Liquid-liquid phase separation (LLPS) of proteins has been found ubiquitously in eukaryotic cells, critical in the controlling of many biological processes through forming a temporary condensed phase with different bimolecular components. TDP-43 is recruited to stress granules in cells and is the main component of TDP-43 granules and proteinaceous amyloid inclusions in patients with amyotrophic lateral sclerosis (ALS). TDP-43 low complexity domain (LCD) is able to demix in solution forming the protein condensed droplets. The molecular interactions regulating its LLPS were investigated at the protein fusion equilibrium stage, where the droplets stopped growing. We found the molecules in the droplet were still liquid-like but with enhanced intermolecular helix-helix interaction in the LCD. The protein would start to aggregate after about 200 minutes of lag time and aggregate slower than at the condition when the protein does not phase separate or the molecules have a reduced intermolecular helical interaction. A structural transition intermediate towards protein aggregation was also discovered involving a decrease of the intermolecular helix-helix interaction and a reduction in the helicity. Therefore, LLPS and the intermolecular helical interaction could help maintain the stability of TDP-43 LCD.

A robust guaranteed cost preview repetitive controller is proposed for a class of polytopic uncertain discrete-time systems. In order to improve the tracking performance, the repetitive controller combined with preview compensator is inserted in the forward channel. By using the L-order forward difference operator, an augmented dynamic system is constructed. Then, the guaranteed cost preview repetitive control problem is transformed into the guaranteed cost control problem for the augmented dynamic system. For given performance index, the sufficient condition of asymptotic stability for the closed-loop system is derived by combining parameter-dependent Lyapunov function method with linear matrix inequality (LMI) techniques. By incorporating the controller obtained into the original system, the guaranteed-cost preview repetitive controller is derived. A numerical example is also included to show the effectiveness of the proposed method.

Evaluating soil quality across various altitudinal gradients, both with and without vegetative cover, is crucial for the proper functioning of soil and optimal crop growth, thereby contributing to the sustainability of agroecosystems. Although the altitudinal gradient significantly influences soil quality, the ability to predict this quality, expressed through an index, in soils with and without vegetative cover, is still insufficiently explored. This study aimed to assess soil quality in the Jun Jun micro-watershed, located in the Tungurahua region, Ecuador. To achieve this objective, three categories of altitudinal gradients were selected: less than 2800 meters above sea level (masl), between 2800 and 2900 masl, and greater than 2900 masl. A total of 24 soil samples were collected in the mentioned gradients, considering both areas with and without vegetative cover. The indicators used included chemical and biological parameters such as soil organic carbon (OC), earthworm density (WD), earthworm biomass (WB), organic matter (OM), pH, total nitrogen (TN), and organic carbon (OC). The results revealed that in areas with altitudinal gradients below 2800 masl, soil quality index values were higher compared to other altitudes. In vegetated areas, a decrease in index values was observed as the altitudinal gradient increased, indicating a deterioration in soil quality with altitude. These findings are significant in providing a quantitative assessment of the effects of altitudinal gradient and vegetative cover influence on soil quality.

Supramolecular solvent (SUPRAS) has received increasing interest as an innovative, efficient, and green solvent for the effective extraction and separation of bioactive compounds from natural resources. However, studies on the use of SUPRAS for the extraction of phenolic components from plants, which are highly valued in food products due to their excellent antioxidant capacity, are still lacking. The present study developed a green ultrasound-assisted and efficient SU-PRAS method to simultaneously determine three phenolic acids in Prunella vulgaris by high-performance liquid chromatography (HPLC) and the experimental parameters were optimized in detail. The efficiency and antioxidant properties of the phenolic compounds obtained by different extraction methods were also compared. Under the optimal conditions, the extraction efficiency of SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, was substantially higher than conventional organic reagents. Moreover, this SUPRAS method also showed more significant antioxidant capacities. The confocal laser scanning microscopy (CLSM) images presented the spherical droplet structure of SUPRAS (A well-defined circle), which coincided with the position of the fluorescence position of phenolic acids. The phenolic acids were encapsulated in the vesicles by the SUPRAS droplets, which indicated the efficient extraction capacities of SUPRAS for the target compounds. Finally, combined with the CLSM method, the mechanism of the proposed method was further clarified, and the superior extraction performance of SUPRAS was theoretically demonstrated through molecular dynamics simulations. In comparison with conventional methods, the higher extraction efficiency of SUPRAS can be illustrated by the larger solvent contact surface area, more types of hydrogen bonds between extractants and supramolecular solvents, and stronger and more stable interaction forces. The results of the theoretical studies are in rational agreement with the experimental outcome.

Trichinellosis is a major worldwide health concern caused by T. spiralis infection without highly efficient and safe therapeutic method so far. To solve the problem of uncomplete drug treatment schemes and the rise of anthelmintic resistance, a potential protective effect of probiotic strains against zoonotic T. spiralis infection was investigated in the framework of a new therapeutic strategy aimed at using probiotics to control parasitic zoonoses. The study was focused on L. reuteri protected against T. spiralis infection in intestinal phase throughout the detection of adult worm number, inflammatory factors mRNA expression, antioxidant enzyme expression and Nrf2 signal pathway protein expression. Mice were divided randomly into 3 groups: 1) Control group: no treatment; 2) Ts group: T. spiralis infection; 3）LAB group: T. spiralis infected after orally administered L. reuteri for 7 days. Probiotics bacteria were administered daily in a dose of 109 CFU/mL, and mice were infected with 400 T. spiralis larvae in the experimental groups. The number of adult worms was also significantly increased after administration of probiotics. Meanwhile, L. reuteri alleviate the inflammatory response caused by T. spiralis infection in intestinal has been confirmed. In addition, the promotion of antioxidant enzyme expression can be inferred that L. reuteri regulate Nrf2 signal pathways against T. spiralis infection. Our study demonstrates that L. reuteri provide protection against T. spiralis infection in intestinal. Therapeutic approaches with probiotic strains admission could help to reduce the risks of trichinellosis or complement classical anti-parasite treatments.

The accompanying mechanical behavior during the flow of ore-rock dispersion is an important factor leading to the instability and failure of the orepass in the ore storage section. It is of great significance to accurately understand the instability characteristics of the well wall in the ore section, during the ore drawing process by understanding the flow characteristics and internal mechanical transfer mechanism of ore-rock dispersion. Using the discrete element method to analyze the flow characteristics, contact compactness, stress distribution characteristics and contact force probability distribution of the ore-rock dispersion, it realizes the quantitative characterization of the damage degree of ore-rock flow, and reveals the damage mechanism of mine storage wall. The results show that: (1) The friction between ore-rock particles, between ore-rock and well wall is an important reason for the change of the macroscopic flow form of ore-rock from “one” to “V” type. (2) The compactness and stress concentration of ores are increasing with the increase of storage depth, which is shown that with the increase of storage depth, the greater the probability of well wall instability. (3) The probability distribution of contact force strength between particles decreases exponentially in the whole process of ore drawing, in which the strong chain plays a major role in the stability of the dispersion system. (4) The number of overpressure and the overpressure coefficient can be used to quantitatively characterize the wall damage degree under the action of ore-rock flow. The dynamic side pressure decreases periodically in the form of exponential fluctuations, and the dynamic load formed by the ore-rock flow mainly played a role in the lower area of the ore storage section.

Water resources are threatened nowadays by pollution that comes from domestic, industrial and agricultural discharges without prior treatment. This pollution causes the degradation of water quality. Surface pollutants can seep through the soil into water tables. The objective of our work is to assess and control the physicochemical quality of the Chari Baguirmi groundwater, to protect human health. The quality of 83 boreholes was assessed, while performing analysis for 12 physicochemical parameters at the National Water Laboratory and at the Center for Quality Control of Foodstuffs in Chad. These parameters are: pH, EC, Ca2+, Mg2+, Na+, K+, Cl-, SO42-, NH4+ and NO3- , Fe2+ and HCO3-. Also, the results obtained were compared with WHO standards. The geochemical statistical approach has made it possible to characterize the hydro geochemical properties and to understand the major processes of the mineralization of groundwater resources in Chari Baguirmi region in Chad. Some of its waters are acidic and weakly mineralized, rich in Fe2+ and NH4+. The origin of the mineralization is due to the alteration of the host rocks and to the hydrolysis of silicate and ferromagnesian minerals as well as anthropogenic pollution. The ammonium concentrations in N’Djamena boreholes are higher than WHO standards, indicating the presence of pollution which may come from organic waste. These results constitute a preliminary step in understanding hydro geochemical functioning and a basis for monitoring the physicochemical quality of the water in the study area.

Background: Previous in vitro and in vivo studies have demonstrated that storage of cooked rice at 4 °C for 24 h and reheating to 65 °C significantly reduced starch digestibility and postprandial glycaemic responses. Moreover, the effect was greater for parboiled rice compared to other rice varieties commonly consumed in New Zealand. This study aimed to evaluate consumer preferences of related sensory attributes and consumer acceptability of several rice varieties freshly cooked or reheated. Method: Sixty-four consumers volunteered and recorded on Visual Analoge Scales their preference and acceptability of freshly prepared or cold-stored and reheated medium grain white, medium grain brown and parboiled rice. Results: All six rice samples were accepted by participants (average 54%). Reheated parboiled rice and reheated medium grain brown rice were both accepted by participants as a preferred staple meal compared to other rice samples. Among all rice samples, the sweetness and the flavour of freshly cooked warm medium-grain white rice were less preferred (scored 42.1% and 45.0% respectively) compared with other samples (P = 0.05). Participants who prepared and consumed brown rice at home regularly (more than 10 times per month), preferred the reheated brown rice (73.8% (67.4, 80.2)) and reheated parboiled rice (74.3% (67.9, 80.7)) (P < 0.001). Conclusions: It is suggested that reheated parboiled rice, with the lowest starch digestibility and glycaemic impact (both in vitro glucose release and in vivo glucose response) could be accepted as a healthier alternative for the daily staple meal.

The assessment of water quality consists of counting bacteria indicating fecal contamination or detecting the presence of pathogenic bacteria using standardized or validated methods of classical microbiology. Our present study aims to determine the bacteriological quality of drilling water in the Tandjilé region of Chad. Our method used was based on qualitative and quantitative research on suspected total coliforms, Echerichia Coli and fecal enterococci were analyzed according to the standard routine methods of the French Association for Normalization (AFNOR). Microbiological analysis shows the presence of indicators of fecal contamination such as total coliforms, Escherichia coli and fecal enterococci. The number of strains detected in 100 ml were E. coli (7 /29 samples), fecal Streptococcus (6 /29 samples) and total coliforms (29/29 samples), respectively from borehole water. The contamination rate of E. coli is 24.13%, total coliforms 100% and 20.68% of fecal enterococci in boreholes. The high number of these microorganisms is more than the values recommended by the WHO for the quality of drinking water. Corrective and urgent measures are needed to improve the quality of these water resources, rich in pathogens, which are health risks, and the causes of infectious diseases such as gastroenteritis, diarrhea, typhoid and skin diseases.

Background: Globally, hot cooked refined rice is consumed in large quantities and is a major contributor to dietary glycaemic load. This study aimed to compare the glycaemic potency of hot and cold stored parboiled rice to widely available medium grain white rice. Method: Twenty-eight healthy volunteers participated in a three treatment experiment where postprandial blood glucose was measured over 120 minutes after consumption of 140g of rice. Three rice samples were freshly cooked medium-grain white rice, freshly cooked parboiled rice, and parboiled rice stored overnight at 4 ºC. All rice was served warm at 65 ºC. Chewing time was recorded. Results: The 24-hours cold-stored and reheated parboiled rice resulted in a 42% and 12% lower blood glucose concentration trajectory than freshly cooked medium-grain white rice and freshly cooked parboiled rice. Chewing time for 10g cold stored parboiled rice was 6 seconds (25%) longer and was considered more palatable, visually appealing and better tasting than freshly cooked medium grain (all P<0.05). Conclusions:. For regular consumers of rice reheating cooked rice after cold storage would lower the dietary glycaemic load and long term may reduce risk for type 2 and gestational diabetes. More trials are needed to identify the significance.

Coptisine (Cop) exerts a neuroprotective effect in central nervous system disease, particularly ischemic stroke. However, its protective mechanism is still unclear. This study aimed to investigate the protective effect of Cop on cerebral ischemia-reperfusion (IR) rats with a middle cerebral artery occlusion model by integrating a gas chromatography-mass spectrometry (GC-MS) based metabolomics approach with biochemical assessment. Our results showed that Cop could improve neurobehavioral function and decrease the ischemia size in IR rats. In addition, Cop was found to decrease inflammatory mediators (e.g., prostaglandin D2 (PGD2) and tumor necrosis factor-α (TNF-α) and attenuate oxidative stress response (e.g., increase the superoxide dismutase (SOD) expression and decrease 8-iso-PGF2α level). Furthermore, GC-MS based cerebrospinal fluid (CSF) metabolomics analysis indicated that Cop influenced the level of glycine, 2,3,4-trihydroxybutyric acid, oleic acid, glycerol, and ribose during IR injury. Cop exhibited a good neuroprotective effect against cerebral IR injury and metabolic alterations which might be mediated through its antioxidant and anti-inflammatory property.

