed by face to face interview. The gender differences are significant for smoking-only, drinking-only, and both behaviors in each city. With respect to smoking-only, males are more than 30.66 times as likely to report it compared with females in Hanoi, followed by Shanghai and Taipei. The above trend holds true when further examining drinking-only and both smoking and drinking. The magnitude of gender differences in smoking-only, drinking-only, and both behaviors widely vary across the three cities. Future research is needed to further examine the mechanisms behind these gender differences and how these differences may be utilized to prevent and reduce smoking and drinking in the adolescent and young adult population.

The four-way reversing valve is a key component determining whether a heat pump air conditioning system can work. Studying the four-way reversing valve is of great significance for improving the performance of the heat pump air conditioning system. In this paper, the control equation of the sliding block movement process is constructed to simulate the reversing process of the four-way reversing valve in fluid mechanics, and a detailed study is carried out from the sliding block speed, sliding block acceleration, sliding block force, refrigerant leakage, and other aspects. Research has shown that optimizing the structure of the slider can greatly improve the working performance of the four-way reversing valve. Increasing the height of the slider not only improves the pressure relief ability of the four-way reversing valve and prevents the slider from being damaged by high-pressure gas impact, but also reduces the leakage of refrigerant during the directional process; When reducing the length of the slider, although it will improve the pressure relief capacity of the four-way reversing valve, it also increases the amount of refrigerant leakage. The research results provide a theoretical basis and improvement direction for designers to improve the performance of four-way reversing valves.

Brain tumors are abnormal cells growth in the brain tissues that can be cancerous, or not. In any case, they could be a very aggressive disease that should be detected as early as possible. Usually, magnetic resonance imaging (MRI) is the main tool commonly adopted by neurologists and radiologists to identify and classify any possible anomalies present in the brain anatomy. In the present work, an automatic unsupervised method called Z2-$\gamma$, based on the use of adaptive finite-elements and suitable pre-processing and post-processing techniques, is introduced. In particular, the proposed methodology is able to automatically classify whether a given MR image represents a healthy or a diseased brain and in this latter case, is able to locate the tumor area.

Tumor invasion, metastasis, and recrudesce remain a considerable challenge in the treatment of gastric cancer (GC). Herein, we first identified that RBFOX3 (RNA binding protein fox-1 homolog 3) was significantly up-regulated in GC tissues and negatively linked to the survival rate of GC patients. RBFOX3 promoted cell division and cell cycle progression in vitro as well as in vivo. Furthermore, RBFOX3 increased cell invasion and migration ability. Interestingly, both the suppression of GC cell multiplication and invasion moderated by the silencing of RBFOX3 was rescued by HTERT up-regulation. Additionally, RBFOX3 augmented the resistance of GC cells to 5-fluorouracil (5-Fu) by repressing RBFOX3. Mechanistically, exogenous up-regulation of RBFOX3 triggered promoter activity and HTERT expression thereby enhancing the division and development of GC cells. Importantly, our findings revealed that RBFOX3 interacted with AP-2β to modulate the HTERT expression as demonstrated by co-immunoprecipitation analysis. In conclusion, our study indicates that high expression of RBFOX3 promotes GC progression and development but predicts worse prognosis by stimulating HTERT signaling. Moreover, the results suggest that the RBFOX3/AP-2β/HTERT pathway is a novel target for the development of therapeutic agents for the prevention and treatment of GC reappearance and metastasis.

There are many theories of carcinogenesis arguing against the orthodox mutation theory, debating on such as “epigenetic alteration” that is inheritable and yet, theoretically, reversible. Our integrated theory describes that any extracellular, intracellular, or intranuclear stressors, mutagenic or not, can initiate a lengthy tumorigenesis to engender a benign or malignant tumor, but the aberrations directly establishing cellular immortality and autonomy may be epigenetic or genetic alterations in the genomic DNA. A neoplasm is considered a semi-new organism with autonomy; it therefore should have genetic mutations to be “new”. We may be able to direct cancer cells towards differentiation as a remedy, because the extracellular milieu may control the phenotype of a cell and the tissue or organ made of the cell’s progenies, and the cytoplasm of a cell may override the nucleus in the phenotypic control. However, the nucleus retains the capacity to manifest itself if allowed by the microenvironment, which then allows the already reversed cells to revert back to tumor cells again. Neoplasms are malignant if they bear epigenetic or genetic anomalies in mutator genes defined as those whose alterations allow or accelerate alterations to occur in other genes, whereas neoplasms are benign if they bear epigenetic or genetic aberrations only in non-mutator genes. It is imperative to identify the immediate tumor-causing cellular alterations defined as those directly responsible for immortality and autonomy, and for treatment purposes to identify the extracellular and intracellular factors that control the phenotype of cancer cells.

The low-altitude quasi-periodic (LQP) E-region echoes observed with the upgraded HCOPAR located in Hainan Island of China (19.5°N, 109.1°E) are presented. With the interferometry technique, the interferometry equations can be developed to investigate the structures of the irregularities. The results show that the plasma structures of the LQP echoes with negative slope mainly drift southwestward almost horizontally, but they also drifted southeastward in some striations. According to the movement of the plasma structures, we find strong wind shear in the region where the LQP echoes are produced. Meanwhile, The periodicity of the LQP echoes may be related to the strength of the wind shear. It is proposed that the plasma structures are most likely produced by the Kelvin-Helmholtz instability.

Electric field assisted combustion is an important means to improve fuel combustion efficiency. This paper conducts extensive research on flame characteristics under different forms and different application methods of electric fields, emission of soot particles and simulation status. Different flame parameter measurement methods will lead to different degrees of error, and perfect numerical simulation can make simple predictions on experimental data. Most of the current numerical simulations are in two dimensions, and it is necessary to develop a complete and accurate three-dimensional model to simulate and predict the characteristics of the flame under an electric field. The emission of soot particles is also affected by the electric field, and reasonable electric field parameters can greatly reduce the emission of soot particles. It is recommended to conduct centralized measurement of different fuels under the electric field under high pressure and temperature conditions, so as to be able to develop a wider and more accurate flame dynamics and chemical model under the electric field.