The current spreading novel coronavirus SARS-CoV-2 is highly infectious and pathogenic and has attracted global attention. Recent studies have found that SARS-CoV-2 and SARS-CoV share around 80% of homology and use the same cell entry receptor, ACE2. These inspired us to study other receptors of SARS-CoV, which may be used for SARS-CoV-2 binding as well. In this study, we screened the gene expression of three receptors (ACE2, DC-SIGN and L-SIGN) in four datasets of normal lung tissue from lung adenocarcinoma patients and two single-cell RNA sequencing datasets from normal lung and bronchial epithelial cells separately. No significant difference in gene expression of these three receptors were found between gender groups (male vs female). We found higher gene expression of DC-SIGN in elder with age>60 and higher gene expression of L-SIGN in Caucasian than Asian. Similar to ACE2, we observed significantly higher DC-SIGN gene expression in the lungs of smokers, especially former smokers. However, smokers upregulate ACE2 and DC-SIGN gene expression in different cell types. In the whole lung, ACE2 is actively expressed in remodeled Alveolar Type II cells of former smokers, while DC-SIGN is largely expressed in monocytes of former smokers and dendritic cells of current smokers. In bronchial epithelium, no obvious gene expression of DC-SIGN and L-SIGN was observed while ACE2 was found to be actively expressed in goblet cells of current smokers and club cells of non-smokers. In conclusion, our findings may indicate that smokers, especially former smokers, and people over 60 have higher risk and are more susceptible to SARS-CoV-2 infection. Also, this study provides hints on possible SARS-CoV-2 pathogenicity mechanisms in lung infection.

Gliomas, the most prevalent and lethal form of brain cancer, are known to exhibit metabolic alterations that facilitate tumor growth, invasion, and resistance to therapies. Peroxisomes, essential organelles responsible for fatty acid oxidation and reactive oxygen species (ROS) homeostasis, rely on the receptor PEX5 for the import of metabolic enzymes into their matrix. However, the prognostic significance of PEX5 for glioma patients remains unclear. We developed a robust prognosis model based on PEX5-dependent signature. This signature not only serves as a robust prognosis model capable of accurately predicting outcomes for glioma patients but also effectively distinguishes several clinicopathological features, including the grade, isocitrate dehydrogenase (IDH) mutation, and 1p19q codeletion status. Furthermore, we developed a nomogram that integrates the prognostic model with other clinicopathological factors, demonstrating highly accurate performance in estimating patient survival. Patients classified into the high-risk group based on our prognostic model exhibit an immunosuppressive microenvironment. Finally, we validated that the peroxisomal localization of the signature genes depends on PEX5 and demonstrated that PEX5 is required for cell growth, migration and invasion of glioma cells. These findings identify the PEX5-dependent signature as a promising prognostic tool for gliomas.

Uncertainty is the main source of risk of geological hazards in tunnel engineering. Uncertainty information not only affects the accuracy of evaluation results, but also affects the reliability of decision-making schemes. Therefore, it is necessary to evaluate and control the impact of uncertainty on risk. In this study, the problems in existing entropy-hazard model such as inefficient decision-making and failure of decision-making are analysed, and an improved uncertainty evaluation and control process are proposed. Then the tolerance cost, the key factor in the decision-making model, is also discussed. It is considered that the amount of change in risk value (R1) can better reflect the psychological behaviour of decision-makers. Thirdly, common attribute decision models, such as the expected utility-entropy model, are analysed, and then the viewpoint of different types of decision-making issues that require different decision methods is proposed. The well-known Allais paradox is explained by the proposed methods. Finally, the engineering application results show that the uncertainty control idea proposed here is accurate and effective. This research indicates a direction for further research into uncertainty, and risk control, issues affecting underground engineering works.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

Microbial community succession in raw milk determines its quality and storage period. In this study, carbon dioxide (CO2) at 2000 ppm was used to treat raw milk to investigate the mechanism of extending the shelf life of raw milk by CO2 treatment from the viewpoint of microbial colonies and metabolites. The results showed that the shelf life of CO2-treated raw milk was extended to 16 days at 4 ℃, while that of the control raw milk was only 6 days. Microbiomics analysis identified 221 Amplicon Sequence Variants (ASVs) in raw milk, and the alpha diversity of microbial communities increased (P < 0.05) with the extension of storage time. Among them, Pseudomonas, Actinobacteria and Serratia were the major microbial genus responsible for the deterioration of raw milk, with a percentage of 85.7%. A combined metagenomics and metabolomics analysis revealed that microorganisms altered the levels of metabolites, such as pyruvic acid, glutamic acid, 5'- cmp, arginine, 2-propenoic acid, and phenylalanine in the raw milk through metabolic activities, such as ABC transporters, pyrimidine metabolism, arginine and proline metabolism and phenylalanine metabolism, and reduced the shelf life of the raw milk. CO2 treatment prolonged the shelf life of the raw milk by inhibiting the abundance of Gram-negative aerobic bacteria, such as Acinetobacter guillouiae, Pseudomonas fluorescens, Serratia liquefaciens and Pseudomonas simiae.

The safe and efficient mining of coal seams with low porosity, low permeability and high inhomogeneity under complex geological conditions is a major challenge, among which the permeability of coal seams is crucial for coal mine gas extraction. The development of coal seam permeability enhancement technology can help coal mines to produce safely and efficiently, and the extracted coal bed methane can be utilized as a green energy. In order to study the effect of freezing and thawing on the evolution of mechanical and permeability properties of coal, triaxial permeability tests were carried out on low-permeability coal under two kinds of surrounding pressures. At the same time, dry, saturated and freeze-thaw coal were set up for comparison, and the effects of water and freeze-thaw were separated from each other. The triaxial mechanics and percolation laws of dry, saturated and freeze-thaw coal rocks were obtained, and the mechanism of the influence of freeze-thaw on the permeability evolution law of coal was revealed. The research results can provide theoretical guidance for the gas extraction technology of low permeability coal seams with increased permeability.

In order to understand the response mechanism between plant stress, physiological indicators and hyperspectral indices, pot experiments were conducted on Suaeda salsa seedlings collected from a coastal wetland area to reveal the effects of salt stress on the physiological indicators and reflectance spectra of Suaeda salsa at the canopy and leaf level. The Suaeda salsa seedlings were exposed to seven salt treatments of different concentrations (0 mmol/L (control), 50 mmol/L, 100 mmol/L, 200 mmol/L, 300 mmol/L, 400 mmol/L, and 600 mmol/L) in natural conditions. The physiological indicators of plant height, fresh weight, dry weight, leaf succulence, chlorophyll content, and carotenoid content were measured, in addition to the reflectance spectra of Suaeda salsa at both the canopy and leaf level. Firstly, the effects of salt stress on the physiological indicators and reflectance spectra were analyzed by the qualitative and quantitative methods. Then, physiological indicators sensitive to salt stress were further retrieved. Afterwards hyperspectral indices such as a/b and ((a-b)/(a+b) ) sensitive to salt stress were also extracted by one-way analysis of variance (ANOVA) and Student-Newman-Keuls (S-N-K) comparison test. Our results showed that plant height, root length, leaf succulence, biomass, Chl-a, and Chl-b were sensitive to salt stress, while carotenoids (Car) and relative water content on the root were not significantly affected by salt stress. At the salt concentration of 200 mmol/L, plant height, biomass, relative water content, leaf succulence peaked. With enhanced salt stress, physiological indicators decreased. The first-order derivative spectral reflectance has the highest correlation with salt stress, compared to the control. The spectral index most sensitive to the salt stress at the canopy level is (D₉₀₃−D₈₅₁)/(D₉₀₃+D₈₅₁), for which the multiple determination coefficient (r²) is 0.9216. While the most sensitive spectral index to the salt stress is (D₄₄₂−D₆₆₇)/(D₄₄₂+D₆₆₇) at the leaf level, for which the r² is −0.898. In summary, the results indicated that there exists the quantitative relationship between the physiological indicators and spectra reflectance under salt stress and hyperspectral plant indices can effectively estimate the degree of salt stress. The inconsistency between the diagnostic hyperspectral plant indices at the canopy and leaf levels may be caused by the observation conditions, canopy structure.

In the pursuit of China’s dual carbon goals, identifying spatio-temporal changes in industrial carbon emission efficiency and their influencing factors in cities at different stages of development is the key to effective formulation of countermeasures to promote the low-carbon transformation of Chinese national industry and achieve high-quality economic development. In this study, we used balanced panel data of 270 Chinese cities from 2005 to 2020 as a research object: (1) to show spatio-temporal evolution patterns in urban industrial carbon emission efficiency; (2) to analyze the aggregation characteristics of industrial carbon emission efficiency in Chinese cities using Global Moran's I statistics; and (3) to use the hierarchical regression model for panel data to assess the non-linear impact of the digital economy on the industrial carbon emission efficiency of cities. The results show the following: (1) the industrial carbon emission efficiency of Chinese cities exhibited an upward trend from 2005 to 2020, with a spatial distribution pattern of high in the south and low in the north; (2) China's urban industrial carbon emission efficiency is characterized by significant spatial autocorrelation, with increasing and stabilizing correlation, and a relatively fixed pattern of spatial agglomeration; (3) there is a significant inverted-U-shaped relationship between the digital economy and the industrial carbon emission efficiency of cities. The digital economy increases carbon emissions and inhibits industrial carbon-emission efficiency in the early stages of development, but inhibits carbon emissions and promotes industrial carbon emission efficiency in mature developmental stages. Therefore, cities at all levels should reduce pollution and carbon emissions from high-energy-consuming and high-polluting enterprises, gradually reduce carbon-intensive industries, and accelerate the digital transformation and upgrading of enterprises. Western, central and eastern regions especially should seek to promote the sharing of innovation resources, strengthen exchanges and interactions relating to scientific and technological innovation, and jointly explore coordinated development routes for the digital economy.

This present study was designed to find out whether the acankoreagenin showed the antidiabetic and renoprotective effects in streptozotocin (STZ)-induced diabetic nephropathy (DN) rats. Type I diabetes was induced by a single intraperitoneal injection of STZ (70 mg/kg). At the end of the experiment, rats were euthanized and serum/plasma was separated for the determination of glucose, insulin, glycated hemoglobin A1c (HbA1c), C-peptide, biochemical parameters, and kidney function. One kidney was used for determining glutathione, superoxide dismutas, malondialdehyde, and tumor necrosis factor-alpha levels. The other kidney and pancreas were used for histopathological studies and immunohistochemical measurement of transforming growth factor beta (TGF-β) or NF-κB. Acankoreagenin (2 mg/kg) treatments led to a significant reduction in blood glucose assessed via oral glucose tolerance test (OGTT) in diabetic rats at 2 h. The treatment also resulted in improved body weight, decreased HbA1c, restored lipid profile, and renal oxidative stress. By inhibiting NF-κB, the release of proinflammatory cytokines was suppressed and by inhibiting TGF-β, the renal fibrosis was suppressed in STZ-induced diabetic rat model. Histopathological injury was also observed in pancreatic and renal tissues. These findings support the beneficial effect of acankoreagenin treatment in DN, which could be attributed to its antidiabetic and renoprotective effects.

Extraction of high-resolution surface waves is essential in surface-wave survey. Because reflections usually interfere with surface waves on X component in a multicomponent seismic exploration, it is difficult to extract dispersion curves of surface waves. The situation goes more serious when the frequencies and velocities of higher-mode surface waves are close to those of PS-waves. A method for surface-wave extraction is proposed based on the morphological differences between reflections and surface waves. Frequency-domain high-resolution linear Radon transform (LRT) and time-domain high-resolution hyperbolic Radon transform (HRT) are used to represent surface waves and reflections respectively. Then, the sparse representation problem based on the morphological component analysis (MCA) is built and optimally solved to obtain high-fidelity surface waves. An advantage of our method is its ability to extract surface waves when their frequencies and velocities are close to those of reflections. Furthermore, results of synthetic and field examples confirm that the proposed method can attenuate the distortion of surface-wave dispersive energy caused by reflections, which contributes to extracting accurate dispersion curves.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

The leaves of Ligustrum robustum have been applied as Ku-Ding-Cha, a functional tea to clear heat and remove toxins; and served as a folk medicine to deal with diabetes, obesity, and hypertension. Trans-p-hydroxycinnamic acid and its esters, which were isolated from the leaves of L. robustum, might be a new resource to prevent diabetes and its complications because of their strong -glucosidase and fatty acid synthase (FAS) inhibitory activities and antioxidant effect. However, the quantitative analytical method for trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum hasn’t been reported so far. In addition, it was difficult and troublesome to analyze no less than 34 trans-p-hydroxycinnamic acid esters by usual HPLC. Therefore, a new HPLC-UV method using hydrolyzation with sodium hydroxide for quantitation of trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum was developed in the present study. The optimal hydrolyzation conditions were as follows: 1 mL sodium hydroxide aqueous solution (1 M) was added into 1 mL the extract of L. robustum and incubated at 80 °C for 2 h , and then 1 mL hydrochloride (1 M) solution was added. HPLC analysis was performed in reverse phase mode using a C-18 column, eluting with methanol-0.1% acetic acid aqueous solution (40:60, v/v) in isocratic mode at a flow rate of 1.0 mL/min, and detecting at 310 nm. The analytical method was simple and rapid, which simplified greatly the analytical process. The method was validated in terms of linearity, limit of detection (LOD), limit of quantification (LOQ), precision, and accuracy. High linearity was demonstrated with correlation coefficient of 1.000 for trans-p-hydroxycinnamic acid. The LOD and LOQ values were 1.55 and 4.69 μg/mL, respectively. The relative standard deviations (RSD) of intra-day and inter-day variabilities for trans-p-hydroxycinnamic acid were less than 2%. The percentage recovery of trans-p-hydroxycinnamic acid was 101.2% ± 0.8%. Finally, the proposed method was applied successfully to the determination and comparison of the contents of trans-p-hydroxycinnamic acid and its esters in various extracts of the leaves of L. robustum. The 60%-70% ethanol extracts of L. robustum showed the highest contents of free trans-p-hydroxycinnamic acid (3.96-3.99 mg/g), and the 50%-80% ethanol extracts of L. robustum displayed the highest contents of trans-p-hydroxycinnamic acid esters (202.6-210.6 mg/g). The method can be applied also to the quality control of the products of L. robustum.

Background: After allogeneic hematopoietic stem cell transplantation (allo-HSCT), acute leukemia relapse is common, and asymmetric bone marrow recurrence hasn’t been reported. Because the anatomical distribution of acute leukemia clones in the bone marrow after allo-HSCT is presumed to be diffuse, bone marrow aspirations are performed in single site. Case presentation: We identified two acute leukemia patients, whose leukemic burden in bilateral bone marrow specimens differed significantly. The first case was a 20-year-old man who was diagnosed with acute myelomonocytic leukemia and received haploidentical allo-HSCT. He had been in complete remission for two years and off immunosuppressive medications for a year, with normal peripheral blood count. Routine bone marrow biopsy of his left posterior iliac bone marrow showed 52% leukemia blasts, while the right side had 0% blasts ten days later. Due to the discordant results, the patient refused further intervention and died of high leukocyte syndrome four months later. The second case was a 23-year-old woman who was diagnosed with acute B lymphoblastic leukemia and received HLA-identical sibling allo-HSCT. Although 62% of blasts were found in her left iliac marrow on day +122, 0 % of blasts were found on a sample obtained from the right iliac crest on day +128. Whole-body 18F-FDG PET/CT scans confirmed that the leukemic infiltration in her bone marrow was asymmetric. Considering the higher leukemic burden on the left, we chose the left posterior iliac crest aspiration for further response evaluation. After chemotherapy combined with donor lymphocyte infusion, she achieved transient hematologic complete remission. She died of septic shock with heart failure at +258 days after allo-HSCT before infusion of anti-CD19 donor chimeric antigen receptor T cells. Conclusions: To our knowledge, these are the first case reports of asymmetric bone marrow infiltration of blasts in acute leukemia patients after allo-HSCT. Bilateral posterior iliac crest aspirations or 18F-FDG-PET/CT scans may help distinguish such distribution. If discordant bone marrow specimens are observed, physicians should restrict future bone marrow studies to the more involved side.

Innovations and improvements in hydraulic fracturing and horizontal well technologies have contributed to the success of the shale gas industry; however, the industry is also challenged by freshwater use and environmental health issues. Increasing water impact makes precise quantification of water consumption important. The objective in this study was to better understand water sustainability and availability of the projected shale gas from 2018 to 2030 in the Weiyuan play, China. The water footprint framework was used to quantify the potential water use and environmental impacts on different time scales. The results showed that the water use per well ranged from 11351.3 to 60664.73 m3, with a median of 36013.94 m3, totaling ~3.44 Mm3 for 97 wells. Yearly evaluation results showed that the gray water footprint was the main contributor and accounted for 83.82% to 96.76%, which was dependent on different scenarios of treatment percentages. The monthly environmental impact results indicated that the annual streamflow statistics were more likely to prevent water withdrawal. Water quality issues may be alleviated through recycling and retreatment measures that improve current waste water management strategies. Resource regulators should manage their water resources by matching water demand to water availability or replenishment.

Compounds with tyrosinase inhibitory efficacy could be effective as depigmenting agents. Although a large number of natural and synthetic tyrosinase inhibitors have been reported, few of them are used as skin-whitening agents due to poor activity and safety concerns. 3-(2,4-Dihydroxyphenyl)propionic acid (DPPA), a naturally occurring compound isolated from Ficus carica, was previously discovered as a moderate tyrosinase inhibitor. In this study, the structure-activity relationship study of DPPA was conducted. Compound 3g, with the 2,4-resorcinol subunit and terminal hydrophobic di-butylamino group, was identified with low nanomolar enzymatic IC₅₀ value. Additionally, compound 3g could effectively reduce melanin levels in B16-F10 melanoma cells treated with α-melanocyte-stimulating hormone (α-MSH) without affecting cell viability and proliferation. All these results indicated that compound 3g could be considered as a promising candidate for the treatment of diseases associated with hyperpigmentation.

Natural montane peatlands generally are not a significant source of nitrous oxide (N₂O) due to environment limitation including phosphorus (P) scarcity and temperature lowness. Phosphorus enrichment and warming caused by global change are altering this limitation, likely to increase the source function of N₂O. However, the combined effects of P addition and warming on N₂O fluxes and biotic/abiotic factor in peatlands are still uncertain. To address this, we investigated the long-term (12 yrs) effects of P addition (5 and 10 kg ha^-1 yr^-1) and its interaction with warming on N₂O fluxes in a peatland. The results showed that although long-term P addition did not significantly affect the source/sink function of N₂O in the peatland, it stimulated enzyme activities, promoted peat decomposition. However, warming amplified the effect of P addition to increase N₂O emissions by stimulating enzyme activities and changing soil stoichiometry, even turned the peatland into a significant source of N₂O with an emission of approximate 100 g m^-2 during the growing season. Our study suggests that P enrichment under the current background of global warming will enhance the possibility of strong N₂O emissions in montane peatlands, which may increase the risk to further aggravate global warming.

A single-crystal of ytterbium-doped “mixed” yttrium-lutetium aluminium garnet with a stoichiometric composition of (Y0.601Lu0.233Yb0.166)3Al5O12 was grown by the Czochralski method and its structure, vibronic, spectroscopic and laser properties were studied. The stimulated-emission cross-section for Yb3+ ions was maximized to 2.53×10-20 cm2 at 1031 nm, the emission bandwidth is ~8 nm and the reabsorption-free luminescence lifetime of the 2F5/2 state is 1.063 ms. Pumped at 941 nm, the Yb-laser generated a maximum output power of 1.04 W at 1.03 and 1.05 μm with a high slope efficiency of 76.4% and a laser threshold of 76 mW. A continuous wavelength tuning over a range of 51.6 nm (1026.4 - 1078.0 nm) was also achieved. Power scaling is achieved using a 969 nm-diode pumped microchip cavity. A maximum output power of ~9 W is obtained at 1.05 μm with a slope efficiency of 76% and with an almost circular laser beam profile.

Cystic Fibrosis (CF) is an inherited monogenic disorder, amenable to gene based therapies. Because CF lung disease is currently the major cause of mortality and morbidity, and lung airway is readily accessible to gene delivery, the major CF gene therapy effort at present is directed to the lung. Although airway epithelial cells are renewed slowly, permanent gene correction through gene editing or targeting in airway stem cells is needed to perpetuate the therapeutic effect. Transcription activator-like effector nuclease (TALEN) has been utilized widely for a variety of gene editing applications. The stringent requirement for nuclease binding target sites allows for gene editing with precision. In this study, we engineered helper-dependent adenoviral (HD-Ad) vectors to deliver a pair of TALENs together with donor DNA targeting the human AAVS1 locus. With homology arms of 4 kb in length, we demonstrated precise insertion of either a LacZ reporter gene or a human CFTR minigene into the target site. Using the LacZ reporter, we determined the efficiency of gene integration to be about 5%. In the CFTR vector transduced cells, we have detected both CFTR mRNA and protein expression by qPCR and Wetern analysis, respectively. We have also confirmed CFTR function correction by flurometric Image Plate Reader (FLIPR) and iodide efflux assays. Taking together, these findings suggest a new direction for future in vitro and in vivo studies in CF gene editing.

Bond Properties were performed on Ag-2.35Au-0.7Pd-0.2Pt-0.1Cu alloy wire with a diameter of 25 µm under different process parameters. Effects of electrical flaming off (EFO) current and EFO time on deformability of the free air ball (FAB) were investigated using scanning electron microscopy (SEM) as well as the effects of ultrasonic power and bonding force on the bond characteristic. The experimental results showed that, FAB grows from a preheated tip to a small ball, a regular ball and finally to a golf ball with increasing either the EFO current or the EFO time, and the FAB presented optimal shape at 25 mA and 650 μs. Moreover, a nonlinear relationship between FAB diameter and EFO time is obtained at the EFO current of 25 mA, which could be expressed by a cubic equation. Further, at a constant bonding force, as the ultrasonic power increased, the mashed ball diameter grew larger and larger, the capillary hole imprint became more and more obvious, and the tail width also increased larger and larger, and vice versa. The optimal ultrasonic power and bonding force are 70 mW and of 45 gf for ball bond and 90 mW and 75 gf for wedge bond, respectively. Finally, for all the bonded wire samples prepared under optimal process parameters, no ball and wedge bond lifts happened after destructive pull test, and full intermetallic compound coverage with perfect morphology occurred on the bond pad after ball shear test, which meant that the bonded wire samples have high bond strength, and hence improved the reliability of microelectronic products.

Transient receptor potential melastatin-8 (TRPM8) is a cation channel that is activated by cold and “cooling agents” such as menthol and icilin, which induce a cold sensation. Stimulation of TRPM8 activates an intracellular signaling cascade that ultimately leads to a change in the gene expression pattern of the cells. Here, we investigated the TRPM8-induced signaling pathway that links TRPM8 channel activation to gene transcription. Using a pharmacological approach, we show that inhibition of phosphatidylinositol 4-phosphate 5 kinase alpha (PIP5K), an enzyme essential for the biosynthesis of phosphatidylinositol 4,5-bisphosphate, attenuated TRPM8-induced gene transcription. Analyzing the link between TRPM8 and Gq proteins, we show that pharmacological inhibition of the beta gamma subunits impairs TRPM8 signaling. In addition, genetic studies showed that TRPM8 requires an activated Galpha subunit for signaling. In the nucleus, the TRPM8-induced signaling cascade triggers an activation of the transcription factor AP-1, a complex consisting of a dimer of basic region leucine zipper (bZIP) transcription factors. Here, we identified the bZIP protein c-Jun as an essential component of AP-1 within the TRPM8-induced signling cscade. In summary, with PIP5K, Gq subunits and c-Jun we have identified key molecules in the TRPM8-induced signaling from the plasma membrane to the nucleus.

The effects of acidic electrolyzed water (AEW) on the microbiological and physicochemical properties of fresh-cut red cabbages were studied. The fresh-cut red cabbages and artificially inoculated red cabbages with Salmonella Typhimurium DT104 were washed with distilled water (DW) and different available chlorine concentration (ACC) of AEW for different times. AEW treatments significantly reduced the populations of native aerobic bacteria, molds and yeasts, and artificially inoculated S. Typhimurium DT104 compared to the DW treated and untreated red cabbage samples. The effectiveness of AEW treatments was greatly enhanced with increasing ACC and treatment times. S. Typhimurium DT104 were not detected in the washing water after the red cabbages treated by AEW. The surface color, pH, and total phenolic contents were did not significantly change when the red cabbages were washed with DW and 100 ppm AEW for 3 min. The anthocyanin contents and antioxidant activities of red cabbage were significantly reduced by 18.5% for cyanidin, 22.1% for pelargonidin, and 11.2% for DPPH radical scavenging activity, the impacts on the nutritional benefits of red cabbage were considered as limited and acceptable. The optimal process condition of AEW for washing red cabbage was 100 ppm for 3 min. In these conditions, most of the native microflora were inactivated, and artificial inoculated S. Typhimurium DT104 on the red cabbage were reduced by 40.2% (3.67 log CFU/g) and with minimal losses of nutrients and antioxidant activity, as well as no requirement of discontinuation treatment on the washing water.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Honeycomb-like CO₃O₄ nanosheets with high specific surface area were successfully synthesized on porous nickel foam by the facile hydrothermal method followed by an annealing treatment (300 °C), which were used as high-performance supercapacitor electrodes. The effects of mole ratio of hexamethylenetetramine (HMT) and Co(NO₃)₂ (1:1, 2:1, 3:1, 4:1, 5:1 and 6:1）as the reactants on morphological evolution and electrochemical performance of the electrodes were investigated in detail. X-ray diffractometry, transmission electron microscopy, X-ray photoelectron spectroscopy and scanning electron microscopy were applied to characterize the structure and morphology of the products. The electrochemical performance was measured by cyclic voltammetry (CV) and galvanostatic charge/discharge. The results indicated that phase constituents were almost unaffected with the change in mole ratio of HMT and Co(NO₃)₂. However, the significant morphological evolution of Co₃O₄ was observed with increasing the mole ratio, which was described as followed: the nanosheets accompanied with a large number of spherical nanoparticles→the formation of some strip-like particles due to the agglomeration of spherical nanoparticles→the formation of new nanosheets resulting from the growth of strip-like particles→the formation of coarse flower-like particles owing to the connection among the nanosheets→the nanosheets gradually covered with flower-like particles. Accompanied with the change, the specific surface area was increased firstly, and then decreased. A maximum was obtained in the HMT and Co(NO₃)₂ mole ratio of 4:1, which was further validated by CV and galvanostatic charge/discharge tests. The specific capacitance value was 743.00 F·g^-1 at 1 A·g^-1 in the galvanostatic charge/discharge test, which was apparently higher than those in the other mole ratios (139.11 F·g^-1 in 1:1, 280.46 F·g^-1 in 2:1, 503.29 F·g^-1 in 3:1, 463.75 F·g^-1 in 5:1 and 363.74 F·g^-1 in 6:1). The change was also observed in the CV test with a scanning rate of 5 mV·s^-1 (121.32 F·g^-1 in 1:1, 217.33 F·g^-1 in 2:1, 559.86 F·g^-1 in 3:1, 693.56 F·g^-1 in 4:1, 423.35 F·g^-1 in 5:1 and 321.64 F·g^-1 in 6:1). Co₃O₄ synthesized in the mole ratio of 4:1 also demonstrated an excellent cyclic performance, in which about 97% of the initial specific capacitance was remained at 1 A·g^-1 for 500 cycles in the galvanostatic charge/discharge test. This excellent electrochemical performance was ascribed to high specific surface area of Co₃O₄ nanosheets that provide enough channels and space for ions transportion.