Photovoltaic(PV) power generation is highly nonlinear and stochastic. Accurate prediction of PV power generation plays a crucial role in grid connection as well as the operation and scheduling of power plants. To predict the PV power combination model, this paper suggests a method based on Empirical Mode Decomposition (EMD), Ensemble Empirical Mode Decomposition (EEMD), Complete Ensemble Empirical Mode Decomposition with Adaptive Noise (CEEMDAN), Nonlinear Auto-Regressive Neural Networks with Exogenous Input (NARXNN), Long Short Term Memory (LSTM) Neural Network, and Light Gradient Boosting Machine (LightGBM) algorithms. To attempt to reduce the non-smoothness of PV power, the weather variable features with the greatest effect on PV power are first identified by correlation analysis. Following this, the PV power modal decomposition is split and reorganized into a new feature matrix. Finally， a NARX is used to obtain preliminary PV power components and residual vector features， and the PV power is predicted by combining three models of LightGBM， LSTM, and NARX and then the final prediction results are obtained by combining the PV power prediction results using error inverse method weighted optimization. The prediction results demonstrate that the model put forth in this paper outperforms those of other models and validate the model's validity by utilizing real measurement data from Andre Agassi College in the United States.

Transient receptor potential melastatin-8 (TRPM8) is a cation channel that is activated by cold and “cooling agents” such as menthol and icilin, which induce a cold sensation. Stimulation of TRPM8 activates an intracellular signaling cascade that ultimately leads to a change in the gene expression pattern of the cells. Here, we investigated the TRPM8-induced signaling pathway that links TRPM8 channel activation to gene transcription. Using a pharmacological approach, we show that inhibition of phosphatidylinositol 4-phosphate 5 kinase alpha (PIP5K), an enzyme essential for the biosynthesis of phosphatidylinositol 4,5-bisphosphate, attenuated TRPM8-induced gene transcription. Analyzing the link between TRPM8 and Gq proteins, we show that pharmacological inhibition of the beta gamma subunits impairs TRPM8 signaling. In addition, genetic studies showed that TRPM8 requires an activated Galpha subunit for signaling. In the nucleus, the TRPM8-induced signaling cascade triggers an activation of the transcription factor AP-1, a complex consisting of a dimer of basic region leucine zipper (bZIP) transcription factors. Here, we identified the bZIP protein c-Jun as an essential component of AP-1 within the TRPM8-induced signling cscade. In summary, with PIP5K, Gq subunits and c-Jun we have identified key molecules in the TRPM8-induced signaling from the plasma membrane to the nucleus.

Staphylococcus aureus(S. aureus) is associated with mastitis in dairy cows, this study investigates the therapeutic effect of maggot antimicrobial peptides on S. aureus induced mastitis in mice. The maggot AMP was isolated and purified, tested for antimicrobial activity, and used to treat a pathological model of rat mastitis. The concentration of 1.5mg/（Kg. BW）AMP was selected as intramammary treatment in S. aureus-induced mastitis in mice. The mice were divided into four groups of 30 mice each: group I (healthy control), group II (disease control), group III (AMP), and group IV (ciprofloxacin). To evaluate the therapeutic efficacy of maggot AMP in mastitis induced by S. aureus based on clinical presentation, mammary gland structure, bacterial load, histopathology, and cure. During the 7-day treatment period, all the mice in Group II died in the afternoon of the fifth day, and the clinical signs of the mice in Group III began to improve on the third day, as evidenced by the gradual recovery of the mice's mental status, dietary intake, and water intake. During the treatment period, the bacterial load count of Group III was significantly lower than that of Group II but higher than that of Group IV, while the bacterial load count of Group III gradually decreased and approached that of Group IV from the fifth to the seventh day. The levels of TNF-α in groups III and IV were significantly lower than those in group II, suggesting that maggot AMP has a certain inhibitory effect on TNF-α. Treatment with AMP@ 1.5 mg/(Kg. BW) showed restoration of clinical signs, reduced bacterial load, and lower TNF-α levels in mice, leading to significant improvement in histopathological changes as compared to disease controls. The final cure rate was 40% for mice in Group III compared to 70% for mice in Group IV, compared to all mice in Group II that died. From this study, it can be concluded that maggot AMP can be used as a potential alternative treatment option to antibiotics for the treatment of bovine mastitis.

We investigated and quantified soil organic carbon (SOC) stock at the mangrove forest (Magyi, That Bot Khan and Wette) of Shwe Thaung Yan coastal region in Myanmar and estimated the SOC stock changes in Magyi mangrove forest over six years using repeated field measurements. The study sites were characterized by different mangrove vegetation, soil types, and sediment deposition from different water sources. Results showed that the mangrove preservation and restoration efforts had a significant effect on soil C storage, with soil carbon stocks in 2021 (1954.43 ± 33.24 ton/ha) being 2.7 times higher than the estimated carbon stock in 2015 (732.26 ± 6.99 ton/ha). The results also revealed slight differences in SOC between Magyi and the Tha-Bot-Khan and Wette areas, as the mangrove plants in the latter areas have an additional source of nutrients from Pho-Thoung-Gyi, a deep-sea bay near the forest. Our research findings are beneficial in understanding the role of Myanmar’s mangrove ecosystems in carbon sequestration and climate change mitigation efforts.

The α-glucosidase inhibitor is of interest to researchers due to its association with type-II diabetes treatment by suppressing postprandial hyperglycemia. Hesperidin is a major flavonoid in orange fruit with diverse biological properties. This paper evaluates the effects of hesperidin on α-glucosidase through inhibitory kinetics, fluorescence quenching, and molecular docking methods for the first time. The inhibition kinetic analysis showed that hesperidin reversibly inhibited the α-glucosidase activity with an IC50 value of 18.52 M and the inhibition was performed in an uncompetitive type. Fluorescence quenching studies indicated that the intrinsic fluorescence of α-glucosidase was quenched via a static quenching process and only one binding site was present between hesperidin and α-glucosidase. The interaction between them was spontaneous and mainly driven by hydrogen bonds as well as hydrophobic forces. Furthermore, molecular docking results suggested that hesperidin might bond to the entrance or outlet part of the active site of α-glucosidase through a network of five hydrogen bonds formed between hesperidin and the four amino acid residues (Trp709, Arg422, Asn424, and Arg467) of ?-glucosidase and hydrophobic effects. These results provide new insights into the inhibitory mechanisms of hesperidin on α-glucosidase, supporting the potential application of hesperidin-rich orange product as a hypoglycemic functional food.