The utilization of tempered blast furnace (BF) slag through the direct fiber forming process to create high-value thermal insulation materials offers a dual benefit: it efficiently harnesses the latent heat within unused slag and substantially enhances the value of blast-furnace slag utilization. However, gauging the melting properties of iron slag under high temperatures is a challenge. In this study, we explore the melting behavior of SiO2 within a high-temperature molten pool. We employ dynamic visual data (video stream) captured via a non-contact charge coupled device (CCD) video recording system to extract SiO2 contours through image processing. The change in image centroid characteristics is used to establish a convolution function relationship, and MATLAB's traversal search algorithm determines SiO2's centroid position. Given that SiO2 is proportionate to crucible pixels, the area of SiO2 is calculated through pixel statistics within these contours. Subsequently, we propose a new indirect method to process image information, yielding SiO2 volume and mass at different time points. An exponential fitting yields the melting rate function of SiO2. Finally, we compare this indirect method with shape from shading (SFS), quantitative characterization, and dimensional analysis techniques. We also discuss the strengths and limitations of each method. Our findings reveal that the indirect solution method presented here boasts straightforward calculation steps and imposes minimal image format requirements. This research provides theoretical and technical support for blast-furnace slag's direct fiber forming process.

Steam Generator Level Control System (SGLCS) is one of the key instrumentations and control subsystems to ensure the safe operation of nuclear power plants. It is highly recommended to perform reliability analysis for SGLCS for making better maintenance strategy. SGLCS is a digital control system with complex redundant configuration and failure\self-diagnosis\repair action, traditional fault tree is not applicable due to its static property, Markov model is not a good choice too because of heavy burden of creating state transition graph for even medium-size system. Boolean Logic Driven Markov Process (BDMP) can describe complex failure-repair state transition via ‘trigger link’ and three kinds of leaf nodes, as well as keep compact and easy-read struct like fault tree. So BDMP is adopted to analysis reliability of SGLCS. Graphical BDMP modeling environment KB3 and Monte Carlo simulator YAMS is used for BDMP modeling and quantitative analysis respectively, and unavailability of SGLCS is obtained. The contribution of three parts of SGLCS to the unavailability of the system is also evaluated, and it is found that the water supply flow control part contributes the most to the failure of SGLCS.

The aim of this study is (a) to develop, test, and employ a combined method of unsupervised machine learning to objectively assess the condition of sports facility in primary schools (PSSFC) and (b) examine the examine the geographical and typological association with PSSFC. Based on the Sixth National Sports Facility Census (NSFC), six PSSFC indicators (indoor and outdoor facility included) were selected as the measurements and decomposed by using the t-stochastic neighbor embedding (t-SNE). Thereafter, the Fuzzy C-mean (FCM) algorithm was used to cluster the same type of PSSFC with selecting the optimum numbers of evaluation level. Overall 845 primary schools in Shanghai, China were recruited and tested by this combined approach of unsupervised machine learning. In addition, the two-way analysis of covariance was used to examine the location and types of school associated with PSSFC variables in each level. The combined method was found to have acceptable reliability and good interpretability, differentiating PSSFC into five gradient levels. The characteristics of PSSFC differ by the location and school type of individual school. Our findings are conducive to the regionalized and personalized intervention and promotion on the children’s physical activity (PA) upon the practical situation of particular schools.

In order to improve the adaptability of broilers to low-temperature environments and their ability to resist acute cold stress (ACS), 240 one-day-old broilers were selected and randomly divided into three groups. The control treatment (CC) was raised at the conventional feeding temperature from 1-43 days (d), the cold stimulation treatments (CS) were kept at 3 °C below the temperature of CC at 1-d intervals for 3 and 6 hours from 15 to 35 d, namely CS3 and CS6, respectively. Then all broilers were kept at 20 °C from 36 to 43 d. ACS was then carried out at 44 d, and the ambient temperature was dropped to 10 °C for 6 hours. The study investigated the production perfor-mance, as well as levels of intestinal barrier genes (including Claudin-1, E-cadherin, Occludin, ZO-1, ZO-2 and Mucin2), secretory IgA in duodenum and jejunum, and immunoglobulins (IgA and IgG) in serum. The results showed that IMCS could increase the daily weight gain and decrease the feed conversion ratio. During the IMCS, the expression levels of intestinal barrier genes were up-regulated and the content of secretory IgA was increased. When IMCS ceased for one week, the level of immunoglobulins in serum stabilized, and the expression levels of Occludin, ZO-2 and Mucin2 still maintained high levels. After ACS, broilers that received IMCS training maintained the high levels of intestinal barrier genes and secretory IgA.

Mitochondrial alternative oxidase 1a (AOX1a) plays an extremely important role in critical node of seed viability. However, the regulatory mechanism is still poorly understood. The study aims to identify regulatory mechanisms by comparing between OsAOX1a-RNAi and wild type (WT) rice seed during artificial aging treatment. Gain weight and P50 significantly decreased in OsAOX1a-RNAi rice seed, indicating that there might be impaired in seed development and storability. Compared to WT seeds in the 100%, 90%, 80%, and 70% germination, respectively, NADH and succinate-dependent O2 consumption, the activity mitochondrial malate dehydro-genase and ATP contents were decreased in OsAOX1a-RNAi seeds in the 100%, 90%, 80%, and 70% germination, respectively, indicating that mitochondrial status in the OsAOX1a-RNAi seeds after imbibition was weaken than the WT. In addition to, the reduced abundance of complex I N and P module subunits might showed that the capacity of mitochondrial electron transfer chain was significantly inhibited in the OsAOX1a-RNAi seed at critical node of seed viability. Above results might indicated that the ATP production was impaired in OsAOX1a-RNAi seeds during ageing. Therefore, we conclude that the activities of mitochondrial metabolism and alternative pathways were severely inhibited in OsAOX1a-RNAi seeds at critical node of viability, which was leading to accelerate the collapse of seed viability. The precise regulatory mechanism of the alternative pathway at the critical node of viability still needs to be further analyzed.

Strigolactones (SLs) are a novel emerging plant hormones, which play important roles in regulating plant organ development and environmental stress tolerance. Even though the SL related genes have been identified and well characterized in some plants. The information of SL related genes in soybean is not fully established yet, especially in response to salt stress. In this study, we identified nine SL biosynthesis genes: two D27, two CCD7, two CCD8, and three MAX1, and seven SL signaling genes: two D14, two MAX2 and three D53 in soybean genome. We found that SL biosynthesis and signaling genes are conserved during evolution in different species. Syntenic analysis of these genes revealed their location on nine chromosomes as well as existence of ten pairs of duplication genes. Moreover, plant hormone and stress-responsive elements were identified in the promoter regions of SL biosynthesis and signaling genes. By using quantitative real-time PCR (qRT-PCR), we confirmed that SL genes have different tissue expression in roots, stems and leaves. Further, we also explored the expression profiles of SL biosynthesis and signaling genes under salt stress. These results suggested that SL signaling genes may play important regulatory roles in response to salt stress. In conclusion, we identified and provided valuable information on the soybean SL biosynthesis and signaling genes, and established a foundation for further functional analysis of soybean SL related genes in response to salt stress.

We investigated the response of leaf photosynthetic capacity to climate warming and its variation among provenances of Larix gmelinii (Dahurian larch). Seedlings of 11 L. gmelinii provenances were transplanted into two common gardens with different climate conditions (control and warming climate). We measured the leaf photosynthetic capacity and explored its influencing factors. The warming treatment significantly increased the maximum net photosynthetic rate (Pmax-a), photosynthetic nitrogen use efficiency (PNUE), maximum carboxylation rate (Vcmax), maximum electron transport rate (Jmax), triose phosphate utilization rate (TPU), mesophyll conductance (gm), leaf nitrogen content (Narea), and chlorophyll content (Chlm). The Pmax-a was significantly positively associated with Vcmax, Jmax, TPU, gm, and Narea, and the slope of the correlations between Pmax-a and Vcmax, Jmax, and TPU was steeper in the warming treatment. The responses of Pmax-a, PNUE, Vcmax, Jmax, TPU, Narea, and Chlm to warming differed among provenances. The effects of warming on Pmax-a, Vcmax, Jmax, and TPU increased and then decreased as the aridity index of the original site increased. Overall, the warming treatment improved the photosynthetic capacity of L. gmelinii, but the extent of the improvement varied among provenances. These findings provide insights into the mechanisms underlying the responses of L. gmelinii to climate warming.

Plant protein phosphatase 2Cs (PP2Cs) serve as negative regulators of protein kinase cascades activated in different processes and play important roles in plant development and abiotic-stress-mediated signaling pathways. In this study, a genome-wide study was conducted on the CqPP2C gene family. A total of putative 117 CqPP2C genes were identified. Comprehensive analyses of physical and chemical feature, chromosome localization and subcellular localization were conducted. According to phylogenetic analysis, CqPP2Cs were divided into 13 subfamilies. CqPP2Cs in the same subfamily had similar gene structure, conserved motif and all the CqPP2C proteins had the type 2C phosphatase domains. Gene duplication revealed that segmental duplication was the major driving force for CqPP2Cs expansion and all duplicated CqPP2Cs evolved from purifying selection. The expression of CqPP2Cs in various tissues under different abiotic stresses was analyzed using RNA-seq data. The results revealed that CqPP2C genes were involved in regulating development and stress responses of quinoa. Real-time quantitative reverse transcription PCR (qRT-PCR) analysis of six CqPP2C genes in subfamily A revealed that they were up-regulated or down-regulated under salt and drought treatments. Furthermore, the results of yeast two-hybrid assays revealed that subfamily A CqPP2Cs interacted not only with subclass III CqSnRK2s, but also with subclass II CqSnRK2s. Subfamily A CqPP2Cs could interact with CqSnRK2s in different combinations and intensities to respond to various biological processes and stresses. Overall, our results will be useful for understanding the functions of CqPP2C in regulating ABA signals and responding to abiotic stress.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

Forest ecosystems make a greater contribution to carbon (C) stocks than any other terrestrial ecosystem. To understand the role of regional forest ecosystems in global climate change and carbon exchange, forest C stock and its spatial distribution within the small (2,300 km2) Liuxihe River basin were analyzed to determine the different contributors to the C stock. Forest C stocks were quantified by measuring the biomass of trees, understory vegetation, litter and roots, as well as soil organic C, using data from field samples and laboratory experiments. The results showed that forests stored 38.04 Tg C in the entire basin, with secondary and planted forests accounting for 89.82% and 10.18%, respectively, of the stored C. Five types of forests, a subtropical evergreen broad-leaved forest, a subtropical coniferous and broad-leaved mixed forest, a subtropical coniferous forest, a timber forest, and a non-wood forest, stored 257.55 ± 15.01, 218.92 ± 9.59, 195.24 ± 18.29, 177.42 ± 17.55, and 117.86 ± 6.04 Mg C ha−1, respectively. In the forest ecosystem C stocks of the basin, soils averagely contribute about 73.78%, not including root underground biomass. It provides a comprehensive method for forest ecosystem carbon investigation and forest management in small basin scale.

Background: The major histocompatibility complex (MHC) plays a key role in the adaptive immune response to pathogens due to its extraordinary polymorphism. However, the spatial patterns of MHC variation in the striped hamster remain unclear, particularly regarding the relative contribution of balancing selection in shaping MHC population and diversity compared to neutral forces. Methods: In this study, we investigated the immunogenic variation of the striped hamster in four wild populations in Inner Mongolia, which experience heterogeneous parasitic stress. Our goal was to identify local adaptation by comparing the genetic structure at MHC with that at seven microsatellite loci, taking into account neutral processes. Results: We observed significant variation in parasite pressure among sites, with parasite burden showing a correlation with temperature and precipitation. Molecular analysis revealed a similar co-structure between MHC and microsatellite loci. We observed lower genetic differentiation at MHC loci compared to microsatellite loci, and no correlation was found between the two. Conclusions: Overall, these results suggest a complex interplay between neutral evolutionary forces and balancing selection in shaping the spatial patterns of MHC variation. Local adaptation was not detected at a small scale but may be applicable at a larger scale.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

The study of the currently known >3,000 species of snakes can provide valuable insights into the evolution of their genomes. Deinagkistrodon acutus, also known as Sharp-nosed Pit Viper, one hundred-pacer viper or five-pacer viper, is a venomous snake with significant economic, medicinal and scientific importance. Widely distributed in southeastern China and South-East Asia, D. acutus has been primarily studied for its venom. Here, we employed next-generation sequencing to assemble and annotate a highly continuous genome of D. acutus. The genome size is 1.46 Gb; its scaffold N50 length is 6.21 Mb, the repeat content is 42.81%, and 24,402 functional genes were annotated. This study helps to further understand and utilize D. acutus and its venom at the genetic level.

Moso bamboo is famous for fast growing and biomass accumulation, as well as high annual output for timber and bamboo shoots. These high outputs require high nutrient inputs to maintain and improve stand productivity. Soil nitrogen (N), phosphorus (P) and potassium (K) are important micronutrients for plant growth and productivity. Due to high variability of soils, analysing spatial patterns of soil N, P and K stocks is necessary for scientific nutrient management in Moso bamboo forests. In this study, soils were sampled from 138 locations across Yong’an City and ordinary kriging was applied for spatial interpolation of soil N, P and K stocks. Soil N stock showed a strong spatial dependence while soil N and P stocks presented a moderate spatial dependence, indicating soil N was mainly controlled by intrinsic factors while soil N and P stocks were controlled by both intrinsic and extrinsic factors. Different spatial patterns were observed for soil N, P and K stocks across the whole study area, indicating that fertilizations with different ratios of N:P:K should be applied for different sites to maintain and improve stand productivity. The total soil N, P and K stocks within 0-60 cm were 0.624, 0.020 and 0.583 Tg, respectively.