When existing at emulsion interface and continuous phase, dispersibility of water-soluble flexible polymer chains has obvious effect on rheology and dielectric properties of whole emulsion. CNF Pickering emulsion is a good system to research these properties with respect to their microscopic phase structure, dielectric and rheological properties by using cellulose nanofibers (CNF) as water-soluble Pickering emulsifier, liquid Paraffin as oil phase and DDAB as a cationic auxiliary surfactant. The CNF- and DDAB-contents were systematically varied while the water to paraffin oil ratio remained constant to discern the influence of the Pickering emulsifiers. Polarized optical microscopic images revealed that the droplets have tendency to become smaller size for higher CNF content, but bigger size for higher DDAB content, which was proved by the fluorescent analysis for CNF dispersibility with varying DDAB content. The dielectric damping exhibits a minimum, whose value decreases with increasing DDAB- and CNF-content. Increasing the DDAB-content promotes solubilization of CNFs in the aqueous phase and will increase the overall viscosity and yield points. Similarly, a higher CNF-content leads to a higher viscosity and yield point, but at high DDAB-contents the viscosity function exhibits an S-shape at intermediate CNF-content. To evaluate the results further they were compared with CNF-dispersions (without oil-phase), which showed a surfactant effect slightly on maximum stress but strongly on yield stress τy, indicating DDAB can promote the formation of CNF network rather than the viscosity of whole system.

Silicon has a theoretical specific capacity of 4200 mAh g−1, which is considered to have significant potential for anode materials in lithium-ion batteries (LIBs). However, the volume change that occurs in silicon during charging and discharging affects the development of commercial applications. In this work, a yolk-shell structured Si@void@C anode material has been developed to address this problem. The silicon nanoparticle yolk material is obtained by recycling kerf-loss (KL) Si waste from the photovoltaic industry, the carbon shell is prepared via a hydrothermal process with glucose, and the sacrificial interlayer is Al2O3. The synthesized material is used to fabricate anodes that show a high reversible capacity of 836 mAh g−1 at the current density of 0.1 A g−1 after 100 cycles, with a Coulomb efficiency of 71.4%. This work demonstrates a relatively low-cost approach to turn KL Si waste into value-added materials for LIBs.

Due to the intermittency and fluctuation of photovoltaic (PV) output power, a high proportion of grid-connected PV power generation systems has a significant impact on power systems. Accurate PV power forecasting can alleviate the uncertainty of the PV power and is of great significance for the stable operation and scheduling of the power systems. Therefore, in this study, a feature rise-dimensional (FRD) two-layer ensemble learning (TLEL) model for short-term PV power deterministic forecasting and probability forecasting is proposed. First， based on the eXtreme Gradient Boosting (XGBoost), Random Forest (RF), CatBoost, and Long-short-term memory (LSTM) models, a TLEL model is constructed utilizing the ensemble learning algorithm. Meanwhile, the FRD method is introduced to construct the FRD-XGBoost-LSTM (R-XGBL), FRD-RF-LSTM(R-RFL), and FRD- CatBoost - LSTM (R-CatBL) models. Subsequently, the above models are combined to construct the FRD-TLEL model for deterministic forecasting, and perform probability interval forecasting based on quantile regression(QR). Finally, the performance of the proposed model is demonstrated with a real-world dataset. By comparing with other models, the proposed model displays better forecasting accuracy for deterministic forecasting and reliable forecasting intervals for probability forecasting, and good generalization ability in the datasets of different seasons and weather types.

It is always a difficult task to assign the peaks recorded from vibrational spectrum. Herein we explored a new pathway of density functional theory (DFT) simulation to present three kinds of spectra of ice XIV and can be referenced as inelastic neutron scattering (INS), IR, and Raman experimental spectrum. The INS spectrum is proportional to phonon density of states (PDOS) while the photon scattering signals reflect the normal vibration frequencies near the Brillouin zone (BZ) center. Based on good agreements with experimental data, we identified the relative frequency and made scientific assignments by normal vibration modes analysis. The debating two hydrogen bond (H-bond) peaks among ice phases from INS have been discussed and the dynamic process of H-bond vibrations were found to be classified into two basic modes. we deduce that two H-bond modes are a general rule among ice family and more works are ongoing to investigate this subject.

Toxoplasma gondii is a widespread protozoan parasite that infects most warm-blooded animals, and felids can serve as intermediate and definitive hosts. Pathological diagnosis and serological and etiological investigations were conducted on a captive caracal (Caracal caracal) carcass collected from China in 2022. Pathological diagnosis revealed that cardiac insufficiency, pulmonary edema, hepatic failure, and renal insufficiency were the causes of the caracal’s death. A modified agglutination test (cut-off: 1:25) revealed that IgG antibodies against T. gondii were present in the myocardium juice, hydroperitoneum, and hydropericardium (≥1:800). A viable T. gondii (TgCaracalCHn2) strain was isolated from the tissue samples (heart, brain, spleen, and skeletal muscle) of this caracal using a mouse bioassay. The genotype of TgCaracalCHn2 was ToxoDB#5 (Type II variant), as determined by RFLP-PCR. The strain was avirulent in Swiss mice and matched the prediction of ROP18 and ROP5 gene alleles of TgCaracalCHn2 (2/2). Many tissue cysts (203 ± 265) were observed in mice brains after inoculation with TgCaracalCHn2 tachyzoites. ToxoDB#5 is the dominant genotype in North American wildlife, and this is the first documented isolation of T. gondii ToxoDB#5 from China. This indicates that caracals can accelerate the transmission of T. gondii genotypes.

Lipid nanoparticles (LNPs) have attracted extensive attention in tumor immunotherapy in recent years. The strategy of targeting immune cells in cancer therapy has become a research area of great interest. mRNA vaccines are a potential choice for tumor immunotherapy due to their ability to directly encode antigen proteins and stimulate a strong immune response. However, the mode of delivery and lack of stability of mRNA are key issues limiting its application. LNPs are an excellent mRNA delivery vector, and their structural stability and biocompatibility make them an effective means to deliver mRNA to specific targets. This study summarizes the research progress in LNP delivery vector-assisted targeted controlled release mRNA vaccines in tumor immunity. The role of LNPs in improving mRNA stability, immunogenicity and targeting is discussed. In addition, combined with the cutting-edge research results, the potential mechanisms and application prospects of LNP-mRNA vaccines in tumor immunotherapy were further analyzed. This review aims to systematically summarize the latest research progress in LNP delivery carrier-assisted targeted controlled-release mRNA vaccines in tumor immunity to provide new ideas and strategies for tumor immunotherapy and provide more effective treatment plans for patients.