The three-pronged sliding universal coupling is a new kind of three-pronged coupling. To study its kinematic and dynamic characteristics, directional cosine matrices are utilized as tools to analyze the coordinate systems by establishing simplified geometric models and corresponding motions. Through the analysis of the motions of the input and output shafts and employing the method of single-force element, a set of equilibrium equations for the forces acting on the output shaft and the input shaft are formulated for solution analysis. The research indicates that during the rotation process, there exists a small angular difference between the input shaft and the intermediate shaft, demonstrating the quasi-constant angular velocity characteristics of the new tripod sliding universal coupling. The curves of the forces and torques acting on each component of the coupling approximate sinusoidal curves. The optimal operating angle range for the new tripod universal coupling is at angle , during which the system exhibits good transmission and mechanical performance.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

The ADP-ribosylation factor 6 (Arf6), as the only member of the Arf family III protein, has been extensively studied for its diverse biological functions in animals. Previously, the Arf6 protein in Magnaporthe oryzae was found to be crucial for endocytosis and polarity establishment during asexual development. However, its role remains unclear in Sclerotinia sclerotiorum. Here, we identified and characterized SsArf6 in S. sclerotiorum using a reverse genetic approach. Deletion of SsArf6 impaired hyphal growth and development, and produced more branches. Interestingly, knockout of SsArf6 enhanced the tolerance of S. sclerotiorum to oxidative stress but the sensitivity to osmotic stress, and increased melanin accumulation, indicative of different roles of SsArf6 in various stress responses. Moreover, the appressorium formation was severely impaired, and fungal virulence to host plants was significantly reduced. Overall, our findings demonstrate the essential role of SsArf6 in hyphal development, stress responses, appressorium formation, and fungal virulence to host plants.

Soarinho Alkaline Intrusion, southeastern Brazil, makes part of the Serra do Mar Igneous Province, and it is composed of alkali feldspar syenite, alkali feldspar trachyte, quartz syenite, and mon-zonite. Geochemical and geochronological analysis of the Soarinho were compared with data from its neighbors Rio Bonito and Tanguá. Zircon U-Pb Laser Ablation ages show that Soarinho is youngest than Rio Bonito and Tanguá. Ages obtained from the monzonite (60 ± 2 Ma), alkali feldspar syenite (58 ± 2 Ma), and quartz syenite (58 ± 2 Ma) are indistinguishable within error. Petrographic and geochemical data show a clear contrast among Soarinho, Rio Bonito, Tanguá, and Lu-Hf isotopic data for the three alkaline intrusions (all negative), point to some similarities in their sources. The data suggest an enriched mantle source for Soarinho; however, an older con-tinental crust contribution cannot be discarded.

Natural vegetation restoration has become an effective and rapid way for eco-logical restoration in fragile areas. However, the response of soil microorgan-isms remains unclear. Using high-throughput sequencing methods, we evalu-ated the dynamics of soil bacterial and fungal communities during forest suc-cession (shrubland, secondary forest, and primary forest) in the karst region of Southwest China. Secondary forest had significantly higher bacterial α-diversity than the shrubland and primary forest. Soil bacterial community in the primary forest was close to the shrubland but diverged from the secondary forest, and that the fungal community could be discriminated along forest suc-cession. Also, the microbial co-occurrence network indicated that soil fungi had less but more intense relationships than bacteria in the karst forests. Further-more, soil properties (pH, SOC, TN, moisture, and AK), soil microbial biomass (MBP, and MBN), and plant factors (Shannon index of woody plants) drove the dynamics of the soil bacterial community, while soil properties (i.e., pH) mostly explained the variation of the soil fungal community along karst forest succession. Different responses of soil bacteria and fungi to forest succession in a karst region give hints for ecological restoration along forest succession in the karst region.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

This work is devoted to physical vapor deposition synthesis, and characterisation of bismuth and lutetium-substituted ferrite-garnet thin-film materials for magneto-optic (MO) applications. The properties of garnet thin films sputtered using a target of nominal composition type Bi_0.9Lu_1.85Y_0.25Fe_4.0Ga₁O₁₂ are studied. By measuring the optical transmission spectra at room temperature, the optical constants and the accurate film thicknesses can be evaluated using Swanepoel’s envelope method. The refractive index data are found to be matching very closely to these derived from Cauchy’s dispersion formula for the entire spectral range between 300-2500 nm. The optical absorption coefficient and the extinction coefficient data are studied for both the as-deposited and annealed garnet thin-film samples. A new approach is applied for accurately deriving the optical constants data simultaneously with the physical layer thickness, using a combination approach employing custom-built spectrum-fitting software in conjunction with Swanepoel’s envelope method. MO properties, such as specific Faraday rotation, MO figure of merit and MO swing factor are also investigated for several annealed garnet-phase films.

Predators are dependent on the capture of prey to meet their energetic and nutritive requirements, imposing a regime of predation risk. Consequently, prey experience both consumptive and non-consumptive effects. Non-consumptive effects may manifest through altered growth and ontogenetic trajectories of prey species, a dynamic modulated by olfactory or other sensory cues from predators. Bactrocera dorsalis Hendel represents a great invasive threat to global horticulture. While earlier research has primarily centered on the consumptive interactions between B. dorsalis and its natural enemies, the potential consequences of non-consumptive interactions on the development of B. dorsalis have been overlooked. In this study, we investigated the impact of predation risk effects, induced by both visual exposure to the predatory mantis Hierodula patellifera Serville and its associated odor, on the life history traits of B. dorsalis. Female B. dorsalis demonstrated reduced development time in the presence of isolated H. patellifera or H. patellifera odor, yet evidenced significantly increased fecundity. Conversely, males displayed no significant change in development time. Additionally, neither female nor male body weight at death was significantly influenced by predation risk from isolated predators or predator odor. These results indicated adaptive developmental strategies of B. dorsalis when faced with risks from predators and highlight the important role of predator odor, which has the potential to lay the groundwork for improving biological control efforts and innovative approaches within pest control.

Green-space resources, in the context of urbanisation, cannot meet the actual needs of residents well, and the study of the balance of green-space resource allocation from the relationship between supply and demand is an urgent problem to be solved. This study quantitatively evaluates the green-space supply level from four dimensions by constructing a framework for assessment in the community life circle. It also evaluates the matching of green space supply and demand, resource distribution fairness, and distribution equilibrium under group differentiation through the supply–demand coupling matrix, Gini coefficient, and the Kruskal–Wallis H non-parametric rank-sum test, respectively. This study shows that (1) a significant spatial imbalance exists in green-space resource allocation in community life circles in different dimensions. (2) The comprehensive green-space supply level in the community life circle matched the total demand of residents to a low degree. (3) There was significant inequality in green-space resource allocation within the community life circle (the Gini coefficient of each evaluation perspective was > 0.4). Based on the study results, we were able to identify community life circles with spatial mismatches, different supply and demand, and other green-space resource allocation problems, which is of great significance to urban green-space research and planning practice under the "green justice" framework.

Calcareous sand deposits are widely distributed along the shoreline in ropical and subtropical regions. Microbially induced calcite precipitation treatment (MICP) is a relatively new method to improve the stiffness and strength of the soil. Little is known about the small-strain shear modulus and damping ratio of MICP-treated calcareous sand, which are two crucial parameters for the prediction of the dynamic behavior of soil. A series of resonant column tests are performed to investigate the dynamic performance of MICP-treated calcareous sand, with special attention paid to the influence of treatment duration and confining stress on the stiffness and damping characteristics. The relationship between the initial dynamic shear modulus and unconfined compressive strength is analyzed. Additionally, the empirical equations of the reference shear strain between treatment duration and confining stress are given. The G/G0 of MICP-cemented calcareous sand presents a higher strain sensitivity than that of untreated sand, and its attenuation pattern can be described by Hardin-Drnevich model. The σc has an apparent effect on the degradation characteristics of the dynamic shear modulus of MICP-treated calcareous sand with a low cementation level, however, its effect decreases with the increasing treatment duration. The relationship between the reference shear strain and the treatment duration and confining stress can be described by a power and a linear formula, respectively.

We tested selecting data randomly or proportionally in class imbalanced sample. Collecting data into the training and test set according to the initial ratio of QSOs, galaxies and stars were rec-ommended. We experimented using the original imbalanced data or introducing the class balance technologies: SMOTE, SMOTEENN, SMOTETomek, ADASYN, BorderlineSMOTE1, Border-lineSMOTE2, and RandomUndersampling. The SMOTEENN performed the best in the Sample 1. The LightGBM, CatBoost, XGBoost, and RF were compared when adopting the SMOTEENN using the petroMag_u, petroMag_g, petroMag_r, petroMag_i, petroMag_z, J, H, Ks, W1, W2, W3, W4 magnitudes as features. All of the precisions or recalls exceeded 0.94. The RF cost a little more time than the other three algorithms, but resulted in the best evaluating indicators. Utilizing the SMOTEENN +RF technology, the precision, recall and f1-score for QSOs (galaxies, stars) could achieve 0.98 (0.99, 0.98), 0.99 (0.96, 1.00), 0.98 (0.97, 0.99) respectively in Sample 1. Utilizing the SMOTEENN +RF technology, the precision, recall and f1-score for QSOs (galaxies, stars) could achieve 0.94 (0.96, 0.96), 0.98 (0.90, 0.97), 0.96 (0.93, 0.97) using the petroMag_u, petroMag_g, petroMag_r, petroMag_i, petroMag_z, W1, W2, W3, W4 magnitudes as features.

Background: Pittosporum tobira (Thunb.) Aiton is an aromatic medicinal plant widely cultivated in the world. However, the essential oils (EOs) from P. tobira flowers for anti-cancer potential is still not systematically studied. The present aim to elucidate the phytochemical composition of the EOs and to explore mechanism of anticancer action. Methods: The EOs were extracted and analyzed by headspace solid-phase microextraction (HS-SPME) with gas chromatography-mass spectrometry (GC-MS). Volatile components were identified according to Kovats retention index (KI) and NIST database. The anti-neoplasm mechanisms of the EOs was comprehensively investigated in lung carcinoma A549 and H460 cells. Results: A total of 47 secondary metabolites representing 94.18% of the EOs were successfully identified: monoterpenes and sesquiterpenes were the dominant terpenoids. The EOs exhibited antiproliferative activity on A549 and H460 lung carcinoma cells. Hoechst 33324 fluorescent staining indicated the typical characteristics of apoptosis and induced cycle phase arrest. AnnexinV/PI staining revealed that the number of apoptotic cells was increased. Furthermore, the EOs also induced the caspase-mediated mitochondrial apoptosis pathway. Conclusions: Findings suggest that the full-scale chemical composition and first characterization of anticancer activities of the EOs, it could be used for integrative natural anti-cancer agents in health care should be pay more attention.

Gas flaring is commonly used by industrial plants for processing oil and natural gases in the atmosphere, and hence is an important anthropogenic source for various pollutants including CO₂, CO, and aerosols. This study evaluates the feasibility of using satellite data to characterize gas flaring form space by focusing on the Khanty Mansiysk Autonomous Okrug in Russia, a region that is well known for its dominatingly gas flaring activities. Multiple satellite-based thermal anomaly data products at night are inter-compared and analyzed, including MODIS (Moderate Resolution Imaging Spectroradiometer) Terra level-2 Thermal Anomalies product (MOD14), MODIS Aqua level-2 Thermal Anomalies product (MYD14), VIIRS (Visible Infrared Imaging Radiometer Suite) Active Fires Applications Related Product (VAFP), and VIIRS level-2 data based Nightfire product (VNF). The analysis compares and contrasts the efficacy of these sensor products in detecting small, hot sources like flares on the ground in extremely cold environments such as Russia. We found that the VNF algorithm recently launched by NOAA has the unprecedented accuracy and efficiency in characterizing gas flares in the region owing primarily to the use of Shortwave Infrared (SWIR) bands. Reconciliation of VNF’s differences and similarities with other nighttime fire products is also conducted, indicating that MOD14/MYD14 and VAFP data are only effective in detecting those gas flaring pixels that are among the hottest in the region. Validation of VNF product of gas flaring location with Google Earth images are made. It is shown that that VNF’s estimates of gas flaring area (the area of gas flaming) agree well the counterparts from Google images with a linear correlation of 0.91, highlighting its potential use for routinely monitoring emissions of gas flaring from space.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

Recently, research on ultra-high-performance concrete (UHPC) with the characteristics of ultra-high strength, high toughness, and high durability has been actively conducted from materials to actual structural applications. However, research on experimental methods that reflect the unique characteristics of UHPC, which are different from those of normal concrete, is insufficient. To solve the difficulties in applying the compressive creep test method for normal concrete to UHPC and to verify the validity of the recently proposed ASTM C 1856 standard test method, this study performed compressive creep tests on UHPC with variables of specimen size, sustained load intensity, fiber length, and strain measuring method. Two types of cylindrical specimens of ϕ100 × 200 mm and ϕ75 × 150 mm were used for a specimen size variable. The sustained load intensities of 10% to 40% based on the specified compressive strength of 150 MPa were applied. Two types of steel fiber lengths of 13 mm and 19.5 mm in the UHPC mix were used as a variable, and three strain measuring methods of the embedded strain gauge method, the attached strain gauge method, and the strain meter with stud measured the change in length of the UHPC specimens. The experimental results showed that the strain meter method using the standard rod had limitations due to the error in the verification process using the standard rod and the observation error of the measurer, and the sustained load intensity is preferable to 15% to 40% of the actual compressive strength. It was found that it is possible to perform a compressive creep test for UHPC using a specimen with a size of ϕ75 mm or more, and the fiber length did not affect the creep behavior of UHPC up to 19.5 mm. As a result of comparing the UHPC creep test results with the creep prediction model, the B3 model was found to most accurately predict the UHPC creep behavior. The creep coefficient pattern of the B3 model was very similar to the measured results, and well reflected the effects of the mixing ratio and compressive strength of UHPC.