Background: The role of preoperative serum carcinoembryonic antigen (sCEA) and postopeative tissue CEA (tCEA ) were widely elaborated separately for colorectal cancer (CRC). But the role of the combined sCEA and tCEA was scarcely described by now. Methods: 1757 cases of 0~ⅣCRC from January 2006 to January 2016 in our institution were involved. Clinicopathological features and follow up data were collected. 0 stage was combined into 0&Ⅰ stages. SCEA was classified to normal and high(>10ng/ml) and tCEA were classified into three grades (+,++,+++). So combined groups were six (2ⅹ3). ANOVA and Crosstab were used to analyze continuous and counting data, Univariate and multivariate were analyzed by Cox regression. All data were analyzed by SPSS27 and survival curves with number at risk were visualized by R 4.3.1. Results: Gender, age, tumor location, tumor size, blood loss, T stage, differentiation, harvested lymph nodes, positive lymph nodes, chemotherapy, TNM stage and complication have difference between the combined CEA test (all P

Colorectal liver metastases (CRLM) patients combined with hepatic lymph node metastases was a negative prognostic factor associated with outcomes. Up to now, there was still lack of a reliable method to identify the status of hepatic lymph nodes. The aim of this study was to investigate the predictive ability of mono-exponential, bi-exponential, and stretched-exponential diffusion-weighted imaging (DWI) models to distinguish between benign and malignant hepatic lymph nodes in CRLM patients who underwent neoadjuvant chemotherapy prior to surgery. In total, 97 CRLM patients with pathologically proved hepatic lymph node status were included. Various quantitative parameters, including the apparent diffusion coefficient (ADC) from mono-exponential model, D, D*, and f derived from intravoxel incoherent motion (IVIM) model, as well as DDC and α from stretched-exponential model (SEM), were measured. Multivariate analysis revealed that the pre- treatment DDC value and the short diameter of the largest lymph node after treatment were independent predictors of metastatic hepatic lymph nodes. A nomogram combining these two factors demonstrated excellent performance in distinguishing between benign and malignant lymph nodes in CRLM patients, with an area under the curve (AUC) of 0.873. Therefore, the nomogram can serve as a preoperative assessment tool for determining the status of hepatic lymph nodes and aiding in the decision-making process for surgical treatment in CRLM patients.

[Objective] To investigate the expression of ALDH2 in hepatocellular carcinoma and its correlation with macrophage infiltration and with the activation of specific subtypes of macrophages. [Methods] Transcriptome and clinical data from patients with hepatocellular carcinoma were downloaded from The Cancer Genome Atlas (TCGA) and the International Cancer Genome Consortium (ICGC) databases and analyzed and collated using R and Perl software. In the TCGA hepatocellular carcinoma dataset, the Wilcoxon test was used to identify macrophage activation-related gene sets that show differential expression between hepatocellular carcinoma and normal tissues. Single-cell sequencing combined with bulk data was used to analyze macrophage infiltration of hepatocellular carcinoma immune cells and the activation and recruitment of different subtypes of macrophages. Single-factor Cox regression and minimum absolute convergence and selection operator (Lasso) were used to identify survival-related genes and construct prognostic models of HCC. The patients were divided into two groups based on their model scores. The Wilcoxon test was used to identify differentially expressed genes (DEGs) between the two groups, and gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analyses of the DEGs were performed. Single-sample gene set enrichment analysis (ssGSEA) was performed to explore the possible mechanism underlying the differences in prognosis. The reliability of the model was verified using the ICGC hepatocellular carcinoma dataset. A Kaplan‒Meier curve was constructed and used to analyze the influence of macrophage activation-related gene expression on survival and prognosis in patients with hepatocellular carcinoma. The log-rank test and the independent t test were used to analyze survival time data and to compare immune cell infiltration in the two groups. [Results] In a comparison of hepatocellular carcinoma and paracancerous tissues, the expression of six of 137 macrophage activation-related genes (ALDH2, CCNB2, CYP2C9, CYP3A4, F9 and KLKB1) was found to be significantly correlated with overall survival time (OS) in patients with hepatocellular carcinoma. Based on this finding, a prognosis assessment model for hepatocellular carcinoma was constructed. The OS of the patients in the high-scoring group was significantly shorter than the OS of the patients in the low-scoring group (P<0.05), and the model predicted the prognosis of patients with hepatocellular carcinoma independently of sex, age, tumor grade and stage. The area under the receiver operating characteristic (ROC) curve of the model used to predict 1-, 2-, and 3-year survival was greater than 0.7 in both the test set and the validation set. GO enrichment of DEGs between the high- and low-scoring groups of the model suggested that the DEGs are mainly related to immune function. GSEA suggested that the tumor-infiltrating immune cells in the high-scoring group were macrophages, Th2 cells and Treg cells and showed that the number of tumor-infiltrating immune cells, including NK cells, was lower in the high-scoring group than in the low-scoring group. With respect to immune function, the immune checkpoint of the high-scoring group was higher than that of the low-scoring group. Single-cell sequencing data indicated the recruitment of B cells, M0 cells, M1 cells and M2 cells to the hepatocellular carcinoma microenvironment and suggested that ALDH2 regulates related signaling pathways in a way that promotes the differentiation of macrophages into M2-type macrophages. [Conclusion] M2-type macrophages are the dominant type of macrophages associated with immune infiltration in hepatocellular carcinoma. The macrophage-associated activation gene ALDH2 activates the macrophage polarization signaling pathway and negatively regulates the differentiation of macrophages into M2-type macrophages.

Piceatannol is a naturally occurring polyphenolic compound that is widely found in grapes, blueberries, mushrooms, passion fruit and other edible fruits and vegetables. It has a variety of biological activities and pharmacological effects, including anti-inflammatory, antioxidation, antiaging, antiviral, antitumor, anticancer, antiatherosclerosis, antiparasitic, immunoregulatory, and cardiovascular protection effects. The aim of this study was to investigate the antiherpesvirus effects of piceatannol. Pseudorabies virus (PRV) belongs to the family Herpesviridae. PRV has a wide host range and can cause cytopathic effects (CPEs) in PK-15 cells. Therefore, PRV was used as a model to study the antiherpesvirus effect of piceatannol. In this study, we evaluated the antiviral activity of piceatannol against PRV in vitro and in vivo. The results showed that piceatannol could reatrain PRV multiplication in PK-15 cells in a dose-dependent manner. The 50% inhibitory concentration (IC50) was 0.0307 mg/mL, the IC50 was 0.0307 mg/mL, and the selectivity index (SI, CC50/IC50) was 3.68. The addition of piceatannol at different stages of PRV infection inhibited the viral adsorption and intracellular replication phases of PRV. Piceatannol significantly reduced the expression levels of the IE180, EP0, UL29, UL44, US6 and UL27 genes of PRV within 48 h, significantly reduced the expression levels of the PRV gB and gD proteins, and reduced PRV-induced apoptosis. Molecular docking showed that piceatannol had good binding activity with the PRV gB and gD proteins. The results of animal experiments in vitro indicated that piceatannol could delay the onset of disease, improve the survival rate of the mice (14.3%), reduce the viral load in the brain and kidney of the mice, alleviate the pathological changes in the mouse tissues and organs, and increase the levels of TNF-α, IEN-γ and IL-4 in the serum of the mice. These data indicate that piceatannol has good anti-PRV activity in vitro and in vivo, indicating that it could be a novel antiherpesvirus infection agent in the future.

The study of the currently known >3,000 species of snakes can provide valuable insights into the evolution of their genomes. Deinagkistrodon acutus, also known as Sharp-nosed Pit Viper, one hundred-pacer viper or five-pacer viper, is a venomous snake with significant economic, medicinal and scientific importance. Widely distributed in southeastern China and South-East Asia, D. acutus has been primarily studied for its venom. Here, we employed next-generation sequencing to assemble and annotate a highly continuous genome of D. acutus. The genome size is 1.46 Gb; its scaffold N50 length is 6.21 Mb, the repeat content is 42.81%, and 24,402 functional genes were annotated. This study helps to further understand and utilize D. acutus and its venom at the genetic level.

Hydrogel antibacterial agent is an ideal antibacterial material because of it could diffuses antibacterial molecules into the decayed area by providing a suitable microenvironment and the hydrogel acts as a protective barrier on the decay interface. The biocompatibility and biodegradation make the removal process easily which were widely used in medical fields. However, there have been few reports on its application for controlling postharvest diseases in fruit. In this study, the Chitosan-Ag (CS-Ag) complex hydrogels were prepared using the physical crosslinking method, which used for controlling postharvest diseases in grape. The prepared hydrogels were stable for a long period at room temperature. The structure and surface morphology of CS-Ag composite hydrogels were characterized by UV-Vis, FTIR, SEM, and XRD. The inhibitory effects of CS-Ag hydrogel on disease in grape caused by P. expansum, A. niger and B. cinerea were investigated both in vivo and in vitro. The remarkable antibacterial activity of CS-Ag hydrogels was mainly due to the synergistic antibacterial and antioxidant effects of CS and Ag. Preservation test showed that the CS-Ag hydrogel had positive fresh-keeping effect. This revealed CS-Ag hydrogels plays a critical role in controlling fungal disease in grape.

Concern over potential antimony mediated toxicity from mining and smelting activities has instigated novel concepts toward removing aqueous antimony ions. The iron based adsorbent Fe3O4/HCO was found to be efficient for treating antimony-containing wastewater However, ineffective methodology for preparation limited its effective adsorption capacity and thus wider application. In this study, a new type of HCO-doped-(Fe3O4)x adsorbent was prepared by co-precipitation method for doping Fe3O4 into HCO sludge (HCO), thereby improving adsorption performance for Sb(III) and Sb(V) ions, with the maximum adsorbing capacity being 44.46 mg/g and 47.91 mg/g, respectively. According to the results of BET, SEM-EDS, XRD and XPS, it were confirmed that the FeOOH and X≡Fe-OH were formed during the preparation process, bring about the increased the surface area, thus resulting in further increase of surface area, hydroxyl groups and the net negative ionic charge. Moreover, the adsorption kinetics followed the pseudo-second-order kinetic model which indicated that adsorption process of Sb(III)/Sb(V) by HCO-doped-(Fe3O4)x adsorbent was controlled by chemical reaction. The main adsorption mechanism is that antimony ion and amorphous iron oxide X≡Fe-OH undergo coordination exchange reaction and complexation reaction with CeO2 or Ce2O3. Furthermore, HCO-doped-(Fe3O4)x could adapt to wide pH and had stable adsorption ability after regeneration. The good adsorption performance of HCO-doped-(Fe3O4)x makes it a potential applications of adsorbent for removal of antimony.

The field of fluorescence sensing, leveraging various supramolecular self-assembled architectures constructed from macrocyclic pillar[n]arenes, has seen significant advancement in recent decades. This review comprehensively discusses, for the first time, the recent innovations in the synthesis and self-assembly of pillar[n]arene-based supramolecular architectures (PSAs) containing metal coordination sites, along with their practical applications and prospects in fluorescence sensing. Integrating hydrophobic and electron-rich cavities of pillar[n]arenes into these supramolecular structures endow the entire system with self-assembly behavior and stimulus responsiveness. Employing the host–guest interaction strategy coupled with complementary coordination forces, PSAs exhibiting both intelligent and controllable properties are successfully constructed. This provides a broad horizon for advancing fluorescence sensors capable of detecting environmental pollutants. This review aims to establish a solid foundation for the future development of fluorescence sensing applications utilizing PSAs. Additionally, current challenges and future perspectives in this field are discussed.

The Double U-pipe ground heat exchanger, recognized for its straightforward process, cost-effectiveness, high heat exchange efficiency, and low thermal resistance, stands as the predominant ground heat exchanger type in today's shallow geothermal energy development and utilization. Recent years have seen significant research into the heat transfer influencing factors and heat exchange performance of Double U-pipe ground heat ex-changers via experimental testing methods. Yet, studies integrating numerical simulation with in-situ testing have been less frequent. Drawing on the cylindrical heat source model theory and the outcomes of regional in-situ thermal response tests, this paper develops a Double U-pipe ground heat transfer model by establishing physical, mathematical, and heat transfer geometric models. It assesses the impact of varying inlet temperatures, flow rates, and initial ground temperatures on heat exchange efficiency under heating conditions. The results validate the precision of the double U-pipe ground heat exchanger model based on in-situ testing. They show that enhancing the temperature differential between the inlet and initial temperatures, elevating the initial ground temperature, and moderately increasing the flow rate can boost the system's heat exchange efficiency.

Depression is one of the psychiatric disorders characterized by anxiety, pessimism, and suicidal tendencies, which seriously affect the quality of life of patients and their families. In this paper, we used polynomial-based kernel Granger causality values as network node connectivity indicators to construct brain networks for 5 depressed patients and 11 healthy individuals’ magnetoencephalogram(MEG) under positive, neutral, and negative emotional stimuli, respectively, and found that depressed patients had closer information exchange between frontal and occipital regions compared to healthy individuals and other brain regions, and fewer causal connections in parietal and central regions. Further analysis of the topological properties of the network revealed that depressed patients had higher mean degrees under negative stimuli (p=0.008)and lower mean clustering coefficients than healthy individuals(p=0.034). Comparing the mean degree and mean clustering coefficient of the same sample under different emotional stimuli, we found that depressed patients had the greater mean degree and mean clustering coefficient under negative stimuli than neutral and positive stimuli. We also found that patients’ feature path lengths under negative and neutral stimuli significantly deviated from small-world attributes. The results suggest that analysis of nuclear Granger causality-based brain networks can effectively characterize depression pathology.