With the rapid evolution of SARS-CoV-2, the emergence of new strains is an intriguing question. This paper presents an evolutionary theory to analyze the mutations of the virus and identify the conditions that lead to the generation of new strains. We represent the virus variants using a 4-letter sequence based on amino acid mutations on the spike protein and employ an n-distance algorithm to derive a variant phylogenetic tree. We show that the theoretically-derived tree aligns with experimental data on virus evolution. Additionally, we propose an A-X model, utilizing the set of existing mutation sites (A) and a set of randomly generated sites (X), to calculate the emergence of new strains. Our findings demonstrate that a sufficient number of random iterations can predict the generation of new macro-lineages when the number of sites in X is large enough. These results provide a crucial theoretical basis for understanding the evolution of SARS-CoV-2.

To achieve a micro-destructive and rapid measurement of the wood density of standing trees, this study investigated the feasibility of using the micro-drilling resistance method, formulated a mathematical model, explored the potential for a unified model across multiple tree species, and analyzed the influence of moisture content on measurement accuracy. First, 231 tree cores and drill resistance data were sampled from Pinus massoniana, Cunninghamia lanceolate, and Cryptomeria fortunei. The basic density and moisture content of each core were measured, and the average value of each resistance data record was calculated. Second, the average drill resistance, the natural logarithm of average drill resistance, and absolute moisture content were used as independent variables, while the wood basic density was used as the dependent variable. Third, the total model of the three tree species and sub-model for each tree species were established through a stepwise regression method. Finally, the accuracy of each model was compared and analyzed with that of using the average basic density of each tree species as an estimated density. The results revealed that the estimation accuracy of the sub-model for each tree species was 1.670 percentage points higher than the average value of each tree species used as the density estimation value for these tree species. Additionally, except for Cryptomeria fortunei, the natural logarithm of drill resistance significantly influenced the wood density model at a significance level of 0.05. Moreover, moisture content significantly affected the total model and sub-models of Pinus massoniana at a significance level of 0.05. The estimation accuracy of the total mathematical model was 2.125 percentage points lower than that achieved using the average basic density of each tree species to predict their density. The results indicated the feasibility of using the micro-drilling resistance method to measure the wood density of standing trees. Moreover, the relationship between wood density and drill resistance did not follow a linear pattern, and moisture content slightly influenced the drill needle resistance. Furthermore, the establishment of a mathematical model for each tree species was deemed essential. This study provides valuable guidance for measuring the wood density of standing trees through the micro-drilling resistance method.

ABSTRACT Background It is important to be able to predict, for each individual patient, the likelihood of later metastatic occurrence, because the prediction can guide treatment plans tailored to a specific patient to prevent metastasis and to help avoid under- or over-treatment. Deep Neural Network (DNN) learning, commonly referred to as deep learning, has become popular due to its success in image detection and prediction, but questions such as whether deep learning outperforms other machine learning methods when using non-image clinical data remain unanswered. Grid search has been introduced to deep learning hyperparameter tunning for the purpose of improving its prediction performance, but the effect of grid search on other machine learning methods are under-studied. In this research, we take the empirical approach to study the performance of deep learning and other machine learning methods when using non-image clinical data to predict the occurrence of breast cancer metastasis (BCM) 5, 10, or 15-years after the initial treatment. We developed DNN models as well as models using 9 other machine learning methods including Naive Bayes (NB), Logistic Regression (LR), Support Vector Machine (SVM), LASSO, Decision Tree (DT), k-Nearest Neighbors (KNN), Random Forrest (RF), AdaBoost (ADB), and XGBoost (XGB). We used grid search to tune hyperparameters for all methods. We then compared the deep learning models to the models trained using the 9 other machine learning methods. Results Based on the mean test AUC results, DNN ranks 6th, 4th, and 3rd when predicting 5-year, 10-year, and 15-year BCM respectively, out of 10 machine learning methods. The top performing methods in predicting 5-year BCM are XGB(1^st), RF(2^nd), and KNN(3^rd). For predicting 10-year BCM the top performers are XGB (1^st), RF(2^nd), and NB(3^rd) . Finally, for 15-year BCM the top performers are SVM (1^st), LR and LASSO (tied for 2^nd), and DNN (3^rd). The ensemble methods RF and XGB outperform other methods when data are less balanced, while SVM, LR, LASSO, and DNN outperform other methods when data are more balanced. Our statistical testing results show that at a significance level of 0.05 DNN overall performs no worse than other machine learning methods when predicting 5-year, 10-year, and 15-year BCM. Conclusions Our results show that deep learning with grid search overall performs at least as well as other machine learning methods when using non-image clinical data. It is interesting to note that some of the other machine learning methods such as XGB, RF, and SVM are very strong competitors of DNN when incorporating grid search. It is also worth noting that the computation time required to do grid search with DNN is way more than that required to do grid search with the other 9 machine learning methods.

In the recent decade, Building Information Modelling (BIM) has widely been adopted in the Architecture, Engineering and Construction (AEC) industry and completely upended the way we build. While BIM continues gain momentum in the industry, it has also attracted increasing attentions from researchers. However, most of the current study focuses on reviewing BIM for management, BIM for green building, BIM for infrastructure and BIM for Facilities Management (FM). There are few studies about Global BIM review and to discuss their complex inter-connections. In this study, we adopted a scientometric analysis method to review global BIM research from 2004-2019. A total of 1455 scholarly bibliographic records obtained from Web of Science Core Collection databased were established for the analysis. This study has identified the top productive and influential researchers, research institutes, regions/countries, subject categories and journals in the BIM field. In addition, 11 clusters of Global BIM research were also identified including construction project, green BIM, construction safety planning, automated IFC-based workflow and so on. Authors distinguished 11 clusters of global BIM research into 3 stages, namely formulating stage, accelerating stage and transforming stage. Furthermore, authors reviewed the BIM policy of Singapore and observed there is a co-production relationship between evolution of BIM policy and global BIM research. These findings provide valuable information for researchers, practitioners and policy makers by visualizing the current progress in the research field of BIM and highlighting future research needs.

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

Ningxiang pig is renowned breed for its exceptional meat quality, but it possesses suboptimal carcass traits. To elucidate the genetic architecture of meat quality and carcass traits in Ningxiang pigs, we assessed heritability and executed a genome-wide association study (GWAS) concerning carcass length, backfat thickness, meat color parameters (L.LD, a.LD, b.LD), and pH at two postmortem intervals (45 minutes and 24 hours) within a Ningxiang pig population. Heritability estimates ranged from moderate to high (0.30 ~ 0.80) for carcass traits and from low to high (0.11 ~ 0.48) for meat quality traits. We identified 21 significant SNPs, the majority of which were situated within previously documented QTL regions. Furthermore, the HMGA1 gene emerged as a pleiotropic gene correlated with carcass length and backfat thickness. The ADGRF1, FKBP5, and PRIM2 genes were associated with carcass length, while the NIPBL gene was linked to backfat thickness. These genes hold potential for use in selective breeding programs targeting carcass traits in Ningxiang pigs.

Pyrethroid pesticides (PYRs) as the third most widely used pesticides, following organophosphorus and carbamate pesticides, which are of significant importance in the analysis and detection of vegetables. However, the current pretreatment technology for PYRs confronts challenges of difficult separation and low enrichment efficiency, resulting in a cumbersome and time-consuming pretreatment process with poor selectivity. Here, a simple and efficient magnetic solid-phase extraction (MSPE) strategy was developed to simultaneously purify and enrich five PYRs in vegetables, with the magnetic covalent organic framework nanomaterial COF-SiO2@Fe3O4 as an adsorbent. The COF-SiO2@Fe3O4 was prepared by a simple solvothermal conditions method, using Fe3O4 as magnetic core, benzidine and 3,3,5,5-tetraaldehyde biphenyl as two building units. COF-SiO2@Fe3O4 could effectively capture the targeted PYRs by virtue of its abundant π-electron system and hydroxyl groups. The impact of various experimental parameters on extraction efficiency was investigated to optimize the MSPE conditions, including adsorbent amount, extraction time, elution solvent type and elution time. Subsequently, method validation was conducted under the optimal conditions in conjunction with gas chromatography-mass spectrometry (GC-MS). Within the range of 5.00–100 μg·kg-1 (1.00–100 μg·kg-1 for bifenthrin and 2.5–100 μg·kg-1 for fenpropathrin), the five PYRs exhibited a strong linear relationship, with determination coefficients ranging from 0.9990 to 0.9997. The limits of detection (LODs) were 0.3–1.5 μg·kg-1, and the limits of quantification (LOQs) were 0.9–4.5 μg·kg-1. The recoveries were 80.2–116.7% with relative standard deviations (RSDs) below 7.0%. Finally, COF-SiO2@Fe3O4, NH2-SiO2@Fe3O4 and Fe3O4 were compared as MSPE adsorbents for PYRs. The results indicated that COF-SiO2@Fe3O4 was an efficient and rapid selective adsorbent for PYRs. This method holds promising prospects for the determination of PYRs in real samples.

In response to the structural optimization problem of PCB stator coreless disc motors, the orthogonal response surface method was used to optimize the motor structure, determine the basic parameters of the motor preliminarily, and conduct orthogonal experiments on the motor parameters based on the optimization design objectives, The optimization factors were the quantity of magnetic pole of the motor rotor, the ratio of main/auxiliary pole size, the thicknessof the permanent magnet, and the air gap length.The motor torque，the amplitude of magnetic density of the air gap and waveform distortion rateare used as optimization objectives. The motor parameters that make the motor torque reach the maximum, the air gap magnetic density maximum, and the waveform distortion rate minimum. Due to the use of PCB plates instead of motor stator cores in PCB coreless disc motors,The service life of the PCB board during motor operation will be reduced with the temperature rise generated by the stator winding To solve this problem, the response surface analysis of the motor is carried out to reduce the temperature rise of the stator windings during the operation of the motor. PCB board and stator winding are the main factors affecting the temperature rise of the motor.Taking the thickness of the PCB board, the hole diameter on the board, and the uneven width of the stator winding as optimization factors, the motor parameters with the lowest temperature rise of the motor winding are obtained. Simulation analysis is conducted using Ansys/Maxwell software, and the results prove the feasibility of optimization.

The most recent National Research Council Nutrient Requirements for Sheep and Goats was published in 2007, one of the most consequential nutrient requirement recommendations for sheep and goats in the world. It is pertinent to continue the refinement and discussion of nutrient utilization and requirements for the purposes of enhancing the efficiency of production systems, maximizing resource economy, and minimizing the carbon footprint, among others. Progress has been made in the estimation of energy and protein requirements in sheep and goats, mainly utilizing empirical feeding experimentation, comparative slaughter technique and minimum endogenous loss method. In sheep, newer estimates of energy and protein requirements for maintenance and growth and partial efficiencies had been reported since 2007. There were suggestions that energy and protein requirements could have been affected by breed, wool growth, gender and size; with these reported values being similar or lower than the recommended values in international feeding systems such as NRC, ARC, INRA and AFRC. In goats, energy and protein requirements for growing goats were reported to be either higher or lower than the established recommendations, depending upon meat or dairy breeds. Effect of gender on energy requirement appeared to be related to the stage of growth or degree of maturity. Newer data also suggested that the guidelines of the major feeding systems for the entire growth phase may not be adequate for non-pregnant and non-lactating pubertal females. In multiparous pregnant goats, energy and protein requirements for maintenance did not appear to be affected by days of pregnancy, but efficiencies of metabolizable energy and metabolizable protein utilization for pregnancy were. There were suggestions that that metabolizable protein synthesis in the rumen can be predicted from energy intake using combined equations that encompass both sheep and goats, but more data on goats were called for to account for specific differences in nutrition. In addition to sulfur, there has been progress made on the estimation of maintenance and growth requirements of calcium, phosphorus, potassium and magnesium in goats, with suggestions on the consideration of gender and breed differences. Species, level of Intake, genotype, mature size, age, gender, body composition, use of tissue energy, activity, season, and acclimatization continue to be important considerations for the estimation of nutrient requirements in sheep and goats, with emerging factors such as climate change, heat stress, parasitism and secondary plant compounds. Model equations and partial efficiencies used by NRC to predict energy and protein requirements for maintenance, growth, lactation, and fiber have been highlighted and discussed for the purpose of a more focus discussion and refinement for the future. Potential and limitation of both traditional and emerging methodologies in determining the nutrient requirements in sheep and goats were discussed. To justify the research investment, emerging methodologies such as nutrigenomics will have to be linked more directly to the improvement of production efficiency via more precise prediction of nutrient requirement.

The newly emerged severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected millions of people and caused tremendous morbidity and mortality worldwide. Effective treatment for coronavirus disease 2019 (COVID-19) due to SARS-CoV-2 infection is lacking and different therapeutic strategies are under testing. Host humoral and cellular immunity to SARS-CoV-2 infection is a critical determinant for patients’ outcome. SARS-CoV-2 infection results in seroconversion and production of anti-SARS-CoV-2 antibodies. The antibodies may suppress viral replication through neutralization but also might also participate in COVID-19 pathogenesis through a process termed antibody-dependent enhancement. Rapid progress has been made in the research of antibody response and therapy in COVID-19 patients including characterization of the clinical features of antibody responses in different populations infected by SARS-CoV-2, treatment of COVID-19 patients with convalescent plasma and intravenous immunoglobin products, isolation and characterization of a large panel of monoclonal neutralizing antibodies, as well as preliminary clinical results from several COVID-19 vaccine candidates. In this review, we summarize the recent progress and discuss the implications of these findings in vaccine development.

Litsea cubeba, an important medicinal plant, is widely used as traditional Chinese medicine and spice. Using cytotoxicity-guided fractionation, nine new lignans (1-9) and eleven known analogues (10-19) were obtained from the EtOH extract of the twigs of L. cubeba. Their structures were assigned by extensive 1D and 2D NMR experiments, and the absolute configurations were resolved by specific rotation and a combination of experimental and theoretically calculated electronic circular dichroism (ECD) spectra. In the cytotoxicity assay, 7',9-epoxylignans with feruloyl or cinnamoyl group (7-9, 13 and 14) were selectively cytotoxic against NCI-H1650 cell line, while the dibenzylbutyrolactone lignans (17-19) exerted cytotoxicities against HCT-116 and A2780 cell lines. The results highlighted the structure-activity relationship importance of a feruloyl or a cinnamoyl moiety at C-9′ or/and C-7 ketone in 7',9-epoxylignans. Furthermore, compound 11 was moderate active toward protein tyrosine phosphatase 1B (PTP1B) with an IC50 value of 13.5 μM, and compounds 4-6, 11 and 12 displayed inhibitions against LPS-induced NO production in RAW264.7 macrophages, with IC50 values of 46.8, 50.1, 58.6, 47.5, and 66.5 μM, respectively.

Background and Objectives: The site types of Eucalyptus urophylla × Eucalyptus grandis clonal plantations in southern Yunnan were compared, aiming to provide basis for site selection and scientific plantations management. Materials and Methods: In this study, 80 standard plots were set up in the 6−9-year-old Eucalypts plantations in Pu'er City and Lincang City. Furthermore, the quantitative theory I model and canonical correlation analysis were used to analyze the relationship between dominant tree growth traits and site factors, and evaluate the growth potential of E. urophylla × E. grandis plantation. Results: The multiple correlation coefficient between 8 site factors (altitude, slope, slope level, soil thickness, slope direction, texture, soil bulk density, and litter thickness) and the quantitative growth of the dominant wood was 0.825 (P < 0.05). According to the correlation coefficient of the quantitative regression model, slope, altitude, and soil thickness were the main factors for the classification of E. urophylla × E. grandis plantations in southern Yunnan. In addition, E. urophylla × E. grandis plantations grew best downhill and mid uphill at relatively low altitude, where the soil layer was thick and composed of weathered red soil. Contrastingly, E. urophylla × E. grandis plantation growth was extremely poor in uphill sites at higher altitude, where the soil layer was thin and composed of semi-weathered purple soil. Furthermore, total N, and available B, Cu, and Zn content, as well as soil organic matter content in the soil had a great influence on the growth of E. urophylla × E. grandis. Conclusions: Nitrogen and phosphate fertilizer as well as trace elements such as B, Zn, and Cu can be properly applied in middle- and low-yield forests to promote the growth and development of E. urophylla × E. grandis plantations.

In this paper we report a new development on the numerical model for aluminum-steam combustion. This model is based on diffusion flame of continuum regime and the thermal equilibrium between the particle and the flow field, which can be used to calculate the aluminum particle combustion model for two phase calculation conditions. The model prediction is in good agreement with the experimental data. A new type of vortex combustor was proposed for the combustion of aluminum and steam, and the mathematical model of the two phase reacting flow with in this combustor was established. The turbulence effects are modeled using the Reynolds Stress Model (RSM) with Linear Pressure-Strain approach, and the Eddy-Dissipation model is used to simulate the gas phase combustion. Aluminum particles are injected into the vortex combustor and form a swirling flow around the chamber and their trajectories are traced using the Discrete Phase Model (DPM). The simulation results show that the vortex combustor can achieve high efficient combustion of aluminum and steam. The influencing factors, such as the eccentric distance of the inlet of aluminum particles, particle size and steam inlet diameter, etc., are studied. The work described in this paper represents an attempt to the design of a vortex combustor in order to increase aluminum combustion efficiency.

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

The research on the excavation mechanical properties of underpass tunnels has already had certain results, but fewer of them consider the effects of dynamic and static loads on the excavation mechanical properties of underground tunnels at the same time, especially the lack of research cases of double-line highway tunnels with angled underpasses of existing railway tunnels. In this paper, based on the tunnel project of the new double-line Shiqian Highway Tunnel passing under the Hurong Railway at an oblique angle, the mechanical parameters of the rock body in the cross-tunneling area under the influence of static and dynamic load coupling are obtained by using the disturbance quantification coefficients and the Hoek-Brown criterion based on the method of over-advanced geological prediction and the investigation of the surrounding rock on the palisade face, and the engineering-scale finite element model is constructed and the mechanical characteristics of the excavation in the tunnel of the double-lane highway tunnel passing under the existing railroad under the influence of the static and dynamic loads are analyzed. The results show that: the new tunnel rock movement law for the top of the arch sinking, bottom plate bulging, side wall to move outward, the height and width of the arch and bottom plate arch with the tunnel excavation and increase, the side wall rock displacement effect is smaller; left and right lines of the tunnel disturbed area of the rule of change is similar; the existing tunnel bottom plate displacement is more than the top plate and the left and right side walls by the excavation of the time step influence is larger. Typical profile displacement is mainly determined by the distance from the excavation surface; the new tunnel in the four types of calculation conditions of the rock disturbance angle is the same; the existing tunnel roof and side wall Von Mises stress extreme occurs in the tunnel structure, the bottom plate there are pressure relief and pressure-bearing areas; based on the displacement control criteria, the recommended upper and lower step blasting method.

Energy Measurement and Verification (M&V) aims to make inferences about the savings achieved in energy projects, given the data and other information at hand. Traditionally, a frequentist approach has been used to quantify these savings and their associated uncertainties. We demonstrate that the Bayesian paradigm is an intuitive, coherent, and powerful alternative framework within which M&V can be done. Its advantages and limitations are discussed, and two examples from the industry-standard International Performance Measurement and Verification Protocol (IPMVP) are solved using the framework. Bayesian analysis is shown to describe the problem more thoroughly and yield richer information and uncertainty quantification than the standard methods while not sacrificing model simplicity. We also show that Bayesian methods can be more robust to outliers. Bayesian alternatives to standard M&V methods are listed, and examples from literature are cited.

Ocean surface waves have been utilized as fundamental information in various fields of oceanic research. In this paper, we suggest a simulation and modelling technique for generating an ocean surface wave using an inverse Fast Fourier Transform (iFFT), and we subsequently verify the wave’s accuracy. The conventional method, linear superposition, requires recursive calculation because of the double summation and the time variable; to circumvent this issue, the new algorithm is presented. The Joint North Sea Wave Project (JONSWAP) spectrum is utilized for the ocean surface wave simulation example, and the parameters are the significant wave height (HS) and the zero-crossing wave period (TZ). A coordinate transform for the wavenumber domain was used to apply the inverse FFT algorithm. To verify the accuracy of the simulation result, the relative error between the input condition and the analysis result was calculated. The result for TZ is below 4% relative error, and the maximum relative error for HS is 7%. To avoid the Nyquist frequency for wave-field analysis and simulation, the minimum grid size was calculated by twice applying the maximum wavenumber.

The broad emission bump in the electromagnetic spectra observed following the detection of gravitational waves created during the kilonova event of merger of two neutron stars in August 2017, GW170817, has been linked to the heavy elements of lanthanides (Z=57-71), and a new understanding of creation of heavy elements in the r-process. The initial spectral emission bump has a wavelength range of 3000 - 7000 \AA, thus covering the region of ultraviolet (UV) to optical (O) wavelengths, and is similar to those seen for lanthanides. Most lanthanides have large number of closely lying energy levels which introduce extensive sets of radiative transitions which often form broad region of lines of significant strength. The current study explores these broad features through photoabsorption spectroscopy of 25 lanthanides ions, Ho I-III, Er I-IV, Tm I-V, Yb I-VI and Lu I-VII. With excitations only to a few orbitals up beyond the ground configurations, we find most of these ions cover large number of bound levels with open $4f$ orbital and produce tens to about hundred thousands lines that may form one or multiple broad features in X-ray to UV, O, and infrared (IR) regions. Spectrum of each of 25 ions is presented indicating presence, shape and wavelength region of the features. Accuracy of atomic data to interpret the merger spectra has been a outstanding problem. The present study aims at providing improved atomic data for energies and transition parameters obtained using relativistic Breit-Pauli approximation implemented in the atomic structure code SUPERSTRUCTURE. The present data have been benchmarked with available experimental data for energies and transition parameters. The study finds that number of ions under the present study are possible contributors of the emission bump of GW170817. All atomic data will be made available online at NORAD-Atomic-Data database.

While considering the sensitivity over the parameter optimization, it is essential to determine which parameters have the most significant implications on model performance. This study focuses on the baseflow recession constant as one of the independent basin parameters to forecast low flows, perform hydrograph analysis, and calibrate rainfall-runoff models for significant improvement. Prior studies examined that the optimization of data adjustment parameters can improve the hydrological model performance and determine the minimum acceptable data length for data scarce regions using the Xinanjaing model. However, it is essential to pay special attention to the sensitivity of the recession constant, which can also impact the model performance during the data scarcity. Therefore, this study extends the research to comprehend the recession constant sensitivity over data adjustment parameters in the shorter datasets leading to more reliable parameter estimation. In terms of that, this study explores how recession constant affects hydrological parameter estimation on annual scale while keeping data adjustment parameters constant in continuous hydrological modeling, employing the Xinanjiang (XAJ) model as a case study. This study considered two approaches of recession constant (cg); (i) assessing the relationship between cg and the data adjustment parameter (Cep), for the 28-year datasets, (ii) investigating the significant impacts of the sensitivity of cg over Cep in shorter datasets which can affect the estimation of the acceptable minimum data length in the data scarce basins. The study underscores the importance of the recession constant sensitivity for reliable continuous hydrological model predictions, especially in data-scared areas. The study’s outcomes enhance the understanding of the importance of parameter sensitivity and its relationship in conceptual hydrological modeling during the data limitations.

The hospital indoor environment plays a significant role in shaping the microbial exposures that humans encounter. Resistance to antibiotics is one of the mechanisms employed by bacteria to develop resilience against stress in indoor environments. The extensive usage of antibiotics has been a key factor in driving changes in the ecological function of antibiotic resistance genes (ARGs) and their acquisition by pathogenic bacteria. By integrating the 16S rRNA Illumina sequencing and high throughput-qPCR approaches with water and air dust samples across seven departments at Peking University Shenzhen Hospital, China, this study yielded intriguing findings regarding the department-specific variation, transmission, and correlation of bacteria, ARGs and MGEs within the hospital indoor environment. One notable observation was that the seasonal variation played a vital role in shaping the bacterial composition in the overall hospital indoor environment across seven studied departments. Nevertheless, a similar significant seasonal impact was only observed in the blood test room and emergency departments, rather than in the other five departments. Another intriguing finding was the correlation between ARGs and MGEs abundance. This correlation was evident in the overall hospital indoor environment, which was conversely not found in the emergency, pneumology and gynecology departments. Additionally, while there was no significant relationship that occurred between bacterial communities and ARGs/MGEs within the hospital, the gynecology department demonstrated a close link between bacterial communities and the presence of ARGs/MGEs. Notably, the gynecology department also stood out as an important source of bacteria and ARGs/MGEs for other departments. This study underscores the need for careful surveillance and monitoring of antibiotic resistance, particularly in Legionella spp. in man-made water systems. The findings also show the importance of monitoring and understanding the genetic elements such as Tp614 involved in gene transfer and recombination, as well as their impact on antimicrobial treatment efficacy.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

Global warming may increase the potential evapotranspiration (Etp), thereby affecting the amount of clean water resources available in a region. In this study, the systematic biases in temperature outputs of 24 global climate models (GCMs) under 3 emission scenarios are corrected by using 8 bias correction methods. The trend of Etp in Yangzi River Delta in the 21st century is projected by using 4 Etp calculation formulas. The uncertainty of the projections is estimated and decomposed by using multi-way analysis of variance. The influence of uncertainty on the projected change signal is quantified by using the signal-to-noise ratio. The results show that, relative to the reference period (1971~2000), the annual mean daily Etp in Yangzi River Delta will increase by 0.14~0.17mm/d during the period 2021~2050 and by 0.21~0.41mm/d during the period 2061~2090, respectively. During 2021~2050, the uncertainty of Etp increase projections is dominantly contributed by the main effects of GCM (63%) and Etp calculation formula (24%). During 2061~2090, it is mainly contributed by the main effect of GCM (36%), followed by the main effects of emission scenario (34%) and Etp calculation formula (18%). The increase projections of Etp are generally reliable and robust during the two projection periods.

Mass hauling operations play central roles in construction projects. They typically use many haulers that consume large amounts of energy and emit significant quantities of CO₂. However, practical methods for estimating the energy consumption and CO₂ emissions of such operations during project planning are lacking. This paper presents a detailed model for estimating the energy consumption and CO₂ emissions of mass haulers that integrates the mass hauling plan with a set of predictive equations. The mass hauling plan is generated using a planning program such as DynaRoad in conjunction with data on the productivity of selected haulers and the amount of material to be hauled during cutting, filling, borrowing, and disposal operations. This plan is then used as input for estimating the energy consumption and CO₂ emissions of the selected hauling fleet. The proposed model will help planners to assess the energy and environmental performance of mass hauling plans, and to select hauler and fleet configurations that will minimize these quantities. The model was applied in a case study, demonstrating that it can reliably predict energy consumption, CO₂ emissions, and hauler productivity as functions of the hauling distance for individual haulers and entire hauling fleets.