Driven by the rapidly growing demand for information security, covert wireless communication conceived as one of the essential technology has attracted tremendous attention. However, traditional wireless covert communication is continuously exposing the inherent limitations that challenge deploying in environments with a large number of obstacles, such as cities with high-rise buildings. In this paper, we propose an intelligent reflecting surface (IRS) assisted covert communication system (CCS) with a friendly UAV, where the UAV generates artificial noise (AN) to interfere with the monitors. Furthermore, we model the power of AN emitted by UAV as an uncertainty model, with which the closed-form detection error probability (DEP) on the covert wireless communication for the monitor is derived. Under the derived DEP, we formulate the optimization problem to maximize the covert rate, and an iterative algorithm is designed to solve the optimization problem to obtain the optimal covert rate by using Dinkelbach method. Simulation results show that the proposed system achieves the maximum covert rate when the phase of the IRS units, the trajectory, and the transmit power of the UAV are jointly optimized.

Alfalfa is an important forage crop around the world. LncRNAs are considered to be a class of functional biomacromolecules, while little is known about lncRNAs in alfalfa. In this study, RNAs from different tissues of alfalfa were sequenced and anlyzed with full-length transcriptome sequencing technology, yielding the full-length transcripts dataset of alfalfa. Based on sequencing and public RNA-seq data, lncRNAs of alfalfa were predicted genome-wide by CPC2 and PLEK. The results showed most lncRNAs shared low sequence conservation with those in other plant species, part of which seems originate from plastid genome. We also identified 88563 lncRNAs, approximately 99.8% of total lncRNAs, with possibility of coding small ORFs using two prediction tools. Our research generated the biggest sequence set of alfalfa lncRNAs, and revealed some plastid originated lncRNAs with high sequence conservation.

In this paper, the effect of Bi₂O₃ doping on the mechanical properties of PbO ceramic pellets was studied. For this purpose, different ratios of Bi2O3/PbO (i.e., xBi2O3–(1-x)PbO, where x is 0, 1, 3, 5, 7 wt%) were fabricated and sintered at 570, 620, and 670°C. Mechanical properties including density, hardness, flexural strength, and sintering of PbO were studied for the aforementioned compositions. Phase compositions, microstructures, and worn surfaces of the composites were characterized by scanning electron microscopy and X-ray diffraction (XRD). The XRD analysis revealed that a solid solution formed in the composite ceramic. The best suited conditions of temperature and doping of Bi₂O₃ for optimal sintering are 620°C and 3 wt%, respectively. The hardness of the 3 wt% Bi2O3–97 wt% PbO ceramic was 717 MPa, which is about four times higher than the hardness of pure PbO; in addition, the strength of the composites was 43 MPa, which is two times higher than that of pure PbO. The integrity of the composites was verified using the lead–bismuth eutectic alloy flushing experiment. Results of this research paper are important for future studies of oxygen control in the lead–bismuth eutectic alloy of lead-cooled fast reactors.

In the present work report, the MgAl₂O₄and the Ag/MgAl₂O₄ samples were successfully synthesized by the modified hydrothermal and the isovolumetric impregnation methods, respectively. The structural properties of the prepared samples were systematically characterized by XRD, SEM, TEM, DRS, XPS and et al techniques. The photocatalytic degradation of methylene blue by the Ag/MgAl₂O₄ and MgAl₂O₄ samples was comparatively studied under UV lamp irradiation. The results revealed that the prepared Ag/MgAl₂O₄ (pH=6) samples were the most active among the samples in photocatalytic of methylene blue. Under UV lamp irradiation, the Ag/MgAl₂O₄ (pH=6) photodegradation of methylene blue reached to 89.6% within 120 min. And the Ag/MgAl₂O₄ (pH=6) complex photocatalysts displayed a high photochemical stability under repeated irradiation. Repeated irradiate the Ag/MgAl₂O₄ (pH=6) compound, which indicated it had a high photochemical stability.

MultiCal is an affordable, high-precision measuring device designed for the on-site calibration of industrial robots. Its design features a long measuring rod with a spherical tip that is attached to the robot. By restricting the rod’s tip to multiple fixed points under different rod orientations, the relative positions of these points are accurately measured beforehand. A common issue with MultiCal is the gravity deformation of the long measuring rod, which introduces measurement errors into the system. This problem becomes especially serious when calibrating large robots, as the length of the measuring rod needs to be increased to enable the robot to move in a sufficient space. To address this issue, we propose two improvements in this paper. Firstly, we suggest the use of a new design of the measuring rod that is lightweight yet has high rigidity. Secondly, we propose a deformation compensation algorithm. Experimental results have shown that the new measuring rod improves calibration accuracy by 20% to 39%, while by using the deformation compensation algorithm, the accuracy increases by 6% to 16%. In the best configuration, the calibration accuracy is similar to that of a measuring arm with a laser scanner, producing an average positioning error of 0.274 mm and a maximum positioning error of 0.838 mm. The improved design is cost-affordable, robust, and has sufficient accuracy, making MultiCal a more reliable tool for industrial robot calibration.

Compact solar-powered plasma water generator: enhanced on-site aged seed germination with the corona dielectric barrier discharger

The city administration of China planned numerous metro projects and more metros can hardly avoid undercrossing a bridge. While metro shield construction when undercrossing a bridge (MSCUB) is frequently located in complicated natural and social context, which made the construction process more susceptible to safety accidents. Therefore, it is crucial to look into safety risk of MSCUB. The paper identified the safety risk factors during SSCUR by using literature review and experts’ evaluation, proposed a novel safety risk assessment model by integrating CFA and FER, and then selected a project case to test the validity of the suggested model. Research results show that (a) a safety risk factors list of MSCUB was identified, including 4 first-level safety risks and 37 second-level safety risk factors; (b) the proposed safety risk assessment model can be used to measure the risk values of the overall worksite safety risk, the first-level safety risks and the safety risk factors of MSCUB; (c) environment-type safety risk and personnel-type safety risk have higher risk values when shield construction undercrossing a bridge; (d) when compared to worker-type safety risk, manager-type safety risk is the higher risk value. The research can enrich the theoretic knowledge of MSCUB safety risk assessment and provide references to safety managers for conducting scientific and effective safety management on the construction site when subway undercrossing a river.