The electroencephalogram (EEG) is a record of brain activity. Brain Computer Interface (BCI) technology formed by the EEG signal has become one of the hotspots at present. How to extract the feature signal of EEG is the most basic research of BCI technology. In this paper, A new method of recognizing fatigue, conscious, concentrated state of human brain is proposed by the combination of discrete wavelet transform and the neural network based on EEG signal. First of all, the law signal is preprocessed by the wavelet denoising method because the law EEG signal contains a large number of high frequency noise, which is decomposed into multi-layer high frequency signal and low frequency signal. thus, δ wave, θ wave, α wave, β wave are obtained by the wavelet transform. And then, frequency band energy of the different wave is regards as the feature signal of EEG. In the experiment, the feature signal is classified by radial basic function (RBF) and annealed chaotic competitive learning network (ACCLN). RBF and ACCLN networks are trained with 500 sets of sample data and are tested by 100 sets of samples in different mental states. The experimental results show that the average accuracy of RBF network under three conditions are 88.75%, 88.25%, 88.5%, respectively, and the correct rate of ACCLN network is 97%, 98%, 98%, respectively.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

Wound healing is a complex, dynamic process involving the coordinated interaction of diverse cell types, growth factors, cytokines, and extracellular matrix components. Despite emerging evidence highlighting their importance, dermal sheath cells remain a largely overlooked aspect of wound healing research. This review explores the multifunctional roles of dermal sheath cells in various phases of wound healing, including modulating inflammation, aiding in proliferation, and contributing to extracellular matrix remodeling. Special attention is devoted to the paracrine effects of dermal sheath cells and their role in fibrosis, highlighting their potential in improving healing outcomes, especially in differentiating between hairy and non-hairy skin sites. By drawing connections between dermal sheath cells activity and wound healing outcomes, this work proposes new insights into the mechanisms of tissue regeneration and repair, marking a step forward in our understanding of wound healing processes.

Microcystis aeruginosa is a common cyanobacteria found in water blooms and often causes ecological harm. Antibiotics are also increasingly used for the prevention and treatment of bacterial infections in aquaculture. However, since most antibiotics cannot be fully metabolized, they enter the water environment and cause ecological impacts. In this paper, the effects of the two quinolone antibiotics (enrofloxacin and ciprofloxacin) on the population density and microcystins (MCs) production of Microcystis aeruginosa were studied. It is of great significance for the ecological risk assessment of antibiotics to the water environment. The results showed that the 96h EC50 values of enrofloxacin and ciprofloxacin to Microcystis aeruginosa were 56.10mg/L and 49.80mg/L respectively, and the toxicity of ciprofloxacin to Microcystis aeruginosa was slightly stronger than that of enrofloxacin. With the increase of the two quinolone antibiotic concentration, the growth inhibition rate (IR) increased, but when the concentration reached a certain height, the IR would reach its threshold. Long-term exposure to low concentrations of these two quinolone antibiotics is not only more likely to lead to the outbreak of Microcystis aeruginosa, but also increase its toxin production capacity. The highest contents of MCs in enrofloxacin and ciprofloxacin groups were 95.539 μg/g and 93.720 μg/g, respectively. The MCs value of these three enrofloxacin treatment groups was more than above 51.8 times that of control group (CK) on the 4th day; from 8th day to 14th day, the MCs value of these three enrofloxacin treatment groups was more than above 3.2 times that of CK group. For another ciprofloxacin, the MCs value of the treatment group was more than 64.98 times that of the CK group on the 4th day, and from 8th day to 14th day, the MCs value of the treatment group was more than 2.7 times that of the CK group. These findings provide crucial management rationale.

Stabilization of a G-quadruplex (G4) in the promotor of the c-MYC proto-oncogene leads to inhibition of gene expression, and it thus represents a potentially attractive new strategy for cancer treatment. However, most G4 stabilizers show little selectivity among the many G4s present in the cellular complement of DNA and RNA. Intriguingly, a crescent-shaped cell-penetrating thiazole peptide, TH3, preferentially stabilizes the c-MYC G4 over other promotor G4s, but the mechanisms leading to this selective binding remain obscure. To investigate these mechanisms at the atomic level, we performed an in silico comparative investigation of the binding of TH3 and its analogue TH1 to the G4s from the promotors of c-MYC, c-KIT1, c-KIT2, and BCL2. Molecular docking and molecular dynamics simulations, combined with in-depth analyses of non-covalent interactions and bulk and per-nucleotide binding free energies, revealed that both TH3 and TH1 can induce the formation of a sandwich-like framework through stacking with both the top and bottom G-tetrads of the c-MYC G4 and the adjacent terminal capping nucleotides. This framework produces enhanced binding affinities for the c-MYC G4 relative to other promotor G4s, with TH3 exhibiting an outstanding binding priority. Van der Waals interactions were identified to be the key factor in complex formation in all cases. Collectively, our findings fully agree with available experimental data. Therefore, the identified mechanisms leading to specific binding of TH3 towards the c-MYC G4 provide valuable information to guide the development of new selective G4 stabilizers.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

In February 2004, the Food and Drug Administration (FDA) was the first to approve the combination of cisplatin (CDDP) and pemetrexed (PEM) as standard first-line chemotherapy for untreated, unresectable malignant pleural mesothelioma (MPM). However, after that approval, no progress was made in the standard first-line treatment of MPM for almost 15 years. Positive results from a phase 3 study (Mesothelioma Avastin Cisplatin Pemetrexed Study: MAPS) verifying the effect of bevacizumab, an anti-angiogenesis agent added to CDDP/PEM for unresectable MPM, were published in The Lancet in December 2015; however, this did not lead to approval by national drug regulatory agencies. Furthermore, no second-line treatment was established for cases refractory to CDDP/PEM. In August 2018, the Pharmaceuticals and Medical Devices Agency of Japan was the first in the world to approve monotherapy with nivolumab, an immune checkpoint inhibitor (ICI), for previously unresectable, advanced, or recurrent MPM. Following Japan, in October 2020, the FDA approved the combination of nivolumab and ipilimumab for the treatment of previously untreated, unresectable MPM. In this article, we review the transition of drug treatment for MPM, in light of the historical background, focusing on the benefits of ICIs.

We study the Gaudin models with gl(1|1) symmetry that are twisted by a diagonal matrix and defined on tensor products of polynomial evaluation gl(1|1)[t]-modules, extending all the results of to the twisted case. Namely, we give an explicit description of the algebra of Hamiltonians (Gaudin Hamiltonians) acting on tensor products of polynomial evaluation gl(1|1)[t]-modules and show that there exists a bijection between common eigenvectors (up to proportionality) of the algebra of Hamiltonians and monic divisors of an explicit polynomial written in terms of the highest weights and evaluation parameters. In particular, our result implies that each common eigenspace of the algebra of Hamiltonians has dimension one. We also give dimensions of the generalized eigenspaces.

ABSTRACT Background Ubiquitination plays an important role in protein post-translational processes and has been found to be involved in a number of regulatory functions including proteasome degradation, DNA repair, transcription, signal transduction, endocytosis, and sorting. As the identification of ubiquitination site is critical to furthering our understanding of the mechanism of ubiquitination, various experimental and machine learning methods have been used to conduct this task. It has been an important but challenging task to improve the accuracy of ubiquitination site prediction. In this research, we explore the possibility of improving the prediction performance of machine learning by incorporating grid search in the training process. Method We developed grid search procedures for each of six widely used machine learning methods including NB, LR, DT, SVM, LASSO, and KNN, and applied them to ubiquitination site prediction using the six PCP datasets that were previously developed. For each of the ML methods, we developed a set of values for each of the tunable hyperparameters available to the method. These sets of values then can be combined to form a large grid of hyperparameter settings, and each of these settings is used in the grid search. We integrated 5-fold cross-validation in grid search to train and test ML models and applied an additional independent validation procedure by conducting a pre-training 80-20 sample split. We evaluated the performance of the six methods by comparing them side by side for each of the six datasets. We also compared the grid search results with the results that were previously published without doing grid search. To optimize the prediction performance, we trained 1.1 million ML models in total through grid search. Results We compared the overall prediction performance of these six methods, as well as their prediction performance when working with balanced vs. imbalanced data, and large-scale vs. small-scale data. From the perspective of dataset, we find that the overall performance of every PCP dataset has been significantly improved in this study compared to the previous study, with the percentage increase of the average AUC of all six datasets ranging from 7.9% (PCP-4) up to 17.0% (PCP-1). From the perspective of method, we find that three out of four methods significantly benefit from grid search comparing to their previously published non-grid search results, with the maximum AUC improvement as high as 47% (LASSO on PCP-5), 43.3% (NB on PCP-1), and 33.7% (SVM on PCP-6). SVM overall ranks number one, followed by KNN as the number two performer based on their average AUCs on all datasets. But these two also ranked the top two (KNN 76 days and SVM 15 days) in terms of the total running time that they need to do grid search. We also find that SVM, KNN, and DT tend to handle small-scale and imbalanced datasets better, while LR, and LASSO are doing well with large-scale and balanced datasets. NB is more sensitive to data imbalance while less sensitive to the size of a dataset. Conclusions Our results show that using grid search has improved the performance of ubiquitination prediction significantly. We find that the performance of a method is closely related to its hyperparameter setting and the type of data it handles. Even though SVM is on average an outperformer, none of the methods can provide the best performance for all datasets. When sufficient computing resources are well accessible, grid search is an effective way to identify both a top performing model for a machine learning method and a suitable machine learning method for a particular dataset.

Permanent magnet brushless DC motor (BLDCM) is usually controlled by six step commutation method, and flux-weakening method is used to make the motor run higher above the base speed. For now, it is considered that the weak magneto-electric angle range is 0-pi/3, and that of deep weakening is pi/3-pi/2. In the field- weakening control, the forward shift of commutation point will form inverter circulating current in the three-phase bridge of inverter and the stator winding of the motor. In this paper, the principle of inverter circulating current formed by inverter is analyzed. Through magnetic potential analysis and Simulink simulation, it is concluded that flux-weakening control will generate inverter circulating current in the inverter and motor stator winding. The inverter circulating current affects the magnetic potential of motor, and magnetic potential will move to the rotating direction of motor rotor. When the forward shift angle of inverter commutation point is 0-pi/6 electrical angle, the movement amplitude of current circulating current of inverter is less than pi/6, which plays the role of weakening magnetic field and driving effect; when the forward moving angle is pi/6-pi/3, the movement amplitude of inverter circulating current exceeds pi/6, which plays the role of magnetic weakening and braking. When the braking effect occurs, the reverse torque will appear, resulting in the decrease of motor torque and efficiency. Therefore, the range of weak magneto-electric angle should be between 0-pi/6.

The Oryzaephilus surinamensis L. (Coleoptera: Silvanidae), is widely distributed all over the world, this beetle causes serious damage to stored products. Much attention has been paid to use food attraction or food volatile as a non-pollution method to achieve pest management. However, in this study, six most attractive food to O. surinamensis were selected among thirty eight food. Furthermore, the food mixture M17 with the best attractiveness were selected among the eighteen food mixtures combined by these six foods at different ratio. Subsequently food mixture M17 were tested in actual barn and compared with commercial attractant. We collected the volatile from food mixture, the volatile compounds attractive to this beetle also. We identified six electrophysio-logically active compounds responsible for the attraction of O. surinamensis, among the six chemically identified compounds, nonanal, dodecane, tridecaneand β-caryophyllene significantly attracted O. surinamensis when tested individually in behavioral assays. Blend of six chemicals according to food volatile concentration was most attractive to the beetles. The findings of this study reveal that food mixture M17 and food volatile can be potentially used for development of effective attractants for management of O. surinamensis.

Real estate industry is related to the national economy and people's livelihood，characterized by a high degree of financial intensity. The enterprises in this industry need certain financial ability and large shareholder controlling ability to support their survival. However，due to the multiple adverse impacts of current state policies，banks and private capital，the credit crunch，the sudden decrease in withdrawn funds and the limitation of internal financing，the problem of capital restraint of real estate enterprises has become more and more serious. From the perspective of corporate governance，this paper studies the interaction among financial constraints，ownership concentration and corporate performance under different shareholding states by analyzing the quantitative characteristics of equity structure，and looks for the appropriate range of the largest shareholder holding ratio，which has considered the financial performance and risk. It is found that raising the ownership concentration can effectively ease the financing constraints and improve the performance of enterprises，both of which are significant under the state of high ownership concentration， while the financial constraints play a significant intermediary effect under the State of absolute holding， while in the decentralized state of ownership，there is a significant regulatory effect，and the interaction of the three will be different due to the size of the enterprise.

The microglia, displaying diverse phenotypes, play a significant regulatory role in the development, progression, and prognosis of Parkinson's disease. Research has established that glycolytic reprogramming serves as a critical regulator of inflammation initiation in pro-inflammatory macrophages. Furthermore, the modulation of glycolytic reprogramming has the potential to reverse the polarized state of these macrophages. Previous studies have shown that levetistilide A (LA), a phthalide component derived from Angelica sinensis, possesses a range of pharmacological effects, including anti-inflammatory, antioxidant, and neuroprotective properties. In our study, we have examined the impact of LA on inflammatory cytokines and glucose metabolism in microglia induced by lipopolysaccharide (LPS). Furthermore, we explored the effects of LA on the AMPK/mTOR pathway and assessed its neuroprotective potential both in vitro and in vivo. The findings revealed that LA notably diminished the expression of M1 pro-inflammatory factors induced by LPS in microglia, while leaving M2 anti-inflammatory factor expression unaltered. Additionally, it reduced ROS production and suppressed IκB-α phosphorylation levels as well as NF-κB p65 nuclear translocation. Notably, LA exhibited the ability to reverse microglial glucose metabolism reprogramming and modulate the phosphorylation levels of AMPK/mTOR. In vivo experiments further corroborated these findings, demonstrating that LA mitigated the death of TH-positive dopaminergic neurons and reduced microglia activation in the ventral SNpc brain region of the midbrain and the striatum. In summary, LA exhibited neuroprotective benefits by modulating the polarization state of microglia and altering glucose metabolism, highlighting its therapeutic potential.