The greatly diversified flowering plants (angiosperms) are the dominating and defining group in the current earth ecosystem. However, from which group by what way the flowers, especially their gynoecia (key characteristics of angiosperms), are derived have been the questions in botany unanswered over centuries. Such an embarrassing situation can be attributed to the lack of plants with partially enclosed ovules, which are supposed to be a post between gymnosperms and angi-osperms. Here we report a fossil plant that has an apparent coniferous vegetative and reproduc-tive morphologies but has a single seed partially wrapped by the subtending bract. Such a mor-phology suggests that the carpels in angiosperms may be equivalent to bracts enclosing their axil-lary seed(s). Such a non-traditional interpretation of the homology of angiosperm carpels is com-patible with various new progresses made in botany and is in line with Tomlinson’s recent hy-pothesis. Together with other fossil evidence reported recently, it appears that gynoecia in angio-sperms are derived in multiple ways.

The garnet Li₇La₃Zr₂O₁₂ (LLZO) has been widely investigated because of its high conductivity, wide electrochemical window and chemical stability to lithium metal. However, the usual preparation process of LLZO requires a long time of high-temperature sintering and a lot of mother powders against the lithium evaporation. The submicron Li₆.6La₃Zr₁.6Nb₀.4O₁₂ (LLZNO) powders are prepared by conventional solid-state reaction method and attrition milling process, which are stable cubic phase and have high sintering activity, and Li stoichiometric LLZNO ceramics are obtained by sintering at a relative lower temperature or for a short time by using these powders which are difficult to control under high sintering temperature and long sintering time. The particle size distribution, phase structure, microstructure, distribution of element, total ionic conductivity, relative density and activation energy of submicron LLZNO powders and LLZNO ceramics are tested and analyzed by laser diffraction particle size analyzer, XRD, SEM, EIS and Archimedean method. The total ionic conductivity of sample sintered at 1200 °C for 30 min is 5.09 × 10-4 S·cm-1, the activation energy is 0.311 eV, and the relative density is 87.3%, and sintered at 1150 °C for 60 min total ionic conductivity is 3.49 × 10-4 S·cm-1, the activation energy is 0.316 eV, and the relative density is 90.4%. At the same time, all-solid-state batteries are assembled with LiMn₂O₄ as positive electrode and submicron LLZNO powders as solid state electrolyte. After 50 cycles, the discharge specific capacity is 105.5 mAh/g and the columbic efficiency is above 95%.

The transforming growth factor-β (TGF-β), in which overexpression have been associated with various diseases, has become an attractive molecular target for the treatment of cancers. Three series of 3-substituted-4-(quinoxalin-6-yl) pyrazoles 14a–h, 15a–h, 16a–h, 22a, 22b, 22d, 23a, 23b, 23d, 24b, and 24d were synthesized and evaluated for their activin receptor-like kinase 5 (ALK5) and p38α mitogen activated protein (MAP) kinase inhibitory activity in an enzymatic assays. Among these compounds, the most active compound 16f inhibited ALK5 phosphorylation with an IC₅₀ value of 0.28 µM, with 98% inhibition at 10 µM. Compound 16f also had good selectivity index of >35 against p38α MAP kinase, with 9.0-fold more selective than clinical candidate, compound 3 (LY-2157299). Molecular docking study was performed to identify the mechanism of action of the synthesized compounds and their good binding interactions were observed. ADMET prediction of good active compounds showed that these ones possess good pharmacokinetics and drug-likeness behavior.

With the rapid development of tumor immunotherapy, nanoparticle vaccines have attracted much attention as a potential therapeutic strategy. The potential role of the mannose-modified lipid calcium phosphate nanoparticle vaccine in enhancing the anti-tumor immune response was investigated. The aim of this study was to investigate the effect of mannose modification on the immune response of nanoparticles in regulating the tumor microenvironment through systematic review and analysis and to explore its potential clinical application in tumor therapy. Currently, despite the potential advantages of nanoparticle vaccines in immunotherapy, achieving an effective immune response in the tumor microenvironment remains a challenge. Tumor immune escape and overexpression of immunosuppressive factors limit its clinical application. Therefore, this study will explore how to intervene in the immunosuppressive mechanism in the tumor microenvironment through mannose-modified lipid calcium phosphate nanoparticle vaccines so as to improve the immunotherapy effect of tumor patients and provide new ideas and strategies for the field of tumor therapy.

As a dominant mangrove species, Kandelia obovata is distributed in an intertidal marsh with an active H₂S release. Whether H₂S participates in the salt tolerance of mangrove plant is still ambiguous although increasing evidence have demonstrated that H₂S functions in plant responses to multiple abiotic stresses. In this study, as an H₂S donor, NaHS was used to investigate the regulatory mechanism of H₂S on salt tolerance of K. obovata seedlings using a combined physiological and proteomic analysis. The results showed that the reduction in photosynthesis (Pn) caused by 400 mM NaCl was recovered by the addition of NaHS (200 μM). Furthermore, the application of H₂S enhanced the quantum efficiency of PSII and the membrane lipid stability, implying that H₂S is beneficial to the survival of K. obovata seedlings under high salinity. We further identified 37 differentially expressed proteins by proteomic approaches under salinity and NaHS treatment. Among them, the proteins related to photosynthesis, primary metabolism, stress response and hormone biosynthesis were primarily enriched. The physiological and proteomic results highlighted that exogenous H₂S up-regulated photosynthesis and energy metabolism to help K. obovata to cope with high salinity. Specifically, H₂S increased photosynthetic electron transfer, chlorophyll biosynthesis and carbon fixation in K. obovata leaves under salt stress. Furthermore, the abundances of other proteins related to metabolic pathway, such as antioxidation (APX, CSD2, PDX1), protein synthesis (HSP, Cpn 20), nitrogen metabolism (GS2, GS1:1), glycolysis (PGK, TPI), AsA-GSH cycle were increased by H₂S under high salinity. These findings provide new insights into the roles of H₂S in the adaptations of mangrove plant K. obovata to high salinity environment.

In this paper, a semi-empirical model of air waves induced by falling rock is described. The model is composed of a uniform motion phase (velocity close to 0 m·s^-1) and an acceleration movement phase. The uniform motion phase was determined based on experimentally and the acceleration movement phase was derived by theoretical analysis. A series of experiments were performed to verify the semi-empirical model and elucidated the law of the uniform motion phase. The acceleration movement phase accounted for a larger portion with a greater height of the falling rock. Experimental results of different falling heights of the goaf showed close agreement with theoretical analysis values. The semi-empirical model could accurately and conveniently estimate the velocity of air wave induced by falling rock. Thus, the semi-empirical model can provide a reference and basis for estimating the speed of air waves and designing protective measures in mines.

Group A rotaviruses (RVA) have been identified as the leading cause of neonatal calf diarrhea (NCD) In Yunnan, China, despite the limited documentation on this issue within the country. Given the significant impact on animal health and welfare, further attention is warranted to comprehend the prevalence and epidemiology of this disease. In this study, we isolated RVA strains from NCD clinical samples to support RVA epidemic study and further disease control in Yunnan. Material and Methods: Ten fecal samples were obtained from calves with a single episode of neonate calf diarrhea from a farmer during a severe NCD outbreak. For the diagnosis of Group A rotavirus (RVA) infection, fecal reverse transcription-polymerase chain reaction (RT-PCR) was employed as the primary method. Subsequently, RVA isolation was conducted on MA104 cells, with inoculates being pretreated with trypsin TPCK to enhance viral infectivity. The isolated RVA strain was further confirmed through RT-PCR and immunofluorescence assay. Results: RVA virus was isolated from clinical samples following six passages depended on trypsin treatment of inoculates. The sign of CPE detected consisted of increased cell granularity, obscure cell boundaries, cell rounding, and eventual degeneration and detachment of cells. Analysis of sequencing revealed that field isolates was of group A serotype. Phylogenetic analysis based on the ORF sequences of the VP4 and VP7 sequences segments indicated that the isolate was classified as the P[1] genotype. VP4 gene of strain YN-1 shares 75.2%-99.7% nucleotide identity of and 81.6%–99.7% amino acid identity with the complete VP4 sequences of the P[1]. The complete VP7 gene of YN-1 is 981 nucleotide long and encode 326 amino acids. The RotaC v2.0 analysis classified the sequence as the G8 genotype. The VP7 gene of strain YN-1 shares 88.5%-97.7% nucleotide identity and 94.2%-99.1% amino acid identity. Conclusion: This is the first study in China which reports the circulation of Group A NCD on cattle farms in the field. Our study constitutes a crucial and a necessary step allowing preventive and veterinary medicine to support RVA disease controls in Yunnan province, China.

To be CMOS-compatible, a low preparation temperature (&lt; 500 °C) of ferroelectric films is required. In this study, BiFeO3 films were successfully fabricated at a low annealing temperature (&lt; 450 °C) on aluminum foils by a metal-organic decomposition process. The annealing atmosphere on performance of BiFeO3 films was assessed at 440 ± 5℃. By replacing an O2-rich atmosphere with an N2-rich one, a better crystalline morphology was achieved in BiFeO3 films, resulting in better electric properties targeted for high-density ferroelectric random-access memory applications. These properties included a large remnant polarization (Pr~78.1 μC/cm2 @ 1165.2 kV/cm) and a high rectangularity (~91.3% @ 1165.2 kV/cm) of the P-E loop, along with excellent charge-retaining ability up to 1.0 × 103 s and a fatigue resistance reaching 1.0 × 109 switching cycles. The enhanced performance of BiFeO3 film in an N2-rich atmosphere maybe originated from the slightly high content of oxygen vacancies during the annealing process. Furthermore, decent electrical properties (Pr~70 μC/cm2 @ 1118.1 kV/cm) of the BiFeO3 films were achieved at a very low annealing temperature of 365 ±5 °C on aluminum foil substrates. These results offer a new idea for lowering the annealing temperature for integrated ferroelectrics in high-density FeRAM applications.

The fast decoding of low-density parity-check (LDPC) is crucial for its future applications. In this paper, we propose to use Early Termination (ET) and Force Convergence (FC) techniques to accelerate the decoding of two new local/global two-phases decoding algorithms to reduce the Globally Coupled (GC) LDPC codes. Specifically, ET is applied in the local decoding phase of two- phases decoding of GC-LDPC codes to skip the local decoding which is highly likely to fail and avoid the unnecessary iterations. FC is applied in global decoding phase where converged variable nodes are identified and removed from Tanner graph and the decoding can be speed up shrinking parity check matrices. Two variants are proposed for the ET operation in local decoding phase. ET-1 merely stops iteration if it meets the stopping criterion while in ET-1, the iteration number saved in local decoding is added up in global decoding to improve the decoding performance. The simulation results show that the ET-1-FC scheme can save up to 42% decoding time complexity in the low SNR region while keeping the error rate performance nearly unchanged, the ET-2-FC can improve the error rate performance by 0.18dB at bit error rate 0.001 or 0.23dB at frame error rate 0.1. In the waterfalling region of BER/FER curves, both schemes can save about 25% decoding time complexity.

We study L_2-approximation problems in the weighted Hilbert spaces in the worst case setting. Three interesting weighted Hilbert spaces appear in this paper, whose weights are equipped with two positive parameters $\ga_j$ and $\az_j$ for $j=1,\,2,\dots,\,d$. We consider the worst case error of algorithms that use finitely many arbitrary continuous linear functionals. We discuss the exponential convergence-(t,s)-weak tractability (EC-(t,s)-WT) of these L_2-approximation problems under the absolute or normalized error criterion. In particular, we obtain the sufficient and necessary conditions for EC-(1,1)-WT and EC-(t,1)-WT with t

Amidst the escalating demands for efficient Intelligent Transportation Systems (ITS) management, the significance of accurate Origin-Destination (OD) data prediction has emerged as a paramount concern, given its indispensable role in the ITS domain. This paper introduces a groundbreaking integrated model, creatively fusing the unique strengths of Graph Convolutional Network (GCN), Residual Neural Network (ResNet), and Long Short-Term Memory Network (LSTM) into a single architecture, which we name GraphResLSTM, to exploit road segment average speed data for OD prediction. Compared with conventional road segment traffic volume data, average speed data is more readily available, significantly reducing the data accessibility barrier for OD prediction. We underscore the critical role of selection of key road segments and employs a combination of Entropy Weight Method and Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) to identify 41 representative road segments from the experimental road network. In the experimental phase, we simulate 86400000 seconds of traffic conditions, generating a total of 1440000 data records. Utilizing these simulated data, we design and conduct comparative experiments between models as well as data types. The results demonstrate that both the GraphResLSTM model and road segment average speed data outperform other models and data types notably in OD prediction tasks.